CA2433225A1 - Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof - Google Patents

Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof Download PDF

Info

Publication number
CA2433225A1
CA2433225A1 CA002433225A CA2433225A CA2433225A1 CA 2433225 A1 CA2433225 A1 CA 2433225A1 CA 002433225 A CA002433225 A CA 002433225A CA 2433225 A CA2433225 A CA 2433225A CA 2433225 A1 CA2433225 A1 CA 2433225A1
Authority
CA
Canada
Prior art keywords
antibody
binding fragment
antigen
complex
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002433225A
Other languages
French (fr)
Inventor
Janette Lazarovits
Yocheved Hagay
Daniel Plaksin
Tikva Vogel
Abraham Nimrod
Hagit Mar-Haim
Ester Szanthon
Tamar Richter
Boaz Amit
Lena Cooperman
Tuvia Peretz
Avigdor Levanon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Savient Pharmaceuticals Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2433225A1 publication Critical patent/CA2433225A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3061Blood cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Diabetes (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Vascular Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides epitopes present on cancer cells and importan t in physiological phenomena such as cell rolling, metastasis, and inflammatio n. Therapeutic and diagnostic methods and compositions using antibodies capable of binding to the epitopes are provided. Methods and compositions according to the present invention can be used in diagnosis of and therapy for such diseases as cancer, including tumor growth and metastasis, leukemia, auto- immune disease, and inflammatory disease.

Description

ISOLATED MOLECULES COMPRISING EPITOPES CONTAINING
SULFATED MOIETIES, ANTIBODIES TO SUCH EPITOPES, AND USES
THEREOF
FIELD OF THE INVENTION
[1.] The present invention relates to epitopes that are present on cells, such as cancer cells, metastatic cells, leukemia cells, and platelets, and that are important in such diverse physiological phenomena as cell rolling, metastasis, inflammation, auto-immune diseases, such as idiopathic thrombocytopenia purpura (ITP), adhesion, thrombosis and/
or restenosis, and aggregation. The present invention relates to therapeutic and diagnostic methods and compositions using antibodies directed against such epitopes. The present invention also relates to the field of tissue targeting and identification, with the aid of phage display technology, of peptides and polypeptides that specifically bind to target cells. Such peptides and polypeptides are antibodies and antigen binding fragments thereof, constructs thereof, fragments of either or constructs of a fragment.
More particularly, the peptides and polypeptides may have anti-cancer activity, anti-metastatic activity, anti-leukemia activity, anti-viral activity, anti-infection activity, and/or activity against other diseases, such as inflammatory diseases, diseases involving abnormal or pathogenic adhesion, thrombosis and/ or restenosis, diseases involving abnormal or pathogenic aggregation, and autoimmune diseases, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by sulfated tyrosine-dependent protein-protein interactions, and diseased cells generally.

BACKGROUND OF THE INVENTION
Antibodies, Phase Display, and Tissue Tar~etin~
[2.] Tissue-selective targeting of therapeutic agents is an emerging discipline in the pharmaceutical industry. New cancer treatments based on targeting have been designed to increase the specificity and potency of the treatment, while reducing toxicity, thereby enhancing overall efficacy. Mouse monoclonal antibodies (MAb's) to tumor-associated antigens have been employed - in an attempt to target toxin, radionucleotide, and chemotherapeutic conjugates to tumors. In addition, differentiation antigens, such as CD19, CD20, CD22 and CD25, have been exploited as cancer specific targets in treating hematopoietic malignancies. Although extensively studied, this approach has several limitations. One limitation is the difficulty of isolating appropriate monoclonal antibodies that display selective binding. A second limitation is the need for high antibody immunogenicity as a prerequisite for successful antibody isolation. A third limitation is that the final product comprises non-human sequences, which gives rise to an immune response to the non-human material (e.g., human anti-mouse antibody-HAMA
response).
The HAMA response often results in a shorter serum half life and prevents repetitive treatments, thus diminishing the therapeutic value of the antibody. This latter limitation has stimulated interest both in engineering chimeric or humanized monoclonal antibodies of murine origin, and in discovering human antibodies. Another limitation of this approach is that it enables the isolation of only a single antibody species directed against only known and purified antigens. Moreover, this method is not selective insofar as it allows for the isolation of antibodies against cell surface markers that are present on normal, as well as on malignant, cells.
[3.] There are many factors that influence the therapeutic efficacy of MAb's for treating cancer. These factors include specificity of antigen expression on tumor cells, level of expression, antigenic heterogeneity and accessibility of the tumor mass.
Leukemia and lymphoma have been generally more responsive to treatment with antibodies than solid tumors, such as carcinomas. MAb's rapidly bind to leukemia and lymphoma cells in the bloodstream and easily penetrate to malignant cells in lymphatic tissue, thus making lymphoid tumors excellent candidates for MAb-based therapy. An ideal system entails identifying a MAb that recognizes a marker on the cell surface of stem cells that are producing malignant progeny cells.
[4.] Phage libraries are used to select random single chain Fv's (scFv's) that bind to isolated, pre-determined target proteins such as antibodies, hormones and receptors. In addition, the use of antibody display libraries in general, and phage scFv libraries in particular, facilitates an alternative means of discovering unique molecules for targeting specific, yet unrecognized and undetermined, cell surface moieties.
[5.] Leukemia, lymphoma, and myeloma are cancers that originate in the bone marrow and lymphatic tissues and are involved in uncontrolled growth of cells.
Acute lymphoblastic leukemia (ALL) is a heterogeneous disease that is defined by specific clinical - and immunological characteristics. Like other forms of ALL, the definitive cause of most cases of B-cell ALL (B-ALL) is not known although, in many cases, the disease results from acquired genetic alterations in the DNA of a single cell, causing it to become abnormal and multiply continuously. Prognosis for patients afflicted with B-ALL is significantly worse than for patients with other leulcemias, both in children and in adults.
[6.] Acute Myelogenous Leulcemia (AML) is a heterogeneous group of neoplasms with a progenitor cell that, under normal conditions, gives rise to terminally differentiated cells of the myeloid series (erythrocytes, granulocytes, monocytes, and platelets). As in other forms of neoplasia, AML is associated with acquired genetic alterations that result in replacement of normally differentiated myeloid cells with relatively undifferentiated blasts, exhibiting one or more type of early myeloid differentiation. AML generally evolves in the bone marrow and, to a lesser degree, in the secondary hematopoietic organs. AML primarily affects adults, peaking in incidence between the ages of 15-40 years, but it is also known to affect both children and older adults. Nearly all patients with AML require treatment immediately after diagnosis to achieve clinical remission, in which there is no evidence of abnormal levels of circulating undifferentiated blast cells.

[7.] To date, a variety of monoclonal antibodies has been developed that induce cytolytic activity against tumor cells. A humanized version of the monoclonal ' antibody MuMAb4D5, directed to the extracellular domain of P 185 - growth factor receptor (HER2) - was approved by the FDA and is being used to treat human breast cancer (US Patent Nos. 5,821,337 and 5,720,954). Following binding, the antibody is capable of inhibiting tumor cell growth that is dependent on the HER2 growth factor receptor. In addition, a chimeric antibody against CD20, which causes rapid depletion of peripheral B cells, including those associated with lymphoma, was recently approved by the FDA (US Patent No. 5,843,439). The binding of this antibody to target cells results in complement-dependent lysis. This product has recently been approved and is currently being used in the clinic to treat low-grade B-cell non-Hodgkin's lymphoma.
[8.] Several other humanized and chimeric antibodies are under development or are in clinical trials. In addition, a humanized Ig that specifically reacts with CD33 antigen, expressed both on normal myeloid cells as well as on most types of myeloid leukemic cells, was conjugated to the anti-cancer drug calicheamicin, CMA-676 (Sievers et al., Blood Supplement, 308, 504a (1997)). This conjugate, known as the drug Mylotarg~, has recently received FDA approval (Caron et al., Cancer Supplement, 73, 1049-1056 (1994)). In light of its cytolytic activity, an additional anti-CD33 antibody (HumMl95), currently in clinical trials, was conjugated to several cytotoxic agents, ,including the gelonin toxin (McGraw et al., Cancer Imnzunol. Imnzunother, 39, (1994)) and radioisotopes 1311 (Caron et al., Blood 83, 1760-1768 (1994)), ~°Y (Jurcic et al., Blood Supplement, 92, 613a (1998)) and 213Bi (Humm et al., Blood Supplement, 38:231P (1997)).
[9.] A chimeric antibody against the leukocyte antigen CD45 (cHuLym3) is in clinical studies for treatment of human leukemia and lymphoma (Sun et al., Cancer Imnzunol. Imnzunother., 48, 595-602 (2000)). In in vitro assays, specific cell lysis was observed in ADCC (antibody dependent cell-mediated cytotoxicity) assays (Henkart, Immunity, 1, 343-346 (1994); Squier and Cohen, Current Opin. Inzmunol., 6, 447-(1994)).

[10.] In contrast to mouse monoclonal humanization and construction of chimeric antibodies, the use of phage display technology enables the isolation of scFv's comprising fully human sequences. A fully human antibody against the human TGFb2 receptor based on a scFv clone derived from phage display technology was recently developed. This scFv, converted into a fully human IgG4 that is capable of competing with the binding of TGFb2 (Thompson et al., J. Inamuf~ol Metlaods, 227, 17-29 (1999)), has strong anti-proliferative activity. This technology, known to one skilled in the art, is more specifically described in the following publications: Smith, Science, 228, 1315 (1985); Scott et al, Scieface, 249, 386-390 (1990); Cwirla et al., PNAS, 87, (1990); Devlin et al., Science; 249, 404-406 (1990); Griffiths et al., EMBO,L, 13(14), 3245-3260 (1994); Bass et al., Proteins, 8, 309-314 (1990); McCafferty et al., Nature, 348, 552-554(1990); Nissim et al., EMBO J., 13, 692 -698 (1994); U.S. Patent Nos 5,427,908, 5,432,018, 5,223,409 and 5,403,484, lib.
Ligand for Isolated scFv Antibody Molecules [1 l.] Platelets, fibrinogen, GPIb, selectins, and PSGL-1 each play an important role in several pathogenic conditions or disease states, such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis, and abnormal or pathogenic aggregation. Thus, antibodies that crossreact with platelets and with these molecules would be useful in the diagnosis and treatment of diseases and disorders involving these and other pathogenic conditions.
Platelets [12.] Platelets are well-characterized components of the blood system and play several important roles in hemostasis, thrombosis and/ or restenosis, and restenosis.
Damage to blood vessel sets in motion a process known as hemostasis, which is characterized by series of sequential events. The initial reaction to damaged blood vessels is the adhesion of platelets to the affected region on the inner surface of the vessel. The next step is the aggregation of many layers of platelets onto the previously adhered platelets, forming the hemostatic plug. This clump of platelets seals the vessel wall. The hemostatic plug is strengthened by the deposition of fibrin polymers. The clot is degraded only when the damage has been repaired.
Imuortance of Platelets in Metastasis [13.] Tumor metastasis is perhaps the most important factor limiting the survival of cancer patients. Accumulated data indicate that the ability of tumor cells to interact with host platelets represents one of the indispensable determinants of metastasis. Leslie Oleksowicz, Z.M., "Characterization Of Tumor-Induced Platelet Aggregation: The Role Of Immunorelated GPIb And GPIIb/IIIa Expression By MCF-7 Breast Cancer Cells,"
Thrombosis Research 79: 261-274 (1995).
[14.] It has been demonstrated that the ability of tumor cells to aggregate platelets correlates with the tumor cells' metastasis potential, and inhibition of tumor-induced platelet aggregation has been shown to correlate with the suppression of metastasis in rodent models. It has been demonstrated that tumor cell interaction with platelets involves membrane adhesion molecules and agonist secretion.
Expression of immunorelated platelet glycoproteins has been identified on tumor cell lines.
It was demonstrated that platelet immunorelated glycoproteins, GPTb, GPIIb/IIIa.
GPIb/IX and the integrin a,, subunit are expressed on the surface of breast tumor cell lines.
Oleksowicz, Z.M., "Characterization Of Tumor-Induced Platelet Aggregation: The Role Of Immunorelated GPIb And GPIIb/IIIa Expression By MCF-7 Breast Cancer Cells,"
Thrombosis Research 79: 261-274 (1995); Kamiyama, M., et al., "Inhibition of platelet GPIIb/IIIa binding to fibrinogen by serum factors: studies of circulating immune complexes and platelet antibodies in patients with hemophilia, immune thrombocytopenic purpura, human immunodeficiency virus-related immune thrombocytopenic purpura, and systemic lupus erythematosus," J Lab Clin Med 117(3): 209-17 (1991).
[15.] Gasic (J.T.B. Gasic et al., Proc. Natl. Acad. Sci. USA 61:46-52 (1968)) and coworkers showed that antibody- induced thrombocitopenia markedly reduced the number and volume of metastases produced by CT26 colon adenocarcinoma, Lewis lung carcinoma, and B16 melanoma. Karpatkin, S., et al., "Role of adhesive proteins in platelet tumor interaction in vitro and metastasis formation in vivo," J.
Clin. Invest. 81 (4):

1012-9 (1988); Clezardin, P., et al., "Role of platelet membrane glycoproteins Ib/IX and IIb/IIIa, and of platelet alpha-granule proteins in platelet aggregation induced by human osteosarcoma cells," Cancer Res. 53(19): 4695-700 (1993). Furthermore, a single polypeptide chain (60kd) was found to be expressed on surface membrane of HEL
cells which is closely related to GPIb and corresponds to an incompletely or abnormally O-glycosylated GPIba subunit. Kieffer, N., et al., "Expression of platelet glycoprotein Ib alpha in HEL cells," J. Biol. Chem. 261(34): 15854-62 (1986).
GPIb Complex [16.] Each step in the process of hemostasis requires the presence of receptors on the.platelet surface. One receptor that is important in hemostasis is the glycoprotein Ib-IX complex (also known as CD42). This receptor mediates adhesion (initial attachment) of platelets to the blood vessel wall at sites of injury by binding von Willebrand factor (vWF) in the subendothelium. It also has crucial roles in two other platelet functions important in hemostasis: (a) aggregation of platelets induced by high shear in regions of arterial stenosis and (b) platelet activation induced by low concentrations of thrombin.
[17.] The GPIb-IX complex is one of the major components of the outer surface of the platelet plasma membrane. The GPIb-IX complex comprises three membrane-spanning polypeptides- a disulfide-linked 130 kDa a-chain and 25 kDa (3-chain of GPIb and noncovalently associated GPIX (22 kDa). All four units are presented in equimolar amounts on the platelet membrane, for efficient cell-surface expression and function of CD42 complex, indicating that proper assembly of the three subunits into a complex is required for full expression on the plasma membrane. The a-chain of GPIb consists of three distinct structural domains: (1) a globular N-terminal peptide domain containing leucine-rich repeat sequences and Cys-bonded flanking sequences; (2) a highly glycosylated mucin-like macroglycopeptide domain; and (3) a membrane-associated C-terminal region that contains the disulfide bridge to GPIb (3 and transmembrane and cytoplasmic sequences.

[18.] Several lines of evidence indicate that the vWF and thrombin-binding domain of the GPIb-IX complex reside in a globular region that encompasses approximately 300 amino acids at the amino terminus of GPIba. The human platelets GPIb-IX complex is a key membrane receptor mediating both platelet function and reactivity. Recognition of subendothelial-bound vWF by GPIb allows platelets to adhere to damaged blood vessels. Further, binding of vWF to GPIba also induces platelet activation, which may involve the interaction of a cytoplasmic domain of the GPIb-IX
with cytoskeleton or phospolipase A2. Moreover, GPIba contains a high-affinity binding site for a-thrombin, which, by an as-yet poorly defined mechanism, facilitates platelet activation.
[19.] The N-terminal globular domain of GPIba contains a cluster of negatively charged amino. Several lines of evidence indicate that, in transfected CHO
cells expressing GPIb-IX complex and in platelet GPIbcx, the three tyrosine residues contained in this domain (Tyr-276, Tyr-278, and Tyr-279) undergo sulfation.
Protein Sulfation [20.] Protein sulfation is a widespread posttranslational modification that involves enzymatic covalent attachment of sulfate, either to sugar side chains or to the polypeptide backbone. This modification occurs in the trans-Golgi compartment and, therefore affects only protein that traverses this compartment. Such proteins include secretory proteins, proteins targeted for granules, and the extracellular regions of plasma membrane proteins. Tyrosine is an amino acid residue presently known to undergo sulfation. J.W. Kehoe et al., Chemistry and Biol 7: R57-R61 (2000). Other amino acids, for example threonine, may perhaps also undergo sulfation, particularly in diseased cells.
[21.] A number of proteins have been found to be tyrosine-sulfated, but the presence of three or more sulfated tyrosines in a single polypeptide, as was found on GPIb, is not common. GPIba (CD42), which is expressed by platelets and megakaryocytes mediates platelet attachment to and rolling on subendothelium via binding with vWF, also contains numerous negative charges at its N-terminal domain.
Such a highly acidic and hydrophilic environment is thought to be a prerequisite for sulfation because tyrosylprotein sulfotransferase specifically recognizes and sulfates tyrosines adjacent to acidic amino residues. J.R. Bundgaard et al., JBC
272:21700-21705 (1997). Full sulfation of the acidic region of GPIba yields a region with remarkable density of negative charge -- 13 negative charges within a 19 amino acid stretch, making it a candidate site for electrostatic interaction with other proteins.
Selectins and PSGL-1 [22.] The P-, E-, and L- Selectins are a family of adhesion molecules that, among other functions, mediate rolling of leukocytes on vascular endothelium.
P-Selectin is stored in granules in platelets and is transported to the surface after activation by thrombin, histamine, phorbol ester, or other stimulatory molecules. P-Selectin is also expressed on activated endothelial cells. E-Selectin is expressed on endothelial cells, and L-Selectin is expressed on neutrophils, monocytes, T cells, and B cells.
[23.] P-Selectin Glycoprotein Ligand-1 (PSGL-1, also called CD162) is a mucin glycoprotein ligand for P-Selectin, E-Selectin, and L-Selectin. PSGL-1 is a disulfide-linked homodimer that has a PACE (Paired Basic Amino Acid Converting Enzymes) cleavage site. PSGL-1 also has three potential tyrosine sulfation sites followed by approximately 15 decamer repeats that are high in proline, serine, and threonine. The extracellular portion of PSGL-1 contains three N-linked glycosylation sites and has numerous sialylated, fucosylated O-linked oligosaccharide branches. K.L. Moore et al., JBC 118:445-456 (1992). Most of the N-glycan sites and many of the O-glycan sites axe occupied. The structures of the O-glycans of PSGL-1 from human HL-60 cells have been determined. A subset of these O-glycans are core-2, sialylated and fucosylated structures that are required for binding to selectins. Tyrosine sulfation of an amino-terminal region of PSGL-1 is also required for binding to P-Selectin and L-Selectin. Further, there is an N-terminal propeptide that is probably cleaved post-translationally.
[24.] PSGL-1 has 361 residues in HL60 cells, with a 267 residue extracellular region, a 25 residue trans-membrane region, and a 69 residue intracellular region. The sequence encoding PSGL-1 is in a single exon, so alternative splicing should not be possible. However, PSGL-1 in HL60 cells, and in most cell lines, has 15 consecutive repeats of a 10 residue consensus sequences present in the extracellular region, but there are 14 and 16 repeats of this sequence, as well, in polymorphonuclear leukocytes, monocytes, and several other cell lines, including most native leukocytes.
PSGL-1 forms a disulfide-bonded homodimer on the cell surface. V. Afshar-Kharghan et al., Blood 97:3306-3312 (2001).
[25.] PSGL-1 is expressed on neutrophils as a dimer, with apparent molecular weight of both 250 kDa and 160 kDa, whereas on HL60 the dimeric form is 220 kDa.
When analyzed under reducing conditions, each subunit is reduced by half.
Differences in molecular mass may be due to polymorphisms in the molecule caused by the presence of different numbers of decamer repeats. Leukocyte Typing VI. Edited by T.
Kishimoto et al. (1997).
[26.] PSGL-1 is expressed on most blood leukocytes, such as neutrophils, monocytes, leukocytes, subset of B cells, and all T cells and mediates rolling of neutrophils on P-Selectin. Leukocyte Typing VI. Edited by T. I~ishimoto et al.
(1997).
PSGL-1 may also mediate neutrophil-neutrophil interaction via binding with L-Selectin, thereby mediating inflammation. Snapp, et al., Blood 91(1): 154-64 (1998).
[27.] PSGL-1 mediates rolling of leukocytes on activated endothelium, on activated platelets, and on other leukocytes and inflammatory sites.
[28.] A commercially available monoclonal antibody to human PGSL-1, KPL1, was generated and shown to inhibit the interactions between PGSL-1 and P-selectin and between PGSL-1 and L-selectin. The KPLI epitope was mapped to the tyrosine sulfation consensus motif of PGSL-1 (YEYLDYD). I~PLl recognizes only this particular epitope and does not cross-react with sulfated epitopes present on other cells, such as B-CLL
cells, AML cells, metastatic cells, multiple myeloma cells, and the like.
[29.] Leukocyte rolling is important in inflammation, and interaction between P
Selectin (expressed by activated endothelium and on platelets, which may be immobilized at sites of injury) and PSGL-1 is instrumental for tethering and rolling of leukocytes on to vessel walls. Ramachandran et al., PNAS 98(18): 10166-71 (2001); Afshar-Kharghan, et al., Blood 97(10): 3306-7 (2001).
[30.] Cell rolling is also important in metastasis, and P- and E-Selectin on endothelial cells is believed to bind metastatic cells, thereby facilitating extravasation from the blood stream into the surrounding tissues.
[31.] Platelets are also involved in the process of metastasis; when metastatic cancer cells enter the blood stream, multicellular complexes composed of platelets and leukocytes coating the tumor cells are formed. These complexes, which may be referred to as microemboli, aid the tumor cells in evading the immune system. The coating of tumor cells by platelets requires expression of P-selectin by the platelets.
[32.] Treatment with heparin, an inhibitor of P- and L-Selectin inhibits tumor cell-platelet interaction. Pretreatment of tumor cells with O-sialoglycoprotease, which removes sialylated, fucosylated mucin ligands, also inhibited tumor cell-platelet complex formation. Ifa vivo experiments indicate that either of these treatments results in greater monocyte association with circulating tumor cells, suggesting that reducing platelet binding increases access by immune cells to circulating tumor cells. Varki and Varki, Bf°az. J. Biol. Res. 34(6): 711-7 (2001).
[33.] PSGL-1 and GPIb share structural similarity, having mucin-like, highly glycosylated ligand binding regions. Afshar-Kharghan, et al., Blood 97(10):

(2001 ).
[34.] PSGL-1 has been found on all leukocytes: neutrophils, monocytes, lymphocytes, activated peripheral T-cells, granulocytes, eosinophils, platelets and on some CD34 positive stem cells and certain subsets of B-cells. P-Selectin is selectively expressed on activated platelets and endothelial cells. Interaction between P-Selectin and PSGL-1 promotes rolling of leukocytes on vessel walls, and abnormal accumulation of leukocytes at vascular sites results in various pathological inflammations.
Stereo-specific contributions of individual tyrosine sulfates on PSGL-1 are important for the binding of P-Selectin to PSGL-1. Charge is also important for binding: reducing NaCl (from 150 to 50 mM) enhanced binding (Kd ~75nM). Tyrosine-sulfation on PSGL-1 enhances, but is not ultimately required for PSGL-1 adhesiofa on P-Selectin. PSGL-1 tyrosine sulfation supports slower rolling adhesiofa at all shear rates and supports polling ad7zesiora at much higher shear rates. (Rodgers SD, et al., Biophys J. 81: 2001-9 (2001)).
Fibrinogen [35.] There are two forms of normal human fibrinogen: fibrinogen y major and fibrinogen 'y prime minor variant, each of which is found in normal individuals. Normal fibrinogen, which is the more abundant form (comprising ~90% of the fibrinogen found in the body), is composed of two identical 55 kDa alpha (a) chains, two identical 95 kDa beta ((3) chains, and two identical 49.5 kDa gamma (y) chains. Normal variant fibrinogen, which is the less abundant form (comprising ~10% of the fibrinogen found in the body), is composed of two identical 55 kDa alpha (a) chains, two identical 95 kDa beta ((3) chains, one 49.5 kDa gamma (y) chain, and one 50.5 kDa gamma prime (~y') chain. The gamma and gamma prime chains are both coded for by the same gene, with alternative splicing occurnng at the 3' end. Normal gamma chain is composed of amino acids 1-411. Normal variant gamma prime chain is composed of 427 amino acids:
amino acids 1-407 are the same as those in the normal gamma chain, and amino acids are VRPEHPAETEYDSLYPEDDL. This region is normally occupied with thrombin molecules.
[36.] Fibrinogen is converted into fibrin by the action of thrombin in the presence of ionized calcium to produce coagulation of the blood. Fibrin is also a component of thrombi, and acute inflammatory exudates.
[37.] Platelets, and molecules (such as fibrinogen, GPIb, selectins, and PSGL-1) that play important roles in cell-cell interactions, cell-matrix interactions, platelet-platelet interactions, platelet-cell interactions, platelet-matrix interactions, cell rolling and adhesion, and hemostasis also play important roles in pathogenic conditions or disease states, such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis, and abnormal or pathogenic aggregation. Thus, antibodies that crossreact with platelets and with these molecules would be useful in the diagnosis and treatment of diseases and disorders involving these and other pathogenic conditions.
There is therefore a need to identify common epitopes in or among these molecules and to identify antibodies capable of crossreacting therewith.
[38.] Antibodies may be provided in many forms, such as fragments, complexes, and multimers. Examples of antibody fragments include single chain Fv (scFv) fragments and Fab fragments.
[39.] It has been established that scFv penetrate tissues and are cleared from the blood more rapidly than a full size antibody because they are smaller in size.
Adams, G.P., et al., Br. J. Cafzcer 77, 1405-1412 (1988); Hudson, P.J., Cuf°~.
Opin. I»zmurzol.
11(5), 548-557 (1999); Wu, A.M., et al., Tumor Targeting 4, 47 (1999). Thus, scFv are often employed in diagnostics involving radioactive labels such as tumor imaging to allow for a more rapid clearance of the radioactive label from the body. A
number of cancer targeting scFv multimers have recently undergone pre-clinical evaluation for in vivo stability and efficacy. Adams, G.P., et al., Br. J. Carzcer-77, 1405-1412 (1988); Wu, A.M., et al., Tumoy° Targeting 4, 47 (1999).
[40.] Single chain Fv (scFv) fragments are comprised of the variable domains of the heavy (VH) and light (VL) chains of an antibody tethered together by a polypeptide linker. The linker is long enough to allow the (VH) and the (VL) domains to fold into a functional Fv domain enabling the scFv to recognize and bind its target with the similar or increased affinity of the parent antibody.
[41.] Typically, scFv monomers are designed with the C-terminal end of the VH
domain tethered by a polypeptide linker to the N-terminal residue of the VL.
Optionally an inverse orientation is employed: the C-terminal end of the VL domain is tethered to the N-terminal residue of VH through a polypeptide linker. Power, B., et al., J.
Immzzn. Meth.
242, 193-204 (2000). The polypeptide linker is typically around fifteen amino acids in length. When the linker is reduced to about three to seven amino acids, the scFvs can not fold into a functional Fv domain and instead associate with a second scFv to form a diabody. Further reducing the length of the linker to less than three amino acids forces the scFv association into trimers or tetramers, depending on the linker length, composition and Fv domain orientations. B.E. Powers, P.J. Hudson, J. Immuh.
Meth. 242 (2000) 193-194.
[42.] Recently, it has been discovered that multivalent antibody fragments such as scFv dimers, trimers, and tetramers often provide higher affinity over the binding of the parent antibody to the target. This higher affinity offers potential advantages including improved pharmaco-kinetics for tumor targeting applications.
Additionally, in studying P-Selectin and its ligand PSGL-1, which are involved in tethering and rolling of leukocytes, scientists have concluded that cells expressing dimeric forms of established more stable rolling adhesions because of this higher binding affinity. These adhesions are more sheer resistant and exhibited less fluctuation in rolling velocities.
Ramachandran, et al., PNAS, vol. 98(18): 10166-71 (2001).
[43.] The greater binding affinity of these multivalent forms may be beneficial in diagnostics and therapeutic regimens. For example, a scFv may be employed as a blocking agent to bind a target receptor and thus block the binding of the "natural" ligand.
In such instances, it is desirable to have a higher affinity association between the scFv and the receptor to decrease chances for disassociation, which may allow an undesirable binding of the natural ligand to the target. In addition, this higher affinity may be useful when the target receptors are involved in adhesion and rolling or when the target receptors are on cells present in areas of high sheer flow, such as platelets.
[44.] It is an object of the present invention to provide isolated epitopes that are present on various molecules that are instrumental in processes such as cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation, and which are present on diseased cells, such as AML cells, B-CLL cells, multiple myeloma cells, and metastatic cells.
[45.] Another object of the invention is to provide methods of using such isolated epitopes to develop antibodies which recognize and crossreact with epitopes that are present on molecules that are instrumental in processes such as cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation, and which are also present on diseased cells, such as AML cells, B-CLL cells, multiple myeloma cells, and metastatic cells.
[46.] Other objectives of the invention include the use of such antibodies in the development and provision of medicaments for the inhibition of cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation, and for the treatment of diseases, such as AML, B-CLL, multiple myeloma, metastasis, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by sulfated tyrosine-dependent protein-protein interactions, or other diseases in which such cellular functions or actions play a significant role.
[47.] It is an object of this invention to utilize the epitopes and antibodies in methods for diagnosing various disease states of an individual, such as, for example, diseases, such as AML, B-CLL, multiple myeloma, and metastasis or other diseases in which such cellular functions or actions as cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation play a significant role.
[48.] It is also an object of the invention to provide multivalent forms of antibodies, fragments, and complexes. More specifically, it is an object of the invention to provide dimers, trimers and tetramers, sometimes referred to herein as diabodies, triabodies, and tetrabodies, respectively.
[49.] These and other objectives of the invention are provided herein.
SUMMARY OF THE INVENTION
[50.] The present invention provides epitopes that are found on ligands and receptors that play important roles in such diverse processes as inflammation, immune reactions, metastasis, adhesion, thrombosis, restenosis, and aggregation.
Epitopes according to the present invention are also found on leukemia and tumor cells, particularly on leukemias of myeloid origin. Thus, these epitopes are useful targets for the therapeutic mediation of these processes. Antibodies directed against such epitopes are useful as therapeutic agents against cancers (both as anti-tumor agents and as anti-metastatic agents), leukemias, autoimmune diseases, inflammatory diseases, cardiovascular diseases such as myocardial infarction, retinopathic diseases and other diseases mediated by abnormal platelet function, and diseases caused by sulfated tyrosine-dependent protein-protein interactions. The present invention provides such antibodies, compositions comprising the antibodies, and therapeutic and diagnostic methods using the antibodies.
[51.~ The present invention provides an isolated epitope comprising the formula (S)r [(W)Z - P - (Y)t - P]q Formula (I) Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated I' 1S (A)n,(A)"(X)u Or (X)u(A)n(A)m Or (A)"(X)u(A)m Or (A)n(A)rn(X)u Or (X)u(A)m(A)n Or (A)n,(X)u(A)n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine q islto6 z is 0, 1, or 2 r is0orl t is 1, 2 or 3 a isOto2 n isOto3 m isOto3 wherein if n = 0 then m >0; wherein if m = 0 then n >0; wherein if q is l, r is l, and if q is >1 at least one of Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
[52.] The present invention provides an isolated epitope comprising Formula I
wherein the sulfated moiety is a peptido or glyco or lipo conjugate, or a combination thereof.
[53.] The present invention also provides an isolated epitope comprising Formula I wherein W is Glycine, Y is a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate, y Carboxy Glutamate or Aspartate; and q is 1, 2, or 3. In certain of these embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is l .e [54.] The present invention also provides an isolated epitope comprising the formula An isolated epitope comprising the formula (S)r (S)r (S)r (~Z - P - (Y)r - P - (Y)c - P - (Y)c - P Formula II
Wherein:

W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P 1S ~A~m~Ay~u Or ~X~OAOA~m Or ~A~yXyA~m Or ~A~yA~mCXO Or ~X~yA~m~AO Or (A~m~X~u~A)n S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine z is 0, l, or 2 r is0orl t is l, 2 or 3 a isOto2 n is 0 to 3 m is 0 to 3 wherein if n =0 then m > 0; wherein if m = 0 then n > 0; wherein at least one Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
[55.] The present invention provides an isolated epitope comprising Formula II
wherein the sulfated moiety is a peptido or glyco or lipo conjugate, or a combination thereof.

[56.] The present invention also provides an isolated epitope comprising Formula II wherein: W is Glycine; Y is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate, y Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline Phenylalanine, Serine or Glycine. In certain of these embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
[57.] The present invention provides an isolated epitope comprising the formula (S~r ~S~r (S~r (CT)OX)u~)OD)mU')t ~X)OE')OD)mO')t~X)OE)OD)mO')t~D)m~E)OX)u Formula III
Wherein:
G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the above z is 0, 1, or 2 t isl,2or3 r is0orl a isOto2 n isOto3 m isOto3 wherein at least one Y is sulfated; wherein if n = 0 then m > 0; wherein if m = 0 then n >
0; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
[58.] The present invention provides an isolated epitope comprising Formula III
wherein r is 1.
[59.] In any of the above embodiments, Y may comprise a lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule.
[60.] The present invention also provides derivatives, homologs, mimetics, and variants of the above-described epitopes and provides epitopes as described above and having at least one post-translational modification in addition to sulfation.
[61.] The present invention provides compositions comprising one or more of the above-described isolated epitopes. Isolated polynucleotides encoding at least a portion of the above-described epitopes are also provided.
[62.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof capable of binding to or cross-reacting with at least one of the above-described epitopes.
[63.] Likewise, a process for producing an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with at least one of the above-described epitopes is provided. The process comprises the steps of (a) providing a phage display library; (b) providing one of the above-described epitopes; (c) panning the phage display library for a phage particle displaying an oligopeptide or polypeptide capable of binding to the isolated epitope; and (d) producing an antibody, binding fragment thereof, or complex comprising an antibody or binding fragment thereof, comprising the peptide or polypeptide capable of binding to the isolated epitope.

[64.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof having the binding capabilities of the scFv antibody fragment of SEQ
ID NO: 25 [Y1 scFv] and/ or SEQ ID NO: 203 [Y17 scFv].
[65.] Antibodies, antibody fragments, and antibody complexes having the binding capabilities of a peptide or polypeptide, wherein the peptide or polypeptide has a first hypervariable region comprising SEQ ID NO: 8 [Y1 CDR3] or SEQ ID NO: 20 [Y17 CDR3] are provided. In certain of these embodiments, the peptide or polypeptide has a second hypervariable region comprising SEQ ID NO: 115 and/ or a third hypervariable region comprising SEQ ID NO: 114.
[66.] Antibodies, antibody fragments, and antibody complexes that are capable of binding to a peptide or polypeptide epitope of approximately 3 to 126 amino acid residues in length and comprising at least one sulfated tyrosine residue and at least two acidic amino acids are provided. In certain of these embodiments, the epitope further comprises at least, one leucine, isoleucine, proline, phenylalanine, serine or glycine residue. In certain of these embodiments, one or more of the at least two acidic amino acid residues is replaced by a leucine, isoleucine, proline, Phenylalanine, Serine or Glycine residue. In certain other embodiments, the epitope comprises DYD or EYE. In certain embodiments, the epitope is DYD or EYE. In yet other embodiments, the epitope comprises DYE or EYD.
[67.] In certain embodiments, antibodies, antibody fragments, and antibody complexes provided according to the present invention are capable of binding to an epitope on a carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule. Preferably, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof according to the present invention are capable of binding to carbohydrate, peptide epitopes, glycolipid epitopes, glycoprotein epitopes, lipoprotein epitopes, and/ or lipopolysaccharide epitopes. In many embodiments, the carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule comprises at least one sulfated moiety.

[68.) The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen y prime, GPlba, heparin, lumican, complement compound 4 (CC4), inter-alpha-inhibitor, and prothrombin, albeit not necessarily simultaneously. Also, the antibodies, antibody fragments, or complexes of the present invention will bind to any analog of these proteins, as long as the receptor epitope is intact.
[69.] In certain preferred embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to at least two proteins selected from the group consisting of PSGL-1, fibrinogen 'y prime, GPlba, lumican, complement compound 4, interalpha inhibitor, prothrombin, and heparin and capable of binding to diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells, are provided. In certain embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to each of PSGL-l, fibrinogen ~ prime, GPlba, heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin are provided. In certain embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to each of PSGL-l, fibrinogen 'y prime, GPlba, and heparin are provided; and, in certain preferred embodiments, these antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are also capable of binding to diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells.
[70.] The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen y prime, heparin, GPlba, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin, and further is capable of binding to an epitope on a carbohydrate and/ or a lipid molecule. In certain of these embodiments, the epitope on the carbohydrate and/ or lipid molecule comprises at least one sulfated moiety.
[71.] The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with two or more epitopes, each epitope comprising one or more sulfated tyrosine residues within a cluster of acidic amino acids.
In certain of these embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with at least one cell type selected from the group consisting of B-CLL
cells, AML cells, multiple myeloma cells, and metastatic cells. In certain other of these embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with PSGL-1. Preferably, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with PSGL-1 bind to the epitope QATEYEYLDYDFLPETE wherein at least one tyrosine residue is sulfated.
[72.] In certain other of these embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with GPlb-cc. Preferably, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with GPlb-a bind to the epitope DEGDTDLYDYYPEEDTEGD wherein at least one tyrosine residue is sulfated, the epitope TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated, the epitope GDEGDTDLYDYYP wherein at least one tyrosine residue is sulfated, the epitope YDYYPEE wherein at least one tyrosine residue is sulfated, andlor the epitope TDLYDYYP wherein at least one tyrosine residue is sulfated.
[73.] In yet other of these embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with fibrinogen y prime. Preferably, antibodies, antigen-binding fragments hereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with fibrinogen y' bind to the epitope EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated.
[74.] In yet other of these embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising an antibody or binding fragment thereof that are capable of crossreacting with heparin are provided.
[75.] In yet other of the se embodiments, antibodies, antigen-binding fragments thereof, or complexes thereof comprising an antibody or binding fragment thereof that are capable of crossreacting with complement compound 4 (CC4) are provided.
Preferably, antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with CC4 bind to the epitope MEANEDYEDYEYDELPAK wherein at least one tyrosine residue is sulfated.
[76.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to fragments, analogs, variants, and mimetics of the above-mentioned proteins, so long as the epitope is essentially intact.
[77.] The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with at least one cell type selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells;
[78.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof, that are capable of inhibiting cell rolling; inhibiting inflammation;
inhibiting auto-immune disease; inhibiting thrombosis; inhibiting restenosis; inhibiting metastasis;
inhibiting growth and/ or replication of tumor cells; increasing mortality of tumor cells;

inhibiting growth and/ or replication of leukemia cells; increasing the mortality rate of leukemia cells; increasing the susceptibility of diseased cells to damage by anti-disease agents; increasing the susceptibility of tumor cells to damage by anti-cancer agents;
increasing the susceptibility of leukemia cells to damage by anti-leukemia agents;
inhibiting increase in number of tumor cells in a patient having a tumor;
decreasing the number of tumor cells in a patient having cancer; inhibiting increase in number of leukemia cells in a patient having leukemia; decreasing the number of leukemia cells in a patient having leukemia; inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, andl or cell-platelet complex formation; inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet adhesion; aggregation.
[79.] Pharmaceutical compositions comprising antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof according to the present invention in amounts effective to inhibit, treat, ameliorate the effects of, or prevent diseases and/ or conditions of interest are provided.
[80.] The present invention provides for the use of antibodies, antigen-binding fragments thereof, or complexes thereof according to the present invention in the manufacture of a medicament to inhibit, treat, ameliorate the effects of, or prevent diseases and/ or conditions of interest.
[81.] The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof according to the present invention for use as a medicament to inhibit, treat, ameliorate the effects of, or prevent diseases and! or conditions of interest.
[82.] The present invention provides methods of inhibiting, treating, ameliorating the effects of, or preventing diseases and/ or conditions of interest comprising administering to a patient in need thereof a pharmaceutical composition comprising an effective amount of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to the present invention.

[83.] Antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof according to the present invention may be complexed with or coupled to agents.
[84.] The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leulcemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents. .
[85.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with one or more toxins, radioisotopes, and pharmaceutical agents.
[86.] The present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with a vehicle or carrier that are capable of being coupled or complexed to more than one agent. Examples of such vehicles and carriers include dextran, lipophilic polymers, HPMA, and liposomes.
[87.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with a radioactive isotope or other imaging agent.
Diagnostic kit comprising an antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof, according to the present invention are also provided.
[88.] The present invention provides an isolated epitope comprising GPIba amino acid sequence Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated. In a preferred embodiment, the epitope further comprises GPIbaamino acids 283-285.

[89.] The present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to the epitope comprising GPIba amino acid sequence Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated, wherein the binding is enhanced when the epitope further comprises GPIbaamino acids 283-285.
[90.] An isolated GPlba N-terminal peptide having an apparent molecular weight of about 40 KDa, said peptide comprising an epitope having the sequence YDYYPEE, wherein at least one tyrosine residue in the epitope is sulfated and an isolated GPlba peptide consisting of amino acids 1 through 282, wherein at least one of amino acids 276, 278 and 279 is sulfated are also provided.
[91.] The present invention also provides polyclonal antibodies, antibody fragments or antibody complexes that cross-react with the variable light chain of human monoclonal antibody scFv Yl. In certain embodiments, the polyclonal antibodies, antibody fragments or antibody complexes cross-react with a NdeI-EcoRl restriction fragment of the variable light chain of human monoclonal antibody Y-1.
Diagnostic kits comprising such polyclonal antibodies are also provided.
DEFINITIONS:
[92.] Antibodies (Ab's), or immunoglobulins (IgG's), are protein molecules that bind to antigen. They are composed of units of four polypeptide chains (2 heavy and 2 light) linked together by disulfide bonds. Each of the chains has a constant and variable region. They can be divided into five classes, IgG, IgM. IgA, IgD, and IgE, based on their heavy chain component. The IgG class encompasses several sub-classes including, but not restricted to, IgGi, IgG2, IgG3, and IgG4. Immunoglobulins are produced in vivo by B lymphocytes and recognize a particular foreign antigenic determinant and facilitate clearing of that antigen.
[93.] Antibodies may be produced and used in many forms, including antibody complexes. As used herein, the term "antibody complex" or "antibody complexes"
is used to mean a complex of one or more antibodies with another antibody or with an antibody fragment or fragments, or a complex of two or more antibody fragments.
Examples of antibody fragments include Fv, F(ab')2, F(ab'), Fc, and Fd fragments.
[94.] As used herein in the specification and in the claims, an Fv is defined as a molecule that is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linlced, fused or covalently attached to, or associated with, the variable region of the light chain. The Fv can be a single chain Fv (scFv) or a disulfide stabilized Fv (dsFv). An scFv is comprised of the variable domains of each of the heavy and light chains of an antibody, linked by a flexible amino-acid polypeptide spacer, or linker. The linker may be branched or unbranched. Preferably, the linker is 0-15 amino acid residues, and most preferably the linker is (Gly4Ser)3.
[95.] The Fv molecule itself is comprised of a first chain and a second chain, each chain comprising a first, second and third hypervariable region. The hypervariable loops within the variable domains of the light and heavy chains are termed Complementary Determining Regions (CDR). There are CDRl, CDR2 and CDR3 regions in each of the heavy and light chains. These regions are believed to form the antigen binding site and can be specifically modified to yield enhanced binding activity.
The most variable of these regions in nature being the CDR3 region of the heavy chain.
The CDR3 region is understood to be the most exposed region of the Ig molecule and as shown and provided herein is the site primarily responsible for the selective and/or specific binding characteristics observed.
[96.] A fragment of an Fv molecule is defined as any molecule smaller than the original Fv that still retains the selective and/or specific binding characteristics of the original Fv. Examples of such fragments include but are limited to (1) a minibody, which comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which comprises a small fractional unit of antibody heavy chain variable region (PCT
Application No. PCT/IL99/00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a light chain variable region.

[97.] As used herein the term "Fab fragment" is a monovalent antigen-binding fragment of an immunoglobulin. A Fab fragment is composed of the light chain and part of the heavy chain.
[98.] A F(ab')2 fragment is a bivalent antigen binding fragment of an immunoglobulin obtained by pepsin digestion. It contains both light chains and part of both heavy chains.
[99.] A Fc fragment is a non-antigen-binding portion of an immunoglobulin. It contains the carboxy-terminal portion of heavy chains and the binding sites for the Fc receptor.
[100.] A Fd fragment is the variable region and first constant region of the heavy chain of an immunoglobulin.
[101.] Polyclonal antibodies are the product of an immune response and are formed by a number of different B-lymphocytes. Monoclonal antibodies are derived from a single cell.
[102.] A cassette, as applied to polypeptides and as defined in the present invention, refers to a given sequence of consecutive amino acids that serves as a frameworlc and is considered a single unit and is manipulated as such. Amino acids can be replaced, inserted into, removed, or attached at one or both ends.
Likewise, stretches of amino acids can be replaced, inserted into, removed or attached at one or both ends.
[103.] The term "epitope" is used herein to mean the antigenic determinant or antigen site that interacts with an antibody, antibody fragment, antibody complex or a complex comprising a binding fragment thereof or T-cell receptor. The term epitope is used interchangeably herein with the terms ligand, domain, and binding region.
[104.] Selectivity is herein defined as the ability of a targeting molecule to choose and bind one cell type or cell state from a mixture of cell types or cell states, all cell types or cell states of which may be specific for the targeting molecule.

[105.] The term "affinity" as used herein is a measure of the binding strength (association constant) between a receptor (e.g., one binding site on an antibody) and a ligand (e.g., antigenic determinant). The strength of the sum total of noncovalent interactions between a single antigen-binding site on an antibody and a single epitope is the affinity of the antibody for that epitope. Low affinity antibodies bind antigen weakly and tend to dissociate readily, whereas high-affinity antibodies bind antigen more tightly and remain bound longer. The term "avidity" differs from affinity because the former reflects the valence of the antigen-antibody interaction.
[106.] Specificity of antibody-antigen interaction: Although the antigen-antibody reaction is specific, in some cases antibody elicited by one antigen can cross-react with another unrelated antigen. Such cross-reactions occur if two different antigens share an homologous or similar epitope or an anchor region thereof or if antibodies specific for one epitope bind to an unrelated epitope possessing similar chemical properties.
[107.] A platelet is a disc-like cytoplasmic fragment of a megakaryocyte that is shed in the marrow sinus and subsequently are circulating in the peripheral blood stream.
Platelets have several physiological functions including a major role in clotting. A
platelet contains granules in the central part and peripherally, clear protoplasm, but no definite nucleus.
[108.] Agglutination as used herein means the process by which suspended bacteria, cells, discs, or other particles of similar size are caused to adhere and form into clumps. The process is similar to precipitation but the particles are larger and are in suspension rather than being in solution.
[109.] The term aggregation means a clumping of platelets induced in vitro, and thrombin and collagen, as part of a sequential mechanism leading to the formation of a thrombus or hemostatic plug.
[110.] Conservative amino acid substitution is defined as a change in the amino acid composition by way of changing one or two amino acids of a peptide, polypeptide or protein, or fragment thereof. The substitution is of amino acids with generally similar properties (e.g., acidic, basic, aromatic, size, positively or negatively charged, polar, non-polar) such that the substitutions do not substantially in a major way alter peptide, polypeptide or protein characteristics (e.g., charge, IEF, affinity, avidity, conformation, solubility) or activity. Typical substitutions that may be performed for such conservative amino acid substitution may be among the groups of amino acids as follows:
(i) glycine (G), alanine (A), valine (V), leucine (L) and isoleucine (I) (ii) aspartic acid (D) and glutamic acid (E) (iii) alanine (A), serine (S) and threonine (T) (iv) histidine (H), lysine (K) and arginine (R) (v) asparagine (N) and glutamine (Q) (vi) phenylalanine (F), tyrosine (Y) and tryptophan (W) [11 l.] Conservative amino acid substitutions can be made in, as well as, flanking the hypervariable regions primarily responsible for the selective and/or specific binding characteristics of the molecule, as well as other parts of the molecule, e.g., variable heavy chain cassette. Additionally or alternatively, modification can be accomplished by reconstructing the molecules to form full-size antibodies, diabodies (dimers), triabodies (timers) and/or tetrabodies (tetramers) or to form minibodies or microbodies.
[112.] A phagemid is defined as a phage particle that carries plasmid DNA.
Phagemids are plasmid vectors designed to contain an origin of replication from a filamentous phage, such as m13 of fd. Because it carries plasmid DNA, the phagemid particle does not have sufficient space to contain the full complement of the phage genome. The component that is missing from the phage genome is information essential for packaging the phage particle. In order to propagate the phage, therefore, it is necessary to culture the desired phage particles together with a helper phage strain that complements the missing packaging information.

[113.] A promoter is a region on DNA at which RNA polymerase binds and initiates transcription.
[114.] A phage display library (also termed phage peptide/antibody library, phage library, or peptide/antibody library) comprises a large population of phage (generally l Og 109), each phage particle displaying a different peptide or polypeptide sequence. These peptide or polypeptide fragments may constructed to be of variable length. The displayed peptide or polypeptide can be derived from, but need not be limited to, human antibody heavy or light chains.
[115.] A pharmaceutical composition refers to a formulation which comprises a peptide or polypeptide of the invention and a pharmaceutically acceptable carrier, excipient or diluent thereof.
[116.] A pharmaceutical agent refers to an agent that is useful in the prophylactic treatment or diagnosis of a mammal including, but not restricted to, a human, bovine, equine, porcine, murine, canine, feline, or any other warm-blooded animal. The pharmaceutical agent is selected from the group comprising radioisotope, toxin, oligonucleotide, recombinant protein, antibody fragment, and anti-cancer agent.
Examples of such pharmaceutical agents include, but are not limited to anti-viral agents including acyclovir, ganciclovir and zidovudine; anti-thrombosis/restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide, denileulcin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti-adhesion/anti-aggregation agents including limaprost, clorcromene, and hyaluronic acid.
[117.] An anti-leukemia agent is an agent with anti-leukemia activity. For example, anti-leukemia agents include agents that inhibit or halt the growth of leukemic or immature pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents that increase the susceptibility of leukemic or pre-leukemic cells to other anti-leukemia agents, and agents that inhibit metastasis of leukemic cells. In the present invention, an anti-leukemia agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
[118.] The expression pattern of a gene can be studied by analyzing the amount of gene product produced under various conditions, at specific times, in various tissues, etc. A gene is considered to be "over expressed" when the amount of gene product is higher than that found in a normal control, e.g., non-diseased control.
[119.] A given cell may express on its surface a protein having a binding site (or epitope) for a given antibody, but that binding site may be exist in a cryptic form (e.g., be sterically hindered or be blocked, or lack features needed for binding by the antibody) in the cell in a state, which may be called a first stage (stage I ). Stage I may be, for example, a normal, healthy, non-diseased status. When the epitope exists in cryptic form, it is not recognized by the given antibody, i.e., there is no binding of the antibody to this epitope or to the given cell at stage I. However, the epitope may be exposed by, e.g., undergoing modifications itself, or being unbloclced because nearby or associated molecules axe modified or because a region undergoes a conformational change.
Examples of modifications include changes in folding, changes in post-translational modifications, changes in phospholipidation, changes in sulfation, changes in glycosylation, and the like. Such modifications may occur when the cell enters a different state, which may be called a second stage (stage II). Examples of second states, or stages, include activation, proliferation, transformation, or in a malignant status.
Upon being modified, the epitope may then be exposed, and the antibody may bind.
[120.] Peptido-mimetics are small molecules, peptides, polypeptides, lipids, polysaccharides or conjugates thereof that have the same functional effect or activity of another entity such as an antibody.
BRIEF DESCRIPTION OF THE DRAWINGS
[121.] FIG. 1 shows cleavage sites of endoprotease on the a chain of GPIb.

[122.] FIG. 2 depicts a Western blot showing binding of Y1 and Y17 to platelets in reduced and non-reduced conditions.
[123.] FIG. 3 is an outline of the optimal determinants for binding of Y1 to its epitope:
[124.] FIG. 4 depicts a Western blot demonstrating that cleavage of platelet GPIb by O-Sialoglycoprotein endoprotease abolishes binding of both Yl and Y17.
[125.] FIG. 5 depicts a Western blot demonstrating that Yl and Y17 bind similar glycocalicin fragments after cleavage by O-Sialoglycoprotein endoprotease.
[126.] FIG. 6 depicts the results of FACS analysis demonstrating that specific GPIb proteolysis abolishes Y1 binding to platelets.
[127.] FIG. 7 depicts a Western blot demonstrating that Y1 binds the N-terminal (His 1- Glu 282) fragment of platelet GPIba after cleavage by mocarhagin.
[128.] FIG. 8 depicts a Western blot showing binding of Yl and Y17 to glycocalicin after cleavage by mocarhagin.
[129.] FIG. 9 depicts a Western blot showing the binding of Y1 and Y17 to platelets.
[130.] FIG. 10 depicts a Western blot demonstrating that Yl and Y17 bind glycocalicin similarly after cleavage by Ficin.
[131.] FIG. 11 depicts a Western blot demonstrating that Yl reacts with the larger fragment generated by cathepsin G cleavage of GPIbaa.
[132.] FIG. 12 depicts a Western blot demonstrating that Y1 and Y17 react with the larger fragment generated by cathepsin G cleavage of GPIbaa.
[133.] FIG. 13 depicts a Western blot demonstrating that cleavage of glycocalicin by mocarhagin and cathepsin G abolishes binding of Yl.

[134.] FIG. 14 depicts a Western blot showing the binding of Yl and Y17 to lysate of washed platelets cleaved by mocarhagin and cathepsin G.
[135.] FIG. 15 is a graph illustrating inhibition by Yl-scFv of agglutination of washed platelets.
[136.] FIG. 16 is a graph illustrating inhibition by Y1-scFv of aggregation of platelets in platelet-rich plasma.
[137.] FIG. 17 is a graph illustrating induction of agglutination of washed platelets by Y1-IgG.
[138.] FIG. 18 is a graph illustrating induction of platelet aggregation in platelet-rich-plasma by Yl-IgG.
[139.] FIG. 19 provides results of an ELISA assay.
[140.] FIG. 20 depicts a Western blot illustrating the specificity of binding of Yl and a-CD42 (N1-19) to their ligands.
[141.] FIG. 21 depicts a Western blot Yl reactivity with Yl-ligand on KG-1 cell membrane purified using immunoprecipitation and RP-HPLC.
[142.] FIG. 22 depicts a Western blot showing the effect of O-Sialoglycoprotein endopeptidase cleavage on Y1 binding.
[143.] FIG. 23 depicts a Western blot showing the effect after aryl-sulfatase cleavage on Y1 binding to RP-HPLC purified KG-1 cell lysates, and heparin-BSA.
[144.] FIG. 24 depicts the immunoprecipitation scheme used in the analysis of the specificity of Y1 binding, the results of which are depicted in FIG. Tab 2A, page 17B.
[145.] FIG. 25 depicts Western blots comparing binding of Yl and anti-CD-162 antibody to cells from AML patients and normal blood.

[146.] FIG. 26 depicts the results of a FACS analysis showing the ability of antibodies KPLl, PL1, and PL2 to compete with Yl for binding.
[147.] FIG. 27 depicts the results of a FAGS analysis demonstrating the specificity of Yl binding.
[148.] FIG. 28 also depicts the results of a FAGS analysis demonstrating the specificity of Y1 binding.
[149.] FIG. 29 is a graph illustrating % inhibition of Yl binding in the presence of various peptides.
[150.] FIG. 30 is a graph depicting liver weights in mice in different treatment groups. FIG. 31 is a graph depicting % MOLT cells in bone marrow in mice in different treatment groups.
[151.] FIG. 32 is a graph depicting % MOLT cells in blood in mice in different treatment groups.
[152.] FIG. 33 is a graph depicting liver weights (mean +/- SEM) of mice at day 35.
[153.] FIG. 34 is a graph depicting liver weights (mean +l- SEM) of mice at day 35.
[154.] FIG. 35 is a graph illustrating effect of treatment on,survival.
[155.] FIG. 36 is a graph depicting % occurrence of leukemia in different treatment groups.
[156.] FIG. 37 is a graph depicting % KG-1 cells in blood in different treatment groups.
[157.] FIG. 38 is a graph illustrating %KG-1 cells in bone marrow of experimental animals.

[158.] FIG. 39 is a graph illustrating the pharmakokinetics of TCA-precipitable radioactivity in plasma after intravenous injection of l2sl-CONY1 in mice. The sequence of CONY1 is given as SEQ ID NO: 204.
[159.] FIG. 40 is a graph illustrating the specific radioactivity of various organs/
tissues after intravenous injection of lasl-CONYl in mice.
[ 160.] FIG. 41 is a graph illustrating the distribution of radioactivity of various organs/ tissues after intravenous injection of lasl-CONY1 in mice.
[161.] FIG. 42 is a graph of the Superdex 75 profile of Y1-cys-kak.
[162.] FIG. 43 reveals the size of the dimers compared to the monomer in reducing and non-reducing conditions.
[163.] FIG. 44 depicts a FAGS analysis showing the level of binding of the IgG-Y1 molecule compared to that of scFv-Yl.
[164.] FIG. 45 depicts Western blots showing binding of Y1 and other antibodies to natural human platelet derived glycocalicin and to recombinant glycocalicin produced in E. coli.
[165.] FIG. 46 shows a binding comparison between a Yl dimer, the Yl scFv (CONY1), and Yl IgG.
[166.] FIG. 47 shows a binding comparison between a Y1 sulfide bridge dimer with the Y1 scFv (CONYl).
[167.] FIG. 48 provides the amino acid and nucleotide sequences of the heavy and light chains of Y1-IgG. The open reading frame (ORF) of the nucleotide sequence of Y1-HC (SEQ ID NO: 205), the amino acid sequence of Y1-HC (SEQ ID NO: 206), the ORF of the nucleotide sequence of Y1-LC (SEQ ID NO: 207), and the amino acid sequence of Yl-LC (SEQ ID NO: 208) are provided.
[168.] FIG. 49 provides the amino acid sequence of TM1 (SEQ ID NO: 209).

[169.] FIG. 50 provides the amino acid and nucleotide sequences of the Y16 scFv (SEQ ID NO: 210).
[170.] FIG. 51 provides the amino acid sequence of the Y1 Biotag (SEQ ID NO:
211).
[171.] FIG. 52 provides the amino acid sequence of the Yl-cys-kak SCFV (SEQ
ID NO:. 212).
DETAILED DESCRIPTION OF THE INVENTION
[172.] In the present invention, whole cells were used to select specific antibodies that recognize leukemia cell surface determinants, wherein the specific receptor was not previously known or characterized. Additionally, a mufti-step biopanning process was utilized, in which phage were selected by panning on more than one cell type.
This is a marked improvement over prior art methods in which the selection of antigen-specific phage antibodies has largely relied on biopanning against an immobilized single antigen, and there was only limited selection using whole cells as a target.
[173.] Certain epitopes that were identified by this multistep process are characterized by the presence of sulfated moieties, such as sulfated tyrosine residues or sulfated carbohydrate or lipid moieties, preferably within a cluster of two or more acidic amino acids, are found on ligands and receptors that play important roles in such diverse processes as inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, cell rolling, and aggregation. Such epitopes are also found on diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. These epitopes are useful targets for the therapeutic mediation of these processes and for diagnostic procedures.
[174.] Although, these epitopes have variable primary amino acid sequences, antibodies directed against such sulfated epitopes are often capable of binding to, or crossreacting with, more than one such epitope on more than one molecule, albeit not necessarily simultaneously. Such antibodies are useful as therapeutic agents against cancers (both as anti-tumor agents and as anti-metastatic agents), leukemias, autoimmune diseases, viral diseases, diseases involving abnormal aggregation, diseases involving abnormal adhesion, infarction, cardiovascular diseases and inflammatory diseases.
[175.] The human scFv Y1 antibody was isolated from a human antibody phage display library that was used to screen fixed human platelets in order to identify antibodies that bind platelets. Several clones (different scFv antibodies) were isolated and characterized. One of these clones, designated as Y1, unexpectedly was found to bind leukemia cells derived from AML patients and patients having certain other leukemias.
Another clone, Y17, was also isolated by panning on fixed platelets and was found to bind to human blood.
[176.] Proteins extracted from human platelets were Western blot analyzed on SDS-PAGE using the Yl scFv antibody and the Yl7 scFv antibody, in order to identify the receptors to which the antibodies bind on the surface of the platelets.
Using this methodology, it was determined that the Yl scFv and Y17 scFv epitope on platelets is glycocalicin, one of the subunits of the CD42 complex.
[177.] The human platelet derived glycocalicin extracellular fragment was purified from activated platelets. It was digested with various proteases, such as ficin, mocarhagin, cathepsin G, in order to localize precisely the Y1 binding epitope on the glycocalicin molecule. Analysis was performed by the Western blot methodology using the Y1 antibody as a detection tool. In addition, commercially available anti-glycocalicin antibodies (antibodies that are known to bind to different epitopes of glycocalicin) were used in a competition binding assay with the Y1 antibody to determine the Y1 binding epitope on glycocalicin.
[178.] Based on the results, it was concluded that amino acids 272 through 285 of glycocalicin play a major role in the binding of Yl to glycocalicin. In addition, since the E. coli derived recombinant N- terminal polypeptide of glycocalicin (amino acids 1 to 340 and 1 to 480) was not detectable by the Y1 antibody, it was concluded that Yl binding to its epitope depends on post-translational modifications, such as glycosylation or sulfation, which are modifications that are not known to occur in E. coli).

[179.] In order to verify this hypothesis, the purified glycocalicin was treated with enzymes (glycosidases) that remove N and O-linked sugar moieties from proteins and enzymes (sulfatases) that remove sulfate moieties from proteins. The binding of the Yl antibody to glycocalicin or glycocalicin derived fragments was not affected by the glycosidases. This result indicates that sulfated groups are essential for the binding of Y1 to glycocalicin.
[180.] In order to further verify these results, sulfated and non-sulfated synthetic peptides based on the identified epitope (amino acids 272 to 285 of glycocalicin) were prepared and used to assess the binding specificity of theYl antibody to glycocalicin in their presence (ELISA assay). Sulfated peptides inhibited the binding of the Y1 antibody to glycocalicin several folds higher than the related non-sulfated peptides indicating that sulfation is required for binding.
[181.] From the above experimental results, it was concluded that the epitope for Y1 antibody is located between amino acids 272 and 285 on glycocalicin in which there is cluster of negatively charged amino acids.
[182.] In parallel, the binding of the Y1 antibody to KG-1 cells (a human cell line derived from AML patient), to various human plasma derived proteins, and to primary leukemia patient blood samples was studied.
[183.] The Y1 antibody was found to bind with relatively low affinity to two human plasma derived proteins, one in the size of ~SOkD molecular weight, which was identified as fibrinogen y prime and a -~-80kD molecular weight protein, which was identified as complement compound 4 (CC4) and human lumican. These proteins contain sulfated tyrosine residues accompanied by a stretch of negatively charged amino acids.
[184.] The Yl ligand on KG-1 cells was identified as PSGL-1, which is a receptor for E, L- and P- selectins. PSGL-1 was identified as the ligand of the Yl antibody on KG-1 cells based on competition assays (wherein binding of the Y1 antibody to the KG-1 cells was carried out in the presence of different commercially available anti PSGL-1 antibodies) and upon a set of experiments using sulfated and non-sulfated synthetic peptides derived from the N-terminal site of PSGL-1. The N-terminal site of PSGL-1 contains sulfated tyrosine residues accompanied by a cluster of negatively charged amino acids.
[185.] Although the Y1 antibody binds to several molecules, such as the glycocalicin molecule on platelets, fibrinogen-gamma prime, the complement compound 4 of human plasma, and the PSGL-1 molecule on KG-1 cells, its affinity to primary leukemia cells derived from either AML or multiple myeloma (MM) patients is several magnitudes higher relative to the previously mentioned epitopes. Moreover, the fact that commercially available anti PSGL-1 antibody (KPL1) does not recognize all (7 out of 12) diseased primary leukemia cells in blood samples derived from patients, while the Y1 antibody recognizes them specifically and selectively, indicates that there are additional epitopes for Y1 antibody on primary leukemia cells that differ from that on KG-1 cells.
[186.] Examples of sulfated epitopes according to the present invention include those delineated in Formulae I, II, and III, as well as derivatives, homologs, mimetics, and variants thereof.
Formula (I):
(S)r [(W)Z - P - (~')c - P]q Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P 1S (A)m(A)n(X)u or (X)u(A)n(A)m Or (A)n(~)u(A)m Or (A)n(A)m(X)u Or (x)u(A)m(A)n Or (A)m(X)u(A)n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine q islto6 z is0, l,or2 r is0orl t isl,2or3 a isOto2 n isOto3 m isOto3 wherein if n = 0 then m >0; wherein if m = 0 then n >0; wherein if q is 1, r is 1, and if q is >1 at least one of Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
[187.] A preferred epitope is the epitope of Formula I wherein W is Glycine, Y
is a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine;
A is Glutamate, y Carboxy Glutamate or Aspartate; and q is 1, 2, or 3. In certain embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
Formula II:
\S)r ~s)r \S)r (W)Z - P - (Y)r - P - (Y)t - P - (Y)t - P Formula II

Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P is ~A~m~AyXy Or (X~OA-OA~m Or (A)n(X)u(A)m Or ~A~yA~m~Xy Or ~X~yA~m~AO Or ~A~m(XyA~n S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine z is 0, 1, or 2 r is0orl t is 1, 2 or 3 a is 0 to 2 n isOto3 m isOto3 wherein if n =0 then m > 0; wherein if m = 0 then n > 0; wherein at least one Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
[188.] A preferred epitope is the epitope of Formula II wherein: W is Glycine;
Y
is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate, y Carboxy Glutamate or Aspartate, Leucine, Isoleucine Phenylalanine, Serine or Glycine. In certain embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
Formula III:
~S)r ~S~r ~S~r .
(CT)z~X)OE)UD)m~Y)t ~X)OE)OD)m(Y)t(X)u(E)n(D)rn(Y)t(D)m(E)n(X)u Wherein:
G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the above z is 0, 1, or 2 t is l, 2 or 3 r is0orl a is 0 to 2 n is 0 to 3 m is 0 to 3 wherein at least one Y is sulfated; wherein if n = 0 then m > 0; wherein if m = 0 then n >
0; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
[189.] A preferred epitope is the epitope of Formula III wherein r is 1.
[ 190.] The sulfated moiety of any of the Formulae may be also a peptido- or glyco- or lipo- conjugate. Y may comprise a lipid and/ or carbohydrate molecule. The epitopes may have at least one post-translational modification in addition to sulfation.
[191.] Such epitopes are found on such diverse molecules as GPIb and PSGL-1 and are found on certain diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. Sulfation of tyrosine and/ or other moieties is particularly important for binding to these epitopes. Human proteins known to be tyrosine sulfated include the following:
Peptide Sequence Thrombomodulin (408-426) E C P E G Y I L D D G F I C T D I D E
HumanGPIbcc (269-287) DEGDTDLYDYYPEEDTEGD
Human Heparin Cofactor II (56-75) GEEDDDYLDLEEDDDYIDIVD
Human Fibrinogen ~' (408-427) V R P E H P A E T E Y D S L Y P E D O L
a-2-Antiplasmin P P M E E D Y P Q F G S P
Cholecystokinin (CCK) R I S D R D Y M G W M D F
a-2-Choriogonadotropin C H C S T C Y Y H K S - C O O H
Complement C4 MEANEDYEDYEYDELPAK

Factor VIII (716-731) GDYYEDSYEDISAYLL
Lumican GYYDYDFPL
Yl - Production and Selection [192.] One example of an antibody of the present invention that binds to epitopes of Formulae I-III is the fully human monoclonal antibody Y1. The selection, production, and initial characterization of Y1 are described in detail in U.S. Patent application Serial Nos. 09/751,181 and 60/258,948. Briefly, a phage display library displaying scFv antibody fragments was utilized to obtain and produce targeting molecules, and flow cytometry, particularly fluorescence-activated cell sorting (FACS), was used for identifying and isolating specific phage clones, the peptide or polypeptide of which recognizes target cells. The phage display library used herein was constructed from peripheral blood lymphocytes of a non-immunized human donor.
[193.] Phage clones were selected by and identified through a multi-step procedure known as biopanning. Biopanning was carned out by incubating phage displaying protein ligand variants (a phage display library) with a target, removing unbound phage by a washing technique, and specifically eluting the bound phage. The eluted phage were optionally amplified before being taken through additional cycles of binding and optional amplification which enriched the pool of specific sequences in favor of those phage clones bearing antibody fragments that display the best binding to the target. After several rounds, individual phage clones were characterized, and the sequences of the peptides displayed by the clones were determined by sequencing the corresponding DNA of the phage virion.
[194.] In the present invention, screening of platelets was carried out against non-defined epitopes for the initial biopanning steps, with subsequent clone selection performed with a desired target cell (e.g., B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells), the targeted cell surface markers of which are unknown.

[195.] Malignant and diseased blood cells (e.g., leukemia or lymphoma) are characterized as immature cells that express cell surface proteins normally found in partially differentiated hematopoietic progenitors. Thus, platelets are an attractive source for the identification of premature cell surface markers expressed on diseased or malignant blood cells.
[196.] Y1, an scFv clone which binds to platelets and myleogenous leukemia cells, particularly AML cells, was selected. Y1 scFv has the sequence SEQ ID
NO: 25.
The binding characteristics of Y1 are primarily attributable to its heavy chain CDR3 region, which has the sequence SEQ ID NO: 8. Full Y1-IgG antibodies were also produced.
[197.] A second scFv clone, Y17, which binds to platelets and cell lines derived from human myleogenous leukemia cells, particularly AML cells, was also selected. Y17 scFv has the sequence SEQ 1D NO: 203. The binding characteristics of Y17 are primarily attributable to its heavy chain CDR3 region, which has the sequence SEQ ID NO:
20.
Full Y17-IgG antibodies were also produced.
Antibody Production [198.] CDRs according to the present invention may also be inserted into cassettes to produces antibodies. A cassette, as applied to polypeptides and as defined in the present invention, refers to a given sequence of consecutive amino acids that serves as a framework and is considered a single unit and is manipulated as such. Amino acids can be replaced, inserted into, removed, or attached at one or both ends.
Likewise, stretches of amino acids can be replaced, inserted into, removed or attached at one or both ends.
[199.] The amino acid sequence of the cassette may ostensibly be fixed, whereas the replaced, inserted or attached sequence can be highly variable. The cassette can be comprised of several domains, each of which encompasses a function crucial to the final construct.

[200.] The hypervariable regions of antibodies of the invention form the antigen binding sites of antibodies of the present invention. The antigen-binding site is complementary to the structure of the epitopes to which the antibodies bind and therefore are referred to as complementarity-determining regions (CDRs). There are three CDRs on each light and heavy chain of an antibody, each located on the loops that connect the ~3 strands of the VH and VL domains..
[201.] The cassette of a particular embodiment of the present invention comprises, from the N-terminus, frameworlc region 1 (FRl), CDRl, framework region 2 (FR2), CDR2, and framework region 3 (FR3).
[202.] In an embodiment of the invention, it is possible to replace distinct regions within the cassette. For example, the CDR2 and CDRl hypervariable regions of the cassette may be replaced or modified by non-conservative or, preferably, conservative amino acid substitutions. More specifically, the CDR2 and CDR1 regions of a cassette of consecutive amino acids selected from the group comprising of SEQ ID NOs: 30-113 or a fragment thereof can be replaced by SEQ m NOs:115 and 114, respectively. Even more specifically, the CDR2 and CDRl regions of a cassette of consecutive amino acids selected from the group comprising of SEQ ID NOs: 30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112, and 113 or fragment thereof can be replaced by SEQ ID NOs:115 and 114, respectively.
[203.] 111 a preferred embodiment of the invention, the peptide or polypeptide comprises a heavy and a light chain, and each chain comprises a first, second and third hypervariable region which are the CDR3, CDR2 and CDR1 regions, respectively.
The binding selectivity and specificity are determined particularly by the CDR3 region of a chain, possibly by the CDR3 region of the light chain and, preferably, by the region of the heavy chain, and secondarily by the CDR2 and CDRl regions of the light chain and, preferably, of the heavy chain. The binding selectivity and specificity may also be secondarily influenced by the upstream or downstream regions flanking the first, second, and/or third hypervariable regions.

[204.] In a preferred embodiment, the CDR3 region of the peptide or polypeptide has an amino acid sequence selected from the group comprising SEQ ID NOs:B-24.
[205.] In a more preferred embodiment, the CDR3 region of the heavy chain has an amino acid sequence selected from the group comprising SEQ ID NOs:B-24, the CDR2 has an amino acid sequence identical to SEQ ID N0:115, and the CDRl region has an amino acid sequence identical to SEQ ID NO:l 14.
[206.] In a most preferred embodiment of the invention, the CDR3 region has an amino acid sequence identical to SEQ ID N0:8.
[207.] A preferred embodiment of the invention is a scFv with a CDR3 sequence identical to SEQ ID NO: 8 and a full scFv sequence identical to SEQ ID N0:25.
[208.] In a most preferred embodiment of the invention the CDR3, CDR2 and CDR1 regions have the amino acid SEQ ID NOs:B, 115 and 114, respectively.
[209.] In an embodiment of the invention, the Fv peptide comprises a CDRl and CDR2 region of the variable heavy chain which itself comprises a cassette with an amino acid sequence selected from the group comprising SEQ ID NOs:30-113; a CDR3 region, preferably of the variable heavy chain, which has an amino acid sequence selected from the group comprising SEQ ID N0:8-24; an upstream region flanking the CDR3 region which has the amino acid sequence of SEQ >D N0:117; a downstream region flanking the CDR3 region which has the amino acid sequence of SEQ ID N0:116; a spacer of 0-amino acid residues of SEQ 117 NO: 123 or 124; a variable light chain region the sequence of which is SEQ.ID N0:7.
[210.] Similarly, in another embodiment the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ID N0:119, the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ID N0:118, the upstream region flanking the CDRl region has the amino acid sequence of SEQ ID N0:121 and the downstream region flanlcing the CDRl region has the amino acid sequence of SEQ
ID
N0:120.

[211.] A preferred embodiment of the invention provides for a peptide or polypeptide wherein the second and third hypervariable regions are a CDR2 and a CDRl hypervariable region, respectively and wherein the CDR3 amino acid sequence is SEQ ID
N0:8, wherein the CDR2 amino acid sequence is SEQ m NO:115, wherein the CDR1 amino acid sequence is SEQ m NO:l 14, wherein the upstream region flanking the region has the amino acid sequence of SEQ m N0:117, wherein the downstream region flanking the CDR3 region has the amino acid sequence of SEQ m N0:116, wherein the upstream region flanking the CDR2 region has the amino acid sequence of SEQ m N0:119, wherein the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ID N0:118, wherein the upstream region flanking the CDRl region has the amino acid sequence of SEQ m N0:121 and wherein the downstream region flanking the CDRl region has the amino acid sequence of SEQ m N0:120.
[212.] Another preferred embodiment of the invention provides for an Fv molecule that comprises a first chain having a first, a second and a third hypervariable region and a second chain having a first, a second and a third hypervariable region, wherein one of the hypervariable regions of the first chain has a sequence selected from the group consisting of SEQ ID NOs:B-24, and wherein one of the hypervariable regions of the second chain has a sequence selected from the group consisting of SEQ m NOs: l-6 and 125-202, and wherein the first, second and third hypervariable regions are a CDR3, CDR2 and CDRl region, respectively and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
[213.] Another embodiment of the invention provides for a peptide or polypeptide (i) wherein the first chain and the second chain each comprises a first hypervariable region selected from the group consisting of SEQ m NOs:B-24; or (ii) wherein the first hypervariable region of the first and second chains are identical and selected from the group consisting of SEQ m NOs:B-24; or (iii) wherein the first hypervariable region of the first chain is selected from the group consisting of SEQ ID
NOs:B-24, and the first hypemariable region of the second chain is selected from the group consisting of SEQ ID NOs:l-6 and 125-202; or (iv) wherein the first hypervariable region of the first chain is selected from the group consisting of SEQ m NOs:l-6 and 125-202, and the first hypervariable region of the second chain is selected from the group consisting of SEQ ID NOs:B-24.
A further embodiment provides for the peptide or polypeptide of the invention wherein the second and third hypervariable regions of the first chain are SEQ ID NOs:l 14 and 115, respectively.
[214.] For all the amino acid sequences of _< 25 amino acid residues described and detailed herein (e.g., CDR regions, CDR flanking regions), it is to be understood and considered as a further embodiment of the invention that these amino acid sequences include within their scope one or two amino acid substitutions) and that preferably the substitutions are conservative amino acid substitutions. For all the amino acid sequences of > 25 amino acid residues described and detailed herein, it is to be understood and considered as an embodiment of the invention that these amino acid sequences include within their scope an amino acid sequence with >_ 90% sequence similarity to the original sequence (Altschul et ccl., Nucleic Acids Res., 25, 3389-3402 (1997)). Similar or homologous amino acids are defined as non-identical amino acids which display similar properties, e.g., acidic, basic, aromatic, size, positively or negatively charged, polar, non-polar.
[215.] Percentage amino acid similarity or homology or sequence similarity is determined by comparing the amino acid sequences of two different peptides or polypeptides. The two sequences are aligned, usually by use of one of a variety of computer programs designed for the purpose, and amino acid residues at each position are compared. Amino acid identity or homology is then determined. An algorithm is then applied to determine the percentage amino acid similarity. It is generally preferable to compare amino acid sequences, due to the greatly increased sensitivity to detection of subtle relationships between the peptide, polypeptide or protein molecules.
Protein comparison can take into account the presence of conservative amino acid substitutions, whereby a mismatch may yet yield a positive score if the non-identical amino acid has similar physical and/or chemical properties (Altschul et al., Nucleic Acids Res., 25, 3389-3402 (1997).

[216.] In an embodiment of the invention the three hypervariable regions of each of the light and heavy chains can be interchanged between the two chains and among the three hypervariable sites within and/or between chains.
Polyclonal Antibodies Against VL (derived from Yl [217.] The DNA fragment encoding the VL domain (variable light chain) of human antibody was PCR-cloned from the Yl clone (the identical DNA fragment can be obtained from any other clone in the Nissim I library (Nissim et al., "Antibody fragments from a 'single pot' phage display library as irmnunochemical reagents," ENTBO
J. 13(3):
692-698 (1994)) or even from the human genome using the same methodology) with the following synthetic oligonucleotide primers: oligo 5'-Nde1 , (TTTCATATGGAGCTGACTCAGGACCCTGCT) and oligo 3'-EcoRI
(TTTGAATTCCTATTTTGCTTTTGCGGC). After amplification by polymerase chain reaction (PCR conditions: 94° 1', 56° 2', 72° 2' x30 then 65° 5') the obtained DNA
fragment was digested with NdeI and.EcoRI restriction enzymes and cloned into NdeI and EcoRI restriction enzymes sites of a pre-digested plasmid, which is an IPTG
inducible expression vector used for prokaryotic expression of recombinant proteins in E. coli. E.
coli cells were transformed with the ligation mixture and positive clones were selected by PCR amplification using the above oligonucleotide primers. Cells harboring this plasmid were grown and induced for expression by IPTG. Bacterial cells were harvested by centrifugation from 1 liter of culture post induction with IPTG, inclusion bodies were isolated and solubilized in guanidine-HCl + DTE, and refolded by dilution in a buffer containing TRIS-ARGIN1NE-EDTA. After refolding at 5-10 ° for 48 hrs, the solution containing protein was dialyzed and concentrated to 20mM Glycine pH 9. The dialyzed solution containing proteins was re-purified by using an ionic exchange column, HiTrapQ, and eluted with a gradient of NaCI. The main peak was analyzed by SDS-PAGE and by gel filtration. At least 10 mgs of purified VL were obtained from an original 1 liter culture.
[218.] Rabbits were immunized with VL (400mg) in the presence of CFA
(complete Fruend's adjuvant) then by VL (200mg) in the presence of IFA
(incomplete Fruend's adjuvant) at 2 to 4 weeks intervals. The titers obtained were low (1:50-1:100) probably due to the high homology between the VL's from human and rabbit.
Polvclonal Antibodies against sc~ Antibodies [219.] Two individual scFv antibody clones (Y1 and N14 ) derived from the Nissim I antibody phage display library (Nissim et al., "Antibody fragments from a 'single pot' phage display library as immunochemical reagents," EMBO J. 13(3):

(1994))were cultured separately. After IPTG induction the cultures were grown at 22° C
for 16 hours. The scFv antibody fragments were harvested from the bacterial cell periplasm and were purified on a Protein A-Sepharose column. All the procedures for bacterial clone culturing, induction protocol, scFv antibody fragment harvesting and antibody fragment purification were carried out in accordance with: Harnson J.L., Williams S.C., Winter G, and Nissim A. Met7zods E~zymol. 267 : 83-109 (1996).
Basically, any two or more individual scFv clones can be selected from the Nissim I
antibody phage display library in order to prepare rabbit derived polyclonal antibodies that recognize any individual scFv antibody that is present in the Nissim library or any IgG or fragment thereof provided that it contains the same VL or a fragment thereof.
[220.] Rabbits were immunized with 400 mg of 1:1 ratio mixture of the purified scFv antibody fragments in the presence of complete Fruend's adjuvant then with 200 mg of that mixture in the presence of incomplete Fruend's adjuvant, at 2 to 4 weeks intervals.
[221.] For detection of the scFv antibodies binding to cells by flow cytometry (FACS) or to various protein fractions on SDS-PAGE ( Western blot analysis), the polyclonal anti scFv antibodies were used directly from the serum of the immunized rabbits or after purification on a Protein A-Sepharose column.
Characterization of Yl Binding Site~on Platelets [222.] Circulating platelets are cytoplasmic particles released from the periphery of megakaryocytes. Platelets play an important role in hemostasis. Upon vascular injury, platelets adhere to damaged tissue surfaces and attach one another (cohesion).
This sequence of events occurs rapidly, forming a structureless mass (commonly called a platelet plug or thrombus) at the site of vascular injury. The cohesion phenomenon, also known as aggregation, may be initiated i~ vitro by a variety of substances, or agonists, such as: collagen, adenosine-diphosphate (ADP), epinephrine, serotonin, and ristocetin.
Aggregation is one of the numerous ira vitro tests performed as a measure of platelet function.
[223.] Several lines of evidence in the prior art indicate that the cluster of negatively charged amino acids between Asp269 and Asp287 of GPIba is important for von Willebrand Factor (vWF) binding to platelets, which in turn mediates platelet adhesion to damaged blood vessels, platelet aggregation induced by high shear in regions of arterial stenosis, and platelet activation induced by low concentrations of thrombin.
Ward, C.M., et al., Biochemistry 35(15): 4929-39 (1996). The interaction of vWF with GPIb is dependent upon an activation event or coyformationah change in vWF
structure when bound to matrix or exposed to shear. This process is mimicked i~c vitf°o by specific modulators that bind to vWF, such as ristocetin and botrocetin.
Reactivity of Yl to Platelet Cell Extract [224.] Immunobhotting and endoprotease cleavage techniques were used to identify the epitope for Y1 on the surface membrane of platelets. Endoprotease cleavage sites on the GPIba molecule are shown in FIG. 1.
Western Blot Analysis [225.] Y1 scFv was selected from phage antibody library by biopanning on human platelets and was found to bind to fixed and washed human platelets.
Characterization of Y1 was done by using ELISA assay and by FAGS analysis.
[226.] In order to characterize the epitope on the platelet membrane to which Yl binds, platelet surface proteins were separated by SDS-PAGE (under both reducing and non-reducing conditions) and immunobhotted with biotin labeled-Yl under reducing and non-reducing conditions. The results of this experiment demonstrate that Y1 reacts with a protein with a molecular mass of 135 kDa under reducing conditions, and with a protein with molecular mass of 160 h~Da under non-reducing conditions. These molecular masses correspond to platelet GPIba, which has a molecular mass of 135 kDa under reducing conditions. Under non-reducing conditions, the GPIba chain disulfide-linked to GPIb(3 has a molecular mass of 160-kDa. (FIG. 2).
[227.] The GPIba chain is disulfide-linked to the GPIb(3 chain to form the platelet membrane protein GPIb. Monoclonal antibodies, MCA466S (Serotec) and S.C.7071(Santa Cruz), are known to bind respectively to the C-terminal fragment of GPIba and to the N-terminal of GPIba and were found to react to the same fragments with which Y1 reacts under reducing and non-reducing conditions (the S.C. was used only under reducing conditions). These results further confirm that Y1 binds to the GPIba platelet surface protein.
[228.] Further analysis on semipurified GPIb fragment (glycocalicin) by Western analysis confirmed that indeed Y1 binds to the alpha subunit of the GPIb complex.
[229.] Western analysis of recombinant GPIb expressed in E. coli demonstrated that GPIb expressed in E. coli does not react with Y1. Thus, it appears that post-translational modification, wluch does not occur in E. coli is required for Y1 binding.
Neither N- nor O- glycanases affect the binding of Y1 to KG-1 cells. However, Yl binding can be inactivated by treatment of ligands with aryl sulfatases or by proteases.
(FIG. 3).
Localization of Yl Enitope Site on GPIba fragment of ~lycocalicin (GC) [230.] To further localize the Yl binding site, specific endoproteases with known cleavage sites were used to digest GPlb and the fragments were tested for Y1 binding.
Effect of O-Sialo~lvconrotein endonrotease on Yl binding to platelet GPIba [231.] The enzyme O-Sialoglycoprotein endoprotease from PasteuYella hae~raolytica (Cedarlan CLE 100) selectively cleaves human platelet GPIb and specifically cleaves only proteins containing sialylated, O-linked glycans. O-Sialoglycoprotein endoprotease does not cleave N-linked glycoproteins or unglycosylated proteins. This enzyme has been reported to cleave GPIb, which is heavily O-glycosylated, but not GPIIb-IIIa or other receptors on platelets. GPIba was digested with O-Sialoglycoprotein endoprotease in order to further establish the binding of Yl to the molecule.
[232.] Immunoblots (FIGS. 4 and 5) and FACS analysis (FIG. 6) demonstrated that incubation of washed platelets with O-Sialoglycoprotein endoprotease abolishes binding of Yl, as well as the binding of monoclonal antibody MCA466S
(Serotec), which is directed against GPIba. The endoprotease did not alter the binding of a monoclonal antibody (anti-CD61) directed against GPIIb/IIIa. (FIG. 4). These results provide additional evidence that the receptor for Y1 on platelet membranes is GPIba.
Mocarha~in Cleavage of GPIb -- Mapping of the Yl Epitope [233.] Mocarhagin [Sigma L4515a] is a cobra venom metalloproteinase that cleaves platelet GPIba specifically at a single site between residues glu-282 and asp-283, thereby generating two stable products: a ~45-kDa N-terminal fragment (Hisl-G1u282), which is released into the supernatant, and a membrane-bound ~95 kDa C-terminal fragment.
[234.] Washed platelets were treated by mocarhagin, and platelet lysates were electrophoresed on SDS-polyacrylamide gels and transferred to nitrocellulose.
Western blot analysis of lysates of mocarhagin-treated washed platelets with Yl shows a loss of the band corresponding to GPIba (135 kDa ) and binding of Y1 to the N-terminal ~45 kDa tryptic fragment. A monoclonal antibody (MCA466S) directed against the C-terminal fragment of GPIba reacted with the ~95 kDa C-terminal fragment, and a monoclonal antibody (S.C.7071) directed against the N-terminal fragment of GPIba reacted with the same ~45 kDa fragment that was recognized by Y1. (FIG. 7).
[235.] Mocarhagin treatment of glycocalicin (soluble, extracellular fragment of GPIba) gave similar results to those observed with washed platelets, showing binding of Y1 and monoclonal antibody S.C.7071 to the ~45 kDa N-terminal cleavage product fragment of GPIba. (FIG. 8). These results suggest that the epitope for Y1 is contained within the sequence Hisl-G1u282.

Characterization of the Y17 Clone-Binding to GPIb [236.] Y17, a second scFv human antibody fragment of the invention, which was selected in the same manner as Y1, was characterized using the methods used to characterize Yl. [See Example 17] Briefly, Y17 was selected from a phage antibody library by biopanning on human platelets. Characterization of Y17 was done by using ELISA assay and FAGS analysis. Y17 was found to bind to both fixed and washed human platelets. In order to further characterize the receptor on platelet membranes which bind Y17, platelet proteins were separated by SDS-PAGE and immunoblotted with biotin labeled-Y17 under reducing and non-reducing conditions. The results demonstrated that Y17 reacts with protein having an apparent molecular weight of 135 kDa under reducing conditions, and with a protein having an apparent molecular weight of 160 kDa under non-reducing conditions. These results correspond to platelet GPIba which under reducing conditions has a molecular weight of 135 kDa and under non-reducing conditions has a molecular weight of 160 kDa and consists of the GPIba-chain disulfide linked to GPIba. Monoclonal antibodies, MCA466S (Serotec) directed against the C-terminal fragment of GPIba monoclonal antibody S.C. 7071 (Santa Cruz) that recognize the N-terminus of GPIba react with the same baaids as Y17 under reducing and non-reducing conditions. (FIG. 2).
[237.] Western Blots show that Y1 and Y17 bind similarly to platelet lysates.
(FIG. 9).
[238.] Y1 and Y17 also bind similarly to glycocalicin after cleavage of glycocalicin by O-Sialoglycoprotein Endoprotease or Ficin. (FIGS. 5 and 10).
[239.] FAGS analysis indicated that Y1 have similar binding profiles to platelets and KG-1. In addition, both do not bind to Raji and T2 cells. In contrast, TMl (SEQ ID
NO: 209), Y16 (SEQ ID NO: 210)and Y45 do not bind to any of the above mentioned human cell lines.

[240.] These results demonstrate that Y1 and Y17, two monoclonal antibody fragments of the present invention, share an epitope on various cells, and that this epitope is not recognized by any other tested monoclonal antibodies.
Cathensin G Cleavage of GPIb -- Manning of the Yl Enitoue [241.] Cathepsin G (Sigma C4428), a neutrophil serine protease, cleaves glycocalicin at a first cleavage site between residues Leu-275 and Tyr-276 and at a second cleavage site between residues Val-296 and Lys-297. Cathepsin G
treatment of glycocalicin generates two N-terminal fragments: a small N-terminal 42 kDa fragment (Hisl-Leu275), a large N-terminal 45 lcDa N-terminal fragment (Hisl-Val-296), and corresponding ~95 kDa C-terminal fragments. (FIG. 1).
[242.] Glycocalicin and glycocalicin fragments generated by cathepsin G
digestion were electrophoresed on SDS-polyacrylamide gels and transferred to nitrocellulose for Western analysis. In immunoblots, Yl bound to the larger N-terminal fragment (His 1-Val-296), but not to the smaller N-terminal fragment (His1-Leu275), nor to the C-terminal fragment. Likewise, commercial monoclonal antibody SZ2 (Irmnmlotech 0719), which is known to recognize an epitope on GPIba between residues Tyr276 and G1u282 also reacts only with the larger N-terminal fragment. (FIGS.
11 and 12).
[243.] Moreover, monoclonal antibody S.C.7071 which is known to recognize an epitope between Hisl and Leu 275, bound to both N-terminal fragments. Y1 does not bind to the His 1-Leu 275 fragment bound by S.C.7071. These results suggest that the epitope for Y1 is localized between the first and second cathepsin-G cleavage site that is within the sequence Tyr 276-Val 296 or more probably between amino acids 276 to 282.
Effect Of Synthetic Partial GPIba Peptides On Yl Binding To Purified Glycocalicin and to Washed Platelets (WP) [244.] ELISA assays were developed to evaluate the effect of the GPIb derived synthetic peptides on the binding of Y1 to purified glycocalicin . In addition, FACS
analysis using washed platelets was carried out. To evaluate the importance of sulfated tyrosine within the Y1 binding site of GPIb, a competitive binding FAGS
analysis was used. Y1-scFv at a concentration of 1 ~.g was preincubated with different peptides at concentrations of 2.5 and 200 p,M. After a preincubation for 30 minutes at room temperature the mixture was added to a tube containing 107 washed platelets and the binding of Y1 to the washed platelets was assessed using polyclonal rabbit anti-scFv-PE.
The inhibitory effect of the peptides compared to control binding (Y1 alone) was evaluated by measuring the residual binding of Yl to washed platelets. The peptides and the results are described in Table 1 and are similar to results that were observed using the same peptides in an ELISA assay (Table B). In both assays, a control level of Y1 binding was determined, as follows. A polystyrene microtiter maxisorb plate was coated with (a) purified glycocalicin or (b) washed platelets. After extensive washing, 0.5 ~g/well of Y1 was added. The plate was then incubated with rabbit anti-scFv followed by addition of anti rabbit -HRP (horse radish peroxidase) and HRP substrate. The level of anti rabbit -HRP binding was measured by the intensity of the color produced, and the level of anti rabbit -HRP binding correlates with the level of binding of anti Yl-scFv and the level of binding of Yl . The optical density was measured at A4o5. Each sample was assayed in duplicate, and the average was calculated.
[245.] The effect of synthetic GPIba peptides on Y1 binding to purified glycocalicin was evaluated by mixing varying concentrations of the peptides with a constant amount of Y1. After a preincubation for 30 minutes at room temperature, the mixture was added to a polystyrene microtiter maxisorb plate coated with purified glycocalicin, as described for evaluation of Y1 binding in the absence of peptides. The inhibitory effect of the peptides was evaluated by measuring the residual binding of Ylto glycocalicin using rabbit anti YlscFv and anti rabbit -HRP antibodies, as described for evaluation of Y1 binding in the absence of peptides. This study was performed with four peptides representing various subsets of the sequence 268 to 285 and a control peptide.
Each peptide was tested at different concentrations: 200 ~M, 25~.M, 2.S~.M, and O.SuM.
[246.] The five peptides are as follows in Table 1:

Table 1 Peptide Name Characterization Sequence EGR negative control peptideREEGRQHFFLLEGRSSYS

P-1 residues 268-285 of GDEGDTDLYDYYPEEDTE
GPIba P- 1-S residues 268-285 of GDEGDTDLY*DY*Y*PEEDTE
GPIba P-2-S residues 273-285 of TDLY*DY*Y*PEEDTE
GPIba P-3-S residues 268-280 of GDEGDTDLY*DY*Y*P
GPIba Y* is identical to Y which is sulfated tyrosine.
[247.] The results obtained from these assays are presented in Tables 2 and 3 below.
Table 2 Effect 'of Synthetic GPIba Peptides on Y1 Binding to Glycocalicin 0.25 fig/ well Y1 Residual Binding of Yl (% of baseline) Peptide 200 ttM 25uM 2.S~M O.S~.M
Concentration [248.] These results clearly show that the inhibitory effect of the peptides containing sulfated tyrosine is significantly higher than that observed for the non-sulfated peptide. This effect is dose-dependent, and peptides containing longer N' (upstream) flanking sequences had a higher inhibitory effect than peptides with extended C' (downstream) flanking sequences. These results clearly support the conclusion that sulfated tyrosine is required for Yl binding to GPIba, and that sequences upstream and downstream from the sulfated region enhance Yl binding to GPIba.
Table 3 Effect of Synthetic GPIba Peptides on Y1 Binding to Washed Platelets as Described By Comparative FACS Analysis Residual Binding of Yl (% of baseline) (Geo Mean) Peptide 200~.M 2.S~M
Concentration Control - No 114 Peptide [249.] These results further support the hypothesis that sulfated tyrosine residues within the specific region are important for Y1 recognition on GPIb. Overall, analysis of N-terminal peptide proteolytic fragments of mocarhagin and cathepsin G suggest that the GPIbcc amino acid sequence Tyr276-Glu-282 is or contains an important epitope for binding of Yl. (FIGS. Tab 1C pages 6 and 7). Further characterization indicated that in addition to residues 276-282 (sulfated anionic sequence) of glycocalicin, upstream amino acids 283-285 are involved in the recognition site of Y 1.
Biological Activity Of Yl scFv , Y17 scFv and I~G Yl On Platelets Function [250.] Localization experiments suggested that the Y1 binding site resides at the alpha-thrombin and vWF binding sites, which are important for platelet aggregation.
Therefore the binding of Yl scFv, Y17 scFv, and Y1 IgG to washed platelets and to platelet-rich-plasma was studied to determine the effects of the binding on platelet aggregation.

Effect of Yl-scFv and Y17-scFv on A~~lutination of Washed Platelets (W.P.) [251.] Aggregation is determined in PRP due to the presence of thrombotic agents, while agglutination is determined in washed platelets. The effect of Yl (scFv) on agglutination of washed platelets was tested at various concentrations of Yl.
Platelets were pre-incubated with Y1 scFv, Y17 scFv, Y16-scFv, or a control TM-1 scFv for 4 min at 37°C before being exposed to ristocetin, an inducer of platelet agglutination and aggregation.
[252.] The results of this study are presented in Table 4 and in FIG. 15.
Preincubation of platelets with 25 ~.g/ml Y1 scFv inhibited agglutination of washed platelets induced by ristocetin. At a Yl concentration of 12.5 ~g/ml, only partial inhibition of platelet agglutination was observed. No inhibition of platelet agglutination was observed at a concentration of 4 ~.g/ml of Y1. These results indicate that inhibitory activity of Yl on washed platelet agglutination is dose dependent. Incubation of washed platelets with negative control scFv TMl had no effect on platelet agglutination induced by ristocetin. Neither Y17 nor Y16, which is another scFv clone selected from the same phage display library and using the same multistep procedure used to select Yl, significantly inhibit agglutination of washed platelets.
Table 4 ScFv Concentration %inhibition % agglutination TM-1 scFv 25 ~g/ml 10 90 Y1 scFv 25 ~.g/ml 77 23 Yl scFv 12.5 ~g/ml 33 67 Yl scFv 4 ~g/ml 8 92 Y17 scFv 25 ~.g/ml 15 85 Y16 scFv 38 ~g/ml 14 86 * 100% agglutination is calibrated on the basis of ristocetin treatment.

Effect of Yl-scFv and Y17-scFv on A~~re~ation of Platelet -Rich -Plasma (PRP) [253.] The effect of Yl (scFv) on aggregation of platelet-rich-plasma (PRP) was tested at various concentrations of Y1. PRP was pre-incubated with Y1 scFv, Y17 scFv, or a control sTM-1 cFv for 4 min at 37 °C before being exposed to ristocetin, an inducer of platelet agglutination and aggregation. A reversible inhibitory effect was observed when scFv was added to PRP prior to the addition of ristocetin, and it was dose dependent.
[254.] The results of this study are presented in Table 5 and in FIG. 16. Y1 at a final concentration of 50 ~.g/ml inhibited ~80 % of platelet aggregation in platelet rich plasma induced by ristocetin as was recorded during the first 4 minutes. There was no significant inhibition of platelet aggregation at a Yl concentration of 25ug/ml. Y17 did not inhibit aggregation of platelets. Incubation of washed platelets with 50~ag/ml of the negative control scFv, TM1, had no effect on platelet aggregation induced by ristocetin.
(Table 5).
[255.] A comparison between washed platelets and PRP indicated that (1) scFv Yl has an inhibitory effect on platelet aggregation and agglutination induced by ristocetin; (2) the effect is dose dependent; (3) higher inhibitory effect is observed in washed platelets relative to PRP; (4) reversible inhibitory effect was detected in PRP; (5) neither TM1 not Y16 scFv antibody fragments has an effect; and (6) Y17 is a negative control in this assay.
Table 5 ScFv Concentration % inhibition% aggregation TM-1 scFv 50 ~.g/ml 0 100 Y1 scFv 50 ~glml 80 20 Yl scFv 25 ~g/ml 13 87 Y17 scFv 38 ~g/ml 0 100 * 100% agglutination is calibrated on the basis of ristocetin treatment.

Effect of Yl-I~G on A~~lutination of Washed Platelets (W.P.
[256.] Due to its natural structure the full IgG Y1 has two binding sites on GPIba and one binding site for an Fc receptor. It is likely that if full IgG Y1 binds two GPIba molecules, it will activate platelets and induce platelet agglutination.
Furthermore, because platelets have an Fc-receptor, Y1-IgG can induce platelet agglutination by binding to GPIba and to an Fc-receptor, thereby producing platelet agglutination by each IgG Y1 binding to three platelets. Therefore, the effect of IgG Yl on aggregation of washed platelets was tested at different concentrations of Yl-IgG in the presence or absence of ristocetin. Induction of platelet aggregation by Yl-IgG was monitored for 4 min at 37°C, followed by addition of ristocetin.
[257.] The results are presented in Table 6 and FIG. 17 without agonist. Yl-IgG
alone at a final concentration of SO~.g/ml induced platelet agglutination ~39%
of normal agglutination of washed platelets. Induction of platelet agglutination by Yl-IgG was tested for 4 min at 37 ° C, followed by addition of ristocetin. No additional effect on platelet agglutination was seen after the addition of ristocetin: normal platelet agglutination was observed. However, there was no induction of platelet agglutination when platelets were incubated with 1 ug/ ml Y1.
[258.] There was no reduction of platelet agglutination when a commercial monoclonal antibody against GPIba (CD42) (Pharmigen), which inhibits platelet agglutination, or control human IgG-Lambda (Sigma) were used as above.

Table 6 % inhibition % agglutination Without Without With With Ristocetin ristocetin ristocetin ristocetin IgG Ab Concentration Y1-IgG 50 ~g/ml 61 5 39 95 Y1-IgG 25 ~g/ml 65 5 35 95 Y1-IgG 12.5 ug/ml62 5 38 95 Y1-IgG 3:5 txg/ml66 14 34 86 Yl-IgG 1 ~g/ml 92 7 8 93 Mouse anti-human 99.5 100 0.5 0 CD42 IgG 20 ~zg/ml Control human 99.5 25 0.5 75 IgG 20 ~g/m Control ristocetin-- ~ 0 -- 100 Activation Effect of Yl-I~G on A~~re~ation of Platelet -Rich-Plasma (PRP) [259.] The effect of Y1-IgG on aggregation of Platelet-Rich-Plasma was tested at different concentrations of Yl-IgG in the presence or absence of ristocetin.
Induction of platelet aggregation by Y1-IgG was tested for 4 min at 37°C, followed by addition of ristocetin.
[260.] The results are presented in Table 7 and FIG. 18. No effect on platelet aggregation was seen after the addition of ristocetin: normal platelet aggregation was observed. Y1-IgG at a final concentration of 50 ~g/ml induced platelet aggregation in Platelet-Rich-Plasma, before the addition of ristocetin. Y1-IgG at a concentration of 25 ~g/ml only partially induced platelet aggregation before the addition of ristocetin. No induction of platelet aggregation was observed with Yl-IgG concentrations of 10 ~g/ml, 4 ~g/ml, or 1 ug/ml. Commercial monoclonal antibodies against GPIba (Pharmigen ), which inhibit platelet aggregation at concentration of 20 ~g/ml, did not induce platelet aggregation. Control human IgG- Lambda (Sigma) in the same concentration as Y1-IgG
also did not induce platelet aggregation.
Table 7 % inhibition % aggregation Without With Without With ristocetinristocetinristocetinristocetin IgG Concentration Yl-IgG 50 ug/ml64 0 36 100 Yl-IgG 25 ~g/ml75 8 25 92 Yl-IgG 10 ~glml93 10 7 90 Yl-IgG 4 ~g/ml 98 5 2 95 Yl-IgG 1 ~g/ml 95.5 0.5 0.5 99.5 Human anti-CD4299.5 0.5 0.5 99.5 IgG 20 ~g/ml Control ristocetin-- 0 -- 100 Activation Identification of Yl Plasma Soluble Li~ands and Cell Lines [261.] Antibodies against GPIba (CD42b) recognize platelet lysate and glycocalicin and but not KG-1 cell lysate (a Y1 binding positive myeloid cell line) or Raji cell lysate (a B cell line that is negative for Y1 binding at concentrations at which KG-1 cells are positive for Y1 binding). In contrast, Y1 recognized both glycocalicin, platelet lysate, and KG-1 cells, but not Raji cell extract. The negative control scFv-181, did not recognize any of the relevant proteins. (FIG. 20).
[262.] The uniqueness of Y1 cross-reactivity was further demonstrated in a comparative analysis between Y1 and SZ2 (Mab against the sulfated region of GPIb). In contrast to SZ2, Yl binds not only to GPIb, but also to plasma proteins and to myeloid derived cell extracts as described below.

Yl Li~ands in Human Plasma [263.] Two proteins immunoreacted with Y1 both in normal as well as in leukemia patients plasma. The first is designated H P-ligand 1, which has a molecular mass of ~50 kDa under reducing conditions and >300 kDa under non-reducing conditions and which completely disappears from the serum after coagulation;
and (2) H
P-ligand 2, which has a molecular mass of ~80 kDa under both reducing and non-reducing conditions and which remains in serum after coagulation. After purification using a Q-Sepharose column reverse phase (RP-HPLC) 2D gel electrophoresis, and peptide mapping, the ~50 kDa ligand was identified as the normal variant of the gamma chain (~ prime) of human fibrinogen. The sequence VRPEHPAETEYDSLYPEDDL, is present only in fibrinogen gamma prime, but not the abundant form of fibrinogen gamma, and is similar to GPIb anionic region containing sulfated tyrosine. Most likely this is the binding site for Yl. The ~80 kDa was identified as complement compound 4 (CC4) and Lumican. As above, it contains sulfated tyrosine residues accompanied by a stretch of negatively charged amino acids.
Sindin~ of Yl to Primary Leukemia Cells [264.] FACS analysis indicates that Y1 binds selectively to leukemia cells, but not to normal blood cells both in normal blood sample and normal cells within the blood of leukemia samples. A summary of the results from patient analysis is shown in the following tables.
Table 8: Results of the patients with Y1 Disease Number Positive % Positive Multiple Myeloma 16/16 100%

AML 60/75 80%

B-Leukemia 29/43 67%

Table 9: B-Leukemia Type Source Number % Positive % Negative Positive Pre-B-ALL BM 3/3 100 0 B-ALL BM ' 3/9 33 67 B-Lymphoma PB 5/8 62 38 BM = Bone Marrow PB = Peripheral Blood Characterization of Yl Epitope on Myeloid Cells (KG-1) [265.] Approximately 25 billion KG-1 cells were collected for the purification of the Yl epitope from the KG-1 cell membranes. KG-1 membrane preparations were found to contain at least 2 subunits to which Y1 binds: a 110 kDa subunit and a 120 kDa subunit. Y1 also binds to a 220 kDa subunit, which may be a dimer of the 110 kDa subunit. Purification of Y1 epitope was accomplished by immunoprecipitation with Y1, and reverse phase (RP-HPLC). 2~.1 of the pooled fractions were used for Western blotting with scFv Y1, and 40.1 were used for silver staining. (FIG. 21).
[266.] Y1 ligand was further characterized using enzymatic treatments with proteases, glycanases, and sulfates; Western blotting with Y1, anti-CD42 antibodies, anti-CD162 antibodies and 181, immunoprecipitation using Y1 and anti-CD162 antibodies;
FACS analysis using Yl anti-CD162 antibodies; and sequencing.
[267.] The table below summarizes the biochemical experiments preformed to characterize and localize the Y1 binding site on KG-1 cells.

Western Blot Analysis with Y1 on SDS-PAGE Reducing Gels Table 10 Substrate Treatment Condition Reactivity Presented with in Y 1 Figure RP-HPLC KG- O-Sialo 30' at 37"C Reactivity Tab 2A slide only 1 membrane glycoprotein with the 14 fraction endopeptidase 120kDa form ~

RP-HPLC KG- O-Sialo 4hr at 37"C No reactivityTab 2A slide 1 membrane glycoprotein- 14 fraction eridopeptidase RP-HPLC KG- aryl-sulfatasel8hr at 22"CNo reactivityTab 2A slide 1 membrane 14 fraction RP-HPLC KG- mocarhagin 7' at 37"C No reactivityTab 2A slide 1 membrane 14 fraction GlycocalicinO-Sialo 30' at 37"C Enhanced Tab 2A slide (GC) glycoprotein binding 14 endopeptidase Heparin-BSA aryl-sulfatasel8hr at 22"CBinds to Tab 2A slide Y1 as without 16 treatment [268.] In summary, following treatment with endopeptidases the Y1 signal is cleaved off and cannot be detected. Most likely, the fragment containing the Y1 binding site is found on the N'-terminus and it is too small to be determined under the conditions used in the above experiments. In addition, the results obtained with the aryl-sulfatase which remove sulfate entities from proteins (within the KG-1 cell extract), but not from sugar moieties (on the heparin) further support our hypothesis that sulfate is required for Y1 recognition. Interestingly, O-Sialo glycoprotein endopeptidase enhanced the Y1 signal in the GC cleavage product. We assume that following this treatment the Yl binding site, now located at the C' terminus is better exposed to the Y1 binding.

Correlation between Yl and PSGL-1 antibody-KPLl: Western Slot Analysis [269.] The binding of scFv Y1 antibody and commercially available anti-PSGL-1 monoclonal antibody (KPLl) to KPLl immunoprecipitated (IP) membrane proteins derived from KG-1 cells was assessed. A Raji cell lysate was used as a Y1 and KPLl negative control.
[270.] The membrane fraction of KG-1 cells was immunoprecipitated with KPL1.
The IP fraction was further immunoprecipitated either with scFv Yl antibody or with KPL1. The non-precipitated (eluate) fractions were analyzed by Western blot, using either scFv Yl or KPLl antibodies.
[271.] Both the immunoprecipitation scheme and the results are shown in Figure 24. KPL1 does not recognize glycocalicin. However, both scFv Yl and KPLl antibodies recognize membrane proteins on KG-1 cells.
[272.] Lysates from cell lines and primary white blood cells were immunoprecipitated with anti-CD162 ailtibodies and centrifuged to produce a supernatant and an eluate. Western blot analysis of the proteins present in the eluate and supernatant was performed using scFv Y1 and anti-CD162 antibodies. KG-1 membrane preparations contain two subunits 0110 kDa and 120 kDa) to which anti-CD162 (PSGL-1) antibodies bind. In contrast, normal white blood cell membrane preparations have only the smaller subunit. Membrane preparations from AML patients have only the larger subunit. scFv Y1 binds to a distinct species, which is found in the supernatant of the immunoprecipitation, and to which anti-CD 162 antibodies do not bind. (FIG.
25).
FRCS Analysis [273.] The binding of Y1 antibody (both the scFv and the IgG forms) to KG-1 cells in the presence of anti-PSGL-1 (anti-CD162) (KPLl) antibodies was assessed in competitive binding assays using FAGS analysis. To this end, different commercially available anti-PSGL-1 antibodies, KPL1 (an antibody that identifies the sulfated tyrosine N-terminal domain of PSGL-1), PL1 (an antibody that identifies the non-sulfated N-terminal domain of PSGL-1), and PL2 (an antibody that identifies a non-sulfated internal domain of the PSGL-1 receptor) were used. Only KPLl completely inhibits the binding of Y1 to KG-1 cells, while PL1 partially inhibits binding. There is no inhibition of binding in the presence of the PL2 antibody. (Figure 26) Raji cells did not bind to KPL1 antibodies. Similarly, complete IgG Y1 at different concentrations inhibits the binding of KPLl antibody to KG-1 cells in a dose dependent mode (Figure 27) Likewise, KPLl antibody inhibits the binding of full IgG Y1 antibody to KG-1 cells in a dose dependent mode. (Figure 28).
Correlation Between Y1 and KPLl Binding to Primary Leukemia Cells [274.] Analysis of binding of scFv Y1 antibodies and anti-CD162 antibodies to diseased cells also illustrates that scFv Y1 has binding characteristics different from those of anti-CD162 antibodies. Specifically, FACS analysis of Y1 and anti-CD162 binding to Pre-B-ALL, HCL, AML, B-ALL, B-CLL, unclassified leukemia, B-PLL, and multiple myeloma cells from human patients showed the two antibodies have different binding profiles. (Table F). Y1 binds to the leukemic cells in 10 of 12 samples. In contrast, anti-CD162 bound only 5 out of 12 samples. Out of the 12 samples, 5 were found to bind Yl but not anti-CD162. Thus, it may be concluded that, in leukemic cells, scFv Yl binds to a ligand other than that recognized by anti-CD162.

Table 11: Leukemia samples -- Analysis of Anti-CD162 versus Y1 Reaction with the Leukemia Cells Patient # Disease ScFv Yl Anti CD162 42291 Pre-B-ALL + -42311 AML + +

42323 B-CLL + -42325 Unclassified+ -42332 B-CLL + -42352 B-PLL + +/ -42330 AML + +

42334 MM + -42366 AML + +

42370 AML/ALL + +/-[275.] Overall, sulfated-tyrosine containing Yl-binding domains in GPTba, Fng-~ prime, and PSGL-l, are DEGDTDLYDYYPEEDTEGD (amino acids 269-287), EHPAETEYDSLYPED (amino acids 411-427), and QATEYELDYDFLPETE (amino acids 1-17), respectively. An additional binding site, with a higher affinity to Yl, is most likely to be expressed on primary leukemia cells. Interestingly, blood samples that are positive both to scFv Y1 and anti-CD162 were derived from AML patients, while B-cell were negative to anti-CD 162.
Binding Analysis of Sulfated Peptides to Yl [276.] A competitive binding ELISA assay was used to assess the importance of the presence and position of sulfated tyrosines to the binding of peptides to Y1.
[277.] Glycocalicin was immobilized on a Maxisorb plate. scFv Y1 was preincubated with a peptide of interest for 10 minutes at three different concentrations (1, and 100 ~M) in order to observe a dose response. (Table 12). After preincubation, the mixture (Y1 + peptide) was added to the plates and binding of scFv Yl was assessed using polyclonal rabbit anti-VL, which recognizes the VL chain of scFv Y1, followed by anti-rabbit-HRP. In mixtures in which the peptide bound to scFv Y1, a decrease in the binding of scFv Y1 to glycocalicin compared to control binding was observed.
In mixtures in which the peptide did not bind to scFv Yl, no change in the binding of scFv Y1 to glycocalicin compared to control binding was observed.
[278.] The experiment was done twice, and the results are described in an ELISA
graph. (Figure 29) Peptides derived from Fbrinogen did not inhibit the binding of the Yl, regardless of sulfation. Non-sulfated peptides from PSGL-1 did not inhibit binding to glycocalicin. All sulfated peptides derived from PSGL-1 inhibited Y1 binding to glycocalicin. Peptides P-YYY* and P-YY* Y* were the best inhibitors, followed in efficiency by P- Y*Y Y* then P-YY*Y then P- Y* Y*Y and P- Y*YY. Non-sulfated peptides derived from glycocalicin did not inhibit Y1 binding to glycocalicin, but glycocalicin-derived peptide having the same sequence sulfated on three sulfates (G- Y*
Y* Y*) did inhibit the binding, with efficiency similar to that of P-Y Y*Y.
[279.] Thus, it is clear that not every sulfated peptide binds to scFv Y1 to the same extent. Also, significantly, these results demonstrate that only one sulfated tyrosine is necessary for binding, as can be seen with peptides P- Y*YY and P-YY Y*.
Further, it can be seen that the amino acid context of the sulfated tyrosines influences Y1 binding.
For example, P- Y*YY (containing one sulfated tyrosine in the sequence EY*E) inhibits binding efficiently only at 100~M. In contrast, P-YYY*(containing one sulfated tyrosine in the sequence DY*D) inhibits binding efficiently at luM.

Table 12: Sulfated Peptides Name Source Sequence #aa MW Sulfation of Peptide F-YY Fibrinogen-'y-VRPEHPAETEYESLYPEDDL 20 2389 -prime chain F- Y* Fibrinogen-y-VRPEHPAETEY*ESLY*PEDDL 20 2549 Sulfated Y*

prime chain P-YYY PSGL-1-n- QATEYEYLDYDFLPETE 17 2126 -terminus P- Y*YY PSGL-1-n- QATEY*EYLDYDFLPETE 17 2206 Sulfated terminus P- Y* PSGL-1-n- QATEY*EY*LDYDFLPETE 17 2286 Sulfated Y*Y

terminus P- Y*Y PSGL-1-n- QATEY*EYLDY*DFLPETE 17 2286 Sulfated Y*

terminus P-Y Y*Y PSGL-1-n- QATEYEY*LDYDFLPETE 17 2286 Sulfated terminus P-Y Y* PSGL-1-n- QATEYEY*LDY*DFLPETE 17 2286 Sulfated Y*

terminus P-YY PSGL-1-n- QATEYEYLDY*DFLPETE 17 2286 Sulfated Y*

terminus -G-YYY GPIba GDEGDTDLYDYYPEEDTE 18 2126 -G-Y*Y*Y*GPIba GDEGDTDLY*DY*Y*PEEDTE 18 2366 Sulfated -Y*=Sulfated Tyrosine HYpothesis/Conclusions [280.] (1) Y1 resembles L-selectin which recognizes both sulfated protein and sugar moieties, and is distinct from the P-selectin which recognizes only sulfated proteins. Therefore, it can compete for the bonding of both proteins.
[281.] (2) Variation irk sulfation during differentiation and cell growth may affect Y1 binding. Therefore, Yl may compete with both P and L selectins for binding to their sulfated ligands.
ha vivo models for evaluating the efficacy of the leukemia-specific antibody.
[282.] Two human leukemia models were developed in immuno-deficient mice as well as in assay systems.

[283.] The human cell lines used were MOLT4 cells derived from a T cell leukemia patient and KG-1 cells derived from an AML patient. Antibodies specific for the relevant human antigens on each cell line were used to identify and quantify malignant cell engraftment.
T-ALL (MOLT4) Model [284.] The iya vivo mouse model for T-ALL uses SLID mice (Jackson Laboratories) injected with MOLT4 cells derived from a T cell leukemia patient.
[285.] In one experiment, SCID mice were pretreated with 100mg/kg Cytoxan (CTX, Cyclophosphamid for injection, Mead Johnson). Eleven days after CTX
injection, MOLT-4 cells were injected intravenously into the tail vein. Control mice were injected with PBS alone. One week post-MOLT-4 injection mice were injected with CONYl-Doxorubicin, which is a conjugate between scFv CON Y1 polypeptide, having _K_A_K_ amino acid residues at its carboxy end and doxorubicin via a short organic linker;
CONY1, which is a scFv antibody fragment derived from Y1 scFv in which the DNA
sequences encoding the myc tag of Y1 were deleted and replaced with a DNA
sequence encoding the amino acids lysine, alanine, lysine (KAK); or free Doxorubicin .
The mice were injected three times per week for three weeks. Control mice were injected with PBS;
and another control group did not receive any treatment. (Table M).
Table 13 Number of Mice Inoculation Treatment PBS only --9 MOLT-4 CONY-Dox (2.5 mglkg) 9 MOLT-4 CONY-Dox (2.5 mg/kg) 8 MOLT-4 Free Dox (0.1 mg/kg) [286.] Mice started to die 32 days post cell inoculation, and the surviving mice were sacrificed at this time. Bone marrow cells were analyzed by flow cytometry using 7s anti-human CD44-FITC and Yl-Biotin/SAV-PE. Blood samples from several animals were monitored for platelet and white blood cell count. Livers were weighted and examined for tumor appearance. Other organs were also examined for tumor appearance.
[287.] The results are depicted in (FIGS. 30, 31 and 32). Massive tumor growths (white nodules) were seen in the livers of all mice inj ected with MOLT-4 cells. However, livers of mice injected with MOLT-4 and treated with CONY1 or CONY1-Doxorubicin conjugate weighted significantly less than those of mice injected with MOLT-4 and treated with free Doxorubicin or left untreated. (FIG 30).
[288.] The percentage of MOLT-4 cells found in the bone marrow was very low.
(FIG 31 ).
[289.] ° Overall,' these results demonstrate that the MOLT-4 model can be used as a useful model for liver metastases of leukemia cells.
[290.] In a second experiment, SCm mice were i.v. injected with 2x107 MOLT-4 cells/mouse, 5 days post treatment with cyclophosphamide. Anti-cancer agents or PBS
(negative control animals) were injected i.v. three times/week from day 5 post cells injection and onward. On day 35, blood was drawn from the animals, the animals were sacrificed, and their livers were excised and weighed. In the untreated, PBS-treated MOLT-4 cell-bearing animals, the liver presented with a very massive tumor growth, and its size was increased 2-3-fold relative to PBS control uninfected animals. In this experiment, there were five treatment groups:
1. PBS control, uninfected with MOLT-4 cells 2. PBS-treated MOLT-4 control 3. MOLT-4 group, treated with Y 1 scFv (CONY 1), 75 p.g/mouse 4. - MOLT-4 group, treated with CONYl scFv -Doxorubicin, 75 ug/mouse MOLT-4 group, treated with Doxorubicin, 0.1 mg/kg.

[291.] In parallel, portions of liver tissue were taken for histology and cell harvesting for FACS analysis. The survival rate of another group of treated animals was recorded relative to that of control untreated mice.
[292.] The liver weights, on day 35, are presented in (FIG. 33). As shown, liver size almost tripled in the tumor-infected mice, negative control PBS treated relative to PBS control, and non-MOLT-4-injected mice. The liver weights of mice treated with a low dose of Doxorubicin were similar to that of PBS treated tumor-infected mice. On the other hand, CONY1 scFv and CONY1 scFv-Doxorubicin conjugate treatments markedly inhibited tumor growth in the liver (much lower liver weights).
[293.] In a third experiment, using the identical SCID/MOLT-4 protocol, there were 6 groups:
1. PBS control, uninfected MOLT-4 cells 2. PBS-treated Molt control 3. Molt group, treated with CONYl scFv, 75 ~,g/mouse 4. Molt group, treated with a non-specific scFv antibody derived from the Nissim I
library, 75 ~,g/mouse (control) 5. Molt group, treated with Y1-IgG, 5 ~.g/mouse 6. MOLT-4 group, treated with a non-specific human-IgG, 5 ~,g/mouse (control) [294.] The results shown in (FIG. 34) indicate that treatment with either scFv or Yl IgG inhibited tumor growth (based on liver weights), while little or no effect was seen in the animals treated with the non-specific antibody molecules.
[295.] Survival was assessed in mice from three groups which received continued treatment, and the results axe presented in (FIG. 35). As shown, only survival of CONY1 scFv-treated mice was prolonged.

AML KG-1 Model [296.] The in vivo mouse model for human AML uses SGID/NOD mice (Jackson Laboratories} inoculated with KG-1 cells derived from a human AML cell line.
[297.] In a first experiment, NOD/SCID mice were pretreated with 100mg/kg CYTOXAN~. Four days post CYTOXAN~ injection, KG-1 cells were injected intravenously into the tail vein of six groups of mice. (Table N, Groups 2 and 5-9). One group of mice (Table N, Group 1) was injected with PBS alone (control).
[297.][[297.]
Beginning 19 days post KG-1 injection mice were treated with: CONYl, Doxorubicin, CONY1-Doxorubicin conjugate, or Mylotarg~. (Mylotarg~ is a monoclonal antibody (anti CD33) conjugated chemically to calcheamicin recently approved by the FDA for treatment of AML patients age 60 and over in a first relapse.) Mice were treated once or three times per week for three weeks. One group (group 2) of KG-1 inoculated mice were left untreated. (Table N). Two other groups of mice (groups 3 and 4) were injected with KG-1 cells that were previously incubated with CONY1 or 181-scFv (a negative, non-specific control antibody) in serum free RPMI
containing 1%
BSA at 4°C for 1 h. The antibodies were used at a concentration of 0.25mg scFv/108 cells (75ug/mouse). Before injection into the mice the preincubated KG-1 cells were washed and resuspended in RPMI. The KG-1 cells in RPMI were inoculated into mice at a concentration of 75 ug scFv/ 0.2 ml RPMI per mouse. Group 3 mice were inoculated with KG-1 + CONYl, and group 4 mice were inoculated with KG-1 + 181-scFv.
(Table N). This treatment (group 3 and 4) was carried out one day after the inoculation of groups 1-2 and 5-9, i.e., at five days after CYTOXAN injection.

Table 14 # of Group InoculationTreatment Mice #

9 3 KG-1 + Yl --9 4 KG-1 + 181 --8 5 KG-1 75 ~.g/mouse (2.5 mg/kg) CONY1, times per week 9 6 KG-1 0.1 mg/kg Doxorubicin, 3 times per week 7 KG-1 5 mg/kg Doxorubicin, 1 time per week 11 8 KG-1 75 tzg/mouse (2.5 mg/kg) CONY1-Doxorubicin, 3 times per week 9 9 KG-1 0.2 mg/kg Mylotarg~, 1 time per week [298.] Mice were sacrificed from 60 to 65 days post cell injection. Bone marrow and blood samples were analyzed by flow cytometry using mouse anti human CD34-FITC (IQP 144F) (or anti CD44-FITC (MCA89F, Serotec)) and Yl-Biotin/SAV-PE.
Mouse IgGI-FITC (IQP 191-F) was used as an isotype control, and mouse IgG2a-FITC
(MCA929F, Serotec) was used as a negative control. Flow cytometry was performed using FACSCalibur system and CellQwest software, Becton Dickinson.
[299.] The results are depicted in (FIGS. Tab 6, pages 5 and 6). Nine out of KG-1 cells-injected mice that were treated with Smg/kg free Doxorubicin (group 7) died within three weeks after treatment initiation.
[300.] The bone marrow of mice injected with KG-1 cells that were not treated (group 2) contained about 30% KG-1 cells on average of bone marrow cell population.
All mice in this group developed leukemia.
[301.] Overall, nearly all mice developed leukemia, with average of 30% KG-1 cells in the bone marrow (as determined by FACS analysis). In general, KG-1 engraftment was confined to the bone marrow. Less than 10% KG-1 cells were found in the blood In one case a solid tumor was observed on peritoneal wall.
[302.] Mice injected with KG-1 cells and treated with 0.1 mg/kg free Doxorubicin (group 6) had a statistically significant (p<0.05) lower percentage of KG-1 cells in their bone marrow, as compared to group 2.
[303.] Mice injected with KG-1 cells and treated with CONYl-Doxorubicin conjugate (group 5) had a lower percentage of KG-1 cells in their bone marrow as compared to group 2 (16.3% versus 30.4%, respectively). However, this difference was not found tb be statistically significant. It was found during the experiment that the CONY1-Doxorubicin was contaminated with lipopolysaccharides (LPS). Therefore, the optimal concentrations of CONYl-Doxorubicin could not be used, and treatment was stopped before the end of the experiment.
[304.] Mice injected with KG-1 cells incubated ih vitro with CONYl or 181-scFv (groups 3 and 4, respectively) had a significantly lower percentage of KG-1 cells in their bone marrow.
[305.] The bone marrow of both mice injected with PBS only (negative control) and mice injected with KG-1 cells and treated with MylotargT"" (group 9) was free of KG
1 cells. These results demonstrate that this irz vivo model is a useful model for AML.
[306.] The overall percentage of KG-1 cells found in the blood stream of the various groups was very low overall, with high variation within the groups. It should be noted that one mouse treated with MylotargT"~ demonstrated relatively high percentage of KG-1 cells in the blood, but not in bone marrow.
[307.] Identification of human leukemia cells (KG-1 origin) in the bone marrow and in the blood stream of the mice, was performed by FACS analysis, using commercially available anti-human CD34 or CD44 antibodies in parallel With the Yl scFv antibodies.

[308.] On the first day of analysis, there was a significant difference between mice injected with KG-1 alone (group 2), which had higher percentage of KG-1 cells in their bone marrow, as compared to mice treated with CONYl-Doxorubicin (group 8). On the third day of analysis this situation was reversed: mice from group 8 bad a higher percentage of KG-1 cells in their bone marrow when compared to mice from group 2.
This situation may have resulted from the following: A) choosing mice in worse physical condition in the first day, B) proliferation of KG-1 cells in mice from group 8 during the days after treatment termination, and C) the number of mice in each group was too small to generate statistically significant results.
[309.] An additional experiment was performed in which SCID-NOD mice were i.v. injected with 3x104 MOLT- 4 cells/mouse 5 days post treatment with cyclophosphamide. Anti-cancer agents or PBS were injected IV three times/week, from day 14 onward. On day 60, blood was drawn, then the animals were sacrificed.
Bone marrow was extracted and analyzed by FAGS analysis using a commercially available antiCD44 antibody for the detection of MOLT-4 cells in the mice bone marrow cell population.
[310.] This study consisted of 7 groups:
1. PBS control, uninfected with MOLT-4 cells 2. PBS-treated KG 1 control 3. KG 1 group, treated with CONY1 scFv, 75 ~,g/mouse 4. KG 1 group, treated with CONY I scFv -Doxorubicin, 75 ~,g/mouse S. KG 1 group, treated with Doxorubicin, 0.1 mglkg 6. KG 1 group, treated with Doxorubicin, 3 mglkg, once a week 7. KG 1 group, treated with MylotaxgTM, 7 ~g/mouse, once a week (MylotargTM is antibody linked to a chemotherapeutic agent, and is FDA-approved for use in leukemia patients).
[31 l.] The results of the study are~presented in (FIG. 38). As shown, the KG-cell-bearing mice had a high prevalence of cancer cells in the bone marrow.
CONYl scFv, alone, had no effect on the development of the malignancy. Mylotarg completely inhibited the prevalence of bone marrow cancer. Doxorubicin, either alone, or in the CONY1 scFv-Doxorubicin conjugate, caused a 50% reduction in the number of tumor cells in the bone marrow.
Pharmacokinetics of CONYIin Immunosunpressed Mice [312.] CONY 1 scFv was labeled with 1~SI-Bolton Hunter reagent (to lysine).
The labeling reaction was carried out at 4°C in a borate buffer (pH
9.2) with l2sl-Bolton Hunter reagent, then l2sl-CONYl was purified on a PD-10 chromatography column.
The radioactive protein was then admixed with unlabeled CONY-1 to yield a solution of 75ugJm1 CONY-1 containing 2.5x106 CPM/ml in saline.
[313.] Male Balb-C mice were pretreated by intraperitoneal injection of 0.5 mlJmouse of 0.9% NaI. After 2 hours, the mice were injected intravenously with 0.2 ml of the labeled CONY-1 solution, resulting in a lasl-CONY-1 dose of 15 fag (5x105 CPM) per mouse.
[314.] At various times after injection, blood was collected over EDTA, mice were sacrificed, and tissues were excised. Samples and organs were taken at 5, 15, and 30 minutes and at 1, 2, 4, 8, and 24 hours after injection. Two to four mice were used per time point. Plasma was separated and either counted for gamma radioactivity or subjected to precipitation with trichloroacetic acid (TCA). After centrifugation, TCA
precipitates were subjected to gamma radioactivity counting. Liver, lung, kidney, spleen, and bone marrow samples were weighed and counted for gamma radioactivity.
Plasma TCA precipitated radioactivity was plotted against time, and a two-compartment kinetics model was fitted. Organ/ tissue total and specific radioactivity values were calculated.
The results are shown in (FIGS. 39, 40 and 41).
[315.] Comparison of the blood and plasma radioactivity values indicated that practically all of the CONY-1 resided in the plasma and did not adhere to erythrocytes.
The plasma radioactivity values were similar to those of the TCA precipitates, indicating that they were associated with undegraded protein. FIG. 39 shows CONY-1 levels in the plasma at various time points after administration. The values were fitted statistically to a two-compartment model, and the half life values of blood clearance obtained were 35 and 190 minutes, respectively.
[316.] The distribution of radioactivity in various tissues at the specified time points after administration are shown as specific and total radioactivity in (FIGS. 40 and 41), respectively. In most tissues, there was no specific accumulation of radioactivity, as is evident from the comparison of the specific activity to that of the blood.
Slightly higher values were seen in the kidney at 4 hours and in the bone marrow at 4 and 8 hours;
this is most probably related to the excretion of degradation products.
[317.] The results indicate that CONY-1 is excreted in mice at a half life of minutes. The second compartment excretion rate is of minor importance and may be the result of the presence of some polymeric forms of the inj ected material.
There is no major specific uptake of CONY-1 in body tissues, with the exception of a slight increase in the bone marrow.
Production of Antibodies and Fragments [318.] Antibodies, fragments thereof, constructs thereof, peptides, polypeptides, proteins, and fragments and constructs thereof can be produced in either prokaryotic or eukaryotic expression systems. Methods for producing antibodies and fragments in prokaryotic and eulcaryotic systems are well-known in the art.
[319.] A eukaryotic cell system, as defined in the present invention and as discussed, refers to an expression system for producing peptides or polypeptides by genetic engineering methods, wherein the host cell is a eukaryote. A
eukaryotic expression system may be a mammalian system, and the peptide or polypeptide produced in the mammalian expression system, after purification, is preferably substantially free of mammalian contaminants. Other examples of a useful eukaryotic expression system include yeast expression systems.
[320.] A preferred prokaryotic system for production of the peptide or polypeptide of the invention uses E. coli as the host for the expression vector. The peptide or polypeptide produced in the E. coli system, after purification, is substantially free of E. coli contaminating proteins. Use of a prokaryotic expression system may result in the addition of a methionine residue to the N-terminus of some or all of the sequences provided for in the present invention. Removal of the N-terminal methionine residue after peptide or polypeptide production to allow for full expression of the peptide or polypeptide can be performed as is known in the art, one example being with the use of Ae~omoraas aminopeptidase under suitable conditions (U.S. Patent No.
5,763,215).
Types of Antibody Fragments and Constructs [321.] The present invention provides for a peptide or polypeptide comprising an antibody or antigen binding fragment thereof, a construct thereof, or a construct of a fragment. Antibodies according to the present invention include IgG, IgA, IgD, IgE, or IgM antibodies. The IgG class encompasses several sub-classes including IgGI, IgG2, IgG3, and IgG4.
[322.] Antibody fragments according to the present invention include Fv, scFv, dsFv, Fab, Fab2, and Fd molecules. Smaller antibody fragments, such as fragments of Fv's, are also included in the term "fragments", as long as they retain the binding characteristics of the original antibody or larger fragment. Examples of such fragments would be (1) a minibody, which comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which comprises a small fractional unit of antibody heavy chain variable region (PCT Application No. PCT/IL99/00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a light chain variable region. Constructs include, for example, multimers such as diabodies, triabodies, and tetrabodies. The phrases "antibody, binding fragment thereof, or complex comprising an antibody or binding fragment thereof' and "antibody or fragment" are intended to encompass all of these molecules, as well as derivatives and homologs, mimetics, and variants thereof, unless it is specified otherwise or indicated otherwise based on context and/ or knowledge in the art.
[323.] Once an antibody, fragment, or construct having desired binding capabilities has been selected and/ or developed, it is well within the ability of one skilled in the art using the guidance provided herein to produce constructs and fragments which retain the characteristics of the original antibody. For example, entire antibody molecules, Fv fragments, Fab fragments, Fab2 fragments, dimers, trimers, and other constructs can be made which retain the desired characteristics of the originally selected or developed antibody, fragment, or construct.
[324.] If it is desired to substitute amino acids but still retain the characteristics of an antibody or fragment, it is well within the skill in the art to make conservative amino acid substitutions. Modifications such as conjugating to pharmaceutical or diagnostic agents, may also be made to antibodies or fragments without altering their binding characteristics. Other modifications, such as those made to produce more stable antibodies or fragments may also be made to antibodies or fragments without altering their specificity. For example, peptoid modification, semipeptoid modification, cyclic peptide modification, N terminus modification, C terminus modification, peptide bond modification, backbone modification, and residue modification may be performed. It is also within the ability of the skilled worker following the guidance of the present specification to test the modified antibodies or fragments to assess whether their binding characteristics have been changed.
[325.] Likewise, it is within the ability of the skilled worker using the guidance provided herein to alter the binding characteristics of an antibody, fragment, or construct to obtain a molecule with more desirable characteristics. For example, once an antibody having a desirable properties is identified, random or directed mutagenesis may be used to generate variants of the antibody, and those variants may be screened for desirable characteristics.

[326.] Antibodies and fragments according to the present invention may also have a tag may be inserted or attached thereto to aid in the preparation and identification thereof, and in diagnostics. The tag can later be removed from the molecule.
Examples of useful tags include: AU1, AUS, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S-Tag~, T7, V5, and VSV-G (Jarvik and Telmer, A~zn.
Rev. Gen., 32, 601-618 (1998)). The tag is preferably c-myc.
Multimeric Antibodies [327.] The present invention provides for a Yl or Y17 peptide or polypeptide comprising an scFv molecule. As used herein a scFv is defined as a molecule which is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linked, fused or covalently attached to, or associated with, the variable region of the light chain.
[328.] A Y1 and Y17 scFv construct may be a multimer (e.g., dimes, trimer, tetramer, and the like) of scFv molecules that incorporate one or more of the hypervariable domains of the Yl or Y17 antibody. All scFv derived constructs and fragments retain enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells. The binding selectivity and/or specificity is primarily determined by hypervariable regions.
[329.] The hypervariable loops within the variable domains of the light and heavy chains are termed Complementary Determining Regions (CDR). There are CDRl, and CDR3 regions in each of the heavy and light chains. The most variable of these regions is the CDR3 region of the heavy chain. The CDR3 region is understood to be the most exposed region of the Ig molecule, and as provided herein, is the site primarily responsible for the selective and/or specific binding characteristics observed.

[330.] The Yl and Yl7 peptide of the subject invention can be constructed to fold into multivalent Fv forms. Y1 and Y17 multimeric forms were constructed to improve binding affinity and specificity and increased half life in blood.
[331.] Mulitvalent forms of scFv have been produced by others. One approach has been to link two scFvs with linkers. Another approach involves using disulfide bonds between two scFvs for the linkage. The simplest approach to production of dimeric or trimeric Fv was reported by Holliger et al., PNAS, 90, 6444-6448 (1993) and A.
I~ortt, et al., Protein Eng., 10, 423-433 (1997). One such method was designed to make dimers of scFvs by adding a sequence of the FOS and JITN protein region to form a leucine zipper between them at the c-terminus of the scFv. I~ostelny SA et al., Jlmmunol.
1992 Mar 1;148(5):1547-53; De Kruif J et al., JBiol Chem. 1996 Mar 29;271(13):7630-4.
Another method was designed to make tetramers by adding a streptavidin coding sequence at the c-terminus of the scFv. Streptavidin is composed of 4 subunits so when the scFv-streptavidin is folded, 4 subunits accommodate themselves to form a tetramer.
Kipriyanov SM et al., Hurry Antibodies Hybridonaas, 1995;6(3):93-101. In yet another method, to make dimers, trimers and tetramers, a free cysteine is introduced in the protein of interest. A peptide-based cross linker with variable numbers (2 to 4) of maleimide groups was used to cross link the protein of interest to the free cysteines.
Cochran JR et al., Ir~amunity, 2000 Mar;l2(3):241-50.
[332.] In this system, the phage library (as described herein above) was designed to display scFvs, which can fold into the monovalent form of the Fv region of an antibody. Further, and also discussed herein above, the construct is suitable for bacterial expression. The genetically engineered scFvs comprise heavy chain and light chain variable regions joined by a contiguously encoded 15 amino acid flexible peptide spacer.
The preferred spacer is (Gly4Ser)3. The length of this spacer, along with its amino acid constituents provides for a nonbulky spacer, which allows the VH and the VL
regions to fold into a functional Fv domain that provides effective binding to its target.
[333.] The present invention is directed to Yl and Y17 multimers prepared by any known method in the art. A preferred method of forming multimers, and especially dimers, employs the use of cysteine residues to form disulfide bonds between two monomers. In this embodiment, dimers are formed by adding a cysteine on the carboxyl terminus of the scFvs (referred to as Y1-cys scFv or Yl dimer) in order to facilitate dimer formation. After the DNA construct was made (See Example 2D and 6D) and used for transfection, Yl dimers were expressed in a production vector and refolded in vitro. The protein was analyzed by SDS-PAGE, HPLC, and FACS. However, none of these first attempts indicated that a dimer formed. Thus, the process was repeated and this time, two-liter fermentation batches of the antibodies were run. After expressing Yl-cys in E.
coli strain BL21, refolding was done in arginine. Following refolding, the protein was dialyzed and purified by Q-sepharose and gel filtration (sephadex 75). Two peaks were detected by SDS-PAGE (non-reduced) and by gel filtration. The peaks were collected separately and analyzed by FACS. Monomer and dimer binding to Jurkat cells was checked by FACS. The binding by dimers required only 1/100 the amount of the monomeric antibody for the same level of staining, indicating that the dimer has greater avidity. Conditions for dimer refolding were determined, and material comprising >90%
dimers (mg quantities) was produced after subsequent dialysis, chromatographic, and gel filtration steps. The purified diner was characterized by gel filtration and by SDS-PAGE
analysis under oxidizing conditions. The diner's binding capacity was confirmed by radioreceptor assay, ELISA, and FAGS analyses.
[334.] To compare the binding of the scFv monomer (also referred to as CONYl) with the Y1 diner, binding competition experiments were done in vitro on KG-1 cells. In addition, these experiments also compared the binding of the full Y1 IgG to the scFv Y1 monomers. To perform this study, a Y1 IgG was labeled with biotin. This study revealed that Y1 IgG competed with IgG Y1-Biotin. Non-relevant human IgG did not compete with the labeled Y1 IgG. Y1 scFvs (Sp.g and 10 ug) partially competed with Y1 IgG-Biotin (SOng). The studies also showed that lng of IgGYl-FITC bound to KG-1 cells (without serum) to the same extent as leg of Y1 scFv-FITC, but in the presence of serum, most of this binding was blocked. These studies also showed that the binding of the Y1 diner is at least 20-fold higher than that of the Yl scFv monomer as analyzed by radioreceptor assay, ELISA or FACS.

[335.] In yet another embodiment, a lysine-alanine-lysine was added in addition to the cysteine at the carboxyl end (referred to as Yl-cys-kak scFv). The amino acid sequence of this scFv construct is reproduced below and is also SEQ ID NO:
212.

[336.] The Y1-cys-kak was produced in a ~,-pL vector in bacteria. Expression in the ~,-pL vector was induced by increasing the temperature to 42°C.
Inclusion bodies were obtained from induced cultures and semi-purified by aqueous solutions, to remove unwanted soluble proteins. The inclusion bodies were solubilized in guanidine, reduced by DTE, and refolded ih vitro in a solution based on arginine/ox-glutathione.
After refolding, the protein was dialyzed and concentrated by tangential flow filtration to a buffer containing Urea/phosphate buffer. The protein was repurified and concentrated by ionic-chromatography in an SP-column.
[337.] The dimer was characterized by SDS-page electrophoresis, gel filtration chromatography, ELISA, radioreceptor binding, and FACS. The apparent affinity of the dimer was higher than the monomer due to the avidity effect. This effect was confirmed by ELISA to glycocalicin, FAGS to KG-1 cells, and competition in a radioreceptor assay.
[338.] HPLC was performed to profile the dimer after refolding and purification from a Superdex 75 gel filtration column. In Figure 42, the Y1-cys-kak (dimer) is the first peak on the left 010.8 minutes) and the subsequent peak is the monomer (~12 minutes). The dimer is approximately 52kDa and the monomer 26kDa, according to protein size markers run on the same column. The balance between the dimer and monomer can be changed by varying the conditions of the refolding (concentration of the oxidized agent and the concentration of the protein in the refolding buffer).
The dimer and monomer were separated by chromatography in a superdex 75 column.
[339.] In Figure 43, a gel is shown with a mixed population of dimers and monomers. In the reduced form, the monomers are seen due to the reduction between the two monomers and in the non reduced form, two population are seen (as in the gel filtration experiment) a monomer fraction of about 30kDa and a dimer of about 60kDa.
[340.] An ELISA assay was performed to ascertain the differences in binding between the monomer (the Yl scFv-also known as Y1-kak) and the dimer Yl-cys-kak (the cysteine dimer) for antigen GPIb (glycocalicin) derived from platelets. A
polyclonal anti single chain antibody and/or a novel polyclonal anti-VL (derived from rabbits) and anti-rabbit HRP, were used to detect the binding to GPIb. The dirner was approximately 100 fold more active than the monomer. For instance, to reach 0.8 OD units 12.8~.g/ml of monomer was used compared to only O.l~ag/ml of dimer. See Figure 19.
[341.] In addition, FACS binding analysis to KG-1 cells showed that the dimer is more sensitive than the monomer when a two or three step binding assay was performed.
Dimers directly labeled by FITC showed a slight advantage (use of l Ox fold less material) than the monomer. The radio receptor assay on KG-1 cells, where the dimer was used as competitor, showed that the dimer is 30x fold more efficient than the monomer.
[342.] Varying the length of the spacers is yet another preferred method of forming dimers, trimers, and triamers (often referred to in the art as diabodies, triabodies and tetrabodies, respectively). Dimers are formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally 5-12 amino acid residues. This shortened spacer prevents the two variable chains from the same molecule from folding into a functional Fv domain. Instead, the domains are forced to pair with complimentary domains of another molecule to create two binding domains. In a preferred method, a spacer of only 5 amino acids (Gly4Ser) was used for diabody construction. This dimer can be formed from two identical scFvs, or from two different populations of scFvs and retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/ or show increased binding strength or affinity.
[343.J In a similar fashion, triabodies are formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains from the same molecule from folding into a functional Fv domain. Instead, three separate scFv molecules associate to form a trimer. In a preferred method, triabodies were obtained by removing this flexible spacer completely. The triabody can be formed from three identical scFvs, or from two or three different populations of scFvs and retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/or show increased binding strength or affinity.
[344.J Tetrabodies are similarly formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains from the same molecule from folding into a functional Fv domain. Instead, four separate scFv molecules associate to form a tetramer.
The tetrabody can be formed from four identical scFvs, or from 1-4 individual units from different populations of scFvs and should retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/or show increased binding strength or affinity.
[345.] Whether triabodies or tetrabodies form under conditions where the spacer is generally less than 5 amino acid residues long depends on the amino acid sequence of the particular scFv(s) in the mixture and the reaction conditions.
[346.J In a preferred method, tetramers are formed via a biotin/streptavidin association. A novel fermentation construct that is capable of being enzymatically labeled with biotin (referred to herein as Yl-biotag or Yl-B) was created. A
sequence that is a substrate for the BirA enzyme was added at the Y1 C-terminus. The BirA
enzyme adds a biotin to the lysine residue within the sequence. Yl-biotag was expressed in E. coli. The inclusion body material was isolated and refolded. The purity of the folded protein was >95%, and >100 mg were obtained from a 1-L culture (small-scale, non-optimized conditions). The molecular weight of this form was found to be similar to that of the scFv according to HPLC, SDS-PAGE, and mass spectroscopy. Yl-biotag was found to be the most consistent reagent for FACE analysis. However, when Yl-biotag binding to KG-1 cells was examined in the presence of serum, high concentrations (10-fold more) are required for comparable binding in the absence of serum.
Nevertheless, this construct offered the advantage of specific biotinylation in which the binding site of the molecule remains intact. Further, each molecule is labeled by only one biotin -- each molecule receives one biotin on the carboxyl end.
[347.] Limiting labeling to one biotin/molecule in a desired location enabled production of tetramers with streptavidin. The tetramers were formed by incubating Yl-B with steptavidin-PE.
[348.] FACS analysis~indicated that the tetramers made by Yl-biotag and streptavidin-PE were 100 to 1000 fold more sensitive that Y1 scFv monomers. Y1-biotag tetramers with streptavidin-PE appear to specifically bind to one of the Yl-reactive cell lines (KG-1). The differential of this reaction, from background binding, was very high, and offered high sensitivity to detect low amounts of receptor. FAGS
evaluation of normal whole blood with YlBSAV tetramers indicated that no highly reactive population is present. Monocytes and granulocytes were positive to a small extent. In cell lines where a positive result was present, such as with KG-1 cells, the tetramers were at least 100-fold more reactive.
[349.] Then, the tetramers were incubated with the cell samples. A low dose of the Yl tetramers (5 ng) binds well to the cell line (KG-1) providing a 10 to 20-fold higher response than previously observed with other Y1 antibody forms. A minor reaction was observed when a negative cell line was examined with varying doses of the tetramers.
Conlu~ates for Diagnostic and Pharmaceutical Use [350.] The antibodies and binding fragments thereof of the subject invention can be associated with, combined, fused or linked to various pharmaceutical agents, such as drugs, toxins, and radioactive isotopes with, optionally, a pharmaceutically effective carrier, to form drug-peptide compositions, fusions or conjugates having anti-disease and/or anti-cancer activity. Such conjugates and fusions may also be used for diagnostic purposes.
[351.] Examples of carriers useful in the invention include dextran, HPMA (a lipophilic polymer) or any other polymer. Alternatively, decorated liposomes can be used, such as liposomes decorated with scFv Yl molecules, such as Doxil, a commercially available liposome containing large amounts of doxorubicin. Such liposomes can be prepared to contain one or more desired pharmaceutical agents and be admixed with the antibodies of the present invention to provide a high drug to antibody ratio..
[352.] Alteniatively, the link between the antibody or fragment thereof and the pharmaceutical agent may be a direct link. A direct link between two or more neighboring molecules may be produced via a chemical bond between elements or groups of elements in the molecules. The chemical bond can be for example, an ionic bond, a covalent bond, a hydrophobic bond, a hydrophilic bond, an electrostatic bond or a hydrogen bond. The bonds can be, for example, amine, carboxy, amide, hydroxyl, peptide and/ or disulfide bonds. The direct link may preferably be a protease resistant bond.
[353.] The link between the peptide and the pharmaceutical agent or between the peptide and carrier, or between the carrier and pharmaceutical agent may be via a linker compound. As used herein in the specification and in the claims, a linker compound is defined as a compound that joins two or more moieties together. The linker can be straight-chained or branched. A branched linker compound may be composed of a double-branch, triple branch, or quadruple or more branched compound. Linker compounds useful in the present invention include those selected from the group comprising dicarboxylic acids, malemido hydrazides, PDPH, carboxylic acid hydrazides, and small peptides.
[354.] More specific examples of linker compounds useful according to the present invention, include:

a. Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid;
b. Maleimido hydrazides such as N-[ -maleimidocaproic acid] hydrazide, 4-[N-maleimidomethyl]cyclohexan-1-carboxylhydrazide, and N-[ -maleimidoundcanoic acid]
hydrazide;
c. PDPH linkers such as (3-[2-pyridyldithio]propionyl hydrazide) conjugated to sulfurhydryl reactive protein; and d. Carboxylic acid hydrazides selected from 2-5 carbon atoms.
[355.] Linking via direct coupling using small peptide linkers is also useful.
For example, direct coupling between the free sugar of, for example, the anti-cancer drug doxorubicin and a scFv may be accomplished using small peptides. Examples of small peptides include AU1, AUS, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S- Tag°, T7, V5, and VSV-G.
[356.] Antibodies, and fragments thereof, of the present invention may be bound to, conjugated to, complexed with or otherwise associated with imaging agents (also called indicative markers), such as radioisotopes, and these conjugates can be used for diagnostic and imaging purposes. Kits comprising such radioisotope-antibody (or fragment) conjugates are provided.
[357.] Examples of radioisotopes useful for diagnostics include mindium, u3indium, 9~"'rhenium, losrhenium, loirhenium, 9~"'technetium, 121mtellurium, iaamtellurium, 12s"'telluriunm l~sthulium, 167thulium lssthulimn lasiodine, la6iodine, isliodine, ls3iodine, 8lmkrypton, 33xenon, 9°yttrium, Zlsbismuth, 77bromine, ~8fluorine, 95ruthenium o7ruthenium losmthenium losruthenium 1°7merc Zos 67 ury, mercury, gallium and 68gallium. Preferred radioactive isotopes, are opaque to X-rays or paramagnetic ions.
[35~.] The indicative marker molecule may also be a fluorescent marker molecule. Examples of fluorescent marker molecules include fluorescein, phycoerythrin, or rhodamine, or modifications or conjugates thereof.

[359.] Antibodies or fragments conjugated to indicative markers may be used to diagnose or monitor disease states. Such monitoring may be carried out in vivo, ira vitf-o, or ex vivo. Where the moutoring or diagnosis is carried out ifa vivo or ex vivo, the imaging agent is preferably physiologically acceptable in that it does not harm the patient to an unacceptable level. Acceptable levels of harm may be determined by clinicians using such criteria as the severity of the disease and the availability of other options.
[360.] The present invention provides for a diagnostic kit for ih vitro analysis of treatment efficacy before, during, or after treatment, comprising an imaging agent comprising a peptide of the invention linked to an indicative marker molecule, or imaging agent. The invention further provides for a method of using the imaging agent for diagnostic localization and imaging of a cancer, more specifically a tumor, comprising the following steps:
a) contacting the cells with the composition, b) measuring the radioactivity bound to the cells, and hence c) visualizing the tumor.
[361.] Examples of suitable imaging agents include fluorescent dyes, such as FITC, PE, and the like, and fluorescent proteins, such as green fluorescent proteins.
Other examples include radioactive molecules and enzymes that react with a substrate to produce a recognizable change, such as a color change.
[362.] In one example, the imaging agent of the kit is a fluorescent dye, such as FITC, and the kit provides for analysis of treatment efficacy of cancers, more specifically blood-related cancers, e.g., leukemia, lymphoma and myeloma. FAGS analysis is used to determine the percentage of cells stained by the imaging agent and the intensity of staining at each stage of the disease, e.g., upon diagnosis, during treatment, during remission and during relapse.
[363.] Antibodies, and fragments thereof, of the present invention may be bound to, conjugated to, or otherwise associated with anti-cancer agents, anti-leukemic agents, anti-viral agents, anti-metastatic agents, anti-inflammatory agents, anti-thrombosis agents, anti-xestenosis agents, anti-aggregation agents, anti-autoimmune agents, anti-adhesion agents, anti-cardiovascular disease agents, or other anti-disease agents or pharmaceutical agent. A pharmaceutical agent refers to an agent that is useful in the prophylactic treatment or diagnosis of a mammal including, but not restricted to, a human, bovine, equine, porcine, murine, canine, feline, or any other warm-blooded animal.
[364.] Examples of such pharmaceutical agents include, but are not limited to anti-viral agents including acyclovir, ganciclovir and zidovudine; anti-thrombosis/restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti-adhesion/anti-aggregation agents including limaprost, clorcromene, and hyaluronic acid.
[365.] Other exemplary pharmaceutical agents include doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof [366.] An anti-cancer agent is an agent with anti-cancer activity. For example, anti-cancer agents include agents that inhibit or halt the growth of cancerous or immature pre-cancerous cells, agents that kill cancerous or pre-cancerous, agents that increase the susceptibility of cancerous or pre-cancerous cells to other anti-cancer agents, and agents that inhibit metastasis of cancerous cells. In the present invention, an anti-cancer agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
[367.] Inhibition of growth of a cancer cell includes, for example, the (i) prevention of cancerous or metastatic growth, (ii) slowing down of the cancerous or metastatic growth, (iii) the total prevention of the growth process of the cancer cell or the metastatic process, while leaving the cell intact and alive, or (iv) killing the cancer cell.
[368.] An anti-leukemia agent is an agent with anti-leukemia activity. For example, anti-leukemia agents include agents that inhibit or halt the growth of leukemic or immature pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents that increase the susceptibility of leukemic or pre-leukemic cells to other anti-leukemia agents, and agents that inhibit metastasis of leukemic cells. In the present invention, an anti-leukemia agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
[369.] Inhibition of growth of a leukemia cell includes, for example, the (i) prevention of leukemic or metastatic growth, (ii) slowing down of the leukemic or metastatic growth, (iii) the total prevention of the growth process of the leukemia cell or the metastatic process, while leaving the cell intact and alive, or (iv) killing the leukemia cell.
[370.] Examples of anti-disease, anti-cancer, and anti-leukemic agents to which antibodies and fragments of the present invention may usefully be linked include toxins, radioisotopes, and pharmaceuticals.
[371.] Examples of toxins include gelonin, Pseudo~rzonas exotoxin (PE), PE40, PE38, diphtheria toxin, ricin, or modifications or derivatives thereof.
[372.] Examples of radioisotopes include gamma-emitters, positron-emitters, and x-ray emitters that may be used for localization and/or therapy, and beta-emitters and alpha-emitters that may be used for therapy.
[373.] More specific examples of therapeutic radioisotopes include 1 i lindium, n3indium, ~9'T'rhenium, losrhenium, loirhenium, 99°'technetium, lzimtellurium, izzmtellurium, lzsT"telluriunm l~5thulium, 167thulium 168thulium iz3iodine, Iz~iodine, i3liodine,133iodine, $Imkrypton, 33xenon, 9°yttrium, zl3bismuth, "bromine, lgfluorine, 9sruthenium, 97ruthenium, lo3ruthenium, losmthenium, 1°7mercury, zo3mercury, 67gallium and ~8gallium.

[374.] Non-limiting examples of anti-cancer or anti-leukemia pharmaceutical agents include doxorubicin, adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives thereof, an combinations thereof.
Pharmaceutical Compositions [375.] Antibodies, constructs, conjugates, and fragments of the subject invention may be administered to patients in need thereof via any suitable method. Exemplary methods include intravenous, intramuscular, subcutaneous, topical, intratracheal, intrathecal, intraperitoneal, intralymphatic, nasal, sublingual, oral, rectal, vaginal, respiratory, buccal, intradermal, transdermal or intrapleural administration.
[376.] For intravenous administration, the formulation preferably will be prepared so that the amount administered to the patient will be an effective amount from about 0.1 mg to about 1000mg of the desired composition. More preferably, the amount administered will be in the range of about ling to about SOOmg of the desired composition. The compositions of the invention are effective over a wide dosage range, and depend on factors such as the particulars of the disease to be treated, the half life of the peptide or polypeptide-based pharmaceutical composition in the body of the patient, physical and chemical characteristics of the pharmaceutical agent and of the pharmaceutical composition, mode of administration of the pharmaceutical composition, particulars of the patient to be treated or diagnosed, as well as other parameters deemed important by the treating physician.
[377.] Pharmaceutical composition for oral administration may be in any suitable form.
Examples include tablets, liquids, emulsions, suspensions, syrups, pills, caplets, and capsules. Methods of making pharmaceutical compositions are well known in the art.
See, e.g., Remington, The Science and Practice of Pharmacy, Alfonso R. Gennaro (Ed.) Lippincott, Williams & Wilkins (pub).

[378.] The pharmaceutical composition may also be formulated so as to facilitate timed, sustained, pulsed, or continuous release. The pharmaceutical composition may also be administered in a device, such as a timed, sustained, pulsed, or continuous release device.
[379.] The pharmaceutical composition for topical administration can be in any suitable form, such as creams, ointments, lotions, patches, solutions, suspensions, and gels.
[380.] Compositions comprising antibodies, constructs, conjugates, and fragments of the subject invention may comprise conventional pharmaceutically acceptable diluents, excipients, Garners, and the like. Tablets, pills, caplets and capsules may include conventional excipients such as lactose, starch and magnesium stearate.
Suppositories may include excipients such as waxes and glycerol. Injectable solutions comprise sterile pyrogen-free media such as saline, and may include buffering agents, stabilizing agents or preservatives. Conventional enteric coatings may also be used.
EXAMPLES
[381.] The following examples axe set forth to aid in understanding the invention but are not intended and should not be construed, to limit its scope in any way. Although specific reagents and reaction conditions are described, modifications can be made that are meant to be encompassed by the scope of the invention. The following examples, therefore, are provided to further illustrate the invention.
Examule 1 : Preparation of Platelets 1.1 Preparation of washed platelets.
[382.] Platelet concentrate in acid-citrate-dextrose (ACD) was obtained from a blood banlc, platelets were isolated, washed once in buffer containing ACD and saline in a ratio of 1:7. The platelets were centrifuged at 800 g for 10 min after each wash and were resuspended in Tyrodes solution (2 mM MgCl2, 137 mM NaCI, 2.68 mM I~C1, 3 mM
NaH2P04, 0.1 % glucose, 5 mM Hepes and 0.35 % albumin, pH 7.35) and count the number of cells.

1.2 Preparation of~latelet-rich 1p asma [383.] Blood was collected into a tube containng 3.8 % sodium citrate.
Platelet-rich plasma was prepared by centrifugation at 250 x g for 10 minutes.
Example 2: Platelet aggregation [384.] For platelet aggregation studies, platelet rich plasma (PRP) and washed platelets were stirred at 500 rpm at 37°C in whole blood Lumiaggregometer (Chronolog, Havertown,PA). The difference in light transmission through the platelet suspension and suspending medium was taken as 100% aggregation. The effect of Yl on platelet aggregation was evaluated by addition of different concentration of Y1 before the addition of agonist, and the effect was recorded for four minutes.
Example 3: Treatment of Platelets with Endonroteases 3.1 Cleava a of platelets by Mocarha~in [385.] For mocarhagin digestion, lOg washed platelets in TS buffer ( 0.01 M
Tris, 0.15 M sodium chloride, pH 7.4) containing 1 mM calcium chloride were treated with 12 ~.g/ml mocarhagin (final concentration) for 1 hour at 22°C and digestion was stopped by adding EDTA to 0.01 M.
3.2 Cleava eg- Of ~lycocalicin by Cathepsin G
[386.] 108 washed platelets in TS buffer containing 1 mM calcium chloride was incubated with 1.8 ug/ml cathepsin G (final concentration) for 4 hours at 22°C and digestion was stopped by adding PMSF to 1 mM.
3.3 Cleava eg of ~lycocalicin by O-Sialo~~coprotein endo~rotease [387.] 106 platelets in 0.1 M Tris buffer pH 7.4 containing 0.2 % albumin and protease inhibitors (10 ~.M leupeptin, 0.24 mM PMSF) was incubated with 0.14 mg/ml O-Sialoglycoprotein endoprotease (final concentration) for 45 min at 37°C and digestion was stopped by adding sample buffer and boiling. The sample buffer used contained 3%
loo SDS, 12% glycerol, SOmM TrisHCl, 2% (3-mercaptoethanol, and 0.03% bromphenol blue.
Example 4: Cleavage of Glycocalicin by Endoproteases Cleavage of ,glycocalicin by Mocarha~in [388.] For mocarhagin digestion, glycocalicin in TS buffer containing 1 mM
calcium chloride was incubated with 10 ~ g/ml mocarhagin (final concentration) for 1 hour at 22 ° C and digestion was stopped by adding EDTA to 0.01 M.
Cleavage of ~lycocalicin by Cathepsin G
[389.] For cathepsin G digestion, glycocalicin in TS buffer containing 1 mM
calcium chloride was incubated with 3.4 ug/ml cathepsin G (final concentration) for 4 hour at 22 ° C and digestion was stopped by adding PMSF to 1 mM.
Cleavage of ~lycocalicin by O-Sialo~lycoprotein endoprotease [390.] Glycocalicin in 0.05 M Tris buffer pH 7.4 was incubated with 1.2 mg/ml O-Sialoglycoprotein endoprotease (final concentration) for 15 min at 37°C and digestion was stopped by adding sample buffer (as described in Example 3(YH) and boiling.
Example 5: Construction of Full Sized Yl I~G
[391.] Whole IgG molecules have several advantages over the Fv forms, including a longer half life ih vivo and the potential for inducing an in-vivo cellular response, such as those mediated by ADCC or CDC (complement dependent cytotoxicity;
Tomlinson, CuYref~t Opifzions oflnamunology, 5, 83-89(1993)). By a molecular cloning approach that is described below, we have converted the Y1 Fv regions into full sized IgGl molecules. Yl-IgGl construction was accomplished by joining fragments of cDNA
to each other in the following order: The sequence of the Yl-IgG heavy and light chains are presented in FIG. 48. The open reading frame (ORF) of the nucleotide sequence of .
Y1-HC (SEQ ID NO: 205), the amino acid sequence of Y1-HC (SEQ ID NO: 206), the ORF of the nucleotide sequence of Yl-LC (SEQ m NO: 207), and the amino acid sequence of Y1-LC (SEQ ID NO: 208) are presented.
[392.] A leader sequence compatible for a mammalian expression system: An exchangeable system was designed to allow convenient insertion of elements required for a full IgG molecule. The following complimentary double stranded oligonucleotides encoding a putative leader sequence were synthesized, annealed, and ligated into the XlaoI
site of the pBJ-2 mammalian expression vector (under the SRaS promoter).
5'-TCGACCTCATCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCA
GGACACAGGGTCCTGGGCCGAT
and 5'-GATCGATTGCACCAGCTGGATATCGGCCCAGGACCCTGTGTCCTGAGTGAG
GAGGGTGAGGAGCAGCAGAGCCCAGGCCATGGTGATGAGG. Upstream of the initiation ATG codon, two Kozal~ elements were included. In addition, an internal EcoRV site was introduced between the putative cleavage site of the leader sequence and the XlaoI site to allow subcloning of the variable regions. This modified vector was designated pBJ-3.
[393.] The VL encoding sequence derived from the Y1 scFv cDNA sequence was inserted between the leader and the constant light region-encoding sequence.
Similarly, the VH encoding sequence derived fiom the Y1 scFv cDNA sequence was inserted between the leader and the constant heavy region-encoding sequence This was accomplished by PCR amplification of the vector pHEN-Y1, encoding for the original Y1, to obtain the VL and the VH regions, individually.
The oligonucleotides [394.] 5'-TTTGATATCCAGCTGGTGGAGTCTGGGGGA (sense) and 5'-GCTGACCTAGGACGGTCAGCTTGGT (anti-sense) were used for the VL PCR
reaction. The cDNA product of the expected size of 350 by was purified, sequenced and digested with EcoRV and Av~II restriction enzymes. The same procedure was employed to amplify and purify the VH cDNA region, using the sense and the anti-sense oligonucleotides [395.] 5'-GGGATATCCAGCTG(C/G)(A/T)GGAGTCGGGC
and 5'-GGACTCGAGACGGTGACCAGGGTACCTTG, respectively.
[396.] Constant regions: The constant ~.3 (CL-7~3) region and the constant heavy regions CH1-CH3 derived for IgGl cDNA were individually synthesized as follows:
[397.] For the constant CL-~,3 region, RT-PCR was performed on mRNA
extracted from a pool of normal peripheral B-cells (CD19+ cells) in combination with the sense 5'- CCGTCCTAGGTCAGCCCAAGGCTGC and the anti-sense 5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT oligonucleotides. The PCR product of the expected size 0400 bp) was purified, sequenced, and digested with AvrII and NotI restriction enzymes.
[398.] For the constant IgGl regions (y chain), a human B cell clone (CMV -clone #40), immortalized at BTG, was selected for PCR amplification. This clone was shown to secrete IgGl against human CMV and was also shown to induce ADCC
response in in-vity-o assays. For the CH1-CH3 cDNA, oligonucleotides 5'-ACCGCTCGAGTGC(T/C)TCCACCAAGGGCCCATC(G/C)GTCTTC (sense) and 5'-TTTGCGGCCGCTCATTTACCC(A/G)GAGACAGGGAGAGGCT (anti-sense) were synthesized and used for PCR amplification. As described for the CL cDNA
encoding sequence, the PCR product of expected size (1500 bp) was purified, sequenced, and digested with AvYII and NotI restriction enzymes.

[399.] For the final expression vectors, a triple ligation procedure was carried out using the EcoRV-NotI pre-digested pBJ-3 vector, EcoRV AvrII variable cDNAs and AvrII-NotI constant regions. The final vectors for heavy chain and light chain expression were designated pBJ-Yl-HC and pBJ-Yl-LC, respectively.
[400.] An additional vector, pBJ-Yl-LP, was constructed based on the pBJ-Y1 LC to allow double selection based on the puromycin resistant gene (PAC). In this vector the neomycin-resistant gene of the pBJ-Yl-LC plasmid was replaced with a fragment of ~1600bp encoding for the PAC gene (from the pMCC-ZP vector).
[401.] The open reading frame (ORF) of both the Y1-HC and Y1-LC and their encoded amino acid sequences axe presented as SEQ IDNOS. 205-208.
[402.] The leader sequence is underlined. The VH and VL regions are each encoded by amino acid sequences that are bolded, followed by either the IgGl (for the heavy chain) or the ~,3 (for the light chain) constant region sequences.
[403.] Expression of Yl heavy and light chain in CHO cells.
Vectors pBJ-Y1-HC and pBJ-Yl-LC were used individually for the transfection and selection of stable cells expressing the heavy or light chains. Following selection on 6418 and cell growth, the secreted protein in the supernatant was analyzed for IgGl expression by the capture EIA assay and by Western blot analysis, as described below:
[404.] Capture EIA assay: The wells of 96 well-plates were pre-coated with mouse anti-human IgGl Fc (Sigma). The supernatant from above was added to the wells, and the presence of heavy chain IgGl was detected with biotinylated goat anti-y chain specific antibody (Sigma), streptavidin-HRP and substrate. An ELISA plate reader monitored development of the color at A4os.
[405.] Western blot analysis: The supernatant for the above cells was run on 12.5% SDS-PAGE. Expression of each chain was detected with (a) goat anti-human IgG-HRP (H+L; Sigma Cat #A8667) for heavy chain detection end (b) biotinylated goat ' 104 anti-human ~,3 chain (Southern Biotechnology Association, Cat #2070-08) for light chain detection.
[406.] Expression of both chains was confirmed by the above assays, and co-transfection was carried out to obtain full size Y1-IgGl.
Expression and Purification of IgG-Yl [407.] Cell Culture and Transfection: CHO cells were cultivated in F-12 medium with 10% fetal calf serum and 40p.g/ml gentamicin at 37°C in 5%
COZ
atmosphere. One day before transfection 0.8-1x106 cells were seeded on 90mm dishes.
The cultures were co-transfected with 10~,g of light and heavy chains DNA by the FuGene (Roche) transfection reagent technique. After 2 days of growth in nonselective medium, the cells were cultured for 10-12 days in F-12 medium containing SSO~,g/ml neomycin and 3 ~,g/ml puromycin. The cells were trypsinized and cloned by limiting dilution of 0.5 cell/well in Costar 96-well plates. Individual colonies were picked, grown in six-well dishes and transferred to flaslcs.
[408.] Determination of heavy and light chain secretion: A sandwich ELISA
assay was used to determine the concentration of the antibody secreted into the supernatant of transfected CHO cells.111 order to determine the concentration of the antibody, the following reagents were used: monoclonal anti human IgGl(Fc) (Sigma) as the coated antibody, goat anti-human IgG (y-chain specific) biotin conjugate as the detector (Sigma), and pure human IgGl, lambda (Sigma) as standard. Based on this ELISA assay the production rate varied between 3-4~g/ml.
[409.] Production and Purification of MAb from the cells: Cells were grown in roller bottles to a final concentration of 1-2x108 cells per bottle in F-12 medium with 10% fetal calf serum, supplemented with neomycin and puromycin. For the production, cells were cultured in the same medium, but with 2% of fetal calf serum for an additional two days.

[410.] The secreted antibody was purified on a protein G-Sepharose column (Pharmacia). Binding was in 20mM sodium phosphate buffer, pH 7.0; elution was performed in O.1M glycine buffer, pH 2.5-3Ø The quantity of the purified antibody was determined by UV absorbance; purity was analyzed by SDS-PAGE. Under non-denaturing conditions the full IgG antibody has its expected molecular weight of 160kD.
In denaturing gels both heavy and light chains have the expected molecular size of 55 and 28 kD, respectively.
[411.] Binding of full size IgG-Yl molecule: Binding experiments were performed to determine the level of binding of the IgG-Y1 molecule compared to the binding level of the scFv-Y1 molecule. A two-step staining procedure was employed, wherein 5 ng of IgG-Yl were reacted with both RAJI cells (negative control, Figure 44) and Jurkat cells (Y1 positive cells, Figure 44). For detection, PE-labeled goat anti-human IgG was used. Similarly, 1 ~.g ~of scFv-Yl was reacted with Jurkat cells (Figure 44), and PE-labeled rabbit anti-scFv was used for detection. Results indicate that both IgG-Yl and scFv-Y1 bind to Jurkat cells, with approximately 103-fold more scFv-Yl molecules needed to obtain a level of detection similar to that of the IgG-Yl .
Example 6: Preparation of Fab and F(ab')2 fragments derived from the full I~G
Yl antibody.
Cell Culture and Transient Transfection:
[412.] CHO~ cells were cultivated in F-12 medium supplemented with 10% fetal calf serum and 40 ug/ml gentamicin at 37°C in 5% C02 atmosphere. One day before transfection 1-1.5-1x106 cells were seeded on 90mm dishes. The cultures were co-transfected with 10 ~.g of DNA encoding the variable light and variable heavy chains of the Y1 antibody, each in a separate eukaryotic expression system. Transfection was carried out with the FuGene (Roche) transfection reagent technique.
[413.] After 2 days of growth in nonselective growth media, the cells were cultured for 10-12 days in F-12 medium containing 550 ~.g/ml neomycin and 3 ~g/ml puromycin. The cells were trypsinized and cloned by limiting dilution of 0.5 cell/well in Costar 96-well plastic plates. Individual colonies were picked, grown in six-well dishes and transferred to flasks for further selection (to determine level of expression and antibody secretion to the growth media).
Cell Culture and Long-Term Transfection:
[414.] CHO- cells were cultivated in F-12 medium supplemented with 10% fetal calf serum and 40 ~.g/ml gentamicin at 37°C in 5% COZ atmosphere. One day before transfection 0.8-1x106 cells were seeded on 90mm dishes. The cultures were transfected with 10 ~g of DNA encoding the variable light and variable heavy chains of the Yl antibody cloned under the CMV (cytomegalovirus) promoter and the dhfr gene under the sv-40 promoter. Transfection was carned out using the FuGene (Roche) transfection reagent technique. After 2 days of growth in nonselective growth media, the cells were cultured in a media containing 100nM-S~M methotrexate (MTX) and dialyzed fetal calf serum in order to select for clones (after limiting dilution) that express increased levels of the full Y1 antibody.
Determination of heavy and light chains secretion:
[415.] A sandwich ELISA assay was established to determine the concentration of the antibody that is being secreted into the supernatant of transfected CHO
cells. In order, to quantitate the concentration of the antibody, the following reagents were used: a monoclonal anti human IgG1(Fc) (Sigma) as the coated antibody, a goat anti human IgG(~y-chain specific) biotin conjugate as the detector (Sigma) and a purified human IgGl, lambda (Sigma) as standard.
Production and Purification of Mab from the cells:
[416.] Cells were grown in roller bottles to a final concentration of 1-2x10$
cells per bottle in F-12 medium supplemented with 10% fetal calf serum, neomycin and puromycin (as indicated above). For antibody production, cells were cultured in the same medium, but with 2% of fetal calf serum for additional two days.
l07 [417.] The secreted antibody was purified on a protein G sepharose column (Pharmacia) and ion exchange column-Q sepharose (Pharmacia). Binding was in 20mM
sodium phosphate buffer pH 7.0, while elution was in O.1M glycine buffer pH
2.5-3Ø
The quantity of the purified antibody was determined by UV absorbance and ELISA, while its purity was analyzed by SDS-PAGE and HPLC. Under non-denaturing conditions the full IgG antibody has its expected molecular weight of 160kD.
In denaturing gels both heavy and light chains have the expected molecular size of 55 and 28 kD respectively.
Fragmentation of Yl I~G into Fab and F(ab')Z:
[418.] The IgG molecule is composed of two identical light chains and two identical heavy chains. These chains are held together in folds (domains) by a combination of non-covalent interactions and covalent bonds (disulfide linkages). The light chain consists of one variable domain and one constant domain. The heavy chain consists of a variable domain (VH) and three separate constant domains (CH 1,2 and 3).
The "hinge" region between constant heavy domain one (CH1) and constant heavy domain two (CH2) is readily accessible to proteolytic attack by enzymes.
Cleavage at this point produces Fab or F(ab')2 fragments and the Fc portion. The Fab portion of the molecule retains the antigen binding capability of the molecule, but has low nonspecific binding. The Fab portion is best suited to those situations where the antigen binding capabilities without effector functions are desired.
[419.] In vivo Fab and F(ab')a fragments are used as diagnostic and therapeutic agents. To make cancer chemotherapeutic agents tumor-specific instead of damaging to all cells, the agents can be linked to antibodies that bind to cell surface antigens of tumors. Using Fab or F(ab')2 fragments in place of intact IgG offers several advantages:
[420.] (1) The fragments can more easily cross capillaries and diffuse to tissue surfaces.
l08 [421.] (2) Fragments not bound to conjugate will be cleared more rapidly than intact unbound IgG; and, therefore, more of the fragment-therapeutic agent will reach the target area.
[422.] An initial attempt to prepare monovalent and divalent antibody fragments has been done by using immobilized Ficin (Pierce). Ficin cleavage produces F(ab')2 fragments in the presence of 1mM cysteine. Similarly, by increasing the concentration of cysteine activator in the digestion buffer to lOmM, Fab fragments can be created from the original IgG.
[423.] After digestion, the fragments are purified on an immobilized Protein A
column. The F(ab')~ and Fab fragments were concentrated using a microconcentrator with either a 10,000 or 30,000 Dalton molecular weight cutoff. Protein recovery was determined using absorbance at 280 nm. Fragment purity was determined using gel electrophoresis.
Detailed procedure for the preparation of the Fab Fragment:
[424.] 1 mg of purified Yl antibody was applied to a 2 ml column of Immobilized Ficin in Digestion buffer in a concentration of 2 mg/ml of cysteine. HCL
(for the preparation of F(ab')Z fragments) and 20mg/ml (for the preparation of Fab fragments), at 37° C for 5 hours (for Fab) and 20 hours (F(ab')Z).
Reaction was terminated by eluting the digest with 4 ml of Immunopure Binding buffer. Separation of Fab or F(ab')2 fragments from undigested IgG and Fc fragments was done by using Protein A
column with Binding buffer. The Fab or F(ab')2 was contained in the flow through. By reading the absorbarlce at 280nm, the peak fractions containing the fragments were pooled. Fragments were concentrated and dialyzed against PBS by using microconcentrator with 10,000 Dalton molecular weight cutoff. Protein recovery, purity and characterization were determined by using absorbance at 280nm, gel electrophoresis and HPLC.

Cell Extract (Lvsatel Preparation [425.] 2x10 cells were harvested and centrifuged in microcentrifuge (1300 rpm, 4°C, 5 minutes). To wash, 0.5-1 ml PBS+pi was applied to the pellet and mixed gently.
The mixture was centrifuged as before. Washing with 0.5-1 ml PBS+pi was repeated, and the mixture was centrifuged as above. The pelleted cells were resuspended in lysis buffer (200 ul/20x 106 cell pellet). The lysis buffer used was 50 mM Tris pH
7.4, 1 mm PMSF 1 % NP-40, and 1 mM EDTA, although other suitable lysis buffers may be used.
The suspension was incubated for about 60 minutes on ice, then centrifuged (3000 rpm, 4 °C, 5 min). The supernatant was collected and divided into aliquots.
Preparation of a crude membrane fraction and extraction of membrane proteins [426.] Twenty volumes of homogenization buffer was added to one volume of packed cells. The homogenization buffer used was 2% (w/v) Tween 20, 1 rnM
MgS04, 2 mM CaCl2, 150 mM NaCI, and 25 mM Tris-HCI, pH 7.4. The following protease inhibitors were also added: 1mM PMSF, 5 ug/ml Leupeptin, and 5 ~ag/ml Aprotonin. T'he cells were homogenized using three to five strokes in a Potter-Elvehjem homogenizer with a rotating Teflon pestle (Ultra-Torex). The sample was kept cold during homogenization, then stirred for 1 hour in an ice-bath. The sample was subjected to a few additional strokes in the homogenizer, then centrifuged at 3000 g for 30 min at 4 °C. The supernatant was collected and centrifuged at 45000 g (19000 rpm rotor ss-34) for 1 hour at 4 °C. The supernatant from the 45000g centrifugation was discarded.
A solution of 50 mM Tris 7.4, 1mM EDTA, 1% NP-40 and protease inhibitors was added to the pellet, and the dissolved pellet was put it on ice for one hour.
Membrane Fraction Purification on HPLC column [427.] An RPC column (Phannacia Type PLRP-S 300 A) was used for membrane fraction purification. The buffers used were (A) 20mM Tris 8.0 and (B) 60%
propanol in DDW. The flow rate was 1 ml/minute, with the exception of the wash step during which the flow rate was 2 ml/min. The whole procedure was performed at ambient temperature.

[428.] The elution sample after immunoprecipitation (IP) of Jurkat or KG-1 membrane fraction was added with sample buffer (62mM Tris pH 6.8, 10%
Glycerol, 3%SDS, 720mM mercaptoethanol) diluted with buffer A at a ratio of 1:4.
[429.] The sample was loaded on the column, and the flow-through liquid was s collected. The column was washed with buffer A until the optic density of the flow declined to zero.
[430.] The proteins were eluted from the column according to the following program: 5 minutes with 80% A, then 40 minutes gradient of 80-0% of A and 20-100%
B. A second gradient was then applied to bring the composition of the flow to 80% A, and this composition was used to wash the column for 5 more minutes. The elution liquid was collected in a fraction collector, in 1 ml fraction sizes.
[431.] The samples were evaporated to small volumes in a Speed-Vac evaporator, then analyzed using SDS-PAGE (SDS-polyacrylamide gel electrophoresis) and western blotting.
Purification of Normal Human Plasma on O Senharose columns [432.] 5 ml of normal human fresh frozen plasma was diluted 1:10 with start buffer and filtered through a 0.45 ~m syringe filter (Sartorius, cat # 16555).
Start buffer is 20 mM Tris-HCI, pH 8.0 and contains protease inhibitors (5 ~.g/ml leupeptin, 5 Pg/ml aprotinin, and 1mM PMSF).
[433.] A 5 ml HiTrap Q Sepharose column (Amersham Pharmacia, cat #
17-1154-01) was attached to a P-1 peristaltic pump (Amersham Pharmacia). The column was washed according to the commercial protocol at a flow rate of approximately 4 ml/minute. The diluted filtered plasma was loaded on the column, and the flow-through liquid was collected. The column was washed with 20 volumes of 0.3 M NaCI
solution in start buffer. Proteins were eluted at 0.6 M, 0.8 M, and 1.0 M NaCI solutions in start buffer. Elution vohunes were 50, 20 and 20 ml, respectively. The whole procedure was performed at 4 °C.

[434.] - Eluted fractions were subjected to SDS-PAGE analysis in duplicated gels, followed by Western blot analysis using biotinylated Y1 and antibody 181 as a negative control. Fibrinogen 'y prime was found in the 0.6M NaCI elution fraction. The 1.0 M
NaCl elution fraction contained complement compound 4 (CC4), lumican, prothrombin, and inter-alpha-inhibitor.
Purification of Normal Human Plasma on HPLC column [435.] Q Sepharose purified normal human plasma was mixed with Urea (to a final concentration of at least 8M), DTT (to a final concentration of 30 mM) and TFA (to a final concentration of 0.1 %).
[436:] The purified plasma solution was loaded on a 3 ml RPC column (AmersOham Pharmacia), and the flow-through liquid was collected. The column was washed with buffer A until the optic density of the flow declined to zero. The proteins were eluted from the column according to the following program: 5 minutes with 90% A, then 40 minutes gradient of 90-0% of A and 10-100% B. A second gradient was then used to bring the composition of the flow to 90% A, and this composition was used to continue washing the column for 5 more minutes. The buffers used were (A) 0.1%
TFA
in DDW and (B) 80% CAN and 0.1% TFA in DDW. The flow rate was 1 ml/minute, with the exception of the wash step, during which the flow rate was 2 ml/ minute.
[437.] The elution liquid was collected in a fraction collector, in 1 ml fraction sizes. The whole procedure was performed at ambient temperature.
[438.] The samples were evaporated to small volumes in a Speed-Vac evaporator, then analyzed using SDS-PAGE and western blot.
Indirect Immunoblotting with Non-Labeled CD162 Antibod [439.] Samples were run on 10% SDS-PAGE at 140-160 Volts for 3.5 hours at Sigma Z37, 503-9 appliance. The electrophoresed samples were transferred onto a nitrocellulose membrane overnight on 20 Volts in Tris Glycine buffer (20%
MeOH, 192 mM glycine, 25 mM TRIS, pH 8.3) at room temperature. The nitrocellulose membrane was blocked using 5% skim milk in PBS (phosphate buffered saline) for one hour at room temperature. The nitrocellulose membrane was washed 3 times for 5 minutes each with 0.05% Tween 20 in PBS. The membrane was incubated with Super Signal mixture (Pierce) for 5 minutes as directed in the commercial protocol, then excess solution was dried. The membrane was use to expose it to X-ray film (Fuji), and the film was developed.
Western Blot Analysis of Yl Receptor - Processing of the Filter After Blotting [440.] The nitrocellulose membrane was blocked using 5% skim milk for one hour at room temperature. The membrane was then washed 3 times for 5 minutes each with 0.05% Tween 20 in PBS at room temperature. The membrane was incubated with S~.glml Y1-biotin (or 181-biotin) in 2% skim milk in PBS for one hour at room temperature. The membrane was then washed 3 times for 5 minutes each with cold 0.05%
Tween 20 in PBS in the cold room (about 4 to about 10 °C ). The membrane was then incubated in the cold room with a 1:1000 dilution of SAV-HRP (streptavidin-HRP) (at a final concentration of 1 g/ ml) in 2% skim milk, 0.05% Tween. The dilution was carned out at room temperature (about 25 °C), then the diluted SAV-HRP was cooled on ice for 10-15 minutes before use. The incubation was carried out for 1 hour with gentle shalcing.
After the incubation with SAV-HRP, the membrane was washed, as above. The membrane was then incubated with Super Signal mixture (Pierce) for 5 minutes as directed in the commercial protocol, then excess solution was dried. The membrane was use to expose it to X-ray film (Fuji), and the film was developed.
Example 7: Prokaryotic expression of recombinant ~lycocalicin (GC) [441.] The DNA fragment encoding for glycocalicin (GC, amino acid 1 to amino acid 493 of GPIba) was cloned into an IPTG inducible prokaryotic vector cassette. E.
coli (BL21 DE3) cells harboring the newly constructed plasmid were grown at 37°C to O.D. 0.7-0.8, than at 37°C for 3 hours for in the presence of IPTG for induction.
[442.] SDS-polyacrylamide gel loaded either with semi-purified human platelet derived glycocalicin ("GC") or with E. coli cell lysates ("total") derived from induced and non-induced cells were analyzed. Western blot analysis was performed with biotinylated Y1-scFv, polyclonal rabbit anti-human glycocalicin antibody, commercially available mouse anti-human CD42 monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HIPl Pharmigen, AN51 DAKO), and polyclonal antibody against the N-terminus of GPIba (Sc-7071, Santa Cruz).
[443.] The two polyclonal antibodies recognized both the recombinant bacterial derived glycocalicin and the natural human platelet derived glycocalicin. The Y1- scFv and the commercially available antibodies recognized the natural human-derived glycocalicin, but did not recognize the bacterial derived recombinant platelet glycocalicin.
FIG. 45.
[444.] The prokaryotic (e.g., E. coli) system lacks post-translational modification mechanisms, such as mechanisms for glycosylation and sulfation. Thus, the lack of recognition by Yl-scFv of the bacterially produced glycocalicin supports the conclusion that post-translational modification, such as glycosylation and sulfation, is essential for 'Y1-scFv binding to glycocalicin.
FRCS Protocol for Blood/Eone Marrow Samples [445.] Samples provided from hospitals. Patients sample 30~1/tube. Add 5~.1 /tube of CD33-APC (for AML) or CD 19-APC (for B-CLL) or CD38-APC (for Multiple Myeloma). Add 5~,1/tube of CD45-PerCp and 5~,1 of scFv-Y1 or control scFv-N31 or CD162-PE (KPL1). Incubate tubes 30 minutes at 4°C with low shaking.
Wash by adding 2m1 PBS and spin 5 minutes at 1200rpm. Discard supernatant.
[446.] For a one step assay continue with the lysis step:
[447.] Add 500,1 BD Lysine solution diluted 1:10 with ddH20 (300.1 to patient sample). Vortex at high speed and incubate 12 minutes at 4°C. Wash as above. Discard supernatant. And add 500.1 PBS. The samples are read in the FACS using blood sample acquisition setup according to international standards.

[448.] For two or more assays: working buffer is PBS + 1%BSA + 0.05%
sodium azide. Incubations and wash as above.
[449.] Lysis of the red blood cells is the final step in the assay, followed by resuspension with 5001 PBS.
EXAMPLE 8: Construction of Triabodies [450.] The vector pHEN-Y1, encoding the original Y1, was amplified using PCR
for both the VL and the VH regions, individually. The sense oligonucleotide 5'-AACTCGAGTGAGCTGACACAGGACCCT, and the anti-sense oligonucleotide 5'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the VL PCR
reaction. The cDNA product of the expected size of 350 by was purified, sequenced, and digested with XhoI and NotI restriction enzymes.
[451.] The same procedure was employed to amplify the VH region (using the sense oligonucleotide 5'-ATGAAATACCTATTGCCTACGG and anti-sense oligonucleotide 5'-AACTCGAGACGGTGACCAGGGTACC). The VH PCR product was digested with NcoI and XhoI restriction enzymes. A triple ligation procedure into the pHEN vector, pre-digested with NcoI-NotI, was employed. The final vector was designated pTria-Y1.
[452.] Following E. coli transformation, several clones were picked for further analysis, which included DNA sequencing, protein expression, and extraction from the periplasmic space of the bacteria. SDS-PAGE under reducing conditions and Western blot analysis were performed to confirm the size of the Y1 triabodies.
EXAMPLE 9: Construction of Diabodies [453.] The pTria-Y1 vector from above was linearized withXlzoI restriction enzyme, and synthetic complimentary double stranded oligonucleotides (5'-TCGAGAGGTGGAGGCGGT and 5' TCGAACCGCCTCCACCTC) were pre-annealed and ligated into the XhoI site, between the Y1-heavy and Yl-light chains.

This new vector was designated pDia-Yl . As described for the triabodies, the DNA
sequence and protein expression was confirmed.
Example 10: Exuression and Purification of Diabodies and Triabodies [454.] Expression in E-coli was essentially as described for the scFv-Yl .
However, the purification of Yl diabodies and triabodies from the periplasm of the transformed E. coli cells was different. The scFv Y1 monomer form can be purified on an affinity column of Protein-A Sepharose beads. Multimeric forms of Y1 are, however, ineffectually purified by this procedure. Therefore, periplasmic proteins extracted from the bacteria were precipitated over-night with 60% ammonium sulfate, resuspended in H20, and loaded onto a Sephacryl-200 (Pharmacia) size exclusion column pre-equilibrated with O.l.xPBS. Fractions were collected and analyzed by HPLC, and separate fractions containing either the dimer or timer forms were collected for FITC
labeling and FAGS analysis.
EXAMPLE 11: Sindin~ of Yl diabodies and triabodies to cells [455.] FAGS analysis was performed on Jurkat cells using a "three step staining procedure." First, crude extracts or purified unlabeled scFv are stained, then mouse anti-myc antibodies, and finally, FITC- or PE-conjugated anti-mouse antibodies. FACS
analysis requires 5-8x105 cells, which have been Ficoll-purified and resuspended in PBS+1 BSA. Binding was carried out for 1 hour at 4°C. After each step, cells were washed and resuspended in PBS+1 % BSA. After the final staining step, cells were fixed by re-suspending in PBS, 1 % BSA, 2 % formaldehyde, and then read by FACS
(Becton-Dickinson).
[456.] The binding of Y1-scFv was compared to that of diabodies and triabodies.
In this analysis (Figure 44), the binding profile of all three forms was very similar, indicating that the above modifications in the molecule did not alter, conceal or destroy the apparent binding affinity of Y1 to its ligand.

EXAMPLE 12: A Study of the Affinity of the S-S Yl-Dimer in Comparison to CONYl and Yl-I~G. using a Radiorecentor Binding Assav with KG-1 Cells [457.] The assay system involved the use of radioactive ligands that were prepared by iodination with 1~SI using chloramine T on the Yl-IgG construct or the Bolton-Hunter (CONY1) reagent. The assay tubes contained 5x106 KG-1 cells per 0.2 ml and a labeled tracer with varying amounts of unlabeled competitor, in PBS +
0.1 % BSA, pH 7.4. After one hour incubation with agitation at 4 °C, the cells were thoroughly washed with cold buffer and taken for radioactivity counting.
[458.] For the radio receptor binding assay (RR.A), 2 ng/tube of l2sl-Yl-IgG
was used, and competition was performed with each of the three molecules. The results are provided in Figure 46. The results presented in this figure demonstrate that the affinity of the S-S Y1 dimer was twofold lower than most of the full Y1 antibody and 30 times higher than that of CONY 1. A rough estimate of the affinity of the Y1-IgG in this experiment is 2x 10-8 M. The corresponding affinity of the dimer is, therefore, 4 x 10-$
M.
[459.] In a second RRA using labeled CONYl, a 100 ng/tube of l2sl-Yl-IgG was used, and competition was performed with each of the three molecules. The results are provided in Figure 47. This figure shows that the affinity of the S-S dimer was 20 times higher than that of CONY1. A rough estimate of the affinity of CONY 1 in this experiment is 10-6M. The corresponding affinity of the dimer is, therefore, Sx 10-$ M.
EXAMPLE 13: Production of Yl-cys-kak (cysteine dimer) [460.] One liter of 7~pL-yl-cys-kak bacterial culture was induced at 42°C for 2-3 hrs. This culture was centrifuged at 5000 RPM for 30 minutes. The pellet was resuspended in 180 ml of TE (SOmM Tris-HCl pH 7.4, 20mM EDTA). 8 ml of lysozyme (from a 5 mg/ml stock) was added and incubated for 1 hr. 20 ml of SM NaCI and 25 ml of 25% Triton was added and incubated for another hour. This mixture was centrifuged at 13000 RPM for 60 minutes at 4° C. The supernatant was discarded. The pellet was resuspended in TE with the aid of a tissuemiser (or homogenizer). This process was repeated 3-4 times until the inclusion bodies (pellet) were gray/light brown in color. The inclusion bodies were solubilized in 6M Guanidine-HCI, O.1M Tris pH 7.4, 2 mM
EDTA
(1.5 grams of inclusion bodies in 10 ml solubilization buffer provided ~10 mg/ml soluble protein). This was incubated for at least 4 hrs. The protein concentration was measured and brought to a concentration of 10 mg/ml. DTE was added to a final concentration of 65 mM and incubated overnight at room temperature. Re-foldirxg was initiated by dilution of 10 ml of protein (drop by drop) to a solution containing 0.5 M
Arginine, 0.1 M
Tris pH 8, 2 mM EDTA, 0.9 mM GSSG. The re-folding solution was incubated at ~10°
C for 48 hrs. The re-folding solution containing the protein was dialyzed in a buffer containing 25 mM Phosphate buffer pH 6, 100 mM Urea, and concentrated to 500 ml.
The concentrated/dialyzed solution was bound to an SP-sepharose column, and the protein was eluted by a gradient of NaCI (up to 1M).
EXAMPLE 14: ELISA to GC (~lycocalicin) [461:] 100 ml of purified glycocalicin was incubated in a 96 flat well maxisorp plates, overnight at 4 degrees Celsius. The plate was washed with PBST
(PBS+0.05%
tween) 3 times, then 200 ml of PBST-milk (PBST + 2% Non fat milk), for 1 hr at room temperature. The plate was washed with PBST, and the monomer or dimer (100 ml) was added in PBST-milk at different concentrations for 1hr at room temp. Then the plate was washed axzd anti-VL polyclonal (derived from immunized rabbits with VL derived from Y1) (1:100 diluted in PBST-milk) was added for an hour. The plate was washed and anti-rabbit HRP was added for an additional hour. The plate was washed 5 times and 100 ~1 TMB substrate was added for approximately 15 minutes then 100 ~l of 0.5 H2S04 was added to stop the reaction. The optical density of the plate was measured at 450nm in an ELISA reader.
EXAMPLE 15: E. coli expression of recombinant ~lvcocalicin (GC
[462.] The DNA fragment encoding the N-terminal soluble part of human platelet GPlb - glycocalicin (GC, amino acid 1 to amino acid 493) was cloned into an IPTG
inducible prokaryotic vector cassette. E. coli (BL21 DE3) cells harboring the newly constructed plasmid were grown at 37°C to O.D. 0.7-0.8, than at 37°C for 3 hours for in the presence of IPTG for induction. SDS-polyacrylamide gel loaded either with semi-purified human platelet derived GC or with E. coli cell lysates (total protein content) derived from induced and non-induced cells were analyzed. Western blot analysis was performed with scFv Y1-biotinylated, polyclonal rabbit anti-human GC antibody, mouse anti-human CD42 monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HIP1 Pharmigen, AN51 DAKO, commercially available) and polyclonal antibody against the N-terminus of GPIba (Sc-7071, Santa Cruz). The two polyclonal antibodies recognized both the recombinant bacterial derived GC as well as the natural huma~l platelet derived GC. The scFv Yl and the commercially available antibodies recognized only the natural human derived GC, but not the bacterial derived recombinant platelet GC.
[463.] Post-translational modification, such as glycosylation and sulfation is essential for scFv and commercially available antibodies binding to GC. The prokaryotic (E. coli) system lacks post-translation modification mechanisms, such as glycosylation and sulfation.
Example 16: Production of tetramers of Yl [464.] A construct was designed where the following sequence, LNDIFEAQKIEWHE, was added at the C-terminus of the Y1 by PCR and cloning into an IPTG inducible expression vector cassette. The clone was named Y1-biotag.
This sequence is a substrate for the enzyme BirA, that in the presence of free biotin, the enzyme is capable of covalently connecting biotin to the lysine (I~) residue (Phenotypic analysis of antigen-specific T lymphocytes. Science. 1996 Oct 4;274(5284):94-6, Altman JD et al). This construct was produced as inclusion bodies in BL21 bacterial cells.
Refolding was performed as described previously. Inclusion bodies were solubilized in guanidine-DTE. Refolding was done by dilution in a buffer containing arginine-tris-EDTA. Dialysis and concentration was performed followed by HiTrapQ ionic exchange purification.
[465.] The purified Y1-biotag scFv was incubated with BirA enzyme (purchased from Avidity) and biotin as recommended by the provider. The biotinylated Y1-biotag was analyzed by HABA test (that estimates the amount of biotin per molecule) and demonstrated that there was around >0.8 biotin residues/molecule.
[466.] The Yl-biotag biotinylated was incubated with Streptavidin-PE
(Phycoerythrin) to form complexes and used in FACS experiments using KG-1 cells (positive for Y1). The sensitivity of the binding was increased at least 100 fold due to the increase in avidity. Streptavidin can bind up to 4 biotinilated-Y1-biotag molecules.
[467.] The sequence of Yl-biotag is as follows, and is SEQ 1T7 NO: 211:
MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMSWVRQ

Example 17: Characterization of Y17 Activity [468.] The enzyme O-Sialoglycoprotein endoprotease from Pastoral laaernolytica that selectively cleaves human platelets GPIb, was used in order to establish the specificity of binding of Y17 to GPIba. The O-Sialoglycoprotein endoprotease, specifically cleaved only proteins containing sialyated, O-linl~ed glycans, and does not cleave N-linl~ed glycoproteins or unglycosylated proteins. This enzyme has been reported to cleave GPIb, which is heavily O-glycosylated, but not GPIIb-IIIa or other receptors on the platelets. Incubation of washed platelets with O-Sialoglycoprotein endoprotease which cleaved GPIb, abolishes binding of Y17 as well as the binding of monoclonal antibody (MCA466S-serotec) directed against GPIba to the GPIb as was shown by 12o immunoblots and by FACS analysis. These endoprotease did not change the binding of monoclonal antibody (anti CD61) directed against GPIIb/IIIa (FIG. 4).
Examule 18: Identification of Y17 Epitope on Platelets GPIb [469.] An interesting approach to identification of the Y1 epitope on platelets GPIb is to use endoproteases enzyme whose cleavage sites on platelets GPIb are fully characterized.
18.1: Effect of Mocarhagin on the Mauuin~ of Yl Enitone [470.] Mocarhagin, a cobra venom metalloproteinase cleaves platelet GPIba specifically at a single site between residues glu-282 and asp-283, generates two stable products, a 45-kDa N-terminal fragment (His-1-Glu-282) found in the supernatant and a membrane bound 100 kDa C-terminal fragment.
[471.] Washed platelets were treated by mocarhagin and, platelets lysate were separated on SDS-polyacrylamide gels and transferred to nitrocellulose.
Analysis of mocarhagin-treated washed platelets by Western blot analysis with Y1-results in loss of the band corresponding to GPIb (135 kDa) and, binding of Y17 to the N-terminal 45 kDa tryptic fragment. Monoclonal antibodies, MCA466S directed against the C-terminal fragment of GPIba reacted with the 100 kDa C-terminal fragment while, monoclonal antibody S.C.7071 which recognizes the N-terminal of GPIba reacted with the same 45 kDa N-terminal fragment that was recognized by Y17 (FIG. 14).
[472.] Mocarhagin treatment of glycocalicin gave results similar to those observed with washed platelets, showing binding of Y1 and monoclonal antibodies, S.C.
7071 to 45 kDa N-terminal cleavage product fragment of GPIba (Figure 8). The results suggest that the epitope for Y17 is contained within the sequence His-1-Glu-282.
18.2: Effect of Cathepsin G on the Mapping of Y17 Epitope [473.] Cathepsin G, a neutroplul serine protease, cleaved glycocalicin between residues leu-275 and Tyr-276 and a second cleavage site between residues Val-296 and Lys-297. Glycocalicin treated by cathepsin G generated two N-terminal fragments, a small fragment 42 kDa fragment (Hisl-Leu275) and a large 45 kDa N-terminal fragment (Hisl-Val-296), in addition to a ~95 kDa C-terminal fragment. Glycocalicin and glycocalicin fragments generated by cathepsin G digestion were separated on SDS-polyacrylamide gels and transferred to nitrocellulose. Y17 bound to the larger fragment (Hisl-Val-296), but not to the smaller fragment (Hisl-Leu275). Moreover, monoclonal antibody S.C. 7071 which recognizes an epitope within Hisl-Leu275 blotted both fragments (FIG. 12). Analysis of N-terminal peptide proteolytic fragments of mocarhagin and cathepsin G suggests that the BPIba amino acid sequence Tyr-276-Glu-282 is an important recognition motif for binding of Y17.
Example 19: Effect of Y17-scFv on vWF-dependent A~~lutination [474.] The effect of Y17-scFv on vWF-dependent agglutination of platelets was tested at different concentrations of Y17. In contrast to Y1, Y17 at a final concentration of 10, 25 or 50 ~.g/ml did not inhibit vWF-dependent platelet agglutination in washed platelets induced by ristocetin. Analysis of N-terminal peptide proteolytic fragments of mocarhagin and cathepsin G suggests that the GPIba amino acid sequence Tyr-276-Glu-282 is an important recognition motif for binding of Y17 and Yl. Since Y17 does not inhibit platelet aggregation, it seems that Yl and Y17 do not bind to the same sequences, but to overlapping sequences.

SEQUENCE LISTING
<110> Bio-Technology General Corp <210> 1 <211> 10 <212> PRT
<213> Homo Sapiens <400> 1 Ser Ser Tyr Thr Ser Ser Ser Thr Leu Val <210> 2 <211> 10 <212> PRT
<213> Homo sapiens <400> 2 Ser Ser Tyr Thr Ser Ser Ser Thr Leu Gly <210> 3 <211> 9 <212> PRT
<213> Homo Sapiens <400> 3 Gln Ser Tyr Asp Ser Asn Leu Arg Val <210> 4 <211> 8 <212> PRT
<213> Homo Sapiens <400> 4 Gln Gln Leu Asn Ser Tyr Pro Thr <210> 5 <211> 11 <212> PRT
<213> Homo Sapiens <400> 5 Asn Ser Arg Asp Ser Ser Gly Phe Gln Leu Val <210> 6 <211> 9 <212> PRT
<213> Homo Sapiens <400> 6 Gln Gln Ala Asn Ser Phe Pro Ile Thr <210> 7 <211> 111 <212> PRT
<213> Homo Sapiens <400> 7 Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala 5er Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp~Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala <210> 8 <2l1> 6 <212> PRT
<213> Homo sapiens <400> 8 Met Arg Ala Pro val Ile <210> 9 <211> 8 <212> PRT
<213> Homo Sapiens <400> 9 Pro Trp Asp Asp Val Thr Pro Pro <210> 10 <211> 12 <212> PRT
<213> Homo Sapiens <400> 10 Gly Phe Pro Arg Ile Thr Pro Pro Ser Ala Glu Ile <210> 11 <211> 5 <212> PRT
<213> Homo Sapiens <400> 11 Gly Phe Pro Met Pro < 210 ~ '1_ 2 <211> 10 <212> PRT
<213> Homo Sapiens <400> 12 Gly Phe Pro His Ser Ser Ser Val Ser Arg <210> 13 <211> 11 <212> PRT
<213> Homo Sapiens <400> 13 Arg Phe Pro Met Arg His Glu Lys Thr Asn Tyr <210> 14 <211> 8 <212> PRT
<213> Homo Sapiens <400> 14 Arg Phe Pro Pro Thr Ala Thr Ile <2l0> 15 <211> 7 <212> PRT
<2l3> Homo Sapiens <400> 15 Thr Gln Arg Arg Asp Leu Gly <210> 16 <211> 11 <2l2> PRT
<213> Homo Sapiens <400> 16 Lys Phe Pro Gly Gly Thr Val Arg Gly Leu Lys <210> 17 <211> 12 <212> PRT
<213> Homo Sapiens <400> 17 Gly Phe Pro Val Ile Val Glu Glu Arg Gln Ser Thr <210> 18 <211> 10 <212> PRT
<213> Homo sapiens <400> 18 Arg Phe Pro Gln Arg Val Asp Asn Arg Val 1 5 ~ 10 <2l0> 19 <211> 8 <212> PRT
<213> Homo Sapiens <400> 19 Thr Gly Gln Ser Ile Lys Arg Ser <210> 20 <211> 6 <212> PRT
<213> Homo Sapiens <400> 20 Leu Thr His Pro Tyr Phe <210> 21 <211> 6 <212> PRT
<213> Homo Sapiens <400> 21 Leu Arg Pro Pro Gln Ser <210> 22 <211> 11 <212> PRT
<213> Homo Sapiens <400> 22 Thr Ser Lys Asn Thr Ser Ser Ser Lys Arg His <210> 23 <211> 12 <212> PRT
<213> Homo Sapiens <400> 23 Arg Tyr Tyr Cys Arg Ser Ser Asp Cys Thr Val Ser <210> 24 <211> 10 <212> PRT
<213> Homo Sapiens <400> 24 Phe Arg Arg Met Glu Thr Val Pro Ala Pro 1 ~ 5 10 <210> 25 <211> 277 <212> PRT
<213> Homo sapiens <400> 25 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly G1y 20 . 25 30 Val Val Arg Pro Gly Gly Ser Leu Arg Leu 5er Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly Gly Gly Ser G1y Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln 180 ~ 185 190 Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala <210>26 <211>464 <212>PRT

<213>Homo sapiens <400> 26 Met Ala Trp Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Asp Thr Gly Ser Trp A1a Asp I1e Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 210 2l5 220 Asn Thr Lys Val Asp Lys Arg Val~Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile gPr Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Ser Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys <210>27 <211>233 <212>PRT

<213>Homo sapiens <400> 27 Met Ala Trp Ala Leu Leu Leu Leu Thr Leu Leu Thr Gln Asp Thr Gly Ser Trp Ala Asp Ala Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp 5er Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Lys Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr Val Ala Pro Thr Glu Cys Ser <210> 28 <211> 11 <212> PRT
<213> Homo Sapiens <400> 28 Phe Leu Thr Tyr Asn Ser Tyr Glu Val Pro Thr l 5 10 <210> 29 <211> 9 <212> PRT
<213> Homo Sapiens <400> 29 Thr Asn Trp Tyr Leu Arg Pro Leu Asn <210> 30 <211> 98 <212> PRT
<213> Homo Sapiens <400> 30 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Thr Val Lys Ile Ser Cys Lys Val Ser Gly Tyr Thr Phe Thr Asp Tyr Tyr Met His Trp Val Gln G1n Ala Pro Gly Lys Gly Leu Glu Trp Met Gly Leu Val Asp Pro Glu Asp Gly Glu Thr Ile Tyr Ala Glu Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Asp Thr Ala Tyr 65 70 ~ 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Thr <210> 31 <211> 98 <212> PRT

<213> Homo Sapiens <400> 31 Gln Val GIn Leu VaI Gln Ser Gly Ala Glu Val Lys Lys Pro GIy Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr Asp Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Glu Leu Gly Trp Met Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Thr Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr AIa Thr Tyr Tyr Cys Ala Arg <210> 32 <211> 98 <212> PRT
<213> Homo Sapiens <400> 32 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Val Ser Gly Tyr Thr Leu Thr Glu Leu Ser Met His Trp Val Arg Gln Ala Pro Gly Lys GIy Leu Glu Trp Met 35 40 ' 45 GIy Gly Phe Asp Pro Glu Asp Gly Glu Thr Tle Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Glu Asp Thr Ser Thr Asp Thr Ala Tyr 65 ~ 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys AIa Thr <210> 33 <211> 98 <212> PRT
<213> Homo Sapiens <400> 33 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Ser Thr Arg Asp Thr Ser I1e Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Val Val Tyr Tyr Cys Ala Arg <210> 34 <211> 98 <212> PRT
<213> Homo Sapiens <400> 34 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr 65 ' 70 75 80 Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 ~ 95 Ala Arg <210> 35 <211> 98 <212> PRT
<213> Homo Sapiens <400> 35 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Trp Va1 Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 ' 90 95 Ala Arg <2l0> 36 <211> 98 <212> PRT
<213> Homo Sapiens <220>
<22l> X

<222> (1) . . (98) <223> Xaa <400> 36 Gln Val Gln Leu Val Gln Ser Gly Ala G1u Val Lys Lys Leu Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Xaa Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 ' 45 Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser IIe Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 37 <211> 98 <2l2> PRT
<213> Homo Sapiens <400> 37 Gln Val Gln Leu Val Gln Ser Gly Ala G1u Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Cys Met His Trp Val Arg Gln Val His Ala Gln Gly Leu Glu Trp Met Gly Leu Val Cys Pro Ser Asp Gly Ser Thr Ser Tyr Ala Gln Lys Phe Gln Ala Arg Val Thr Ile Thr Arg Asp Thr Ser Met Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Val Arg <210> 38 <211> 98 <212> PRT
<213> Homo Sapiens <400> 38 Gln Met Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly Thr Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Ser Ser Ala Val Gln Trp Val Arg Gln Ala Arg Gly Gln Arg Leu Glu Trp Ile 35 ' 40 45 Gly Trp 21e Val Val Gly Ser Gly Asn Thr Asn Tyr Ala Gln Lys Phe Gln Glu Arg Val Thr Ile Thr Arg Asp Met Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala <210> 39 <211> 98 <212> PRT
<213> Homo Sapiens <400> 39 Gln Val Gln Leu Va1 Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 . 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly Ile,Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 40 <211> 98 <212> PRT
<213> Homo Sapiens <400> 40 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly~Leu Glu Trp Met Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr A1a Val Tyr Tyr Cys Ala Arg <210> 41 <211> 98 <212> PRT
<213> Homo Sapiens <400> 41 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr 65 70~ 75 80 Met Glu Leu Ser Ser Leu Arg Ser GIu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 42 <211> 98 <212> PRT
<213> Homo Sapiens <400> 42 Gln Val G1n Leu Val Gln Ser G1y Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met Gly Trp Ser Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser Gln Glu Phe Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Met Ala Val Tyr Tyr Cys Ala Arg <210> 43 <211> 98 <212> PRT
<213> Homo sapiens <400> 43 Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr Leu Gln Ile Cys Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 44 <211> 98 <212> PRT
<213> Homo Sapiens <400> 44 Gln Val Gln Leu Val Gln Ser Gly Ser Glu Leu Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Ala Met Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Asn Pro Thr Tyr Ala Gln Gly Phe Thr Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Tyr Leu Gln Ile Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 45 <211> 98 <212> PRT
<213> Homo sapiens <400> 45 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr 5er Tyr Asp I1e Asn Trp Val Arg Gln Ala Thr Gly Gln Gly Leu Glu Trp Met Gly Trp Met Asn Pro Asn Ser Gly Asn Thr Gly Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asn Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 46 <211> 98 <212> PRT
<213> Homo sapiens <400> 46 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys A1a Arg <210> 47 <211> 92 <212> PRT
<213> Homo Sapiens <4nn~ 47 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala <210> 48 <211> 98 <212> PRT
<213> Homo Sapiens <400> 48 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 . 45 Gly Ile Ile Asn Pro Ser Gly G1y Ser Thr Ser Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 49 <211> 98 <212> PRT
<213> Homo sapi,ens <400> 49 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Asn Ser Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser GIu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 50 <211> 98 <212> PRT
<213> Homo sapiens <400> 50 Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Thr Gly 'Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Arg 20 25 ~ 30 Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Ala Leu Glu Trp Met Gly Trp Ile Thr Pro Phe Asn Gly Asn Thr Asn Tyr Ala Gln Lys Phe Gln Asp Arg Val Thr Ile Thr Arg Asp Arg Ser Met Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> 51 <211> 98 <212> PRT
<213> Homo sapiens <400> 5l Gln Met Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Thr Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Tyr Arg Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Ala Leu Glu Trp Met Gly Trp Ile Thr Pro Phe Asn Gly Asn Thr Asn Tyr Ala Gln Lys Phe Gln Asp Arg Val Thr Ile Thr Arg Asp Arg Ser Met Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> 52 <211> 96 <212> PRT
<213> Homo Sapiens <400> 52 Gln Val Thr Leu Lys Glu Ser Gly Pro Val Leu Val Lys Pro Thr Glu Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Asn Ala Arg Met Gly Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala His Ile Phe Ser Asn Asp Glu Lys Ser Tyr Ser Thr Ser Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Ser Gln Val Va1 Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr <210> 53 <211> 99 <212> PRT
<213> Homo Sapiens <400> 53 Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser Glu Trp Cys Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala Leu Ile Tyr Trp Asn Asp Asp Lys Arg Tyr Ser Pro Ser Leu Lys Ser Arg Leu Thr Ile Thr Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala His Arg <210> 54 <211> 96 <212> PRT
<213> Homo Sapiens <400> 54 Gln Val Thr Leu Arg Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser Gly Met Cys Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala Leu Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr <210> 55 <211> 96 <212> PRT
<213> Hamo sapiens <400> 55 Gln Val Thr Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser Gly Met Arg Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala Arg Ile Asp Trp Asp Asp Asp Lys Phe Tyr Ser Thr Ser Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val 65 70 '75 80 Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr <210> 56 <211> 100 <212> PRT
<213> Homo sapiens <400> 56 Gln Ile Thr Leu Lys Glu Ser Gly Pro Thr Leu Val Lys Pro Thr Gln Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Ala Leu Ile Tyr Trp Asn Asp Asp Lys Arg Tyr Ser Pro Ser Leu Lys Ser Arg Leu Thr 21e Thr Lys Asp Thr Ser Lys Asn Gln Val Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr Cys Ala His Arg <210> 57 <211> 100 <212> PRT
<213> Homo Sapiens <400> 57 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His Tyr Met Asp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Gly Arg Thr Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 58 <211> 100 <212> PRT
<213> Homo Sapiens <400> 58 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His Tyr Met Ser Trp Val Arg Gln Ala Gln Gly Lys Gly Leu Glu Leu Val Gly Leu Ile Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala Ser Val Lys Gly Arg Leu Thr Ile Ser Arg Glu Asp Ser Lys Asn Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Leu Ala Val Tyr Tyr Cys Ala Arg <210> 59 <211> 100 <212> PRT
<213> Homo Sapiens as <400> 59 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp His Tyr Met Ser Trp Val Arg Gln Ala Gln G1y Lys Gly Leu Glu Leu Val G1y Leu Ile Arg Asn Lys Ala Asn Ser Tyr Thr Thr Glu Tyr Ala Ala Ser Val Lys Gly Arg Leu Thr Ile Ser Arg Glu Asp Ser Lys Asn Thr Leu Tyr Leu Gln Met Ser Ser Leu Lys Thr Glu Asp Leu Ala Val Tyr Tyr Cys Ala Arg <210> 60 <211> 98 <212> PRT
<213> Homo Sapiens <400> 60 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Met His Trp Va1 Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys Ala Lys <210> 61 <211> 98 <212> PRT
<213> Homo Sapiens <400> 61 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Aha Ser Gly Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr His Cys Ala Arg <210> 62 <211> 98 <212> PRT
<213> Homo Sapiens <400> 62 Glu Val Gln Leu Val Glu Ser Gly G1y Val Val Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 , Thr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Leu Ile Ser Trp Asp Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Leu Tyr Tyr Cys Ala Lys <210> 63 <211>. 98 <212> PRT
<213> Homo Sapiens <400> 63 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Tyr Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg AIa Glu Asp Thr AIa Val Tyr Tyr Cys Ala Arg <210> 64 <211> 100 <212> PRT
<213> Homo Sapiens <400> 64 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ala Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Gly Arg Ile Lys Ser Lys Thr Asp Gly Gly Thr Thr Asp Tyr Ala Ala Pro Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr Thr <210> 65 <211> 98 <212> PRT
<213> Homo Sapiens <400> 65 Glu Va1 Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Pro Ala 5er Gly Phe Thr Phe Ser Asn His Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser Gly Asp Ser Gly Tyr Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Asn Asn Ser Pro Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Val Lys <210> 66 <211> 98 <212> PRT
<213> Homo sapiens <400> 66 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn His Tyr Thr Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ser Ser Gly Asn Ser Gly Tyr Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn 5er Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Val Lys <210> 67 <211> 98 <212> PRT
<213> Homo Sapiens <400> 67 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Ser Asp Met Asn Trp Val His Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Val Ser Trp Asn Gly Ser Arg Thr His Tyr Ala Asp Ser Val 50 55~ 60 Lys Gly Arg Phe Ile Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu Gln Thr Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Val Arg <210> 68 <211> 97 <212> PRT
<213> Homo Sapiens <400> 68 Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Ile Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 69 <211> 97 <212> PRT
<213> Homo Sapiens <400> 69 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Val Ser Ser Asn Tyr Met Ser Trp Val Arg Gln A1a Pro Gly Lys Gly Leu Glu Trp Val 35 40 ' 45 Ser Val Ile Tyr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 70 <211> 97 <212> PRT
<213> Homo Sapiens <400> 70 Glu Val Gln Leu Val His Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Ser Sex Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Va1 Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala A'sp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala Arg <210> 71 <211> 97 <212> PRT
<213> Homo Sapiens <400> 71 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu-Arg Leu Ser Cys AIa Gly Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro GIy Lys Gly Leu Glu Trp Val Ser Ala Ile Gly Thr Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala Arg <210> 72 <211> 98 <212> PRT
<213> Homo Sapiens <400> 72 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Val Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Val Arg <210> 73 <211> 35 <212> PRT
<213> Homo Sapiens <400> 73 Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val Ser Ala Ile Ser Ser Asn Gly Gly Ser Thr Tyr Tyr Ala Asp <210> 74 <211> 98 <212> PRT
<213> Homo Sapiens <400> 74 Gln Val Gln Leu Val Glu Ser G1y Gly Gly Val Val Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Sex Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 75 <211> 98 <212> PRT
<213> Homo Sapiens <400> 75 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 76 <21l> 98 <212> PRT
<213> Homo sapiens <400> 76 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg l 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 77 <211> 98 <212> PRT
<213> Homo sapiens <400> 77 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Sex Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 ' 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys <210> 78 <211> 97 <212> PRT
<213> Homo Sapiens <400> 78 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Asp Met His Trp Val Arg Gln Ala Thr Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Gly Thr Ala Gly Asp Thr Tyr Tyr Pro Gly Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Glu Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Gly Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 79 <211> 98 <212> PRT

<213> Homo sapiens <400> 79 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Glu Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Alw Ara <210> 80 <211> 98 <212> PRT
<213> Homo sapiens <400> 80 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 ' 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ly.s <210> 81 <211> 98 <212> PRT
<213> Homo Sapiens <400> 81 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 82 <211> 98 <212> PRT
<213> Homo Sapiens <400> 82 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ser Met. Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser Ser Ser Ser Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 83 <211> 97 <212> PRT
<213> Homo Sapiens <400> 83 Glu Asp Gln Leu Val Glu Ser Gly G1y Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Pro Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr Val Leu His Trp Val Arg Arg Ala Pro G1y Lys Gly Pro Glu Trp Val Ser Ala Ile Gly Thr Gly Gly Asp Thr Tyr Tyr Ala Asp Ser Val Met Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Lys Ser Leu Tyr Leu Gln Met Asn Ser Leu Ile Ala Glu Asp Met Ala Val Tyr Tyr Cys Ala Arg <210> 84 <211> 98 <212> PRT
<213> Homo Sapiens <400> 84 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Trp Met His,Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Val Trp Val Ser Arg Ile Asn Ser Asp Gly Ser Ser Thr Thr Tyr Ala Asp 5er Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 85 <211> 98 <212> PRT
<213> Homo Sapiens <400> 85 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala 5er Gly Phe Thr Phe Ser Ser Tyr Trp Met Ser Trp Va1 Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Asn Ile Lys Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 ~ 90 95 Ala Arg <210> 86 <211> 97 <212> PRT
<213> Homo Sapiens <400> 86 Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu I , 5 10 1~
Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Glu Ile Ile His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 87 <211> 97 <212> PRT
<213> Homo sapiens <400> 87 Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Phe Ser Gly Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Glu Ile Asn His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala,,Val Tyr Tyr Cys Ala Arg <210> 88 <211> 97 <212> PRT
<213> Homo Sapiens <400> 88 Gln Val Gln Leu Gln Gln Trp Gly Ala Gly Leu Leu Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Ala Val Tyr Gly Gly Ser Val Ser Gly Tyr 20 ~ 25 30 Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Asn Asn Pro Ser Leu Lys Ser Arg A1a Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Asn Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Cys Cys Ala Arg <210> 89 <211> 99 <212> PRT
<213> Homo Sapiens <400> 89 Gln Leu Gln Leu Gln Glu Ser Gly Ser Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Gly Gly Tyr Ser Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Arg Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 90 <211> 99 <212> PRT
<213> Homo Sapiens <400> 90 GIn Va1 Gln Leu Gln Glu Ser GIy Pro Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Gly Gly Tyr Tyr Trp Ser Trp Ile Arg Gln His Pro Gly Lys Gly Leu Glu Trp TlP Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 91 <211> 99 <212> PRT
<213> Homo Sapiens <400> 91 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser GIu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser VaI Ser Ser GIy Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 .45 Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Ser Leu Lys Leu Ser Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 92 <211> 98 <212> PRT
<213> Homo Sapiens <400> 92 Gln Val Gln Leu GIn Glti Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Gly Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu G1u Trp Ile Gly Ser Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu~Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys AIa Arg <210> 93 <211> 98 <212> PRT
<2l3> Homo Sapiens <400> 93 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile Ser Ser Gly Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Ser Ile Tyr His Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys A1a Arg <210> 94 <211> 98 <212> PRT
<213> Homo Sapiens <400> 94 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Asp Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Ser Asn Trp Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 95 <211> 98 <212> PRT
<213> Homo Sapiens <400> 95 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Tyr Ser Ile Ser Ser Ser Asn Trp Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Ile Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Met Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Val Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 96 <211> 98 <212> PI2T
<213> Homo sapiens <400> 96 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Val Val Ser Gly Gly~Ser Tle Ser Ser Ser Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Glu Ile Tyr His Ser Gly Asn Pro Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Ile Asp Lys Ser Lys Asn Gln Phe Ser 65 ~ 70 75 80 Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 97 <211> 98 <2l2> PRT
<213> Homo Sapiens <400> 97 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Val Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 ~ 30 Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu G1u Trp Ile Gly Glu Ile Tyr His Ser Gly Ser Pro Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 98 <211> 98 <212> PRT
<213> Homo Sapiens <400> 98 Gln Va1 Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Pro Gly Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Lys Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Cys Cys Ala Arg <210>99 <211>98 <212>PRT

<213>Homo Sapiens <400> 99 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gly Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Ser Ser Asn Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile 5er Val Asp Lys Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 100 <211> 99 <212> PRT
<213> Homo Sapiens <400> 100 Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser 5er Ser Ser Tyr Tyr Trp Gly Trp I1e Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55 . 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr,Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 101 <211> 99 <2I2> PRT
<213> Homo Sapiens <400~ 101 Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser Ser Tyr Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn His Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 102 <211> 97 <212> PRT
<213> Homo Sapiens <400> 102 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Ala Gly Lys Gly Leu Glu Trp Ile Gly Arg Ile Tyr Thr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Asn Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 103 <211> 97 <212> PRT
<213> Homo sapiens <400> 103 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 l5 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55~ 60 Ser Arg Val Thr Ile 5er Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 104 <211> 97 <212> PRT
<213> Homo Sapiens <400> 104 Gln Val Gln Leu G1n Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Met Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 105 <211> 97 <212> PRT
<213> Homo Sapiens <400> 105 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Asp Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 106 <211> 98 <212> PRT
<213> Homo Sapiens <400> 106 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr Trp Tle Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser 5er Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> 107 <211> 98 <212> PRT
<213> Homo Sapiens <400> 107 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Pro Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> 108 <211> 98 <212> PRT
<213> Homo Sapiens <400> 108 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> 109 <211> 98 <212> PRT
<213> Homo sapiens <400> 109 Glu Val Gln Leu Leu Gln Ser Ala Ala Glu Val Lys Arg Pro Gly Glu Ser Leu Arg Ile Ser Cys Lys Thr Ser Gly Tyr Ser Phe Thr Ser Tyr Trp Ile His Trp Val Arg Gln Met Pro Gly Lys Glu Leu Glu Trp Met Gly Ser Ile Tyr Pro Gly Asn Ser Asp Thr~Arg Tyr Ser Pro Ser Phe Gln Gly His Val Thr Ile Ser Ala Asp Ser Ser 5er Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Ala Ala Met Tyr Tyr Cys Val Arg <210> 110 <211> 98 <212> PRT
<213> Homo Sapiens <400> 110 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu Ser Leu Arg Ile Ser Cys Lys Gly Ser G1y Tyr Ser Phe Thr Ser Tyr Trp Ile Ser Trp Val Arg Gln Met Pro G1y Lys Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Ser Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe Gln Gly His Val Tar Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> 111 <211> 98 <212> PRT
<213> Homo Sapiens <400> 111 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu Ser Leu Arg Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr Trp Ile Ser Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Ser Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe Gln Gly His Val Thr Ile Ser Ala Asp Lys 5er Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg <210> ll2 <211> l01 <212> PRT
<213> Homo Sapiens <400> 112 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 113 <211> 87 <212> PRT
<213> Homo Sapiens <400> 113 Arg Lys Leu Gly Ala Ser Val Lys Val Ser Arg Lys Ala Ser Ser Tyr Thr Phe Thr Ser Tyr Asp Ile His Cys Val Arg Gln Ala Pro Gly Lys Gly Leu Lys Gly Trp Met Gly Gly Ile Tyr Ser Gly Asn Gly Lys Thr Gly Tyr Ala Gln Lys Phe Gln Arg Val Thr Met Thr Arg Asp Met Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Gln Arg Ser Glu Asp Ile Asp Val Tyr Tyr Cys Ala Arg <210> 114 <211> 5 <212> PRT
<213> Homo Sapiens <400> 114 Asp Tyr Gly Met Ser <210> 115 <211> 17 <212> PRT
<213> .Homo Sapiens <400> 115 Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys Gly <210>1l6 <211>11 <212>PRT

<213>Homo sapiens <400> 116 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Arg <210> 117 <211> 11 <212> PRT
<213> Homo sapiens <400> l17 Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg <210> 118 <211> 11 <212> PRT
<213> Homo sapiens <400> 118 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn <210> 119 <211> 8 <212> PRT
<213> Homo Sapiens <400> 119 Gly Lys Gly Leu Glu Trp Val Ser <210> 120 <211> 6 <212> PRT
<213> Homo Sapiens <400> 120 Trp Val Arg Gln Ala Pro <210> 121 <211> 11 <212> PRT
<213> Homo Sapiens <400> 121 Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp <210> 122 <211> 7 <~12> PRT
<213> Homo Sapiens <400> 122 Ala Val Tyr Tyr Cys Ala Arg <210> 123 <211> 20 <212> PRT
<213> Homo Sapiens <400> 123 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser <210> 124 <211> 15 <212> PRT
<213> Homo Sapiens <400> 124 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser <210> 125 <211> 9 <212> PRT
<213> Homo sapiens <400> 125 Asn Ser Arg Asp Ser 5er Gly Asn His <210> 126 <211> 8 <212> PRT
<213> Homo Sapiens <400> 126 Ala Ala Trp Asp Asp Ser Leu Val <210> 127 <211> 8 <212> PRT
<213> Homo Sapiens <400> 127 Met Gln Ser Ile Gln Leu Pro Thr <210> 128 <211> 9 <212> PRT
<213> Homo Sapiens <400> 128 Met Gln Ser Ile Gln Leu Pro Ala Thr <210> 129 <211> 10 <212> PRT
<213> Homo Sapiens <400> 129 Ala Ala Trp Asp Asp Gly Leu Ser Leu Val <210> 130 <211> 10 <212> PRT
<213> Homo sapiens <400> 130 Ala Ala Trp Asp Asp Ser Leu Ser Gly Val <210> 131 <211> 11 <212> PRT
<213> Homo Sapiens <400> 131 Asn Ser Arg Asp Ser Ser Gly Ser Val Arg Val <210> 132 <211> 9 <212> PRT
<213> Homo Sapiens <400> 132 Leu Leu Tyr Tyr Gly Gly Ala Tyr Val <210> 133 <211> 11 <212> PRT
<213> Homo Sapiens <400> 133 Asn Ser Arg Asp Ser Ser Gly Val Ser Arg Val <210> 134 <211> 10 <212> PRT
<213> Homo Sapiens <400> 134 Ala Ala Trp Asp Asp Ser Leu Pro Tyr Val <210> 135 <211> 12 <212> .PRT
<213> Homo Sapiens <400> 135 Ala Ala Trp Asp Asp Ser Leu Cys Pro Glu Phe Val <210> 136 <211> 11 <212> PRT
<213> Homo Sapiens <400> 136 Ala Ala Trp Asp Asp Ser Leu Ala Trp Phe Val <210> 137 <211> 10 <212> PRT
<213> Homo Sapiens <400> I37 Leu Ala Trp Asp Thr Ser Pro Arg Trp Val <210> 138 <211> 10 <212> PRT
<213> Homo sapiens <400> 138 Thr Ala Trp Asp Asp Ser Leu Ala Val Val <210> 139 <211> 11 <212> PRT
<213> Homo Sapiens <400> 139 Asn Ser Arg Asp Ser Ser Gly Asn His Arg Val <210> 140 <211> 9 <212> PRT
<213> Homo Sapiens <400> 140 Gln Gln Tyr Gly Ser Ser Gln Arg Thr <210> 141 <211> 10 <212> PRT
<213> Homo sapiens <400> 141 Ala Ala Trp Asp Asp Ser Leu Arg Leu Va1 <210> 142 <211> 9 <212> PRT
<213> Homo Sapiens <400> 142 Met Gln Gly Thr His Trp Arg Pro Thr <210> 143 <211> 9 <212> PRT
<213> Homo Sapiens <400> 143 Met Gln Gly Lys His Trp Pro Leu Thr <210> 144 <211> 9 <212> PRT
<213> Homo Sapiens <400> 144 Ala Ala Trp Asp Asp Ser Leu Gly Phe <210> 145 <211> 9 <212> PRT
<213> Homo Sapiens <400> 145 Met Gln Gly Thr His Arg Arg Ala Thr <210> 146 <211> 9 <212> PRT
<213> Homo Sapiens <400> 146 Met Gln Ala Leu Gln Thr Pro Leu Thr <210> 147 <211> 9 <212> PRT
<213> Homo Sapiens <400> 147 Met Arg Gly Thr His Arg Arg Ala Thr <210> 148 <211> 9 <212> PRT
<213> Homo sapiens <400> 148 Met Gln Gly Thr His Trp His Pro Thr <210> 149 <211> 8 <212> PRT
<213> Homo Sapiens <400> 149 Met Gln Ala Leu Gln Ser Pro Thr <210> l50 <211> ZO
<212> PRT
<213> Homo Sapiens <400> 150 Ala Ala Trp Asp Asp Ser Leu Ala Phe Val 1. 5 10 <210> 151 <211> 8 <212> PRT
<213> Homo Sapiens <400> 151 Met Gln Ala Leu Gln Thr Pro Thr <210> 152 <211> 8 <212> PRT
<213> Homo Sapiens <400> 152 Gln Gln Ser Tyr Ser Thr Arg Thr <210> 153 <211> 9 <212> PRT
<213> Homo Sapiens <400> 153 Met Gln Gly Thr His Trp Pro Phe Thr <210> 154 <211> 9 <212> PRT
<213> Homo Sapiens <400> 154 Met Gln Gly Thr His Trp Pro Ala Thr <210> 155 <211> 10 <212> PRT
<213> Homo Sapiens <400> 155 Ala Ala Trp Asp Asp Ser Leu Arg Ser Val <210> 156 <211> 9 <212a PRT
<213> Homo Sapiens <400> 156 Ala Ala Trp Asp Asp Ser Leu Leu Val <210> 157 <211> 11 <2l2> PRT
<213> Homo Sapiens <400> 157 Asp Ser Trp Asp Asn Ser Leu Val Ser Pro Val 1' ,5 10 <210> 158 <211> 9 <212> PRT
<213> Homo sapiens <400> 158 Met Gln Ala Leu Gln Ser Pro Ala Thr <210> 159 <211> 9 <212> PRT
<2l3> Homo Sapiens <400> 159 Met Gln Ala Leu Gln Thr Pro Val Thr <210> 160 <211> 11 <212> PRT
<213> Homo Sapiens <400> 160 Ala Ala Trp Asp Asp Ser Leu Ser Ala Tyr Val <210> 161 <211> 11 <212> PRT
<213> Homo Sapiens <400> 161 Asn Ser Arg Asp Ser Ser Gly Arg Val Asn Val <210> 162 <211> 8 <212> PRT

<213> Homo Sapiens <400> 162 Met Gln Ala Leu Arg Thr Arg Thr <210> 163 <211> 11 <212> PRT
<213> Homo Sapiens <400> 163 Ala Ala Trp Asp Asp Ser Leu Phe Tyr Pro Val <210> 164 <211> 9 <212> PRT
<213> Homo Sapiens <400> 164 Met Gln Gly Thr His Trp Pro Val Thr <210> 165 <211> 8 <212> PRT
<213> Homo Sapiens <400> 165 Met Gln Gly Thr His Trp Arg Thr <210> 166 <211> 10 <212> PRT
<213> Homo Sapiens <400> 166 Ala Ala Trp Asp Asp Ser Leu Phe Tyr Val 1 . 5 10 <210> 167 <211> 9 <212> PRT
<213> Homo Sapiens <400> 167 Met Gln Ser Ile Gln Leu Pro Leu Thr <210> 168 <211> 11 <212> PRT
<213> Homo Sapiens <400> 168 Ala Ala Trp Asp Asp Ser Leu Leu Gly Ser Val <210> 169 <211> 9 <212> PRT
<2I3> Homo sapiens <400> 169 Cys Ser Tyr Ala Gly Ser Ser Tyr Val <210> 170 <211> 8 <212> PRT
<213> Homo Sapiens <400> 170 Gln Gln Asp Tyr Asn Leu Leu Thr <210> 171 <211> 10 <212> PRT
<213> Homo sapiens <400> 171 Val Leu Tyr Met Gly Ser Gly Ser Ala Val <210> 172 <211> 9 <212> PRT
<213> Homo Sapiens <400> 172 Met Gln Arg Ile Glu Phe Pro Asn Thr <210> 173 <211> 11 <212> PRT
<213> Homo Sapiens <400> 173 Ala Ala Trp Asp Asp Ser Leu Ala Cys Ala Val <210> 174 <211> 8 <212> PRT
<213> Homo sapiens <400> 174 Gln Gln Ala Asn Ser Phe Arg Thr <210> 175 <211> 11 <212> PRT
<213> Homo sapiens <400> 175 Ala Ala Trp Asp Asp Ser Leu Ser Arg Pro Val <210> 176 <211> 10 <212> PRT
<213> Homo Sapiens <400> 176 Ala Ala Trp Asp Asp Ser Leu Tyr Asn Val <210> 177 <211> 11 <212> PRT

<213> Homo Sapiens <400> 177 Ala Ala Trp Asp Asp Ser Leu Asn Arg Asn Val <210> 178 <211> 8 <212> PRT
<213> Homo Sapiens <400> 178 Met Gln Val Leu Gln Thr Arg Thr <210> 179 <211> 8 <212> PRT
<213> Homo Sapiens <400> 179 Met Gln Ala Leu Gln Thr Arg Thr <210> 180 <211> 8 <212> PRT
<213> Homo Sapiens <400> 180 Gln Gln Ser Tyr Ser Thr Arg Met <210> 18l <211> 8 <212> PRT
<213> Homo Sapiens <400> 181 Met Gln Ala Leu Gln Thr Leu Thr <210> 182 <211> 8 <212> PRT
<213> Homo Sapiens <400> 182 Met Arg Ala Leu Gln Thr Pro Thr <210> 183 <211> 11 <212> PRT
<213> Homo Sapiens <400> 183 Ala Ala Trp Asp Asp Ser Leu Pro Gly Tyr Val <210>184 <211>10 <212>PRT

<213>Homo Sapiens <400> 184 Ala Ala Trp Asp Asp Ser Leu Gly Phe Val <210> 185 <211> 10 <212> PRT
<213> Homo Sapiens <400> 185 Ala Ala Trp Asp Asp Ser Leu Phe Leu Val 1 5 ~ 10 <210> 186 <211> 8 <212> PRT
<213> Homo Sapiens <400> 186 Met Gln Ser Tle Gln Leu Arg Thr <210> 187 <211> 10 <212> PRT
<213> Homo Sapiens <400> 187 Ala Ala Trp Asp Asp Ser Leu Ser Ile Val <210> 188 <211> 8 <212> PRT

<213> Homo Sapiens <400> 188 Met Gln Gly Thr His Trp Pro Thr <210> 189 <211> 8 <212> PRT
<213> Homo Sapiens <400> 189 Met Gln Ala Leu His Thr Arg Thr <2l0> 190 <211> 9 <212> PRT
<213> Homo Sapiens <400> 190 Asn Ser Arg Asp Ser Ser G1y Ser Val <210> 191 <211> 9 <212> PRT
<213> Homo sapiens <400> 191 Gln Gln Tyr Gly Ser Ser Pro Tyr Thr <210> 192 <211> 8 <212> PRT
<213> Homo Sapiens <400> 192 Gln Gln Ser Tyr.Ser Thr Arg Thr <210> 193 <211> 9 <212> PRT
<213> Homo Sapiens <400> 193 Gln Gln Ala Asn Ser Phe Ala Ala Thr <210> 194 <211> 9 <212> PRT
<213> Homo Sapiens <400> I94 Gln Gln Ala Asn Ser Phe Pro Ala Thr <210> 195 <211> 10 <212> PRT
<213> Homo Sapiens <400> 195 Val Leu Tyr Met Gly Ser Gly Val Tyr Val <210> 196 <211> 11 <212> PRT
<213> Homo Sapiens <400> 196 Ala Ala Trp Asp Asp Ser Leu Trp Ser Ala Val <210> 197 <211> 12 <212> PRT
<213> Homo Sapiens <400> 197 Ala Ala Trp Asp Asp Ser Leu Pro Arg Arg Leu Val <210> 198 <211> 11 <212> PRT
<213> Homo Sapiens <400> 198 Ala Ala Trp Asp.Asp Ser Leu Pro Ser Gly Val <210> 199 <211> 8 <212> PRT
~1 <213> Homo sapiens <400> 199 Met Gln Ala Leu Gln Thr Leu Thr <210> 200 <211> 10 <212> PRT
<213> Homo sapiens <400> 200 Ala Ala Trp Asp Asp Gly Leu Leu Arg Val <210> 201 <211> 10 <212> PRT
<213> Homo sapiens <400> 201 Ala Ala Trp Asp Asp Ser Leu Ala Leu Val <210> 202 <211> 11 <212> PRT
<213> Homo Sapiens <400> 202 Asn Ser Arg Asp Ser Ser Gly Phe Gln Leu Val ~2 <210> 203 <2I1> 277 <2I2> PRT
<213> Homo sapiens <400> 203 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Glu Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser Thr Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr I1e Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Leu Thr His Pro Tyr Phe Trp Gly' GIn Gly Thr Leu Val Thr Val Ser Arg Gly GIy GIy Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Ser 225 ' 230 235 240 Arg~Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Ala Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala Ala <210> 204 <211> 266 <212> PRT
<213> Homo Sapiens <400> 204 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Glu Val Gln Leu Va1 Glu Ser Gly Gly Gly Val Val Arg Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly ' Lys Gly Leu Glu Trp Val Ser Gly Ile Asn Trp Asn Gly Gly Ser~Thr Gly Tyr A1a Asp Ser Val Lys Gly Arg Phe Thr Iie Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Met Arg Ala Pro Val Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Arg Gly Gly G1y Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 5er Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly Gln Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Ala Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Gly Lys Asn Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser Ser Ser Gly Asn Thr Ala Ser Leu Thr $4 Ile Thr Gly Ala Gln Ala Glu Asp Glu A1a Asp Tyr Tyr Cys Asn Ser 225 230 , 235 240 Arg Asp Ser Ser Gly Asn His Val Val Phe Gly Gly Gly Thr,Lys".,Leu 245 250 2'55 Thr Val Leu Gly Ala Ala Ala Lys Ala Lys

Claims (323)

We claim:
1. An isolated epitope comprising the formula Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P is (A)m(A)n(X)u or (X)u(A)n(A)m or (A)n(X)u(A)m or (A)n(A)m(X)u or (X)u(A)m(A)n or (A)m(X)u(A)n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine; serine, or glycine q is 1 to 6 z is 0, 1, or 2 r is 0 or 1 t is 1, 2 or 3 a is 0 to 2 n is 0 to 3 m is 0 to 3 wherein if n = 0 then m >0; wherein if m = 0 then n >0; wherein if q is 1, r is 1, and if q is >1 at least one of Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
2. The isolated epitope of claim 1 wherein the sulfated moiety is a peptido or glyco or lipo conjugate.
3. The isolated epitope of claim 1 wherein:
W is Glycine, Y is a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine.
A is Glutamate, ~ Carboxy Glutamate or Aspartate q is 1, 2, or 3
4. The isolated epitope of claim 3 wherein:
Y is a peptido conjugate of Tyrosine q is 3 r is 1
5. An isolated epitope comprising the formula Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P is (A)m(A)n(X)u or (X)u(A)n(A)m or (A)n(X)u(A)m or (A)n(A)m(X)u or (X)u(A)m(A)n or (A)n,(X)u(A)n S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine z is 0, 1, or 2 r is 0 or 1 t is 1, 2 or 3 a is 0 to 2 n is 0 to 3 m is 0 to 3 wherein if n =0 then m > 0; wherein if m = 0 then n > 0; wherein at least one Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
6. The isolated epitope of claim 5 wherein the sulfated moiety is a peptido or glyco or lipo conjugate.
7. The isolated epitope of claim 5 wherein:
W is Glycine Y is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine A is Glutamate, .gamma. Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline, Phenylalanine, serine, or glycine.
8. The isolated epitope of claim 7 wherein:
Y is a peptido conjugate of Tyrosine q is 3; and r is 1
9. An isolated epitope comprising the formula Wherein:
G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the above z is 0, 1, or 2 t is 1, 2 or 3 r is 0 or 1 u is 0 to 2 n is 0 to 3 m is 0 to 3 wherein at least one Y is sulfated; wherein if n = 0 then m > 0; wherein if m = 0 then n >
0; and further wherein the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID
NO: 8 or SEQ ID NO: 20.
10. The isolated epitope of claim 9 wherein r is 1.
11. The isolated epitope of any one of claims 1-8, wherein the naturally occurring moiety that is capable of being sulfated Y comprises a lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule.
12. A homolog or mimetic of the isolated epitope of any one of claims 1-10.
13. The isolated epitope of any one of claims 1-10, wherein the isolated epitope comprises at least one post-translational modification in addition to sulfation.
14. A composition comprising the isolated epitope of any one of claims 1-10.
15. The composition of claim 14 further comprising an upstream or downstream region capable of improving the binding capacity of the epitope.
16. The composition of claim 15, wherein the upstream or downstream region is proximate to the epitope.
17. An isolated polynucleotide encoding at least a portion of the isolated epitope of any one of claims 1-10.
18. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with the isolated epitope of claim 1.
19. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with the isolated epitope of claim 5.
20. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with the isolated epitope of claim 9.
21. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with the isolated epitope of any of claims 2-4, 6-8, or 10-13.
22. A process for producing an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with the isolated epitope of any of claims 1-13, comprising the steps of (a) providing a phage display library;
(b) providing an isolated epitope according to any one of claims 1-13;

(c) panning the phage display library for a phage particle displaying an oligopeptide or polypeptide capable of binding to the isolated epitope; and (d) producing an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof comprising an antibody or binding fragment thereof, comprising the peptide or polypeptide capable of binding to the isolated epitope.
23. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, having the binding capabilities of the scFv antibody fragment of SEQ ID NO: 25 or SEQ ID NO: 203.
24. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, having the binding capabilities of a peptide or polypeptide, wherein the peptide or polypeptide comprises a first hypervariable region comprising or SEQ ID NO: 8 or SEQ ID NO: 20.
25. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof of any one of claims 23-24, further wherein the peptide or polypeptide has a second hypervariable region comprising SEQ ID
NO: 115 and/ or a third hypervariable region comprising SEQ ID NO: 114.
26. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof comprising an antibody or binding fragment thereof, that is capable of binding to a peptide or polypeptide epitope of about 3 to about 126 amino acid residues in length and comprising at least 2 acidic amino acids and at least one sulfated tyrosine residue.
27. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 26, wherein the epitope further comprises a proline, leucine, isoleucine, serine, glycine, or phenylalanine residue.
28. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of any of claims 23-27, wherein the antibody or antigen-binding fragment thereof further is capable of binding to an epitope on a carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule.
29. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 28, further wherein the epitope on the carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule comprises at least one sulfated moiety.
30. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, that is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin.
31. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, that is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin and is capable of binding to at least one cell type selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells.
32. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 31, that is capable of binding to each of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., and heparin.
33. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 32, capable of binding to each of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., and heparin and is capable of binding to at least one cell type selected from the group consisting of B-CLL cells, AML
cells, multiple myeloma cells, and metastatic cells.
34. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, that is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin and further is capable of binding to an epitope on a lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule.
35. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 34, further wherein the epitope on the lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule comprises at least one sulfated moiety.
36. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, that is capable of crossreacting with two or more epitopes, each epitope comprising one or more sulfated tyrosine residues and at least one cluster of two or more acidic amino acids.
37. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that is capable of crossreacting with PSGL-1.
38. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 37 that binds to QATEYEYLDYDFLPETE wherein at least one tyrosine residue is sulfated.
39. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that is capable of crossreacting with GP1b-.alpha..
40. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that binds to DEGDTDLYDYYPEEDTEGD wherein at least one tyrosine residue is sulfated.
41. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 39 that binds to TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated.
42. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 39 that binds to DEGDTDLYDYYP wherein at least one tyrosine residue is sulfated.
43. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 39 that binds to YDYYPEE
wherein at least one tyrosine residue is sulfated.
44. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 39 that binds to TDLYDYYP
wherein at least one tyrosine residue is sulfated.
45. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that is capable of crossreacting with fibrinogen gamma prime (.gamma.').
46. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 45 that binds to EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated.
47. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that is capable of crossreacting with heparin.
48. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that is capable of crossreacting with complement compound 4 (CC4).
49. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 48 that binds to MEANEDYEDYEYDELPAK wherein at least one tyrosine residue is sulfated.
50. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of Claim 36 that is capable of crossreacting with at least one cell type selected from the group consisting of B-CLL
cells, AML cells, multiple myeloma cells, and metastatic cells.
51. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting cell rolling.
52. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting inflammation.
53. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting auto-immune disease.
54. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting thrombosis.
55. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting restenosis.
56. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting metastasis.
57. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting growth and/ or replication of tumor cells.
58. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of increasing mortality of tumor cells.
59. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting growth and/ or replication of leukemia cells.
60. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of increasing the mortality rate of leukemia cells.
61. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of increasing the susceptibility of diseased cells to damage by anti-disease agents.
62. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of increasing the susceptibility of tumor cells to damage by anti-cancer agents.
63. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of increasing the susceptibility of leukemia cells to damage by anti-leukemia agents.
64. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting increase in number of tumor cells in a patient having a tumor.
65. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of decreasing the number of tumor cells in a patient having cancer.
66. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting increase in number of leukemia cells in a patient having leukemia.
67. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of decreasing the number of leukemia cells in a patient having leukemia.
68. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/
or cell-platelet complex formation.
69. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/
or cell-platelet adhesion.
70. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/
or cell-platelet aggregation.
71. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
72. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 71, wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
73. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 71, wherein the agent is an anti-thrombosis/ anti- restenosis agent selected from the group consisting of cilostazol, dalteparin sodium, reviparin sodium, and aspirin.
74. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 71, wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid.
75. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 71, wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide.
76. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 71, wherein the agent is an anti-adhesion/anti-aggregation agent selected from the group consisiting of limaprost, clorcromene, and hyaluronic acid.
77. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 71 wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents.
78. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 77 wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof.
79. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 77 wherein the radioisotope is selected from the group consisting of gamma-emitters, positron-emitters, x-ray emitters, beta-emitters, and alpha-emitters.
80. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 77 wherein the radioisotope is selected from the group consisting of 111indium, 113indium, 99m rhenium, 105rhenium, 101rhenium, 99m technetium, 121m tellurium, 122m tellurium, 125m telluriunm 165thulium, 167thulium, 168thulium, 123iodine, 126iodine, 131iodine, 133iodine, 81m krypton, 33xenon, 90yttrium, 213bismuth, 77bromine, 18fluorine, 95ruthenium, 97ruthenium, 103ruthenium, 105ruthenium, 107mercury, 203mercury 67gallium and 68gallium.
81. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 77 wherein the pharmaceutical agent is selected from the group consisting of doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.
82. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
83. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 wherein the vehicle or carrier is selected from the group consisting of dextran, lipophilic polymers, HPMA, and liposomes.
84. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any of claims 18-20, 23, or 24 coupled to or complexed with a radioactive isotope or other imaging agent.
85. A diagnostic kit comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 84.
86. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit cell rolling.
87. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit inflammation.
88. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit auto-immune disease.
89. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit thrombosis.
90. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit restenosis.
91. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit metastasis.
92. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit growth and/ or replication of tumor cells.
93. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to increase mortality of tumor cells.
94. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit growth and/ or replication of leukemia cells.
95. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to increase the mortality rate of leukemia cells.
96. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to increase the susceptibility of diseased cells to damage by anti-disease agents.
97. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to increase the susceptibility of tumor cells to damage by anti-cancer agents.
98. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to increase the susceptibility of leukemia cells to damage by anti-leukemia agents.
99. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit increase in number of tumor cells in a patient having a tumor.
100. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to decrease number of tumor cells in a patient having a tumor.
101. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit increase in number of leukemia cells in a patient having leukemia.
102. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to decrease number of leukemia cells in a patient having leukemia.
103. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet aggregation.
104. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet complex formation.
105. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in an amount effective to inhibit cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet adhesion.
106. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis,anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
107. The pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 106, wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
108. The pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 106, wherein the agent is an anti-thrombosis/ anti-restenosis agent selected from the group consisting of cilostazol, dalteparin sodium, reviparin sodium, and aspirin.
109. The pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 106, wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid.
110. The pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 106, wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide.
111. The pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to claim 106, wherein the agent is an anti-adhesion/anti-aggregation agent selected from the group consisiting of limaprost, clorcromene, and hyaluronic acid.
112. A pharmaceutical composition according to claim 106 wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents.
113. A pharmaceutical composition according to claim 106 wherein the toxin is selected from the group consisting of gelonin, Pseudonaouas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof.
114. A pharmaceutical composition according to claim 106 wherein the radioisotope is selected from the group consisting of gamma-emitters, positron-emitters, x-ray emitters, beta-emitters, and alpha-emitters.
115. A pharmaceutical composition according to claim 106 wherein the radioisotope is selected from the group consisting of 111indium, 113indium, 99m rhenium, 105rhenium, 101rhenium, 99m technetium, 121m tellurium, 122m tellurium, 125m telluriunm 165thulium, 167thulium 168thulium 123iodine, 126iodine, 131iodine, 133iodine, 81m krypton, 33xenon, 90yttrium, 213bismuth, 77bromine, 18fluorine, 95ruthenium, 97ruthenium, 103ruthenium, 105ruthenium, 107mercury, 203mercury, 67gallium and 68gallium.
116. A pharmaceutical composition according to claim 106 wherein the pharmaceutical agent is selected from the group consisting of doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.
117. A pharmaceutical composition, comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
118. A pharmaceutical composition according to claim 117 wherein the vehicle or carrier is selected from the group consisting of dextran, lipophilic polymers, HPMA, and liposomes.
119. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting cell-rolling.
120. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting inflammation.
121. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting auto-immune disease.
122. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting restenosis.
123. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting thrombosis.
124. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting metastasis.
125. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting growth and/ or replication of tumor cells.
126. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of increasing the mortality rate of tumor cells.
127. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting growth and/ or replication of leukemia cells.
128. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of increasing the mortality rate of leukemia cells.
129. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of increasing the susceptibility of diseased cells to damage by anti-disease agents.
130. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of increasing the susceptibility of tumor cells to damage by anti-cancer agents.
131. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of increasing the susceptibility of leukemia cells to damage by anti-leukemia agents.
132. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting increase in number of tumor cells in a patient having a tumor.
133. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of decreasing number of tumor cells in a patient having a tumor.
134. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting increase in number of leukemia cells in a patient having leukemia.
135. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of decreasing number of leukemia cells in a patient having leukemia.
136. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet complex formation.
137. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet aggregation.
138. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 in the manufacture of a medicament that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet adhesion.
139. The method of any one of claims 119-138, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, is coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis,anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
140. The method of claim 139, wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
141. The method of claim 139, wherein the agent is an anti-thrombosis/ anti-restenosis agent selected from the group consisting of cilostazol, dalteparin sodium, reviparin sodium, and aspirin.
142. The method of claim 139, wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtohnetin, celecoxib, indomethacin, rofecoxib, and nimesulid.
143. The method of claim 139, wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide.
144. The method of claim 139, wherein the agent is an anti-adhesion/anti-aggregation agent selected from the group consisiting of limaprost, clorcromene, and hyaluronic acid.
145. The method of claim 139, wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents.
146. The method of claim 139, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof.
147. The method of claim 139, wherein the radioisotope is selected from the group consisting of gamma-emitters, positron-emitters, x-ray emitters, beta-emitters, and alpha-emitters.
148. The method of claim 139, wherein the radioisotope is selected from the group consisting of 111indium, 113indium, 99rhenium, 105rhenium, 101rhenium, 99m technetium, 121m tellurium,122m tellurium, 125m telluriunm 165thulium, 167thulium 168thulium 123iodine, 126iodine, 131iodine, 133iodine, 81m krypton, 33xenon, 90yttrium, 213bismuth, 77bromine, 18fluorine, 95ruthenium, 97ruthenium, 103ruthenium, 105ruthenium, 107mercury, 203mercury, 67gallium and 68gallium.
149. The method of claim 139, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.
150. The method of any one of claims 119-138, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, is coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
151. The method of claim 150 wherein the vehicle or carrier is selected from the group consisting of dextran, lipophilic polymers, HPMA, and liposomes.
152. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting cell rolling.
153. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting inflammation.
154. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting auto-immune disease.
155. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting restenosis.
156. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting thrombosis.
157. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting metastasis.
158. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting growth and/ or replication of tumor cells.
159. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of increasing the mortality rate of tumor cells.
160. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting growth and/ or replication of leukemia cells.
161. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of increasing the mortality rate of leukemia cells.
162. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of increasing the susceptibility of diseased cells to damage by anti-disease agents.
163. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of increasing the susceptibility of tumor cells to damage by anti-cancer agents.
164. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of increasing the susceptibility of leukemia cells to damage by anti-leukemia agents.
165. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting increase in number of tumor cells in a patient having a tumor.
166. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of decreasing number of tumor cells in a patient having a tumor.
167. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting increase in number of leukemia cells in a patient having leukemia.
168. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of decreasing number of leukemia cells in a patient having leukemia.
169. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet complex formation.
170. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet aggregation.
171. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 18-20, 23, or 24 for use as a medicament that is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet adhesion.
172. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 152-171, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, is coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
173. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
174. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the agent is an anti-thrombosis/ anti- restenosis agent selected from the group consisting of cilostazol, dalteparin sodium, revipaxin sodium, and aspirin.
175. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid.
176. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide.
177. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the agent is an anti-adhesion/anti-aggregation agent selected from the group consisting of limaprost, clorcromene, and hyaluronic acid.
178. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents.
179. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof.
180. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the radioisotope is selected from the group consisting of gamma-emitters, positron-emitters, x-ray emitters, beta-emitters, and alpha-emitters.
181. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the radioisotope is selected from the group consisting of 111indium, 113indium, 99m rhenium, 105rhenium, 101rhenium, 99m technetium,121m tellurium,122m tellurium, 125m telluriunm 165thulium, 167thulium 168thulium 123iodine, 126iodine, 131iodine, 133iodine, 81m krypton, 33xenon, 90yttrium, 213bismuth, 77bromine, 18fluorine, 95ruthenium, 97ruthenium, 103ruthenium, 105ruthenium, 107mercury, 203mercury, 67gallium and 68gallium.
182. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, of claim 172 wherein the pharmaceutical agent is selected from the group consisting of doxorubicin, methoxyrnorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.
183. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to any one of claims 152-171, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof is coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
184. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof of claim 183 wherein the vehicle or carrier is selected from the group consisting of dextran, lipophilic polymers, HPMA, and liposomes.
185. An isolated epitope comprising GPIb.alpha. amino acid sequence Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated.
186. The isolated epitope of claim 185 further comprising GPIb.alpha. amino acids 283-285.
187. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof that is capable of binding to the epitope of claim 185, wherein the binding is enhanced when the epitope of claim 185 further comprises GPIb.alpha. amino acids 283-285.
188. An isolated GP1ba N-terminal peptide having an apparent molecular weight of about 40 KDa, said peptide comprising an epitope having the sequence YDYYPEE, wherein at least one tyrosine residue in the epitope is sulfated.
189. An isolated GP1ba peptide consisting of amino acids 1 through 282, wherein at least one of amino acids 276, 278 and 279 is sulfated.
190. An antibody multimer comprising at least a first and a second antigen binding fragment, wherein the at least first or second antigen binding fragment or both is capable of binding or cross-reacting with an epitope comprising the formula Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P ~is (A)m(A)n(X)u or (X)u(A)n (A)m or (A)n(X)u(A)m or (A)n(A)m (X)u or (X)y(A)m(A)n or (A)m(X)u(A)n S ~is sulfate or a sulfated molecule X ~is any amino acid except Aspartate, Glutamate, or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine q is 1 to 6 z is 0,1,or 2 r is 0 or 1 t is 1,2 or 3 u is 0 to 2 n is 0 to 3 m is 0 to 3 wherein if n = 0 then m >0; wherein if m = 0 then n >0; wherein if q is 1, r is 1, and if q is >1 at least one of Y is sulfated.
191. An antibody multimer of claim 190 wherein the first or second antigen binding fragment or both binds or cross reacts with the epitope in which:
W ~is Glycine, Y ~is a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine.

A is Glutamate, .gamma. Carboxy Glutamate or Aspartate q is 1, 2, or 3.
192. An antibody multimer of claim 190 wherein the first or second antigen binding fragment or both binds or cross reacts with the epitope in which:
Y is a peptido conjugate of Tyrosine q is 3 r is 1.
193. An antibody multimer comprising at least a first and second antigen binding fragment, wherein the first or second antigen binding fragment or both is capableof binding or cross-reacting with an epitope comprising the formula Formula II
Wherein:
W is any amino acid other than Aspartate and Glutamate Y is any naturally occurring moiety that is capable of being sulfated P is (A)m(A)n(X)u or (X)u(A)n(A)m or (A)n(X)u(A)m or (A)n(A)m(X)u or (X)u(A)m(A)n or (A)m(X)u(A)n S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate or Tyrosine A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine z is 0, 1, or 2 r is 0 or 1 t is 1, 2 or 3 u is 0 to 2 n is 0 to 3 m is 0 to 3 wherein if n =0 then m > 0; wherein if m = 0 then n > 0; wherein at least one Y is sulfated.
194. An antibody multimer of claim 193 wherein the first or second antigen binding ragment or both binds or cross reacts with the epitope in which:
W is Glycine Y is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine A is Glutamate, .gamma. Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline, Phenylalanine, Serine, or Glycine.
195. An antibody multimer of claim 193 wherein the first or second antigen binding fragment or both binds or cross reacts with the epitope in which:
Y is a peptido conjugate of Tyrosine q is 3; and r is 1.
196. An antibody multimer comprising at least a first and second antigen binding fragment, wherein the at least first or second antigen binding fragment or both is capable of binding or cross-reacting with an epitope comprising the formula Wherein:
G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the above z is 0, 1, or 2 t is 1, 2 or 3 r is 0 or 1 u is 0 to 2 n is 0 to 3 m is 0 to 3 wherein at least one Y is sulfated; wherein if n = 0 then m > 0; wherein if m = 0 then n > 0.
197. An antibody multimer of claim 196 wherein the first or second antigen binding fragment or both binds or cross reacts with the epitope in which r is 1.
198. An antibody multimer of claim 190, 193 or 196 wherein the multimer is a dimer, trimer or tetramer.
199. An antibody multimer of claim 198 wherein the multimer is a dimer.
200. A dimer of claim 199 wherein at least one of the first and second antigen binding fragments is selected from scFv fragments of Y1 and Y17.
201. A dimer of claim 199 wherein the first and second antigen binding fragments are linked by a disulfide bridge.
202. A dimer of claim 201 wherein the first and second antigen binding fragments are Y1-CysKAK.
203. A dimer of claim 199 wherein the first and second antigen binding fragments are linked by a polypeptide linker of 5 to 20 amino acids.
204. A dimer of claim 203 wherein the polypeptide linker comprises 5 amino acids.
205. A dimer of claim 204 wherein the polypeptide linker is Gly4Ser.
206. An antibody multimer of claim 198 wherein the multimer is a trimer.
207. A trimer of claim 206 comprising three antigen binding fragments, wherein at least one of the antigen binding fragments is a Y1 scFv fragment or Y17 scFv fragment.
208. A trimer of claim 207 wherein the antigen binding fragments are linked by a polypeptide linker.
209. A trimer of claim 208 wherein the polypeptide linker comprises 1 to 5 amino acids.
210. An antibody multimer of claim 198 wherein the multimer is a tetramer.
211. A tetramer of claim 210 comprising four antigen binding fragments, wherein at least one of the antigen binding fragments is a Y1 scFv fragment or Y17 scFv fragment.
212. A tetramer of claim 211 wherein the antigen binding fragments are linked by a polypeptide linker.
213. A tetramer of claim 212 wherein the polypeptide linker comprises 1 to 5 amino acids.
214. A tetramer of claim 210 wherein the four antigen binding fragments form a complex through streptavidin-biotin association.
215. An antibody multimer of claim 198 comprising identical antigen binding fragments.
216. An antibody multimer of claim 198 wherein the at least first or second antigen binding fragment comprises a first hypervariable region comprising SEQ ID NO:
8.
217. An antibody multimer of claim 198 wherein the at least first or second antigen binding fragment or both comprises a first hypervariable region comprising SEQ
ID
NO:20.
218. An antibody multimer of claim 216 or 217 wherein the at least first or second antigen binding fragment or both has a second hypervariable region comprising SEQ ID
NO: 115 and/ or a third hypervariable region comprising SEQ ID NO: 114.
219. An antibody multimer of any one of claims 190, 193, 196, 216 and 217 wherein the multimer is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin.
220. An antibody multimer of any one of claims 190, 193, 196, 216 and 217 wherein the multimer is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen gamma prime (.gamma.'), GP1b.alpha., heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin and is capable of binding to at least one cell type selected from the group consisting of B-CLL
cells, AML
cells, multiple myeloma cells, and metastatic cells.
221. An antibody dimer comprising a first and second antigen binding fragment, wherein said first or second antigen binding fragment or both comprises a hypervariable region comprising the amino acid sequence of SEQ ID NO: 8 [Y1 CDR3].
222. An antibody dimer comprising a first and second antigen binding fragment, wherein said first or second antigen binding fragment or both comprise a hypervariable region comprising the amino acid sequence of SEQ ID NO: 20 [Y17 CDR3].
223. An antibody dimer of claim 221 or 222, wherein said first or second antigen binding fragment or both further comprises a second hypervariable region comprising the amino acid sequence of SEQ ID NO:115 and/or a third hypervariable region comprising SEQ ID NO: 114.
224. An antibody multimer comprising a first and second antigen binding fragment, wherein said first or second antigen binding fragment or both is capable of cross-reacting with two or more epitopes, each epitope comprising one or more sulfated tyrosine residues and at least one cluster of two or more acidic amino acids.
225. An antibody multimer of claim 224 wherein said multimer is capable of cross reacting with PSGL-1.
226. An antibody multimer of claim 224 that binds to QATEYEYLDYDFLPETE
wherein at least one tyrosine residue is sulfated.
227. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with GP1b-.alpha..
228. An antibody multimer of claim 224 that binds to DEGDTDLYDYYPEEDTEGD
wherein at least one tyrosine residue is sulfated.
229. An antibody multimer of claim 224 that binds to TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated.
230. An antibody multimer of claim 224 that binds to DEGDTDLYDYYP wherein at least one tyrosine residue is sulfated.
231. An antibody multimer of claim 224 that binds to to YDYYPEE wherein at least one tyrosine residue is sulfated.
232. An antibody multimer of claim 224 that binds to to TDLYDYYP wherein at least one tyrosine residue is sulfated.
233. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with fibrinogen gamma prime.
234. An antibody multimer of claim 233 that binds to EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated.
235. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with heparin.
236. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with complement 4 (CC4).
237. An antibody multimer of claim 224 that is capable of cross-reacting with at least one cell selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells and metastatic cells.
238. A pharmaceutical composition comprising an antibody multimer according to any one of claims 1, 4, 7, 27 and 28.
239. A pharmaceutical composition of claim 238 comprising the antibody multimer in an effective amount to increase mortality of tumor cells or to increase the susceptibility of tumor cells to damage by an anti-cancer agent.
240. A pharmaceutical composition of claim 238 comprising the antibody multimer in an effective amount to inhibit growth and/or replication of leukemia cells.
241. A pharmaceutical composition of claim 238 comprising the antibody multimer in an effective amount to inhibit abnormal cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/or platelet-cell adhesion.
242. A pharmaceutical composition of claim 238 comprising the antibody multimer in an effective amount to increase the susceptibility of diseased cells to damage by anti-disease agents.
243. A pharmaceutical composition of claim 238 comprising the antibody multimer in an effective amount to increase the mortality of leukemia cells amount or to increase the susceptibility of leukemia cells to damage by anti-leukemia agents.
244. A pharmaceutical composition comprising an antibody multimer according to any one claims 190, 193, 196, 216 and 217 coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-auto-immune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
245. A pharmaceutical composition of claim 244 wherein the agent is selected from the group consisting of toxins, radioisotopes and pharmaceutical agents.
246. A pharmaceutical composition of claim 244 wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
247. A pharmaceutical composition of claim 244 wherein the agent is an anti-thrombosis/ anti- restenosis agent selected from the group consisting of cilostazol, dalteparin sodium, reviparin sodium, and aspirin.
248. A pharmaceutical composition of claim 244 wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid.
249. A pharmaceutical composition of claim 244 wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide.
250. A pharmaceutical composition of claim 244 wherein the agent is an anti-adhesion/anti-aggregation agent selected from the group consisiting of limaprost, clorcromene, and hyaluronic acid.
251. A pharmaceutical composition of claim 245 wherein the the radioisotope is selected from the group consisting of gamma-emitters, positron-emitters, x-ray emitters, beta-emitters, and alpha-emitters.
252. A pharmaceutical composition of claim 251 wherein the wherein the radioisotope is selected from the group consisting of 111indium, 113indium, 99m rhenium, 105rhenium, 101rhenium, 99m technetium, 121m tellurium, 122m tellurium, 125m telluriunm 165thulium, 167thulium 168thulium 123iodine, 126iodine, 131iodine, 133iodine, 81m krypton, 33xenon, 99yttrium, 213bismuth, 77bromine, 18fluorine, 95ruthenium, 97ruthenium, 103ruthenium, 105ruthenium 107mercury, 203mercury, 67gallium and 68gallium.
253. A pharmaceutical composition of claim 245 wherein the pharmaceutical agent is selected from the group consisting of doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.
254. A pharmaceutical agent of claim 244 coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
255. A pharmaceutical composition of claim 254 wherein the vehicle or carrier is selected from the group consisting of dextan, lipophiolic polymers, HPMA and liposomes.
256. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit cell rolling.
257. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit inflammation.
258. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit auto-immune disease.
259. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit thrombosis.
260. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit restenosis.
261. A pharmaceutical composition of claim 238 in an amount effective to inhibit metastasis.
262. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit growth and/ or replication of tumor cells, increase mortality of tumor cells, or increase the susceptibility of tumor cells to damage by anti-cancer agents.
263. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit growth and/ or replication of leukemia cells, increase the mortality rate of leukemia cells or increase the susceptibility of leukemia cells to damage by anti-leukemia agents.
264. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to increase the susceptibility of diseased cells to damage by anti-disease agents.
265. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/
or cell-platelet aggregation, adhesion or complex formation.
266. A pharmaceutical composition of claim 238 coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis,anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
267. A pharmaceutical composition of claim 266 wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
268. A pharmaceutical composition of claim 238 wherein the antibody multimer is coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
269. A pharmaceutical composition of claim 238 wherein the vehicle or carrier is selected from the group consisting of dextran, lipophilic polymers, HPMA, and liposomes.
270. The use of an antibody multimer according to any one of claims 1, 4, 7, 27 and 28 in the manufacture of a medicament that inhibits cell-rolling.
271. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217, in the manufacture of a medicament that inhibits inflammation.
272. The use of an antibody multimer according to any one of claims 1, 4, 7, 27 and 28 in the manufacture of a medicament that inhibits auto-immune disease.
273. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits restenosis.
274. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits thrombosis.
275. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits metastasis.
276. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits growth and/ or replication of tumor cells.
277. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217, in the manufacture of a medicament that increases the mortality rate of tumor cells.
278. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits growth and/ or replication of leukemia cells.
279. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that increases the mortality rate of leukemia cells.
280. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that increases the susceptibility of diseased cells to damage by anti-disease agents.
281. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that increases the susceptibility of tumor cells to damage by anti-cancer agents.
282. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that increases the susceptibility of leukemia cells to damage by anti-leukemia agents.
283. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits increase in number of tumor cells in a patient having a tumor.
284. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that decreases number of tumor cells in a patient having a tumor.
285. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits increase in number of leukemia cells in a patient having leukemia.
286. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that decreases number of leukemia cells in a patient having leukemia.
287. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/or cell-platelet complex formation.
288. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/or cell-platelet aggregation.
289. The use of an antibody multimer according to any one of claims 190, 193, 196, 216 and 217 in the manufacture of a medicament that inhibits cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and/ or cell-platelet adhesion.
290. The method of any one of claims 270-289, wherein the antibody multimer is coupled to or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis,anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti-inflammatory agents.
291. The method of claim 290, wherein the agent is an anti-viral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine.
292. The method of claim 290, wherein the agent is an anti-thrombosis/ anti-restenosis agent selected from the group consisting of cilostazol, dalteparin sodium, reviparin sodium, and aspirin.
293. The method of claim 290, wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid.
294. The method of claim 290, wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide.
295. The method of claim 290, wherein the agent is an anti-adhesion/anti-aggregation agent selected from the group consisiting of limaprost, clorcromene, and hyaluronic acid.
296. The method of claim 290, wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents.
297. The method of claim 290, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof.
298. The method of claim 290, wherein the radioisotope is selected from the group consisting of gamma-emitters, positron-emitters, x-ray emitters, beta-emitters, and alpha-emitters.
299. The method of claim 290, wherein the radioisotope is selected from the group consisting of 111indium, 113indium, 99m rhenium, 105rhenium, 101rhenium, 99m technetium, 121m tellurium, 122m tellurium, 125m telluriunm 165thulium, 167thulium 168thulium 123iodine, 126iodine, 131iodine, 133iodine, 81m krypton, 33xenon, 90yttrium, 213bismuth, 77bromine, 18fluorine, 95ruthenium, 97ruthenium, 103ruthenium, 105ruthenium, 107mercury, 203mercury, 67gallium and 68gallium.
300. The method of claim 290, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.
301. The method of any one of claims 270-289, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, is coupled to or complexed with a vehicle or carrier that is capable of being coupled or complexed to more than one agent.
302. The method of claim 301 wherein the vehicle or carrier is selected from the group consisting of dextran, lipophilic polymers, HPMA, and liposomes.
303. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits cell rolling.
304. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits inflammation.
305. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits auto-immune disease.
306. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits restenosis.
307. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits thrombosis.
308. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits metastasis.
309. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits growth and/ or replication of tumor cells.
310. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that increases the mortality rate of tumor cells.
311. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as for use as a medicament that inhibits growth and/ or replication of leukemia cells.
312. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that increases the mortality rate of leukemia cells.
313. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that increases the susceptibility of diseased cells to damage by anti-disease agents.
314. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that increases the susceptibility of tumor cells to damage by anti-cancer agents.
315. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that increases the susceptibility of leukemia cells to damage by anti-leukemia agents.
316. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that inhibits increase in number of tumor cells in a patient having a tumor.
317. The antibody multimer according to any one of claims 190, 193, 196, 216 and 217 for use as a medicament that decreases number of tumor cells in a patient having a tumor.
318. A polyclonal antibody, antibody fragment or antibody complex that cross-reacts with the variable light chain of human monoclonal antibody scFv Y1.
319. The polyclonal antibody, antibody fragment or antibody complex of claim that cross-reacts with a NdeI-EcoR1 restriction fragment of the variable light chain of human monoclonal antibody Y-1.
320. A diagnostic kit comprising the antibody or antibody fragment or complex of any of claims318-319.
321. A composition comprising the antibody or antibody fragment or complex of any of claims318-319 conjugated to doxirubicin.
322. A composition comprising the antibody or antibody fragment or complex of any of claims318-319 and a pharmaceutically acceptable carrier selected from the group consisting of dextran, HPMA, and lipophilic polymers.
323. A composition comprising the antibody or antibody fragment or complex of any of claims318-319 admixed with a doxirubicin-decorated liposome.
CA002433225A 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof Abandoned CA2433225A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US75118100A 2000-12-29 2000-12-29
US25894800P 2000-12-29 2000-12-29
US60/258,948 2000-12-29
US09/751,181 2000-12-29
PCT/US2001/049442 WO2002053700A2 (en) 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Publications (1)

Publication Number Publication Date
CA2433225A1 true CA2433225A1 (en) 2002-07-11

Family

ID=26946974

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002433225A Abandoned CA2433225A1 (en) 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Country Status (13)

Country Link
EP (1) EP1406930A4 (en)
JP (1) JP2005503756A (en)
KR (1) KR20030091953A (en)
CN (1) CN100347194C (en)
BR (1) BR0116764A (en)
CA (1) CA2433225A1 (en)
CZ (1) CZ20031982A3 (en)
HU (1) HUP0700079A2 (en)
IL (1) IL156689A0 (en)
MX (1) MXPA03005945A (en)
PL (1) PL366223A1 (en)
RU (1) RU2003123101A (en)
WO (1) WO2002053700A2 (en)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040116333A1 (en) 2001-08-03 2004-06-17 Rong-Hwa Lin Modulators of P-selectin glycoprotein ligand 1
US7744888B2 (en) 2001-08-03 2010-06-29 Abgenomics Cooperatief U.A. Methods of modulating T cell or natural killer cell activity with anti-P-selectin glycoprotein ligand 1 antibodies
CA2491427A1 (en) * 2002-07-01 2004-01-08 Savient Pharmaceuticals, Inc. Compositions and methods for therapeutic treatment
CA2531283A1 (en) * 2003-06-30 2005-01-20 Bio-Technology General (Israel) Ltd. Specific human antibodies
MXPA06000252A (en) * 2003-06-30 2006-12-15 Bio Technology General Israel Antibodies and uses thereof.
ITMI20031714A1 (en) * 2003-09-05 2005-03-06 Gentium Spa FORMATIONS FOR ANTITUMORAL ACTION.
UY28886A1 (en) 2004-05-10 2005-12-30 Boehringer Ingelheim Int ANTIBODIES CONSISTING IN POLYPEPTIDES AND DERIVATIVES UNDERSTANDING THREE SEQUENCES CONCERNING THE FOLLOWING NUMBERS OF SEQ. ID: 1-3 AND 4-6; 7-9 AND 10-12 AND 13-15 OR 16-18
CA2565872C (en) * 2004-05-11 2016-06-21 Abgenomics Corporation T-cell death-inducing epitopes
CN103260627A (en) 2010-11-12 2013-08-21 真蒂奥姆有限公司 Defibrotide for use in prophylaxis and/or treatment of graft versus host disease (gvhd).
EP2718325A4 (en) 2011-06-13 2015-03-11 ABGENOMICS COöPERATIEF U A Anti-psgl-1 antibodies and uses thereof
DK2864496T4 (en) 2012-06-22 2021-01-04 Gentium S R L EUGLOBULIN-BASED PROCEDURE FOR DETERMINING THE BIOLOGICAL ACTIVITY OF DEFIBROTID
WO2016013828A1 (en) * 2014-07-21 2016-01-28 연세대학교 산학협력단 Extracellular domain 1 mutant of sulfated duffy chemokine receptor, and use thereof
EP3026122A1 (en) 2014-11-27 2016-06-01 Gentium S.p.A. Cellular-based method for determining the potency of defibrotide
JP2019031486A (en) * 2017-08-04 2019-02-28 公立大学法人福島県立医科大学 Novel polypeptide and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011778A1 (en) * 1991-12-12 1993-06-24 The Scripps Research Institute Bifunctional antithrombotic molecules and antithrombotic polypeptides
HUP9901131A2 (en) * 1995-06-14 1999-07-28 The General Hospital Corporation P-selectin ligands and related molecules and methods
JPH11510543A (en) * 1995-08-03 1999-09-14 ボード オブ リージェンツ オブ ザ ユニヴァーシティー オブ オクラホマ O-glycan inhibitors of peptide and selectin-mediated inflammation
US5985833A (en) * 1996-09-17 1999-11-16 Wisconsin Alumni Research Foundation Thrombin inhibitor
US6593459B1 (en) * 1998-06-16 2003-07-15 The Board Of Regents Of The University Of Oklahoma Synthetic glycosulfopeptides and methods of synthesis thereof

Also Published As

Publication number Publication date
BR0116764A (en) 2007-01-09
WO2002053700A2 (en) 2002-07-11
WO2002053700A3 (en) 2004-02-12
EP1406930A2 (en) 2004-04-14
EP1406930A4 (en) 2007-01-10
IL156689A0 (en) 2004-01-04
PL366223A1 (en) 2005-01-24
MXPA03005945A (en) 2004-10-15
KR20030091953A (en) 2003-12-03
CN100347194C (en) 2007-11-07
JP2005503756A (en) 2005-02-10
HUP0700079A2 (en) 2007-05-02
RU2003123101A (en) 2005-03-10
CZ20031982A3 (en) 2004-09-15
CN1649900A (en) 2005-08-03

Similar Documents

Publication Publication Date Title
US20040002450A1 (en) Y17 - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001822A1 (en) Y1-isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001839A1 (en) Multimers - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20070149768A1 (en) Specific human antibodies for selective cancer therapy
US20090220486A1 (en) Antibodies and uses thereof
CA2433225A1 (en) Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
AU2002246737B2 (en) Specific human antibodies for selective cancer therapy
JP2005503756A5 (en)
AU2002246737A1 (en) Specific human antibodies for selective cancer therapy
US20040202665A1 (en) Compositions and methods for therapeutic treatment
CA2491363A1 (en) Antibodies and uses thereof
US20080274100A1 (en) Antibodies and uses thereof
AU2003279657A1 (en) Compositions and methods for therapeutic treatment
EP1649001A2 (en) Antibodies and uses thereof
CA2531283A1 (en) Specific human antibodies
US20040208877A1 (en) Antibodies and uses thereof
AU2002246738A1 (en) Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued