MXPA03005945A - Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof. - Google Patents

Abstract

The present invention provides epitopes present on cancer cells and important in physiological phenomena such as cell rolling, metastasis, and inflammation. Therapeutic and diagnostic methods and compositions using antibodies capable of binding to the epitopes are provided. Methods and compositions according to the present invention can be used in diagnosis of and therapy for such diseases as cancer, including tumor growth and metastasis, leukemia, auto-immune disease, and inflammatory disease.

Description

ISOLATED MOLECULES THAT COMPRISE EPITOPES CONTAINING SULPHATE GROUPS, ANTIBODIES FOR SUCH EPITOPES AND USES OF THEM FIELD OF THE INVENTION The present invention relates to epitopes that are present in cells, such as cancer cells, metastatic cells, leukemia cells, and platelets, and which are important in diverse physiological phenomena such as cell coiling, metastasis, inflammation, autoimmune diseases, as idiopathic thrombocytopenic purpura (ITP), adhesion, thrombosis and / or restenosis, and aggregation. The present invention relates to therapeutic and diagnostic methods and compositions that use antibodies directed against such epitopes. The present invention also relates to the field of tissue indication and identification, with the aid of phage display technology, of peptides and polypeptides that specifically bind to target cells. Such peptides and polypeptides are antibodies and fragments thereof that bind to antigens, altered sequences thereof, fragments of either "or altered sequences of a fragment." More particularly, the peptides and polypeptides may have an anti-cancer activity, an anti-metastatic activity, a anti-leukemia activity, an antiviral activity, an anti-infective activity, and / or an activity against other diseases, such as inflammatory diseases, diseases consisting of abnormal or pathogenic adhesion, thrombosis and / or restenosis, diseases consisting of abnormal or pathogenic aggregation , and autoimmune diseases, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by protein-protein tyrosine-dependent interactions and diseased cells in general.

BACKGROUND OF THE INVENTION Antibodies, Presentation of Phages, and Indication of Tissues The selective indication of the tissue of therapeutic agents is a discipline emerging in the pharmaceutical industry. New treatments for cancer based on the indication of targets have been designed to increase the specificity and potency of the treatment while simultaneously reducing toxicity, thereby improving overall efficacy. Monoclonal antibodies from mice (MAb) have been used for antigens associated with tumors, in an attempt to target toxins, radionucleotides, and chemotherapeutic conjugates to tumors. In addition, different antigens, such as CD19, CD20, CD22 and CD25, have been exploited as cancer-specific targets in the treatment of nematopoietic diseases. Although it has been extensively studied, this approach has several limitations. One of the limitations is the difficulty of isolating appropriate monoclonal antibodies that exhibit selective binding. A second limitation is the need for high immunogenicity of the antibody as a prerequisite for successful isolation of the antibody. A third limitation is that the final product comprises non-human sequences, which gives rise to an immune response to non-human material (eg, a human anti-mouse antibody response). The answer ????. it often results in a shorter half-life of the serum and prevents repetitive treatments, thus decreasing the therapeutic value of the antibody. This last limitation has an interest stimulated both in the creation of chimeric or humanized monoclonal antibodies of mouse origin, and in the discovery of human antibodies. Another limitation of this approach is that it allows the isolation of only one species of antibody directed against only known and purified antigens. Moreover, this method is not selective insofar as it allows the isolation of antibodies against cell surface markers that are present in normal as well as malignant cells.

There are many factors that influence the therapeutic efficacy of MAb to treat cancer. These factors include the specificity of antigen expression in tumor cells, the level of expression, antigenic heterogeneity and accessibility of the tumor mass. Leukemia and lymphoma have generally been more sensitive to antibody treatment than solid tumors, such as carcinomas. MAbs rapidly bind to leukemia and lymphoma cells in the bloodstream and easily penetrate malignant cells in lymphatic tissue, making lymphoid tumors excellent candidates for MAb-based therapy. An ideal system involves identifying a MAb that recognizes a marker on the cell surface of stem cells that are producing malignant progeny cells.

Phage libraries are used to identify single-stranded Fv (scFv) that bind to isolated predetermined target proteins such as antibodies, hormones and receptors. In addition, the use of antibody presentation libraries in general, and phage scFv libraries in particular, provides an alternative means of discovering unique molecules to target groups of specific cell surfaces, not yet recognized and not determined.

Leukemia, lymphoma and myeloma are cancers that originate in the bone marrow and lymphatic tissues and are involved in the uncontrolled growth of cells. Acute lymphoblastic leukemia (ALL) is a heterogeneous disease defined by specific clinical and immunological characteristics. Like other forms of ALL, the definitive cause of most cases of ALL of B cells (B-ALL) is not known, although in many cases, the disease is the result of genetic alterations acquired in the DNA of a single cell, which causes it to become abnormal and multiply continuously. The prognosis for patients affected by B-ALL is significantly worse than for patients with other leukemias, both in children and adults.

Acute Myelogenous Leukemia (AML) is a heterogeneous group of neoplasms with a progenitor cell that, under normal conditions, gives origin to terminally differentiated cells of the myeloid series (erythrocytes, granulocytes, monocytes and platelets). As in other forms of neoplasm, AML is associated with acquired genetic alterations that result in myeloid cells differentiated normally with relatively undifferentiated blasts, which present one or more types of early myeloid differentiation. AML usually evolves in the bone marrow and, to a lesser extent, in the secondary hematopoietic organs. AML mainly affects adults, with peak incidence at ages 15 to 40 years, but it is also known to affect both children and older adults. Almost all patients with AML require treatment immediately after diagnosis to achieve clinical remission, where there is no evidence of abnormal levels of undifferentiated blasts cells in circulation.

To date, a variety of monoclonal antibodies have been developed that induce cytolytic activity against tumor cells. A humanized version of the monoclonal antibody MuMAb4D5, targeting the extracellular domain of P185, growth factor receptor (HER2), was approved by the FDA (Food and Drug Association) and is being used to treat human breast cancer (US Patent Nos. 5,821,337 and 5,720,954). After binding, the antibody is capable of inhibiting the growth of tumor cells that depends on the growth factor receptor HER2. In addition, a chimeric antibody to CD20, which causes rapid depletion of peripheral B cells, including those associated with lymphoma, was recently approved by the FDA (US Patent No. 5,843,439). The binding of this antibody to target cells results in complement-dependent lysis. This product has recently been approved and is currently being used in clinical medicine to treat low-level B-cell non-Hodgkin lymphomas.

Various other humanized and chimeric antibodies are in development or in clinical trials. In addition, a humanized Ig that specifically reacts with CD33 antigen, expressed both on normal myeloid cells and in most types of myeloid leukemia cells, was conjugated to calicheamicin anticancer drug, - CMA-676 (Sievers et al, Blood Supplement, 308, 504a (1997)). This conjugate, called MYLOTA G® drug, has recently received approval from the FDA (Caron et al, Cancer Supplement, 73, 1049-1056 (1994)). In light of its cytolytic activity, an additional anti-CD.33 (HumM195), currently in clinical trial, antibody to various cytotoxic agents, including gelonin will toxin (McGraw et al, Cancer Immunol. Immunother, 39, 367 conjugated -374 (1994)) and radioisotopes 131I the (Charon et al, Blood 83, 1760-1768 (1994)), 90Y (Jurcic et al, Blood Supplement 92, 613a (1998)) and 213Bi (Humm et al, Supplement de Sangre, 38: 231P (1997)).

A chimeric antibody against leukocyte antigen CD45 (cHuLym3) is a clinical study for the treatment of human leukemia and lymphoma (Sun et al, Cancer Immunol. Immunother., 48, 595-602 (2000)). In in vitro assays, the lysis of specific cells was observed in ADCC assays (antibody-dependent cell-mediated cytotoxicity) (Henkart, Immunity, 1, 343-346 (1994); Squier and Cohen, Current Opin. Immunol., 6 , 447-452 (1994)).

In contrast to the humanization and mouse monoclonal construction of chimeric antibodies, the use of phage display technology allows the isolation of scFv comprising completely human sequences. Recently, a completely human antibody against the human TGFb2 receptor based on a scFv clone derived from the phage display technology was developed. This scFv, converted into a fully human IgG4 that is capable of competing with the binding of TGFβ2 (Thompson et al, J. Immunol Methods, 227, 17-29 (1999)), has strong antiproliferative activity. This technology, known to one skilled in the art, is described more specifically in the following publications: Smith, Science, 228, 1315 (1985); Scott et al, Science, 249, 386-390 (1990); Cwirla et al, PNAS, 87, 6378-6382 (1990); Devlin et al, Science, 249, 404-406 (1990); Griffiths et al, EMBO J., 13 (14), 3245-3260 (1994); Bass et al, Proteins, 8, 309-314 (1990); McCafferty et al, Nature, 348, 552-554 (1990); Nissim et al, EMBO J., 13, 692-698 (1994); U.S. Patent Nos. 5,427,908, 5,432,018, 5,223,409 and 5,403,484, lib.

Ligand for Isolated scFv Antibody Molecules Platelets, fibrinogens, GPIb, selectins, and PSGL-1 each play an important role in various pathogenic conditions or disease states, such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastases, abnormal or pathogenic adhesion, thrombosis and / or restenosis, and abnormal or pathogenic aggregation. Therefore, antibodies that cross-react with platelets and with these molecules would be useful in the diagnosis and treatment of diseases and disorders consisting of these and other pathogenic conditions.

Platelets Platelets are well characterized components of the blood system and play several important roles in hemostasis, thrombosis and / or restenosis, restenosis. The injury to blood vessels sets in motion a process called hemostasis, characterized by series of sequential events. The initial reaction to the injured blood vessels is the adhesion of the platelets to the affected region on the inner surface of the vessel. The next step is the aggregation of many layers of platelets on the platelets previously adhered, forming the hemostatic plug. This group of tablets seals the wall of the glass. The hemostatic plug is strengthened by the deposition of fibrin polymers. The clot degrades only when the lesion is repaired.

Importance of Platelets in Metastasis Tumor metastasis is perhaps the most important factor limiting the survival of cancer patients. The data collected indicate that the ability of tumor cells to interact with host platelets represents one of the essential determinants of metastasis. Leslie Oleksowicz, Z.M., "Characterization of Tumor-Induced Platelet Aggregation: The Role of GPIb and GPIIb / IIIa Expression Immunorelated by MCF-7 Mammary Cancer Cells", Thrombosis Research. 79: 261-274 (1995).

It has been shown that the ability of tumor cells to aggregate platelets correlates with the potential for tumor cell metastasis, and it has been shown that the inhibition of tumor-induced platelet aggregation correlates with the suppression of metastasis in tumor models. rodents It has been shown that the interaction of tumor cells with platelets involves molecules of adhesion of membranes and secretion of agonists. The expression of immunorelaclonated platelet glycoproteins has been identified in lines of tumor cells. It was shown that glycoproteins immunorelated with platelets, GPIb, GPIIb / IIIa. GPIb / IX and the integrin v subunit are expressed on the surface of mammary tumor cell lines. Oleksowicz, Z.M., "" Characterization of Platelet Aggregation Induced by • Tumors: The Role of GPIb and GPIIb / IIIa Expression Immunorelated by MCF-7 Mammary Cancer Cells ", Thrombosis Investigation 79: 261-274 (1995); Kamiyama, M. et al, "Inhibition of platelet GPIIb / IIIa binding to fibrinogen by serum factors: studies of circulating immune complexes and platelet antibodies in patients with hemophilia, immune thrombocytopenic purpura, immune thrombocytopenic purpura related to the virus of human acquired immunodeficiency and systemic lupus erythematosus ", J Lab Clin Med 117 (3): 209-17 (1991).

Gasic (JTB Gasic et al, Proc. Nati, Acad. Sci. USA 61 :: 46-52 (1981)) and his collaborators showed that antibody-induced thrombocytopenia markedly reduced the number and volume of metastases produced by adenocarcinoma of CT26 colon, Lewis lung carcinoma, and B16 melanoma. Karpatkin, S. et al,? 1 Role of adhesive proteins in the interaction of platelet tumors in vitro and the formation of metastases in vivo ", J. Clin.Invest.81 (4): 1012-9 (1988); Clezardin, P. et al, WE1 Role of platelet membrane glycoproteins Ib / IX and Iib / IIIa, and of platelet alpha-granule proteins in platelet aggregation induced by human osteosarcoma cells ", Cancer Res. 53 (19) : 4695-700 (1993). Moreover, it was found that a single polypeptide chain (60kd) is expressed on the surface membrane of HEL cells that is closely related to GPIb and corresponds to a subunit GPIba O-glycosylated in incomplete or abnormal form. Kieffer, N. et al "Expression of glycoprotein Ib platelet alpha in HEL cells", J. Biol. Chem. 261 (34): 15854-62 (1986).

GPIb complex Each step in the process of hemostasis requires the presence of receptors on the surface of the platelet, a receptor that is important in hemostasis is the glycoprotein complex Ib-IX (also called CD42). This receptor mediates the adhesion (initial binding) of the platelets to the blood vessel wall at the sites of the lesions by binding von Willebrand factor (vWF) to the subendothelium. It also has crucial roles in two other functions of platelets important in hemostasis: (a) platelet aggregation induced by high cut in regions of arterial stenosis and (b) activation of platelets by low concentrations of thrombin.

The GPIb-IX complex is one of the main components of the outer surface of the platelet's plasma membrane. The GPIb-IX complex comprises three membrane-bound polypeptides, a disulfide-linked 130 kDa chain and a 25 kDa GPIb chain and a non-covalently associated GPIX (22 kDa). The four units are presented in equimolar amounts in the platelet membrane, for the efficient cell surface expression and the function of the CD42 complex, which indicates that the correct union of the three subunits in a complex is required for the complete expression in the plasma membrane. The a-chain of GPIb consists of three different domains: (1) a globular N-terminal peptide domain containing repeated sequences rich in leucine and flanking sequences linked to Cys; (2) a macroglicopeptide domain similar to highly glycosylated mucin; and (3) a C-terminal region associated with the membrane containing the disulfide bridge with GPIbp and transmembrane and cytoplasmic sequences.

Several lines of evidence indicate that vWF and the thrombin-binding domain of the GPIb-IX complex reside in a globular region spanning approximately 300 amino acids at the amino terminus of GPIba. The human platelet GPIb-IX complex is a key membrane receptor that mediates both the function and the reactivity of platelets. The recognition of vWF attached to the subendothelium by GPIb allows platelets to adhere to the injured blood vessels. In addition, the binding of vWF to GPIba also induces the activation of platelets, which may involve the interaction of a cytoplasmic domain of GPIb-IX with the cytoskeleton or phospholipase A2. Moreover, GPIba contains a high affinity binding site for α-thrombin, which, by a mechanism poorly defined so far, facilitates the activation of platelets.

The N-terminal globular domain of GPIba contains a group of negatively charged amino acids. Several lines of evidence indicate that, in transfected CHO cells expressing the GPIb-IX complex on the GPIba platelet, the three tyrosine residues contained in this domain (Tyr-276, Tyr-278 and Tyr-279) undergo sulphation.

Protein Sulfation Protein sulfation is a widespread post-translational modification consisting of the covalent attachment of sulfate, to sugar side chains or to the polypeptide backbone. This modification occurs in the trans-Golgi compartment and, consequently, affects only the protein that crosses this compartment. Such proteins include secretory proteins, white granule proteins, and the extracellular regions of the plasma membrane proteins. Tyrosine is an amino acid residue that is currently known to undergo sulfation. J.W. Ke oe et al, Chemistry and Biol 7: B.57-R61 (2000). Other amino acids, for example threonine, may also suffer from sulfation, particularly in diseased cells.

It has been found that numerous proteins are sulphated by tyrosine, but the presence of three or more sulfated tyrosines in a single polypeptide, as found in GPIb, is not common. GPIbot (CD42), expressed by platelets and megakaryocytes mediates the binding of platelets to and coiling over the subendothelium through binding with vWF, also contains numerous charges in its N-terminal domain. It is thought that such a highly acidic and hydrophilic medium is a prerequisite for sulphation because tyrosylprotein sulfotransferase recognizes and sulfates specifically tyrosines adjacent to amino acid residues. J.R. Bundgaard et al, JBC 272: 21700-21705 (1997). The complete sulfation of the acid region of GPIb gives a region with a remarkable density of negative charge, 13 negative charges within a stretch of 19 amino acids, which makes it a candidate site for electrostatic interaction with other proteins.

Selectins and PSGL-1 The P-, E- and L-selectins are a family of adhesion molecules that, among other functions, mediate the winding of leukocytes on the vascular endothelium. P-selectin is stored in granules in platelets and is transported to the surface after activation by thrombin, histamine, phorbol ester, other stimulatory molecules. P-selectin is also expressed in activated endothelial cells. E-Selectin is expressed in endothelial cells and L-Selectin is expressed in neutrophils, monocytes, T cells and B cells.

P-Selectin Glycoprotein Ligand-1 (PSGL-1, also called CD162) is a mucin glycoprotein ligand for P-Selectin, E-Selectin and L-Selectin. PSGL-1 is a disulfide-linked homodimer that has a PACE cleavage site (Matched Basic Amino Acid Conversion Enzymes). PSGL-1 also has three potential tyrosine sulfation sites followed by approximately 15 repeats of decamers that are high in proline, serine, and threonine. The extracellular portion of PSGL-1 contains three N-linked glycosylation sites and has numerous branched, sialylated, fucosylated oligosaccharides. K.L. Moore et al, JBC 118: 445-456 (1982). Most of the N-glycan sites and many of the O-glycan sites are occupied. The structures of the O-glycans of PSGL-1 of human HL-60 cells have been determined. A subgroup of these O-glycan are sialylated and fucosylated core-2 structures necessary for binding to selectins. Tyrosine sulfation of an amino terminal region of PSGL-1 is also necessary for binding to P-Selectin and L-Selectin. In addition, there is an N terminal propeptide that probably breaks posttranslationally.

PSGL-1 has 361 residues in HL60 cells, with an extracellular region of 267 residues, a transmembrane region of 25 residues and an intracellular region of 69 residues. The sequence encoding PSGL-1 is a single exon, so alternative splicing should be possible. However, PSGL-1 in HL60 cells, and in most cell lines, has 15 consecutive repeats of 10-residue sequences present in the extracellular region, but there are 14 and 16 repeats of this sequence, too, in polymorphonuclear leukocytes, monocytes and several other cell lines, which include most of the native leukocytes. PSGL-1 forms a disulfide-linked homodimer on the cell surface. V. Afshar-Kharghan et al, Blood 97: 3306-33112 (2001).

PSGL-1 is expressed in neutrophils as a dimer, with an apparent molecular weight of 250 kDa and 160 kDa, while in HL60 the form of the dimer is ~ 220 kDa. When analyzed under reduced conditions, each subunit is reduced by half. The differences in molecular mass can be due to polymorphisms in the molecule caused by the presence of different numbers of repeats of decamers. Classification of Leukocytes VI. Edited by T. Kishimoto et al (1997).

PSGL-1 is expressed in most blood leukocytes, such as neutrophils, monocytes, leukocytes, subgroup B cells, and all T cells and mediates the coiling of neutrophils in P-Selectin. Classification of Leukocytes VI. Edited by T. Kishimoto et al (1997). PSGL-1 also mediates neutrophil-neutrophil interaction through L-Selectin binding, mediating inflammation. Snapp et al, Blood 91 (1):. 154-64 (1998).

PSGL-1 mediates the coiling of leukocytes in activated endothelium, in activated platelets, and in other leukocytes and inflammatory sites.

A commercially available monoclonal antibody was generated for PGSL-1, KPL1, and was shown to inhibit the interaction between PGSL-1 and P-selectin and between PGSL-1 and L-selectin. The KPL1 epitope was mapped for the tyrosine consensus motif of PGSL-1 (YEYELDYD) (Snapp et al, Blood 91 (1): 154-164 (1998)). KPL1 recognizes only this particular epitope and does not cross-react with sulfated epitopes in other cells, such as B-CLL cells, AML cells, metastatic cells, multiple myeloma cells, and the like.

The winding of leukocytes is important in inflammation, and the interaction between P-Selectin (expressed by the activated endothelium and in the platelets, which can be immobilized in the sites of injury) and PSGL-1 is instrumental for the ligation and winding of leukocytes in the walls of the vessels.

Ramachandran et al, PNAS 98 (18): 10166-71 (2001); Afshar-Kharghan et al, Blood 97 (10): 3306-7 (2001).

Cell coiling is also important in metastasis, and it is believed that P- and E-Selectin in endothelial cells binds to metastatic cells, thereby facilitating extravasation from the bloodstream into the surrounding tissues.

Platelets also participate in the process of metastasis; When metastatic cancer cells enter the bloodstream, multicellular complexes composed of platelets and leukocytes lining the tumor cells form. These complexes, which can be called microemboli, help the tumor cells to evade the i mune system. The coating of tumor cells by platelets requires the expression of P-selectin by platelets.

Treatment with heparin, an inhibitor of P- and L-Selectin, inhibits the interaction of tumor cells and platelets. Pretreatment of the tumor cells with 0-sialoglycoprotease, which removes the sialylated, fucosylated mucin ligands, also inhibits the formation of tumor cell and platelet complexes. In vivo experiments indicate that any of these treatments leads to a greater association of monocytes with circulating tumor cells, which suggests that the reduction of platelet binding increases access by immune cells to tumor cells. Varki and Varki, Braz. J. Biol. Res. 34 (6): 711-7 (2001).

PSGL-1 and GPIb share a structural similarity, which has highly glycosylated, mucin-like ligand-binding regions. Afshar-Kharghan, et al, Blood 97 (10): 3306-7 (2001).

PSGL-1 has been found in all leukocytes: neutrophils, monocytes, lymphocytes, activated peripheral T cells, granulocytes, eosinophils, platelets and in some CD34 positive stem cells and certain subsets of B cells. P-selectin is selectively expressed in platelets activated and endothelial cells. The interaction between P-Selectin and PSGL-1 promotes the coiling of leukocytes in the walls of the vessels, and the abnormal accumulation of leukocytes in vascular sites derives in different pathological inflammations. The stereospecific contributions of individual tyrosine sulfates in PSGL-1 are important for the binding of P-Selectin to PSGL-1. Loading is also important for binding: reducing NaCl (150 to 50 mM) improved binding (Kd ~ 75 nM). Tyrosine sulfation in PSGL-1 improves, but is ultimately not necessary for the adhesion of PSGL-1 to P-Selectin. The tyrosine sulfation of PSGL-1 supports slower winding adhesion at all cut rates and supports winding adhesion at much higher cut rates. (Rodgers SD, et al, Biophys, J. 81: 2001-9 (2001)).

Figrinogen There are two forms of normal fibrinogen: fibrinogen? Major and the fibrinogen variant? minor premium, each of which is found in normal individuals. Normal fibrinogen, which is the most abundant form (comprising 90% of the fibrinogen found in the body), is composed of two identical alpha (a) chains of 55 kDa, two identical beta (ß) chains of 95 kDa and two gamma chains (?) of 49.5 kDa identical. The normal fibrinogen variant, which is the least abundant form (comprising 10% of the fibrinogen found in the body), is composed of two identical alpha (a) chains of 55 kDa, two identical beta (ß) chains of 95 kDa , a gamma chain (?) of 49.5 kDa and a gamma prime chain (? ') of 50.5 kDa. The gamma and gamma-prime chains are both encoded by the same gene, with an alternative splice occurring at the 3 'end. The normal gamma chain is composed of amino acids 1-411. The normal variant of the gamma prime chain is composed of 427 amino acids: amino acids 1-407 are the same as those of the normal gamma chain, and amino acids 408-427 are VRPEHPAETEYDSLYPEDDL. This region is normally occupied with thrombin molecules.

Fibrinogen is converted to fibrin by the action of thrombin in the presence of ionized calcium to produce blood coagulation. Fibrin is also a component of thrombi, and acute inflammatory exudates.

Platelets and molecules (such as fibrinogen, GPIb, selectins, and PSGL-1) that play important roles in the interactions of cells with cells, in cell-matrix interactions, in platelet-platelet interactions, in interactions of platelets with cells, in the interactions of platelets with matrix, in the winding and the adhesion of cells, and in hemostasis also play important roles in pathogenic conditions or disease states, such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions , autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and / or restenosis, and abnormal or pathogenic aggregation. Therefore, antibodies that cross-react with platelets and with these molecules would be useful in the diagnosis and treatment of diseases and disorders that involve these and other pathogenic conditions. Consequently there is a need to identify common epitopes in or between these molecules and to identify antibodies capable of reacting with them.

Antibodies can be provided in many forms, such as fragments, complexes and multimers. Examples of antibody fragments include single chain Fv fragments (scFv) and Fa fragments.

It has been established that scFvs penetrate tissues and are removed from the blood more rapidly than a full-size antibody because they are smaller in size. Adams, G.P. et al, Br. J. Cancer 77, 1405-1412 (1988); Hudson, P.J., Curr. Opin. Immunol. 11 (5), 548-557 (1999); Wu, A.M., Tumor Targeting 4, 47 (1999). Therefore, scFv are frequently employed in diagnosis consisting of radioactive labels such as tumor images to allow a more rapid removal of the radioactive label from the body. Recently, numerous scFv multimers targeting cancer have undergone preclinical evaluation of their stability and efficacy in vivo. Adams, G.P. et al, Br. J. Cancer 77, 1405-1412 (1988); Wu, A.M., Tumor Targeting 4, 47 (1999).

Fragments of single chain Fv (scFv) are composed of the variable domains of the heavy (VH) and light (VL) chains of an antibody linked together by polypeptide linkages. The link is long enough to allow domains (VH) and (VL) to bend in a functional Fv domain that allows scFv to recognize and bind to its target with similar or increased affinity of the parent antibody.

Generally, scFv monomers are designed with the N-terminus of the VH domain linked by the polypeptide linkage to the N-terminal residue of the VL. Optionally, an inverse orientation is employed: the C-terminal end of the VL domain binds to the N-terminal residue of VH through a polypeptide linkage. Power, B. et al, J. Immunol. Meth. 242, 193-204 (2000). The polypeptide linkage is generally about fifteen amino acids in length. When the link is reduced to three to seven amino acids, the scFvs can not be doubled in the functional Fv domain and instead associate with a second scFv to form a diabody. A greater reduction in the length of the link to less than three amino acids forces the association of scVv in trimers or tetramers, depending on the length of the link, the composition and the orientations of the Fv domains. B.E. Powers, P.J. Hudson, J. Immunol. Meth. 242 (2000) 193-194.

Recently, it has been discovered that fragments of muitivalent antibodies such as dimers, trimers, and scFv tetramers usually provide a higher affinity with respect to the binding of the parent antibody to the target. This higher affinity offers potential advantages including improved pharmacokinetics for applications that target tumors. In addition, by studying P-selectin and its ligand PSGL-1, which are involved in the binding and coiling of leukocytes, scientists have come to the conclusion that cells expressing dimeric forms of PSGL-1 established additional coil adhesions. stable due to this higher binding affinity. These adhesions are more resistant to deviation and exhibit less fluctuation in winding speeds. Ramachandran et al, PNAS, vol. 98 (18): 10166-71 (2001).

The higher binding affinity of these multivalent forms may be beneficial in the diagnosis and in the therapeutic regimens. For example, a scFv can be used as a blocking agent to bind a white receptor and therefore block the binding of the "natural" ligand. In such cases, it is desirable to have a higher affinity association between the scFv and the receptor to reduce the chances of dissociation, which may allow an undesirable binding of the natural ligand to the target. In addition, this higher affinity may be useful when the target receptors are involved in adhesion and coiling or when the target receptors are in cells present in areas of higher deviation flow, such as platelets.

An objective of the present invention is to provide isolated epitopes that are present in different molecules that are instruments in processes such as cell coiling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and / or restenosis, and aggregation, and that are present in diseased cells, such as AMX cells, B-CLL cells, multiple myeloma cells, and metastatic cells.

Another objective of the invention is to provide methods of using such isolated epitopes to develop antibodies that recognize and react with epitopes that are present in molecules that are instruments in processes such as cell coiling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and / or restenosis, and aggregation, and that are also present in diseased cells, such as AML cells, B-CLL cells, multiple myeloma cells, and metastatic cells.

Other objects of the invention include the use of such antibodies in the development and provision of medicaments for the inhibition of cell winding, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and / or restenosis, and aggregation, and for the treatment of diseases, such as AML, B-CLL, multiple myeloma, metastasis, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by protein-protein interactions dependent on tyrosine sulphated, or other diseases in which such functions or cellular actions play a significant role.

An objective of this invention is to use the epitopes and antibodies in methods for diagnosing different diseased states of an individual, such as, for example, diseases, such as AML, B-CLL, multiple myeloma, and metastases or other diseases in which functions or cellular actions such as cell coiling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and / or restenosis and aggregation play a significant role.

It is also an object of the invention to provide multivalent forms of antibodies, fragments and complexes. More specifically, an object of the invention is to provide dimers, trimers and tetramers, sometimes referred to in the present invention as diabodies, triabodies, and tetrabodies, respectively.

These and other objects of the invention are provided in the present invention.

EXTRACT OF THE INVENTION The present invention provides epitopes that are found in ligands and receptors that play important roles in diverse processes such as inflammation, immune reactions, metastasis, adhesion, thrombosis, restenosis, and aggregation. The epitopes according to the present invention are also found in leukemia and tumor cells, particularly in leukemias of myeloid origin. Therefore, these epitopes are useful targets for the therapeutic mediation of these processes. Antibodies directed against such epitopes are useful as therapeutic agents against cancers (both as antitumor agents and anti-metastasis agents), leukemias, autoimmune diseases, inflammatory diseases, cardiovascular diseases such as myocardial infarction, retinopathic diseases and other diseases mediated by abnormal function of platelets, and diseases caused by protein-protein interactions dependent on tyrosine sulphated. The present invention provides such antibodies, compositions comprising the antibodies, and therapeutic and diagnostic methods using the antibodies.

The present invention provides an isolated epitope comprising the formula (S) r I [(W) z - P - (Y) t- P] q Formula (I) wherein: W is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulfated. is (A) m (A) n (X) uo (X) u (A) n (A) mo (A) n (X) u (A) mo (A) n (A) m (X) uo ( X) u (A) m (A) not (A) m (X) u (A) n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with a negative charge or leucine , isoleucine, proline, phenylalanine, serine or glycine q is 1 to 6 z is 0, 1 or 2 r is O or 1 t is 1, 2 or 3 u is 0 to 2 n is 0 to 3 m is 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; where if q is 1, r is 1 and if q is > 1 at least one of Y is sulfated; and further wherein the isolated epitope is capable of being linked by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region. comprising SEQ ID No. 8 or SEQ ID No. 20. The present invention provides an isolated epitope comprising Formula I wherein the sulphated group is a peptide or glyco or conjugated lipo, or a combination thereof.

The present invention also provides an isolated epitope comprising Formula I wherein W is Glycine, Y is a tyrosine conjugated peptide or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate,? Carboxy Glutamate or Aspartate; and q is 1, 2, or 3. In certain embodiments, Y is a Tyrosine conjugated peptide; q is 3; and r is 1.

The present invention also provides an isolated epitope comprising the formula (S) r (S) r (S) r III (W) ZP- (Y) RP- (Y) TP- (Y) TP (Formula II) wherein: W is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulfated P is (A) m (A) n (X) uo (X) u (A) n (A) mo (A) n (X) u (A) mo (A ) n (A) m (X) uo (X) u (A) m (A) not (A) m (X) u (A) n S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate , or Tyrosine A is any amino acid with a negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is from 0 to 2 n is 0 to 3 m is from 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; wherein at least one Y is sulfated; and further wherein the isolated epitope is capable of being linked by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region. comprising SEQ ID No. 8 or SEQ ID No. 20.

The present invention provides an isolated epitope comprising Formula II wherein the sulphated group is a peptide or glyco or conjugated lipo, or a combination thereof.

The present invention also provides an isolated epitope comprising Formula II wherein: W is Glycine; And it is a conjugated peptide of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate,? Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline, Phenylalanine, Serine or Glycine. In certain embodiments, Y is a Tyrosine conjugated peptide; q is 3; and r is 1.

The present invention provides an isolated epitope comprising formula (S) r (S) r (S) r III (G) z (X) u (E) "(D) m (Y) t (X) u (E) n (D) m (Y) t (X) u (E) n (D) m (Y) t (D) m (E) n (X) u Formula? t? where : G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the preceding z is 0, 1 or 2 te if, 2 or 3 r is 0 or 1 u is 0 to 2 n is from 0 to 3 m is from 0 to 3 wherein at least one Y is sulfated; where if n = 0 then m > 0; where if m = 0 then n > 0; and further wherein the isolated epitope is capable of being bound by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first i-variable region. comprising SEQ ID No. 8 or SEQ ID No. 20.

The present invention provides an isolated epitope comprising Formula III wherein r is 1.

In any of the preceding embodiments, Y can be a molecule of lipid, carbohydrate, peptide, glycol, glycoprotein, lipoprotein, and / or lipopolysaccharide.

The present invention also provides derivatives, homologs, imitations, and variants of the epitopes described above and provides epitopes described above and having at least one post-translational modification in addition to sulfation.

The present invention provides compositions comprising one or more of the epitopes described above. Also provided are isolated polynucleotides that encode at least a portion of the epitopes described above.

The present invention also provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof capable of binding or reacting with at least one of the epitopes described above.

Similarly, a process for producing an antibody, a fragment thereof that binds to an antigen, or a complex thereof that comprises at least one antibody or a binding fragment thereof, capable of binding or reacting with the antigen is provided. minus one of the epitopes described above. The process comprises the steps of: (a) providing a phage display library; (b) providing one of the epitopes described above; (c) viewing the phage display library in search of a phage particle presenting an oligopeptide or polypeptide capable of binding to the isolated epitope; and (d) producing an antibody, a binding fragment thereof, or a complex comprising an antibody or a binding fragment thereof, comprising a peptide or polypeptide capable of binding to the isolated epitope.

The present invention also provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof having the binding capabilities of the scFv antibody fragment of SEQ ID N ° 25 [Yl scFv] and / or SEQ ID No. 203 [Y17 scFv].

Antibodies, antibody fragments, and antibody complexes having the binding capabilities of a peptide or polypeptide are provided, wherein the peptide or polypeptide has a first hypervariable region comprising SEQ ID No. 8 [? 1 CD 3] or SEQ ID No. 20 [Y17 CDR3]. In certain embodiments, the peptide or polypeptide has a second hypervariable region comprising SEQ ID No. 115 and / or a third hypervariable region comprising SEQ ID No. 1114.

Antibodies, antibody fragments, and antibody complexes are provided which are capable of binding to a peptide or polypeptide epitope of about 3 to 126 amino acid residues in length and comprising at least one sulphated tyrosine residue and at least two acidic amino acids . In certain embodiments, the epitope further comprises at least one residue of leucine, isoleucine, proline, phenylalanine, serine or glycine. In certain embodiments, one or more of at least two acidic amino acid residues is replaced by a leucine, isoleucine, proline, phenylalanine, serine or glycine residue. In other certain embodiments, the epitope comprises DYD or EYE. In certain embodiments, the epitope is DYD or EYE. In still other embodiments, the epitope comprises DYE or EYD.

In certain embodiments, antibodies, antibody fragments, and antibody complexes provided in accordance with the present invention are capable of binding to an epitope in a lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein and / or lipopolysaccharide molecule. Preferably, antibodies, fragments thereof that bind to antigens or complexes thereof comprising at least one antibody or a binding fragment thereof according to the present invention, are capable of binding to a lipid, carbohydrate, lipid epitopes, glycolipid epitopes, glycoprotein epitopes, lipoprotein epitopes, and / or lipopolysaccharide epitopes. In many embodiments, the lipid molecule, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and / or lipopolysaccharide comprises at least one sulfated group.

The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of binding to at least two different molecules selected from the group consisting of PSGL -1, prime fibrinogen, GPIb, heparin, lumican, compound complement 4 (CC4), inter-alpha-inhibitor, and prothrombin, although not necessarily simultaneously. In addition, the antibodies, antibody fragments or complexes of the present invention bind to any analogue of these proteins, provided that the receptor epitope is intact.

In certain preferred embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of binding to at least two proteins selected from the group formed are provided. by PSGL-1, fibrinogen? prima, GPIba, lumican, compound complement 4, interalfa inhibitor, prothrombin, and heparin and which are capable of binding to diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. In certain embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof that comprise at least one antibody or a binding fragment thereof that are capable of binding to each of PSGL-1, frinogen, are provided? prima, GPIba, heparin, lumican, compound complement 4 (CC4), interalfa inhibitor, and protombine. In certain embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of binding to each of PSGL-1, fibrinogen, are provided? prima, GPIba, and heparin; and in certain preferred embodiments, these antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof are also capable of binding to diseased cells, such as B-cells. CLL, AML cells, multiple myeloma cells, and metastatic cells.

The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of binding to at least two different molecules selected from the group consisting of PSGL -1, fibrinogen? prima, heparin, GPIbcx, lumican, compound complement 4 (CC4), interalfa inhibitor, and protombine, and in addition is capable of binding to an epitope in a carbohydrate and / or a lipid molecule. In certain embodiments, the carbohydrate epitope and / or the lipid molecule comprises at least one sulfated group.

The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof are capable of reacting with two or more epitopes, each epitope comprising one or more residues of sulphated tyrosine within a group of acidic amino acids. In certain embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of reacting with at least one cell type selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. In certain other embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof are capable of reacting with PSGL-1. Preferably, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of reacting with PSGL-1 bind to the QATEYEYLDYDFLPETE epitope wherein at least one residue of tyrosine is sulfated.

In certain other embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof are capable of reacting with GPIb-oc. Preferably, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of reacting with GPIb-oc bind to the epitope DEGDTDLYDYYPEEDTEGD wherein at least one residue of tyrosine is sulfated, to the TDLYDYYPEEDTE epitope wherein at least one tyrosine residue is sulfated, to the epitope GDEGDTDLYDYYP wherein a tyrosine residue is sulfated, to the YDYYPEE epitope wherein at least one tyrosine residue is sulfated, and / or to the epitope TDLYDYYP wherein at least one tyrosine residue is sulfated.

In still other embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof, are capable of reacting with fibrinogen? cousin. Preferably, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of reacting with fibrinogen? cousin [?' ] bind to the EPHAETEYDSLYPED epitope wherein at least one tyrosine residue is sulfated.

In yet other of these embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof that comprise an antibody or a binding fragment thereof that are capable of reacting with heparin are provided.

In yet another of these embodiments, antibodies, fragments thereof that bind to antigens, or complexes thereof that comprise an antibody or a binding fragment thereof that are capable of reacting with the compound complement 4 (CC4) are provided. Preferably, antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of reacting with CC4 are attached to the MEANEDYEDYEYDELPAK epitope wherein at least one residue is provided. of tyrosine is sulfated.

The present invention also provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of binding fragments, analogs, variants, and imitations of proteins. mentioned above, provided that the epitope is essentially intact.

The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of reacting with at least one type of cell selected from the group formed by B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells.

The present invention also provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof, which are capable of inhibiting the winding of cells, of inhibiting inflammation, of inhibit autoimmune disease, inhibit thrombosis, inhibit restenosis, inhibit metastasis, inhibit the growth and / or replication of tumor cells, increase tumor cell mortality, inhibit growth and / or replication of leukemia cells, of increasing the mortality of leukemia cells, of increasing the susceptibility of diseased cells to damage by anti-disease agents; to increase the susceptibility of tumor cells to damage by anticancer agents, to increase the susceptibility of leukemia cells to damage by anti-leukemia agents, to inhibit the increase in the number of tumor cells in a patient having a tumor, to reduce the number of tumor cells in a patient having cancer, of inhibiting the increase in the number of leukemia cells in a patient having leukemia, of reducing the number of leukemia cells in a patient having leukemia, of inhibiting the formation of cell complexes -cell, cell-matrix, plate-matrix, platelet-platelet and / or platelet cell; to inhibit the adhesion of cell-cell, cell-matrix, platelet-matrix, platelet-platelet and / or cell-matrix, and aggregation.

Pharmaceutical compositions are provided comprising antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof according to the present invention in amounts effective to inhibit, treat, improve effects or prevent diseases and / or conditions of interest.

The present invention provides the use of antibodies, fragments thereof that bind to antigens, or complexes thereof according to the present invention in the manufacture of a medicament for inhibiting, treating, ameliorating the effects or preventing diseases and / or conditions of interest The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof in accordance with the present invention for use as a medicament for inhibiting, treating, ameliorating the effects or preventing diseases and / or conditions of interest.

The present invention provides methods to inhibit, treat, ameliorate the effects or prevent diseases and / or conditions of interest which comprise administering to a patient in need thereof a pharmaceutical composition comprising an effective amount of an antibody, a fragment thereof that binds antigens, or a complex thereof comprising at least one antibody or a binding fragment thereof, according to the present invention.

Antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof according to the present invention can be complexed or coupled to agents.

The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof coupled or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis agents, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, antibacterial, antiviral, and anti-inflammatory.

The present invention also provides antibodies, fragments thereof that bind antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof coupled or complexed with one or more toxins, radioisotopes, and pharmaceutical agents.

The present invention provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof coupled or complexed with a carrier or carrier that are capable of being coupled or complexed to more of an agent. Examples of such carriers and carriers include dextran, lipophilic polymers, hydrophilic polymers, HPMA, and liposomes.

The present invention also provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof coupled or complexed with a radioactive isotope or other imaging agent. Also provided is a diagnostic kit comprising an antibody, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof, according to the present invention.

The present invention provides an isolated epitope comprising the amino acid sequence of GPIba Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated. In a preferred embodiment, the epitope further comprises the amino acids of GPIba 283-285.

The present invention also provides antibodies, fragments thereof that bind to antigens, or complexes thereof comprising at least one antibody or a binding fragment thereof that are capable of binding to the epitope comprising the amino acid sequence of GPIba Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated, wherein the binding is enhanced when the epitope further comprises the amino acids of GPIba 283-285.

Also provided is an N-terminal peptide of isolated GPIba having an apparent molecular weight of 40 KDa, said peptide comprising an epitope having the sequence YDYYPEE, wherein at least one tyrosine residue in the epitope is sulfated and a GPIba peptide isolated comprising amino acids 1 to 282, wherein at least one of amino acids 276, 278 and 279 is sulfated.

The present invention also provides polyclonal antibodies, antibody fragments or antibody complexes that react with the variable light chain of the human monoclonal antibody scFv Yl. In certain embodiments, the polyclonal antibodies, antibody fragments or antibody complexes react with the peptide encoded by an Ndel-EcoRll restriction fragment of the variable light chain of the human monoclonal antibody Y-1. Diagnostic kits comprising such polyclonal antibodies are also provided.

ANTIBODIES Antibodies (Ab) or immunoglobulins (Ig) are protein molecules that bind to antigens. They are composed of units of four polypeptide chains (2 heavy and 2 light) joined together by disulfide bonds. Each of the chains has a constant and variable region. They can be divided into five classes, IgG, IgM, IgA, IgD, and IgE, based on their heavy chain component. The IgG class encompasses several subclasses that include, in non-limited form, IgGi, IgG ?, IgG3 and IgG, j. Immunoglobulins are produced in vivo by B lymphocytes and recognize a particular foreign antigenic determinant and facilitate the elimination of that antigen.

Antibodies can be produced and used in many forms, including antibody complexes. As used herein, the term "antibody complex" or "antibody complexes" means a complex of one or more antibodies with another antibody or with a fragment or fragments of antibodies, or a complex of two or more antibody fragments. Examples of antibody fragments include the Fv, F (ab ') 2, F (ab'), Fe and Fd fragments.

As used herein, in the specification and in the claims, an Fv is defined as a molecule composed of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be same or different, and wherein the variable region of the heavy chain is connected, linked, fused or covalently linked to, or associated with, the variable region of the light chain. The Fv can be a single chain Fv (scFv) or a disulfide stabilized Fv (dsFv). A scFv is composed of the variable domains of each of the heavy and light chains of an antibody, linked by a flexible amino acid polypeptide spacer, or a bond. The link can be branched or unbranched. Preferably, the bond e of 0-15 amino acid residues, and more preferably the bond is (Gly Ser) 3.

The Fv molecule itself consists of a first chain and a second chain, each chain comprising a first, second and third hypervariable region. The hypervariable loops within the variable domains of the light and heavy chains are called Complementary Determining Regions (CDR). There are CDR1, CDR2, and CDR3 regions in each of the heavy and light chains. It is believed that these regions form the antigen binding site and can be specifically modified to give the enhanced binding activity. The most variable of the regions is the CDR3 region of the heavy chain. It is understood that the CDR3 region is the most exposed region of the Ig molecule and as shown and provided herein is the site primarily responsible for the selective and / or specific binding characteristics observed.

A fragment of an Fv molecule is defined as any molecule smaller than the original Fv that still retains the selective and / or specific binding characteristics of the original Fv. Examples of such fragments include, but are not limited to, an antibody, comprising a fragment of the heavy chain only of Fv, 82) a microbody, comprising a small fractional unit of the variable region of the heavy chain of the antibody (Application PCT No. PCT / IL99 / 00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a variable region of the light chain.

As used herein, the term "Fab fragment" is a monovalent antigen-binding fragment of an immunoglobulin. A Fab fragment is composed of the light chain and part of the heavy chain.

An F (ab ') 2 fragment is a bivalent antigen-binding fragment of an immunoglobulin obtained by digestion of pepsin. It contains both light chains and part of both heavy chains.

A Fe fragment is a portion that does not bind to an antigen of an immunoglobulin. It contains the carboxy terminal portion of the heavy chains and the binding sites for the Fe receptor.

An Fd fragment is the variable region and the first constant region of the heavy chain of an immunoglobulin.

Polyclonal antibodies are the product of an immune response and are formed by a number of different B lymphocytes. Monoclonal antibodies are derivatives of a single cell. A cassette, applied to polypeptides and defined in the present invention, refers to a given sequence of consecutive amino acids that serves as a framework and is considered a single unit and is handled as such. The amino acids can be replaced, inserted, removed, or attached to one or both ends. Similarly, stretches of amino acids can be replaced, inserted, removed or attached to one or both ends.

The term "epitope" used herein means the antigenic determinant or antigen site that interacts with an antibody, an antibody fragment, an antibody complex, or a complex that comprises a fragment binding it to a T cell receptor. The term epitope is used interchangeably with the terms ligand, domain and binding region.

Selectivity is defined here as the ability of a targeted molecule to target and bind to a cell type or cell state of a mixture of cell types or cell states, all of which cell types or cell states can be specific for the molecule targeted to a target.

The term "affinity" used herein is a measure of the binding strength (association constant) between a receptor (e.g., a binding site on an antibody) and a ligand (e.g., an antigenic determinant). The resistance of the sum total of the non-covalent interactions between a single antigen-binding site in an antibody and a single epitope is the affinity of the antibody for that epitope. The low affinity antibodies bind to the antigen weakly and tend to dissociate easily, while the high affinity antibodies bind to the antigen tightly and remain together longer. The term "avidity" differs from affinity because the former reflects the valence of the antigen-antibody interaction.

Specificity of the antibody-antigen interaction: Although the antigen-antibody reaction is specific, in some cases the antibody produced by an antigen can react with another non-related antigen. Such a cross reaction occurs if two different antigens share a homologous or similar epitope or an anchor region thereof or if the antibodies specific for an epitope bind to an unrelated epitope that possesses similar chemical properties.

A platelet is a cytoplasmic fragment similar to a disc of a megakaryocyte that is stored in the marrow channel and then circulates in the peripheral bloodstream. Platelets have several physiological functions that include a major role in coagulation. A platelet contains granules in the central part and peripherally, transparent protoplasm, but no defined nucleus.

Agglutination as used herein means the process by which bacteria, cells, disks or other particles of similar size suspended are adhered and form lumps. The process is similar to precipitation but the particles are larger and are in suspension instead of being in solution.

The term aggregation means the formation of platelet clumps induced in vitro, and thrombin and collagen, as part of a sequential mechanism that leads to the formation of a hemostatic plug or thrombus.

The amino acid substitution preservative is defined as a change in the composition of the amino acid through the change of one or two amino acids of a peptide, polypeptide or protein, or a fragment thereof. Substitution is generally amino acids with similar properties (ie, acidic, basic, aromatic, size, positive or negative charge, polar, non-polar) so that substitutions do not significantly alter the characteristics (for example, charge, isoelectric point, affinity, avidity, conformation, solubility) or the activity of the peptide, polypeptide or protein. Typical substitutions that can be made for such amino acid substitution can be between the following amino acid groups: (i) glycine (G), alanine (A), valine (V), leucine (L) and isoleucine (I) (ii) aspartic acid (D) and glutamic acid (E) (iii) alanine (A), serine (S) and threonine (T) (iv) histidine (H), lysine (K) and arginine (R) (v) asparagine (N) and glutamine (Q) (vi) phenylalanine (F), tyrosine (Y) and triptofan (W) The substitutions of preservative amino acids can be made in, as well as in the flanks of the hypervariable regions responsible mainly for the characteristics of selective and / or specific binding of the molecule, as well as other parts of the molecule, for example the variable heavy chain cassette. . In addition or alternatively, the modification can be performed by reconstructing the molecules to form full size antibodies, diabodies (dimers), triabodies (trimers) and / or tetrabodies (tetramers) or to form minibodies or myobodies.

A phagemid is defined as a phage particle that transports plasmid DNA. Phagemids are plasmid vectors designed to contain an origin of the replication form from a filamentous phage, such as M13 or fd. As it carries the plasmid DNA, the phagemid particle does not have enough space to contain the complete complement of the phage genome. The missing component of the phage genome is essential information for packaging the phage particle. To propagate the phage, consequently, it is necessary to cultivate the desired phage particles together with a collaborating phage strain that complements the missing packaging information.

A promoter is a region in the DNA in which the RNA polymerase binds and initiates transcription.

A phage display library (also referred to as a peptide / phage antibody library) comprises a large g, phage population (generally 10 -10 '), each phage particle having a different peptide or polypeptide sequence. These peptide or polypeptide fragments can be constructed to be of variable length. The presented peptide or polypeptide can be derived from, but need not be limited to, heavy or light chains of human antibodies.

A "pharmaceutical composition" refers to a formulation comprising a peptide or polypeptide of the invention and a pharmaceutically acceptable carrier, excipient or diluent thereof.

A "pharmaceutical agent" refers to an agent that is useful in the prophylactic or diagnostic treatment of a mammal that includes, but is not limited to, a human, bovine, equine, porcine, mouse, canine, feline or any other blood animal. hot. The pharmaceutical agent is selected from the group comprising radioisotope, toxin, oligonucleotide, recombinant protein, antibody fragment, and anti-cancer agent.

Examples of such pharmaceutical agents include, but are not limited to, antiviral agents including acyclovir, ganciclovir and zidociclovir; antithrombosis / restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti-adduction / anti-aggregation agents including limaprost, chlorchromen, and ialuronic acid.

An anti-leukemia agent is an agent with activity against leukemia. For example, anti-leukemia agents include agents that inhibit or stop the growth of immature leukemic or preleukemic cells, agents that eliminate leukemic or preleukemic cells, agents that increase the susceptibility of leukemic or preleukemic cells to other anti-leukemia agents and agents that inhibit the metastasis of leukemic cells. In the present invention, an anti-leukemia agent can also be an agent with anti-angiogenic activity that prevents, inhibits, retards or stops the vascularization of tumors.

The expression pattern of a gene can be studied by analyzing the amount of genetic product produced in different conditions, at specific times, in different tissues, etc.

A gene is considered "overexpressed" when the amount of the genetic product is greater than that found in a normal control, for example a non-diseased control.

A given cell can express on its surface a protein that has a binding site (or epitope) for a given antibody, but that binding site can exist in a cryptic form (e.g., it can be blocked or spherically blocked, or lacking characteristics). necessary to bind to an antibody) in the cell in a state, which may be referred to as a first step (step I). Stage I may be, for example, a normal, healthy, non-diseased state. When the epitope exists in cryptic form, it is not recognized by the given antibody, ie there is no binding of the antibody to this epitope or to the cell given in stage I. However, the epitope can be exposed, for example, undergoing modifications itself, or being unblocked because nearby or associated molecules are modified or because a region undergoes a conformational change. Examples of modifications include changes in the fold, changes in post-translational modifications, changes in phospholipidation, changes in sulfation, changes in glycosylation, and the like. Such modifications may occur when the cell enters a different state, which may be referred to as the second stage (stage II). Examples of second stages or stages include activation, proliferation, transformation, or in an evil state. Upon modification, the epitope can then be exposed, and the antibody can bind.

The peptide mimetics are molecules, peptides, polypeptides, lipids, polysaccharides or conjugates thereof that have the same effect or functional activity of another entity such as an antibody.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows endoprotease sites in the a chain of GPIb.

Figure 2 depicts an immunoblot showing the binding of Yl and Y17 to platelets under reduced and unreduced conditions.

Figure 3 is a representation of the reactivity of Yl with different preparations of the GC platelet and the membrane fraction 4 of KG-1 cells.

Figure 4 illustrates an immunoblot that demonstrates that cleavage of the GPIb platelet by O-Sialoglycoprotein endoprotease eliminates the binding of both Yl and Y17.

Figure 5 illustrates an immunotransference that demonstrates that Yl and Y17 bind similar glycocalicin fragments after cleavage by O-sialoglycoprotein endoprotease.

Figure 6 illustrates the results of the FACS analysis demonstrating that specific GPIb proteolysis removes the binding of Yl to platelets.

Figure 7 illustrates an immunoblot that demonstrates that Yl binds the N-terminal fragment (His 1-Glu 282) of the GPIba platelet after the disruption by mocarhagin.

Figure 8 illustrates an immunotransference that shows the binding of Yl and Y17 to glycocalicin after disruption by mochahagin.

Figure 9 illustrates an immunotransference that shows the binding of Yl and Y17 to platelets.

Figure 10 illustrates an immunoblot showing that Yl and Y17 bind glycocalicin in a similar manner after Ficin cleavage.

Figure 11 illustrates an immunoblot that shows that Yl reacts with the larger fragment generated by the cleavage of cathepsin G from GPIbaoc.

Figure 12 illustrates an immunoblot that demonstrates that Yl and Y17 react with the larger fragment generated by the GIbacc cathepsin G cleavage.

Figure 13 illustrates an immunoblot that demonstrates that the cleavage of glycocalicin by mocarhagin and cathepsin G eliminates the binding of Yl.

Figure 14 illustrates an immunoblot that shows that the binding of Yl and Y17 causes the lysis of washed platelets broken by mochahagin and cathepsin G.

Figure 15 is a graph illustrating the inhibition by Yl-scFv of the agglutination of washed platelets.

Figure 16 is a graph illustrating the inhibition by Yl-scFv of platelet aggregation in platelet-rich plasma.

Figure 17 is a graph illustrating the induction of agglutination of washed platelets by Yl-IgG.

Figure 18 is a graph illustrating the induction of platelet aggregation in platelet-rich plasma by Yl-IgG.

Figure 19 provides the results of an ELISA assay.

Figure 20 illustrates an immunoblot that illustrates the specificity of the binding of Yl and α-CD42 (Nl-19) to other 1igands.

Figure 21 illustrates an etern blot of the reactivity of Yl with the ligand of Yl in the membrane of the purified KG-1 cell using immuno-precipitation and RP-HPLC.

Figure 22 illustrates an immunoblot showing the effect of the cleavage of O-Sialoglycoprotein endopeptidase at the binding of Yl.

Figure 23 illustrates an immunoblot showing the effect after the breakdown of aryl sulfate at the junction of Yl to Used of KG-1 cells purified by RP-EPLC, and heparin-BSA.

Figure 24 illustrates the immunoprecipitation scheme used in the analysis of the binding specificity of Yl.

Figure 25 illustrates an immunoblot comparing the binding of Yl and the anti-CD-162 antibody with the cells of patients with AML and normal blood.

Figure 26 illustrates the results of a FACS analysis showing the ability of antibodies KPL1, PL1 and PL2 to compete with Y1 for binding.

Figure 27 illustrates the results of a FACS analysis demonstrating the specificity of Yl binding.

Figure 28 also illustrates the results of a FACS analysis demonstrating the specificity of Yl binding.

Figure 29 is a graph illustrating the% inhibition of Yl binding in the presence of different peptides.

Figure 30 is a graph illustrating liver weights in mice in different treatment groups.

Figure 31 is a graph illustrating the% of MOLT cells in the bone marrow in mice in different treatment groups.

Figure 32 is a graph illustrating the% of MOLT cells in the blood in mice in different treatment groups.

Figure 33 illustrates an immunoblot showing the effect of cleavage by Aryl-Sulfatase and Mocarhagxna at the binding of Yl.

Figure 34 is a graph illustrating the liver weights (mean +/- SEM) of mice on day 35.

Figure 35 is a graph illustrating the effect of treatment on survival.

Figure 36 is a graph that illustrates the% occurrence of leukemia in different treatment groups.

Figure 37 is a graph illustrating the% of KG-1 cells in the blood in different treatment groups.

Figure 38 is a graph illustrating the% of KG-1 cells in the bone marrow of experimental animals.

Figure 39 is a graph illustrating the pharmacokinetics of TCA precipitable radioactivity in plasma after intravenous injection of 125 I-C0NY1 in mice. The sequence of CONY1 is given SEQ ID No. 204.

Figure 40 is a graph illustrating the specific radioactivity of different organs / tissues after intravenous injection of 125 I-C0NY1 in mice.

Figure 41 is a graph illustrating the distribution of radioactivity of different organs / tissues after intravenous injection of 125 I-C0NY1 in mice.

Figure 42 is a graph of the Superdex 75 profile of Y-cys-kak.

Figure 43 reveals the size of the dimers compared to the monomer under reducing and not reducing conditions.

Figure 44 illustrates a FACS analysis showing the level of binding of the IgG-Yl molecule compared to that of scFv-Yl.

Figure 45 illustrates immunoblots showing the binding of Yl and other antibodies to glycocalicin derived from natural platelets and to recombinant glycocalicin produced in E. coli.

Figure 46 shows a comparison of bonds between a dimer of Yl, Yl scFv (C0NY1) and Yl IgG.

Figure 47 shows a comparison of junctions between the sulfide bridge dimer of Yl with Yl scFv (C0NY1).

Figure 48 provides the amino acid and nucleotide sequences of the heavy and light chains of Yl-IgG. The open reading frame (ORF) of the nucleotide sequence of Yl-HC (SEQ ID No. 205), the amino acid sequence of Yl-HC (SEQ ID NO. 206), the ORF of the nucleotide sequence of Yl-LC (SEQ ID N ° 207) and the amino acid sequence of Yl-LC (SEQ ID No. 208).

Figure 49 provides the amino acid sequence of TM1 (SEQ ID No. 209).

Figure 50 provides the amino acid and nucleotide sequences of Y16 scFv (SEQ ID No. 210).

Figure 51 provides the amino acid sequence of Yl Biotag (SEQ ID No. 211).

Figure 52 provides the amino acid sequence of Yl-cys-KAK scFv (SEQ ID No. 212).

DETAILED DESCRIPTION OF THE INVENTION In the present invention, whole cells are used to select specific antibodies that recognize surface determinants of leukemia cells, where the specific receptor was not previously known or characterized. In addition, a multi-step bio-observation process was used, where the phage was selected by observing more than one cell type. This is a remarkable improvement over prior art methods in which the selection of antigen-specific phage antibodies was highly dependent on bio-preservation against a single immobilized antigen, and there was only limited selection using whole cells as target.

Certain epitopes that were identified by this multi-step process are characterized by the presence of sulphated groups, such as sulphated tyrosine residues or sulfated or lipid carbohydrate groups, preferably within a group of two or more acidic amino acids, are found in ligands and receptors that play an important role in various processes such as inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and / or restenosis, cell coiling, and aggregation. Such epitopes are also found in diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. These epitopes are useful targets for the therapeutic mediation of these processes and for diagnostic procedures.

Although these epitopes have variable primary amino acid sequences, antibodies directed against such sulfated epitopes are often able to bind to or react against more than one such epitope in more than one molecule, although not necessarily simultaneously. Such antibodies are useful as therapeutic agents against cancers (both as antitumor agents and anti-metastatic agents), leukemias, autoimmune diseases, viral diseases, diseases that involve abnormal aggregation, diseases involving abnormal adhesion, infarction, cardiovascular diseases and inflammatory diseases.

The human scFv Yl antibody was isolated from a phage display library of human antibodies that was used to evaluate fixed human platelets in order to identify antibodies that bind to platelets. Several clones were isolated and characterized (different scFv antibodies). It was unexpectedly found that one of these clones, called Yl, binds to leukemia cells derived from patients with AML and patients who have other certain leukemias. Another clone, Y17, was also isolated by observing fixed platelets and found to bind to human blood.

Protein extracted from human platelets were analyzed by immunotransference in SDS-PAGE, using Yl scFv antibody and Y17 scFv antibody, to identify the epitopes to which they bind on the surface of platelets. Using this methodology, it was determined that the epitopes Yl scFv and Y17 scFv in the platelets is glycocalycine, one of the subunits of the CD42 complex.

The extracellular fragment of glycocalicin derived from human platelets was purified from activated platelets. It was digested with different proteases, such as ficin, mochahagin, cathepsin G, to precisely locate the binding epitope of Yl in the glycocalicin molecule. The analysis was carried out using the immunotransference methodology using the Yl antibody as a detection tool. In addition, commercially available anti-glycocalicin antibodies (antibodies that are known to bind to different glycocalicin epitopes) were used in a competition binding assay with antibody Y1 to determine the binding epitope of Y1 in glycocalicin.

Based on the results, it was concluded that amino acids 272 to 285 of glycocalicin play an important role in the binding of Yl to glycocalicin. In addition, since the N-terminal polypeptide derived from glycocalicin E. coli (amino acids 1 to 340 and 1 to 480) were not detectable by the Yl antibody, it was concluded that the binding of Yl to its epitope depends on post-translational modifications, such as glycosylation or sulfation, which are modifications that are not known if they occur in E. coli.

To verify this hypothesis, the purified glycocalicin was treated with enzymes (glycosidases) that remove sugar groups bound by N and O from proteins and enzymes (sulphatases) that remove sulfate groups from proteins. The binding of the Yl antibody to glycocalicin or fragments derived from glycocalicin was not affected by the glycosidases. This result indicates that the sulphated groups are essential for the binding of Yl to glycocalicin.

To better verify these results, sulfated and non-sulfated synthetic peptides were prepared and used based on the identified epitope (glycocalicin amino acids 272 to 285) to evaluate the specificity of the binding of the Yl antibody to glycocalicin in their presence (ELISA assay). The sulphated peptides inhibited the binding of the Yl antibody to glycocalicin several times more than the related non-sulphated peptides indicating that sulfation is required for the binding.

From the preceding results, it was concluded that the epitope for the Y1 antibody is located between amino acids 272 and 285 in glycocalicin where there is a group of amino acids with. negative charge.

In parallel, the binding of Yl antibody to KG-1 cells (a human cell line obtained from a patient with AML), different proteins derived from human plasma, blood samples from patients with primary leukemia was studied.

It was found that the Yl antibody binds with relatively low affinity to two proteins derived from human plasma, one of the size of ~ 50 kD molecular weight, which was identified as fibrinogen? raw and a protein of ~ 80 kD molecular weight, which was identified as a compound complement 4 (CC4) and human lumican. The proteins contain sulphated tyrosine residues accompanied by a stretch of negatively charged amino acids.

Ligand Y1 in KG-1 cells was identified as PSGL-1, which is a receptor for E, L- and P-selectins. PSGL-1 was identified as the antibody ligand Y1 in KG-1 cells based on competition assays (where the binding of antibody Y1 to KG-1 cells was carried out in the presence of different anti-PSGL-1 antibodies commercially available) and in a set of experiments using sulfated and unsulfated synthetic peptides derived from the N-terminal site of PSGL-1. The N-terminal site of PSGL-1 contains sulphated tyrosine residues accompanied by a group of negatively charged amino acids.

Although the Yl antibody binds to several molecules, such as the platelet glycocalicin molecule, fibrinogen-gamma prime, the compound complement 4 of the human plasma, and the PSGL-1 molecule in the KG-1 cells, its affinity to the Primary leukemia cells obtained from patients with AML or multiple myeloma (MM) is several times higher in relation to epitopes mentioned above. Furthermore, the fact that commercially available anti-PSGL-1 antibody (KPL1) does not recognize all diseased primary leukemia cells (7 out of 12) in blood samples obtained from patients, although Yl antibody recognizes them specifically and selectively , indicates that there are additional epitopes for Yl antibody in primary leukemia cells that differ from those in KG1 cells.

Examples of sulfated epitopes according to the present invention include those delineated in Formulas I, II and III, as well as homologs, imitations and variants thereof.

Formula (I): (S) r I [(W) z - P - (Y) t-P] q wherein: W is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulfated P is (A) ra (A) n (X) uo (X) u (A) "(A) mo (A) n (X) u (A) mo (A) n (A) m (X) uo (X) u (A) m (A) n O (A) m (X) u (A) n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine q is 1 to 6 z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is from 0 to 2 n is from 0 to 3 m is from 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; where if q is 1, r is 1 and if q is > 1 at least one of Y is sulfated; and further wherein the isolated epitope is capable of being linked by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region. comprising SEQ ID No. 8 or SEQ ID No. 20.

A preferred epitope is that of Formula I wherein W is Glycine, Y is a Tyrosine conjugated peptide or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate,? Carboxy Glutamate or Aspartate; and q is 1, 2, or 3. In certain embodiments, Y is a Tyrosine conjugated peptide; q is 3; and r is 1.

Formula II: (S) r (S) r (S) r I I I (W) z-P- (Y) r-P- (Y) t-P- (Y) t-P wherein: W is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulfated P is (A) m (A) n (X) i (X) u (A) n (A) mo (A) n (X) u (A) mo (A) n (A) m (X) uo (X) u (A) m (A) no (A) m (X) u (A) "S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with a negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is from 0 to 2 n is from 0 to 3 m is from 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; wherein at least one Y is sulfated; and further wherein the isolated epitope is capable of being bound by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, which comprises a first region. hypervariable comprising SEQ ID No. 8 or SEQ ID No. 20.

A preferred epitope is that of Formula II wherein: is Glycine; And it is a conjugated peptide of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate,? Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline, Phenylalanine, Serine or Glycine. In certain embodiments, Y is a Tyrosine conjugated peptide; q is 3; and r is 1.

Formula III: (S) r (S) r (S) r (G) z (X) u (E) n (D) ni (YI) t (X) u (E) n (D) ra (YI) t (X) u (E) n (D) m (YI) t (D) m (E) n (X) u where : G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the preceding z is 0, 1 or 2 te if, 2 or 3 r is 0 or 1 u is 0 to 2 n is from 0 to 3 m is from 0 to 3 wherein at least one Y is sulfated; where if n = 0 then m > 0; where if m = 0 then n > 0; and further wherein the isolated epitope is capable of being linked by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region. comprising SEQ ID No. 8 or SEQ ID No. 20.

A preferred epitope is that of Formula III wherein r is 1.

The sulphated group of any of the Formulas can also be a peptide- or glyco- or lipo-conjugated. And it may comprise a lipid and / or carbohydrate molecule. The epitopes may have at least one post-translational modification in addition to the sulfation.

Such epitopes are found in diverse molecules such as GPIb and PSGL-1 and are found in certain diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. The sulfation of tyrosine and / or other groups is particularly important for binding to these epitopes. It is known that human proteins that are tyfated with tyrosine include the following: Peptide Thrombomodulin Sequence (408-426) ECPEGYILDDGFICTDIDE Human GPIb (269-287) DEGDTDLYDYYPEEDTEGD Human Heparin Cofactor II GEEDDDYLDLEEDDDYIDIVD (56-75) Human Fibrinogen? (408-427) VRPEHPAETEYDSLYPEDOL 2-Antiplasmin PPMEEDYPQFGSP Cholecystokinin (CCK) RISDRDYMGWMDF < x ~ 2-Coriogonadotropin CHCSTCYYHSKS-COOH Complement C4 MEANEDYEDYEYDELPAK PSGL-1 QATEYEYLDYDFLPET Factor VIII (716-731) GDYYEDSYEDISAYLL Lumican GYYDYDFPL Production and Selection of Yl An example of an antibody of the present invention that binds epitopes of Formulas I-III is the fully human monoclonal antibody Yl. The selection, production and initial characterization of Yl are described in detail in the American patent application Minutes No. 09 / 751,181 and 60 / 258,948. Briefly, a phage display library was used to present fragments of scFv antibodies to obtain and produce target-targeting molecules, and flow cytometry, particularly fluorescence activated cell sorting (FACS) was used to identify and isolate clones from specific phages, whose peptide or polypeptide recognizes white. The phage display library used here was constructed from peripheral blood lymphocytes from a non-immunized human donor.

The phage clones were selected and identified through a multi-step procedure called bio-observation. Bio-observation was carried out by incubating variants of phage-presenting protein ligands (a phage display library) with a blank, removing unbound phage by a washing technique, and specifically eluting the bound phage. The eluted phage was optionally amplified before taking it through additional cycles of binding and additional amplification that enriched the set of specific sequences in favor of those phage clones that carry fragments of antibodies that present the best binding to the target. After several rounds, individual phage clones were characterized, and the sequences of the peptides presented by the clones were determined by sequencing the corresponding DNA of the phage virion.

In the present invention, the evaluation of platelets was carried out against undefined epitopes for the initial steps of bio-observation, the selection of subsequent clones was performed with a desired target cell (eg B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells), whose markers of the surface of the target cells are known.

Malignant and diseased blood cells (eg, leukemia or lymphoma) are characterized as immature cells that express proteins from surface cells normally found in partially differentiated hematopoietic progenitors. Therefore, platelets are an attractive source for identifying surface markers of premature cells expressed in diseased or malignant blood cells.

Yl, a clone of scFv that binds to platelets and myelogenous leukemia cells, particularly AML cells, was selected. Yl scFv has the sequence SEQ ID No. 25. The characteristics of the binding of Yl can be attributed mainly to its heavy chain CDR3 region, which has the sequence SEQ ID No. 8. Yl-IgG complete antibodies were also produced.

A second clone of scFv, Y17, was also selected, which binds to platelets and cell lines derived from human myelogenous leukemia cells, particularly AML cells. Y17 scFv has the sequence SEQ ID No. 203. The characteristics of the binding of Y17 can be attributed mainly to its heavy chain CDR3 region, which has the sequence SEQ ID No. 20.

Production of Antibodies The CDRs according to the present invention can also be inserted into cassettes to produce antibodies. A cassette, applied to polypeptides and defined in the present invention, refers to a given sequence of consecutive amino acids that serves as a framework and is considered a single unit and is manipulated as such. The amino acids can be replaced, inserted, removed or joined at one or both ends. Similarly, stretches of amino acids can be replaced, inserted, removed or attached to one or both ends.

The amino acid sequence of the cassette can be fixed ostensibly, while the sequence replaced, inserted or joined can be highly variable. The cassette can be composed of several domains, each of which covers a crucial function for the final construction.

The hypervariable regions of the antibodies of the invention form the antigen-binding sites of the antibodies of the present invention. The antigen-binding site is complementary to the structure of the epitopes to which the antibodies bind and is consequently they call complementarity determining regions (CDR). There are three CDRs in each light and heavy chain of an antibody, each located in the loops that connect the ß strands of the VH and VL domains.

The cassette of a particular embodiment of the present invention comprises, from the N terminals, the frame region 1 (FR1), CDR1, frame region 2 (FR2), CDR2 and frame region 3 (FR3).

In an embodiment of the invention, it is possible to replace distinguishable regions within the cassette. For example, the CDR2 and CDR1 hypervariable regions of the cassette can be replaced or modified by non-conservative or preferably conservative amino acid substitutions. More specifically, the CDR 2 and CDR1 regions of a cassette of consecutive amino acids selected from the same group comprising SEQ ID Nos. 30-113 or a fragment thereof can be replaced by SEQ ID Nos. 115 and 114, respectively. Even more specifically, the CDR2 and CDR1 regions of a consecutive amino acid cassette selected from the group consisting of SEQ ID Nos. 37-39, 41, 43, 45, 46, 48, 51, 59-68, 70, 71, 76 -85, 87, 98-92, 94, 97, 99, 103, 106, 112 and 113 or a fragment thereof can be replaced by SEQ ID Nos. 115 and 114, respectively.

In a preferred embodiment of the invention, the peptide or polypeptide comprises a heavy and a light chain, and each chain comprises a first, second and third hypervariable regions which are the CDR1, CDR2 and CDR3 regions, respectively. The selectivity and specificity of the binding are determined in particular by the CDR3 region of a chain, possibly by the CDR3 region of the light chain, and preferably, by the CDR3 region of the heavy chain, and secondarily by the CDR2 and CDR1 regions of the light chain and preferably heavy chain. The selectivity and specificity of the binding may also be secondarily influenced by the ascending or descending regions flanking the first, second and / or third hypervariable regions.

In a preferred embodiment, the CDR3 region of the peptide or polypeptide has an amino acid sequence selected from the group comprising SEQ ID Nos. 8-24.

In a more preferred embodiment, the CDR3 region of the heavy chain has an amino acid sequence selected from the group comprising SEQ ID Nos. 8-24, CDR2 has an amino acid sequence identical to SEQ ID No. 115 and the region CDR1 has an amino acid sequence identical to SEQ ID No. 114.

In the most preferred embodiment of the invention, the CDR2 region has an amino acid sequence identical to SEQ ID No. 8.

A preferred embodiment of the invention is a scFv with a sequence of CDR3 identical to SEQ ID No. 8 and a complete scFv sequence identical to SEQ ID No. 25.

In the most preferred embodiment of the invention, the CDR3, CDR2 and CDR1 regions have SEQ ID Nos. 8, 115 and 114 of the amino acids, respectively.

In one embodiment of the invention, the Fv peptide comprises a CDR1 and CDR2 region of the variable heavy chain that alone comprises a cassette with an amino acid sequence selected from the group comprising SEQ ID Nos. 30-113; a CDR3 region, preferably of the variable heavy chains, having an amino acid sequence selected from the group comprising SEQ ID N ° 8-24; an ascending region flanking the CDR3 region having the amino acid sequence of SEQ ID No. 117; a descending region flanking the CDR3 region having the amino acid sequence of SEQ ID No. 116; a 0-20 amino acid residue separator of SEQ ID No. 123 or 124; a variable light chain region whose sequence is SEQ ID No. 7.

Similarly, in another embodiment the ascending region flanking the CDR2 region has the amino acid sequence of SEQ ID No. 119, the descending region flanking the CDR2 region has the amino acid sequence of SEQ ID No. 118 , the ascending region flanking the CDR1 region has the amino acid sequence of SEQ ID No. 121 and the descending region flanking the CDR1 region has the amino acid sequence of SEQ ID No. 120.

A preferred embodiment of the invention provides a peptide or polypeptide wherein the second and third hypervariable regions are an iRavariable region CDR2 and a CDR1, respectively and wherein the amino acid sequence of CDR3 is SEQ ID No. 8, wherein the sequence of amino acids of the CDR2 region is SEQ ID No. 115, wherein the amino acid sequence of CDR1 is SEQ ID No. 114, wherein the ascending region flanking the CDR3 region has the amino acid sequence of SEQ ID No. 117 , wherein the descending region flanking the CDR3 region has the amino acid sequence of SEQ ID No. 116 wherein the ascending region flanking the CDR2 region has the amino acid sequence of SEQ ID No. 119, wherein the region descending flanking the CDR2 region has the amino acid sequence of SEQ ID No. 118, wherein the ascending region flanking the CDR1 region has the amino acid sequence of SEQ ID No. 121 and wherein the The descending ion flanking the CDR1 region has the amino acid sequence of SEQ ID No. 120.

Another embodiment of the invention provides an Fv molecule comprising a first chain having a first, a second and a third hypervariable region and a second chain having a first, a second and a third hypervariable region, wherein one of the regions hypervariables of the first strand has a sequence selected from the group consisting of SEQ ID Nos. 8-24, and wherein one of the hypervariable regions of the second strand has a sequence selected from the group consisting of SEQ ID Nos. 1-6 and 125-202, and wherein the first, second and third hypervariable regions are a CDR3, CDR2 and CDR1 region, respectively and wherein Fv is a scFv or a dsFv, and optionally has one or more markers.

Another embodiment of the invention provides a peptide or polypeptide (i) wherein the first strand and the second strand each comprise a hypervariable region selected from the group consisting of SEQ ID Nos. 8-24; or (ii) wherein the first hypervariable region of the first and second chains are identical and are selected from the group consisting of SEQ ID Nos. 8-24; or (iii) wherein the first hypervariable region of the first strand is selected from the group consisting of SEQ ID Nos. 8-24 and the first hypervariable region of the second strand is selected from the group consisting of SEQ ID Nos. 1-6 and 125-202; or (iv) wherein the first hypervariable region of the first strand is selected from the group consisting of SEQ ID Nos. 1-6 and 125-202 and the first hypervariable region of the second strand is selected from the group consisting of SEQ ID Nos. 8-24.

Another embodiment provides the peptide or polypeptide of the invention wherein the second and third hypervariable regions of the first strand are SEQ ID Nos. 114 and 115, respectively.

For all amino acid sequences of < 25 amino acid residues described and detailed herein (eg the CDR regions, the regions flanking the CDRs) should be understood and considered as another embodiment of the invention that these amino acid sequences include within their scope one or two amino acid substitutions and that the substitutions are preferably conservative amino acid substitutions. For all amino acid sequences of > 25 amino acid residues described and detailed herein, it should be understood and considered as an embodiment of the invention that these amino acid sequences include within their scope an amino acid sequence with > 90% similarity of the sequences to the original sequence (Atschul et al, Nucleic Acids Res., 25, 3389-3402 (1997)). Similar amino acids or homologs are defined as non-identical amino acids that have similar properties, for example, acids, basic, aromatic, size, with positive or negative charge, polar, non-polar.

The percentage of similarity or homology of the amino acids or of similarity of the sequences is determined by comparing the amino acid sequences of two different peptides or polypeptides. The two sequences are aligned, generally using one of the variety of computer programs designed for that purpose, and the amino acid residues at each position are compared. Then the identity or homology of the amino acids is determined. Then an algorithm is applied to determine the percentage of similarity of the amino acids. It is generally preferable to compare amino acid sequences, due to the much greater sensitivity to the detection of subtle relationships between the peptide, polypeptide or protein molecules. The comparison of proteins can take into account the presence of conservative amino acid substitutions, so that an inequality can still give a positive rating if the non-identical amino acid has similar physical and / or chemical properties (Altschul et al, Nucleic Acids Res. , 25, 3389-3402 (1997)).

In one embodiment of the invention the three hypervariable regions of each of the light and heavy chains can be exchanged between the two chains and between the three hypervariable sites within and / or between chains.

Polyclonal Antibodies against Vi (derivative of Yl) The DNA fragment encoding the VL domain (variable light chain) of the human antibody was cloned with PCR from clone Yl (the identical DNA fragment can be obtained from any other clone in the Nissim library (Nissim et al, Fragments of Antibodies from the "single-container" phage display library as immunochemical reagents ", EMBO J. 13 (3): 692-698 (1994)) or even from the human genome using the same methodology) with the following oligonucleotide primers Synthetic: oligo 5'-Nidel (TTTCATATGGAGCTGACTCAGGACCCTGCT) and oligo 3'-EcoRI (TTTGAATTCCTATTTTGCTTTTGCGGC) After amplification by the polymerase chain reaction (PCR conditions: 94 ° 1 ', 56 ° 2', 72 ° 2 ' x 30 then 65 ° 5 ') the obtained DNA fragment was digested with the restriction enzymes Ndel and EcoRI and cloned at the sites of the restriction enzymes Ndel and EcoRI of a predigested plasmid, which is an inducible expression vector IPTG used for l a prokaryotic expression of recombinant proteins in E. coli. The E. coli cells were transformed with the ligation mixture and positive clones were selected by PCR amplification using the preceding oligonucleotide primers. The cells harboring this plasmid were cultured and expression was induced by IPTG. Baceterian cells were cultured by centrifugation from 1 liter of culture after induction with IPTG, inclusion bodies were isolated and solubilized in guanidine-HCl + DTT and folded again by dilution in a buffer containing Tris-Arginine-EDTA. After re-folding at 5-10 ° for 48 hours, the solution containing the protein was dialysed and concentrated to 20 mM Glycine at pH 9. The dialyzed solution containing proteins was again purified using an ion exchange column, HiTrapQ, and eluted with a NaCl gradient. The main peak was analyzed by SDS-PAGE and by gel filtration. At least 10 mg of purified VL were obtained from an original 1 liter culture.

Rabbits were immunized with VL (400 mg) in the presence of CFA (complete Freund's adjuvant) then with VL (200 mg) in the presence of TFA (incomplete Freund's adjuvant) at intervals of 2 to 4 weeks. The titles obtained were low (1: 50-1: 100) probably due to the high homology between the VL of humans and rabbits.

Polyclonal Antibodies against scFv Antibodies Two clones of individual scFv antibodies (Yl and Y14) derived from the phage display library of Nissim I antibodies (Nissim et al, "Antibody fragments from a" single-container "phage display library as immunochemical reagents", EMDO J. 13 (3): A692-698 (1994)) were cultured separately. After induction of IPTG the cultures were cultured at 22 ° C for 16 hours. The scFv antibody fragments were cultured from the periplasm of bacterial cells and purified on the Protein A-Sepharose column. All procedures for the culture of bacterial clones, the induction protocol, the culture of scFv antibody fragments and the purification of antibody fragments were carried out according to: Harrison JL, Williams SC, Winter G., and Nissim A Methods Enzymol. 267: 83-109 (1996). Basically, two or more individual scFv clones can be selected from the Nissim I antibody phage display library to prepare polyclonal antibodies obtained from rabbits that recognize any individual scFv antibody that is present in the Nissim library or any IgG or fragment. of it whenever it contains the same VL or a fragment of it.

Rabbits were immunized with 400 mg of a mixture at a ratio of 1: 1 of the purified scFv antibody fragments in the presence of complete Freund's adjuvant and then with 200 mg of that mixture in the presence of incomplete Freund's adjuvant, with intervals from 2 to 4 weeks.

For the detection of the binding of scFv antibodies to the cells by flow cytometry (FACS) or to different protein fractions on SDS-PAGE (immunotransfer analysis), the polyclonal anti-scFv antibodies were used directly from the serum of the immunized rabbits or after purification on a Prtacin A-Sepharose column.

Characterization of the Yl Union Site in Platelets Circulating platelets are cytoplasmic particles released from the periphery of magacariocytes. Platelets play an important role in hemostasis. In the presence of a vascular lesion, the platelets adhere to the surfaces of the damaged tissues and attach themselves to one another (cohesion). This sequence of events occurs rapidly, forming an unstructured mass (commonly called a platelet plug or thrombus) at the site of the vascular injury. The phenomenon of cohesion, also called aggregation, can be initiated in virto into a variety of substances, or agonists, such as: collagen, adenosine diphosphate (ADP), epinephrine, serotonin, and ristocetin. Aggregation is one of the numerous in vitro tests performed as a measure of platelet function.

Several lines of evidence from the prior art indicate that the group of negatively charged amino acids between Asp269 and Asp287 of GPIba is important for the binding of von Willebrand Factor (vWF) to platelets, which in turn mediates the adhesion of platelets to proteins. Damaged blood vessels, platelet aggregation induced by high cut in regions of arterial stenosis, and platelet activation induced by low concentrations of thrombin. Ward, C.M. et al, Biochemistry 35 (15): 4929-39 (1996). The interaction of vWF with GPIb depends on an activation event or conformational change in the vWF structure when it joins the array or is exposed to a cut. This process is mimicked in vitro by specific modulators that bind to vWF, such as ristocetin and botrocetin.

Bioactivity of Yl to Platelet Cell Extract Immunoblotting and endoprotease cleavage techniques were used to identify the Y1 epitope in the surface membrane of the platelets. The endopfotease cleavage sites in the GPIba molecule are shown in Figure 1.

Immunoblot Analysis [Western Blot] Yl scFv was selected from the faqos antibody library by looking at human platelets and found to bind to fixed and washed human platelets. The characterization of Yl was done using the ELISA assay and by FACS analysis.

To characterize the epitope in the membrane of the peg to which Yl binds, the proteins on the surface of the platelet are separated by SDS-PAGE (under conditions of reduction and not reduction) and immunoblotted with Yl labeled with biotin. The results of this experiment demonstrate that Yl reacts with a protein with a molecular mass of 135 kDa under reducing conditions, and with a protein with a molecular mass of 160 kDa under non-reducing conditions. These molecular masses correspond to the GPIba platelet, which has a molecular mass of 135 kDa under reduction conditions. Under non-reducing conditions, the GPIb chain linked by disulfide to GPIbp has a molecular mass of 160 kDa (Figure 2).

The GPIba chain binds with disulfide to the GPIbp chain to form the GPIb platelet membrane protein. It is known that monoclonal antibodies, MCA466S (Serotec) and SC7071 (Santa Cruz), bind respectively to the C-terminal fragment of GPIba and the N-terminus of GPIba and were found to react to the same fragments with which Yl reacts in conditions of reduction and not reduction (SC was used only in reduction conditions). These results further confirm that Yl binds to the GPIba platelet surface protein.

Another analysis on a fragment of semipurified GPIb (glycocalicin) by immunoblotting confirmed that Yl still binds to the alpha subunit of the GPIb complex.

Immunoblot analysis of recombinant GPIb expressed in E. coli showed that GPIb expressed in E. coli does not react with Yl. Therefore, it seems that post-translational modification, which does not occur in E. coli, is necessary for the union of Yl. Neither the N- nor the O-glycanases affect the binding of Yl to the KG-1 cells. however, the binding of Yl can be inactivated (eliminated) by the treatment of the ligands with aryl sulfatases or by proteases (Figure 3).

Location of the Epitope Site Yl in the glycocalycine GPIba fragment (GC) To locate the Yl binding site, specific endoproteases with known break sites were used to digest GPIb and the fragments were tested for Yl binding.

Effect of O-Sialoglycoprotein endoprotease on the binding of Yl to the GPIba platelet The enzyme O-sialoglycoprotein endoprotease of Pasteurella haemolytica (Cedarlan CLE 100) selectively breaks down the human GPIb platelet and specifically breaks only proteins containing sialylated glycans, bound by O. The O-sialoglycoprotein endoprotease does not break N-linked glycoproteins or non-glycosylated proteins. It has been reported that this enzyme breaks GPIb, which is strongly O-glycosylated, but not GPIIb-IIIa or other receptors in platelets. GPIba was digested with O-Sialoglycoprotein endoprotease to further establish the binding of Yl to the molecule.

The immunoblots (Figures 4 and 5) and the FACS analysis (Figure 6) demonstrated that incubation of platelets washed with O-Sialoglycoprotein endoprotease eliminates the binding of Yl, as well as the binding of the monoclonal antibody MCA466S (Serotec), which is directed against GPIba. The endoprotease did not alter the binding of a monoclonal antibody (anti-CD61) directed against GPIIb / IIIa (Figure 4). These results provide further evidence that the receptor for Yl in platelet membranes is GPIba.

Rupture by Mocarhagina of GPIb Mapping of Epitope Yl Mocarhagina [Sigma L4515a] is a cobra venom metalloproteinase that breaks the GPIba platelet specifically at a single site between the glu-282 and asp-283 residues, thereby generating two stable products: a 45 kDa N-terminal fragment ( Hisl-Glu282), which is released into the supernatant, and a 95 kDa C-terminal fragment bound to the membrane.

Washed platelets were treated with mochahagin, and platelet used were subjected to electrophoresis on SDS-polyacrylamide gels and transferred to nitrocellulose. Immunoblot analysis of lysates treated washed platelets with Yl mocarhagina shows a loss corresponding to GPIBA band (135 kDa) and binding of Yl to 45 kDa fragment of terminal N. A monoclonal antibody (MCA466S) directed against the C-terminal fragment of GPIba reacted with the 95 kDa C-terminal fragment and a monoclonal antibody (SC7071) directed against the N-terminal fragment of GPIba reacted with the same 45 kDa fragment recognized by Y1 (Figure 7).

Mocarhagina treatment of glycocalicin (soluble, extracellular fragment GPIBA) gave results similar to those observed with washed platelets results, which shows the binding of Yl and monoclonal antibody fragment SC7071 product breaking the N terminal 45 kDa GPIba (Figure 8). These results suggest that the epitope for Yl is contained within the Hisl-Glu282 sequence.

Characterization of the 'Union of Clone Y17 to GPIb Y17, a second human scFv antibody fragment of the invention, which was selected in the same manner as Y1, was characterized using the methods used to characterize Y1 [See Example 17]. In summary, Y17 was selected from a phage antibody library by bio-observation of human platelets. The characterization of Y17 was done using the ELISA assay and the FACS analysis. It was found that Y17 binds to fixed and washed human platelets. To further characterize the receptor on the platelet membranes that bind to Y17, the platelet proteins were separated by SDS-PAGE and immunoblotted with biotin-labeled Y17 under reduced and non-reduced conditions. The results demonstrated that Y17 reacts with proteins having an apparent molecular weight of 135 kDa under reducing conditions, and with a protein having an apparent molecular weight of 160 kDa under non-reducing conditions. These results correspond to the GPIba platelet that under reduction conditions has a molecular weight of 135 kDa and under non-reducing conditions it has a molecular weight of 160 kDa and consists of the chain of GPIba bound by disulfide to GPIba. The, MCA466S (Serotec) monoclonal antibodies directed against the C-terminal fragment monoclonal antibody SC7071 (Santa Cruz) of GPIBA recognizing the N terminus of GPIBA react with the same bands Y17 under reducing conditions and reducing conditions (Figure 2).

Immunoblots show that Yl and Y17 bind in a similar way to platelet lysates (Figure 9).

Yl and Y17 also bind in a similar manner to glycocalicin after the glycocalicin breakdown by O-Sialoglycoprotein Endoprotease or Ficin (Figures 5 and 10).

The FACS analysis indicated that Yl has similar binding profiles to platelets and KG-1. In addition, none bind to Raji and T2 cells. In contrast, TM1 (SEQ ID No. 209), Y16 (SEQ ID No. 210) and Y45 do not bind to any of the human cell lines mentioned above.

These results demonstrate that Yl and Y17, two fragments of monoclonal antibodies of the present invention, share an epitope in different cells, and that this epitope is not recognized by any other monoclonal antibody tested.

Rupture by Cathepsin G of GPIb Mapping of Yl Epitope Cathepsin G (Sigma C4428), a neutrophil serine protease, breaks glycocalicin at a first cleavage site between residues Leu-275 and Tyr-276 and at a second cleavage site between residues Val-296 and Lys-297. Treatment with glycocalicin cathepsin G generates two N-terminal fragments: a 42 kDa fragment of the N-terminus (Hisl-Leu275), a large-size N-terminal 45 kDa N-terminal fragment (Hisl-Val-296) and corresponding to the 95 kDa C-terminal fragments (Figure 1).

Glycocalicin and the glycocalicin fragments generated by the cathepsin G digestion were subjected to electrophoresis in SDS-polyacrylamide gels and transferred to nitrocellulose for immunoblot analysis. In immunoblots, Yl bound to the larger N-terminal fragment (Hisl-Val-296), but not to the smaller N-terminal fragment (Hisl-Leu275), nor to the C-terminal fragment. Similarly, the commercial monoclonal antibody SZ2 (Immunotech 9719), which is known to recognize an epitope in GPIba between residues Tyr276 and Glu282 also reacts only with the larger N-terminal fragment (Figures 11 and 12).

Moreover, the monoclonal antibody S.C.7071 known to recognize an epitope between Hisl and Leu 275, bound to both terminal N fragments. Yl does not bind to the His 1-Leu 275 fragment bound by S.C.7071. These results suggest that the epitope for Yl is located between the first and the second cleavage site of cathepsin G that is within the sequence Tyr 276 - Val 296 or more likely between amino acids 276 and 282.

Effect of the Partial Synthetic GPIboc Peptides on the Union of Yl to purified glycocalicin and washed platelets (WP) ELISA assays were developed to evaluate the effect of synthetic peptides derived from GPIb on the binding of Yl to purified glycocalicin. In addition, FACS analyzes were carried out using washed platelets. To evaluate the importance of sulphated tyrosine within the Y1 binding site of GPIb, a competitive binding FACS analysis was used. Yl-scFv at a concentration of 1 μg was preincubated with different peptides at concentrations of 2.5 and 200 μ ?. After preincubation for 30 minutes at room temperature the mixture was added to a tube containing 107 washed platelets and the binding of Yl to the washed platelets was evaluated using rabbit polyclonal anti-scFv-PE. The inhibitory effect of the peptides compared to the binding of the control (Yl alone) was evaluated by measuring the residual binding of Yl to washed platelets. The peptides and results are described in Tables 1 and 3, respectively, and are similar to the results that were observed using the same peptides in an ELISA assay (Table 2). In both tests, a control level of the binding of Yl was determined in the following manner. A Maxisorp® polystyrene microtiter plate was coated with (a) purified glycocalicin or (b) washed platelets. After extensive washing, 0.5 μg / Yl receptacle was added. The plate was then incubated with rabbit anti-scFv followed by the addition of rabbit HRP (horseradish peroxidase) and HRP substrate. The level of binding of rabbit HRP was measured by the intensity of the color produced, and the level of binding of rabbit HRP correlates with the level of binding of anti Yl-scFv and the level of binding of Yl. The optical density was measured at? 405. Each sample was tested in duplicate, and the average was calculated.

The effect of the synthetic GPIba peptides on the binding of Yl to purified glycocalicin was evaluated by mixing varying concentrations of the peptides with a constant amount of Yl. After preincubation for 30 minutes at room temperature, the mixture was added to a Maxisorp polystyrene microtiter plate coated with purified glycocalicin, as described for the evaluation of Yl binding in the absence of peptides. Peptide inhibiting effete was evaluated by measuring the residual binding of Y1 to glycocalicin using rabbit anti-YlscFv and rabbit anti-HRP antibodies, as described for the evaluation of Y1 binding in the absence of peptides. This study was conducted with four peptides representing different subsets of the sequence from 268 to 285 and a control peptide. Each peptide was tested at different concentrations: 200 μ ?, 25 μ ?, 2.5 μ? and 0.5 μ ?.

The five peptides are the following in Table 1: Table 1 Y * is identical to Y which is tyrosine sulphated.

The results obtained from these tests are presented Tables 2 and 3 below.

Tala 2 Effect of Synthetic GPIba Peptides on the Union of Yl to Glycocalycine at 0.5 μg / Yl Receptacle These results clearly show that the inhibitory effect of the sulphated tyrosine-containing peptides is significantly higher than that observed for the non-sulfated peptide. This effect is dose dependent, and peptides containing longer N 'side (ascending) sequences had a higher inhibitory effect than peptides with extended C (lateral) side sequences. These results clearly support the conclusion that sulfated tyrosine is required for the binding of Yl to GPIba, and that the ascending and descending sequences from the sulphated region improve the binding of Yl to GPIbot.

Table 3 Effect of Synthetic GPIba Peptides on the Union of Yl to Washed Platelets Described by Comparative FACS Analysis These results further support the hypothesis that sulphated tyrosine residues within the specific region are important for the recognition of Yl in GPIb. In general, analysis of the proteolytic fragments of N-terminal peptides of mocarhagin and cathepsin G suggest that the amino acid sequence of GPIboc Tyr276-Glu-282 is or contains an important epitope for the binding of Yl. (Figure 3). Another characterization indicated that in addition to residues 276-282 (anionic sulfated sequence) of glycocalicin, ascending amino acids 283-285 are involved in the recognition site of Yl.

Biological Activity of Yl scFv,? 17 scFv and IgG Yl on the Function of Platelets Localization experiments suggested that the Yl binding site resides in alpha-thrombin and vWF binding sites, which are important for platelet aggregation. Accordingly the binding of Yl scFv, Y17 scFv, and Yl IgG to washed platelets and to platelet rich plasma was studied to determine the effects of binding on platelet aggregation.

Effect of Yl-scFv and Y17-scFv on the Agglutination of Washed Platelets (W.P.) Aggregation is determined in PRP due to the presence of thrombotic agents, while agglutination is determined in washed platelets. The effect of Yl (scFv) on the agglutination of washed platelets was tested at different concentrations of Yl. The platelets were preincubated with Yl-scFv, Y17 scFv, Y16-scFv or a TM-1 control scFv for 4 minutes at 37 ° C before being exposed to ristocetin, an inducer of agglutination and platelet aggregation.

The results of this study are presented in Table 4 and Figure 15. Platelet preincubation with 25 μg / ml of Yl scFv inhibited washed platelet agglutination induced by reistocetin. At a Yl concentration of 12.5 μg / ml, only partial inhibition of platelet agglutination was observed. No inhibition of platelet agglutination was observed at a concentration of 4 μg / ml of Yl. These results indicate that the inhibitory activity of Yl on the agglutination of washed platelets depends on the dose. Incubation of platelets washed with scFv TM1 negative control had no effect on platelet agglutination induced by ristocetin. Neither Y17 nor Y16, which is another scFv clone selected from the same phage display library and using the same multistep procedure used to select YI, significantly inhibited the agglutination of washed platelets.

Table 4 * 100% agglutination is calibrated based on ristocetin treatment Effect of Yl-scFv and Y17-scFv on Aggregation of Platelet Rich Plasma (PRP) The effect of Yl (scFv) on aggregation of platelet-rich plasma (PRP) was tested at different concentrations of Yl. PRP was pre-incubated with Yl scFv, Y17 scFv, or a sTM-lcFv control for 4 minutes at 37 ° C before being exposed to ristocetin, an inducer of agglutination and platelet aggregation. A reversible inhibitory effect was observed when scFv was added to PRP before the addition of ristocetin, and was dose dependent.

The results of this study are presented in Table 5 and Figure 16. Yl at a final concentration of 50 μg / ml · inhibited 80% platelet aggregation in platelet-rich plasma induced by ristocetin recorded during the prmeros 4 minutes There was no significant inhibition of platelet aggregation at a Yl concentration of 25 g / ml. Y17 did not inhibit platelet aggregation. Incubation of platelets washed with 50 μg ml of scFv, TM1, negative control, had no effect on platelet aggregation induced by ristocetin (Table 5).

A comparison between washed platelets and PRP indicated that (1) scFv Yl has an inhibitory effect on platelet aggregation and agglutination induced by ristocetin; (2) the effect depends on the dose; (3) a higher inhibitory effect is observed in washed platelets in relation to PRP; (4) a reversible inhibitory effect on PRP was detected; (5) neither TM1 nor the Y16 scFv antibody fragments had effect; and (6) Y17 is a negative control in this assay.

Table 5 * 100% agglutination is calibrated based on ristocetin treatment Effect of Yl-IgG on Washing Platelet Agglutination (W.P.) Due to its natural structure the complete IgG Yl has two binding sites for GPIba and a binding site for a Fe receptor. It is likely that if Yl of complete IgG binds to two molecules of GPIba, activate platelets and induce agglutination of platelets. Moreover, because platelets have a Fe receptor, Yl-IgG can induce platelet agglutination by binding to GPIba and a Fe receptor, thereby producing platelet agglutination by binding each YL of IgG to three. platelets. Consequently, the effect of Yl of IgG on the aggregation of washed platelets was tested at different concentrations of Yl-IgG in the presence or absence of ristocetin. The induction of platelet aggregation by Yl-IgG was monitored for 4 minutes at 37 ° C, followed by the addition of ristocetin.

The results are presented in Table 6 and in Figure 17 without agonist. Yl-IgG alone at a final concentration of 5C ^ g / ml induced platelet agglutination by 39% of the normal agglutination of washed platelets. The induction of platelet agglutination by Yl-IgG was assayed for 4 minutes at 37 ° C, followed by the addition of ristocetin. No additional effect on agglutination was observed after the addition of ristocetin: normal platelet agglutination was observed. However, there was no induction of platelet agglutination when the platelets were incubated with 1 μg ml of Yl.

There was no reduction in platelet agglutination when the commercial monoclonal antibody against GPIba (CD42) (Pharmigen), which inhibits platelet agglutination, or control human IgG-Lambda (Sigma) was used as described above.

Table 6% of Inhibition of Sinus Aglutirion Without With Ristocetin Ristocetin Ristocetin Ristocetin Concentration of IgG Ab Yl-IgG 50 μg / ml 61 5 39 95 Yl-IgG 25 g ml 65 5 35 95 Yl-IgG 12.5 μg / ml 62 5 38 95 Yl-IgG 3.5 μg / ml 66 14 34 86 Yl-IgG 1 μg / ml 92 7 8 93 CD42 IgG 99.5 100 0.5-0 Mouse anti-human 20 μg / ml Human IgG 99.5 25 0.5 75 control 20 μg / ml Activation of 0 100 ristocetin control Effect of Yl-IgG on the Aggregation of Plasma Rich in Platelets (PRP) The effect of Yl-IgG on aggregation of Platelet Rich Plasma was tested at different concentrations of Yl-IgG in the presence or absence of ristocetin. The induction of platelet aggregation by Yl-IgG was assayed for 4 minutes at 37 ° C, followed by the addition of ristocetin.

The results are presented in Table 7 and Figure 18. No effect on platelet aggregation was observed after the addition of ristocetin: normal platelet aggregation was observed. Yl-IgG at the final concentration of 50 μg / ml induced platelet aggregation in platelet-rich plasma, before adding ristocetin. Yl-IgG at a concentration of 25 μg / ml only partially induced the aggregation of platelets before the addition of ristocetin. No inhibition of platelet aggregation was observed with 10 μg / ml Yl-IgG concentrations, 4 μg / ml or 1 μg / ml. Commercial monoclonal antibodies against GPIb (Pharmigen), which inhibit platelet aggregation at the concentration of 20 μg ml / · did not induce platelet aggregation. IgG-Lambda (Sigma) human control at the same concentration as Yl-IgG did not induce platelet aggregation.

Table 7% of Inhibition% Aglutiiiación Sin Con Sin Con Ristccetina Ristocetina Ristocetina Ristocetina IgG concentration Yl-IgG 50 μg / ml · 64 0 36 100 Yl-IgG 25 μg / ml 75 8 25 92 Yl-IgG 10 μg / ml · 93 10 7 90 Yl-IgG 4 μg / ml 98 5 2 95 Yl-IgG 1 μg / ml 95, 5 0.5 0.5 99, 5 IgG anti-CD42 99.5 0.5 0, 0.5 99.5 human 20 μg / ml Activation of 0 100 ristocetin control Identification of Yl Plasma Soluble Ligands and Cell Lines Antibodies against GPIboc (CD42b) recognize the platelet lysate and glycocalycine but not the lysate of KG-1 cells (a line of Yl-positive myeloid cells) or the lysate of RAJI cells (a B cell line that is negative for the binding of Yl to concentrations at which the KG-1 cells are positive for the binding of Yl). In contrast, he recognized glycocalycin, platelet lysate and KG-1 cells, but not the extract of RAJI cells. The negative control scFv-181 did not recognize any of the relevant proteins (Figure 20).

The exclusivity of the cross-reactivity of Yl was further demonstrated in a comparative analysis between Yl and SZ2 (Mab versus the sulfated region of GPIb). In contrast to SZ2, Yl binds not only to GPIb, but also to plasma proteins, and to extracts of myeloid-derived cells described below.

Ligands of Yl in Human Plasma Two proteins immunoreacted with Yl in plasma from normal patients as well as from patients with leukemia. The first is called H P-ligand 1, which has a molecular mass of 50 kDa under reducing conditions and > 300 kDa under non-reducing conditions and completely disappears from the serum after coagulation; and (2) H P-ligand 2, which has a molecular mass of 80 kDa under reducing and non-reducing conditions and which is maintained in the serum after coagulation. After purification using an inverted-phase 2D electrophoresis of Q-Sepharose column (RP-HPLC), and peptide mapping, the 50 kDa ligand was identified as the normal variant of the gamma (? Prime) fibrinogen chain human. The sequence VRPEHPAETEYDSLYPEDDL, is present only in the gamma-prime fibrinogen, but not the abundant form of gamma fibrinogen, and is similar to the anionic region of GPIb containing tyrosine sulphated. More likely this is the binding site for Yl. 80 kDa was identified as the compound complement 4 (CC4) and lumican. As before, it contains sulphated tyrosine residues accompanied by a stretch of amino acids with a negative charge.

Union of Yl to Primary Leukemia Cells The eAFACS analysis indicates that Yl binds selectively to leukemia cells, but not to normal blood cells in both a normal blood sample and normal cells within the blood of leukemia samples. A summary of the results of patient analysis is shown in the following tables.

Table 8: Results of Patients with Yl Table 9: Leukemia BM = Bone Marrow PB = Peripheral Blood Characterization of the Yl Epitope in Myeloid Cells (KG-1) Approximately 25 billion KG-1 cells were collected for the purification of the Yl epitope from KG-1 cell membranes. It was found that membrane preparations of KG-1 contained at least two subunits to which Yl binds: a subunit of 110 kDa and a subunit of 120 kDa. Yl also binds to a subunit of 220 kDa, which can be a dimer of the 110 kDa subunit. Purification of the Yl epitope was achieved by immunoprecipitation with Yl, and inverted phase (RP-HPLC). 2 μ? of fractions deposited for immunoblotting with scFv Yl, and 40 μ? for the silver coloration (Figure 21). The ligand of Yl was further characterized using enzymatic treatments with proteases, glycanases, and sulfates; immunoblotting with Yl, anti-CD42 antibodies, anti-CD162 and 181 antibodies, immunoprecipitation using YI and anti-CD162 antibodies; FACS analysis using Yl and anti-CD162 antibodies; and sequenced.

The following table summarizes the biochemical experiments performed to characterize and localize the Yl binding site in KG-1 cells.

Immunofluorescence analysis with Yl on reducing gels SDS-PAGE Table 10 Substrate Treatment Condition Reactivity Presented with Yl in Figure Fraction of O-Sialo 30 'at 37 ° C Reactivity Figure 22 glycoprotein membrane only with KG-1 in RP-endopeptidase form of HPLC 120 kDa Fraction of O-Sialo 40 h at 37 ° C Without Figure 22 membrane of glycoprotein reactivity KG -1 in RP- HPLC endopeptidase Fraction of Aril- 18 at 22 ° C Sin Figure 23 sulfatase membrane reactivity KG-1 in RP-HPLC Mocarhagin fraction 1 'at 37 ° C Without Figure 33 reactivity membrane KG-1 in RP -HPLC Glicocalicin O-Sialo 30 'at 37 ° C Union Figure 22 (GC) Enhanced glycoprotein endopeptidase Heparin - Aril- 18 h at 22 ° C Binds to Yl Figure 23 BSA sulfatase without treatment In summary, after treatment with endopeptidases, the Yl signal breaks down and can not be detected (Figure 22). More likely, the fragment containing the Yl binding site is found at the N 'terminus and is too small to be determined under the conditions used in the preceding experiments. Similarly, after treatment with Mocarhagina, the Yl signal breaks down and can not be detected (Figure 33), suggesting that the epitope for Yl is found at the N 'terminus of the ligand. In addition, the results obtained with the aryl sulfatase that remove sulphate entities from proteins (within the KG-1 cell extract), but not from the sugar groups (in heparin) additionally support our hypothesis that sulfate is needed to the recognition of Yl (Figure 23). Interestingly, O-Sialo glycoprotein endopeptidase improved the Yl signal in the product of the GC break. We assume that after the treatment the Yl binding site, now located in the C term, is better exposed to the binding of Yl.

Correlation between Yl and KPLl of PSGL-1 antibody: Immunoblot analysis The binding of the scFv Yl antibody and the commercially available anti-PSGL-1 monoclonal antibody (KPLl) to KPLl immunoprecipitated membrane proteins (IP) derived from KG-1 cells was evaluated. A Raj i cell lysate was used as a negative control for Yl and KPLl.

The membrane fraction of KG-1 cells was immunoprecipitated with KPLI. The IP fraction was further immunoprecipitated with scFv Yl antibody or with KPLl. The non-precipitated fractions (eluted) were analyzed by immunoblotting, using scFv Yl or KPLl antibodies.

Both the immunoprecipitation schedule and the results are shown in Figure 24. KPL1 does not recognize glycocalicin. However, Yl and KPLl scFv antibodies recognize membrane proteins in KG-1 cells.

The used ones from cell lines and primary white blood cells were immunoprecipitated with anti-CD162 antibodies and centrifuged to produce a supernatant and an eluate. The immunoblot analysis of the proteins present in the eluate and the supernatant was performed using scFv Yl and anti-CD162 antibodies. Membrane preparations of KG-1 contain two subunits (110 kDa and 120 kDa) to which anti-CD162 antibodies (PSGL-1) bind. In contrast, preparations of normal white blood cell membranes have only the smallest subunit. Membrane preparations of patients with AML have only the largest subunit. scFv Yl binds to a distinguishable species, which is found in the supernatant of immunoprecipitation, and to which anti-CD162 antibodies do not bind (Figure 25).

Analysis of FACS The binding of Yl antibody (the scFv and IgG forms) to KG-1 cells in the presence of anti-PSGL-1 (anti-CD162) antibodies (KPL1) was evaluated in competitive binding assays using FACS analysis. For this purpose, different commercially available anti-PSGL-1 antibodies, KPL1 (an antibody that identifies the N-terminal domain of sulphated tyrosine of PSGL-1) were used., PL1 (an antibody that identifies the non-sulfated N-terminal domain of PSGL-1) and PL-2 (an antibody that identifies an unsulfated internal domain of the PSGL-1 receptor). Only KPL1 completely inhibits the binding of Yl to KG-1 cells, whereas PL1 partially inhibits the binding. There is no inhibition of binding in the presence of the PL2 antibody (Figure 26). Ra i cells did not bind to KPL1 antibodies. Similarly, Yl of complete IgG at different concentrations inhibits the binding of KPL1 antibody to KG-1 cells in a dose-dependent manner (Figure 27). Similarly, the KPL1 antibody inhibits the binding of the whole IgG Yl antibody to KG-1 cells in a dose-dependent manner (Figure 28).

Correlation between Yl and the binding of KPL1 to Primary Leukemia Cells Analysis of the binding of scFv Yl antibodies and anti-CD162 antibodies to diseased cells also illustrates that scFv Yl has binding characteristics different from those of anti-CD162 antibodies. Specifically, the FACS analysis of the binding of Yl and anti-CD162 to Pre-B-ALL, HCL, AML, B-ALL, B-CLL, unclassified leukemia, B-PLL, and multiple myeloma cells of human patients showed that the two antibodies have different binding profiles (Table 11). Yl binds to leukemic cells in 10 out of 12 samples. In contrast, anti-CD162 bound only 5 out of 12 samples. It was found that of the 12 samples, 5 bind to Yl but not to anti-CD162. Therefore, it can be concluded that, in leukemic cells, scFv Yl binds to a ligand that is not recognized by anti-CD162.

Table 11: Leukemia Samples - Analysis of Anti-CD162 against Yl Reaction with Leukemia Cells Patient No. Illness scFv Yl Anti CD162 42291 Pre-B-ALL + - 42299 HCL - 42311 AML + + 42321 B-ALL - 42323 B -CLL - 42325 Unranked + 42332 B-CLL + _ 42352 B-PLL + +/- 42330 AML + + 42334 MM + - 42366 AML + + 42370 AML / ALL + +/- In general, Yl binding domains containing tyrosine sulfated in GPIboc, fibronectin, and PSGL-1 , are DEGDTDLYDYYPEEDTEGD (amino acids 269-287), EHPAETEYDSLYPED (amino acids 411-427) and QATEYELDYDFLPETE (amino acids 1-17), respectively. Another binding site, with a higher affinity to Yl, is more likely to be expressed in primary leukemia cells. Interestingly, blood samples that are positive for both scFv Yl and anti-CD162 were obtained from patients with AML, whereas B cells were negative for anti-CD162.

Analysis of the Union of Sulphated Peptides to Yl A competitive binding ELISA assay was used to evaluate the importance of the presence and position of sulfated tyrosines for the binding of peptides to Yl.

Glycocalycine was immobilized on a Maxisorb plate. scFv Yl was preincubated with a peptide of interest for 10 minutes at three different concentrations (1, 10 and 100 μ?) to observe a dose response (Table 12). After preincubation, the mixture (Yl + peptide) was added to the plate, and the binding of scFv Yl was evaluated using polyclonal rabbit anti-Vi, which recognizes the VL chain of scFv Yl, followed by rabbit anti-HRP . In mixtures in which the peptide was bound to scFv Yl, a reduction in the binding of scFv Yl to glycocalicin was observed compared to the control binding. In mixtures in which the peptide was not bound to scFv and I, no change in the binding of scFv to glycocalicin was observed compared to the control link.

The experiment was done twice and the results are described in an ELISA graph (Figure 29). The peptides derived from fibrinogen did not inhibit the binding of Yl, without taking into account the sulfation. The non-sulfated peptides of PSGL-1 did not inhibit the binding of Yl to glycocalicin. All sulfated peptides derived from PSGL-1 inhibited the binding of Yl to glycocalicin. The peptides P-YYY * and? - ?? *? * Were the best inhibitors, followed in efficiency by P-Y * Y Y * then P-YY * Y then P- Y * Y * Y and P-Y * YY. The non-sulfated peptides derived from glycocalicin did not inhibit the binding of Yl to glycocalicin, but the peptide glycocalicin derivative having the same sulphated sequence in three ulfates (GY * Y * Y *) did inhibit the binding, with an efficiency similar to of PY Y * Y Therefore, it is clear that not all sulfated peptides bind to scFv and Y in the same magnitude. In addition, significantly, these results demonstrate that only a sulphated tyrosine is needed for the binding, as can be seen with the peptides P-Y * YY and P-YY Y *. In addition, it can be observed that the amino acid context of the sulphated tyrosines influences the binding of Yl. For example, P- Y * YY (which contains a sulfated tyrosine 5 in the sequence EY * E) effectively inhibits binding only to 100 uM. In contrast, P-YYY * (containing a sulfated tyrosine in the DY * D sequence) inhibits binding efficiently to 1 μ ?.

Table 12: Sulphated Peptides Name Sequence Oriqen #aa Weight Sulfation Molecular Peptide F-YY Chain of VRPEHPAETEYESLYPEDDL 20 2389 fibrinóge no? cousin? _? *? * VRPEHPAETEY chain * ESLY * PEDDL 20 2549 Sulphated fibrinóge not? prime P-YYY Term n QATEYEYLDYDFLPETE 17 2126 PSGL-1 P- Y * YY Term n QATEY * EYLDYDFLPETE 17 2206 Sulfated PSGL-1 P- Y * Term n QATEY * EY * LDYDFLPETE 17 2286 Sulfated? *? of PSGL-1? -? *? Finished ? QATEY * EYLDY * DFLPETE 17 2286 Sulphated? * From PSGL-1? ? *? Term n QATEYEY * LDYDFLPETE 17 2286 Sulfated PSGL-1? -? ? * Term n QATEYEY * LDY * DFLPETE 17 2286 Sulphated? * Of PSGL-1? - ?? ? * Term n QATEYEYLDY * DFLPETE 17 2286 Sulfated PSGL-1 G-YYY GPIbot GDEGDTDLYDYYPEEDTE 18 2126 GY * Y *? * GPIboc GDEGDTDLY * DY * Y * PEEDTE 18 2366 Sulfated Y * = Tyrosine Sulftada Hypothesis / Conclusions 5 (1) Yl resembles L-selectin which recognizes protein and sulphated sugar groups, and is distinguished from P-selectin which recognizes only sulphated proteins. Consequently, it can compete for the binding of both proteins. (2) The variation in sulphation during differentiation and cell growth can affect the binding of Yl. Consequently, Yl can compete with P and L selectins for binding to their sulfated ligands.

In vivo models to evaluate the efficacy of leukemia specific antibody Two models of human leukemia were developed in immunodeficient mice as well as in test systems.

The lines of human cells used were M0LT4 cells obtained from a patient with T-cell leukemia and KG-1 cells obtained from a patient with AML. Specific antibodies were used for the relevant human antigens in each cell line to identify and quantify the graft of malignant cells.

MODEL OF T-ALL (M0LT4) The in vivo mouse model for T-ALL uses SCID mice (Jackson Laboratories) injected with MOLT4 cells obtained from a patient with T-cell leukemia.

In one experiment, SCID mice were treated with 100 mg / kg of Cytoxen (CTX, Cyclophosphamide for injection, Mead Johnson), and injected intravenously with 2xl07 MOLT-4 cells / mouse, 5 days after treatment with Cyclophosphamide. Anti-cancer agents or PBS (negative control animals) were injected intravenously three times / week from day 5 after injection of MOLT-4 cells and thereafter. On day 35, blood was drawn from the animals, animals were sacrificed, and their livers were removed and weighed. In the animals that carried MOLT-4 cells treated with PBS, untreated, the liver presented a very massive tumor growth, and its size was increased 2-3 times compared to the uninfected animals control with PBS. In this experiment, there were five treatment groups: Table 13 1. Not injected with MOLT-4 cells, treated with PBS 2. Control injected with MOLT-4, treated with PBS 3. Injected with MOLT-4, treated with Yl scFv (CONY 1), 75 μg / mouse 4. Injected with MOLT-4, treated with CONY 1 scFv - Doxorubicin, 75 μg mouse 5. Injected with MOLT-4, treated with Doxorubicin, 0.1 mg / kg Number of Mice Inoculation Treatment 5 PBS only 9 MOLT-4 9 MOLT-4 CONY-Dox (2.5 mgYkg) 9 MOLT-4 CONY-Dox (2.5 mg / kg) 8 MOLT-4 Dox Free (0, lmg / kg) Mice started dying 32 days after cell inoculation, and the surviving mice were sacrificed at this time. The cells of the bone marrow were analyzed by flow cytometry using anti-human CD44-FITC and Yl-Biotin / SAV-PE. Blood samples from several animals were monitored for the platelet and white blood cell count. The livers were weighed and examined for the appearance of tumors. Other organs were also examined for the appearance of tumors.

The results are illustrated in Figures 30, 31 and 32. Growths of massive tumors (white nodules) were observed in the livers of all mice injected with MOLT-4 cells.

The percentage of MOLT-4 cells found in the bone marrow was very low (Figure 31).

In general, these results demonstrate that the MOLT-4 model can be used as a useful model for liver metastasis of leukemia cells.

In parallel, portions of liver tissue were removed for histology and cell culture for FACS analysis. The survival rate of another group of treated animals was recorded compared to that of the untreated control mice.

The livers weights, on day 35, are presented in Figure 30. As shown, liver size nearly tripled in mice infected with tumors, treated with PBS negative control compared to control with PBS, and mice not injected with MOLT-4. The weights of the livers of mice treated with a low dose of Doxorubicin were similar to those of the mice infected with tumors treated with PBS. On the other hand, treatments with conjugates of CONY1 scFv and CONY1 scFv-Doxorubicin markedly inhibited the growth of tumors in the liver (much lower liver weights).

In a second experiment, using the identical SCID / MOLT-4 protocol, there were 6 groups: 1. PBS control, not injected with MOLT-4 2. Injected with MOLT-4, treated with PBS 3. Injected with MOLT-4, treated with CONY1 scFv, 75 μg mouse 4. Injected with MOLT-4, treated with a non-specific scFv antibody obtained from the NISSIM I library, 75 μg / mouse (control). 5. Injected with MOLT-4, treated with Yl-IgG, 5 μg / mouse 6. Group with MOLT-4, treated with a non-specific human IgG, 5 (control) The results shown in Figure 34 indicate that treatment with C0NY1 scFv or Yl IgG inhibited tumor growth (based on liver weights), whereas little or no effect was observed in animals treated with nonspecific antibody molecules .

Survival was evaluated in mice from three groups that received continuous treatment, and the results are presented in Figure 35. As shown, the survival of mice treated with CONY1 scFv was prolonged only.

AML KG-1 model The in vivo mouse model for human A L uses SCID / NOD mice (Jackson Laboratories) inoculated with KG-1 cells obtained from a human AML cell line.

In a first embodiment, NOD / SCID mice were pretreated with 100 mg / kg of CYTOXAN. Four days after the injection of CYTOXAN, KG-1 cells were injected intravenously into the tail vein of six groups of mice. (Table 14, Groups 2 and 5-9). A group of mice (Table 14, Group 1) was injected with PBS alone (control).

Beginning 14 days after injection with KG-1 mice were treated with: C0NY1, Doxorubicin, CONY1-Doxorubicin conjugate, or MYLOTARG®. (MYLOTARG® is a monoclonal antibody (anti CD33) chemically conjugated with calcheamycin recently approved by the FDA for the treatment of patients with AML of 60 years and in a first relapse.) The mice were treated once or three times a week for three weeks A group (group 2) of mice inoculated with untreated KG-1 was left (Table 14). Two other groups of mice (groups 3 and 4) were injected with KG-1 cells that were previously incubated with CONY1 or 181-scFv (a non-specific, negative control antibody) in serum-free RPMI containing 1% BSA at 4 ° C for 1 hour. The antibodies were used at a concentration of 0.25 mg scFv / 108 cells (75 μg / mouse). Before injection into the mice the preincubated KG-1 cells were washed and suspended again in RPMI. The KG-1 cells in RPMI were inoculated into mice at a concentration of 75 g scFv / 0.2 ml RPMI per mouse. The mice of group 3 were inoculated with KG-1 + C0NY1, and the mice of group 4 were inoculated with KG-1 + 181-scFv (Table 14). This treatment (groups 3 and 4) was carried out one day after the inoculation of groups 1-2 and 5-9, that is to say five days after the injection of CYT0X7AN®.

Table 14 11 8 KG-1 75 g mouse (2.5 mg / kg) of CONYl-Doxorubicin, 3 times a week 9 9 KG-1 0.2 mg / kg of MYLOTARG®, once a week Mice were sacrificed 60 to 65 days after cell injection. Bone marrow and blood samples were analyzed by flow cytometry using anti human CD34-FITC (IQP 144F) (or anti CD44-FITC (MCA98F, Serotec)) and Yl-Biotin / SAV-PE. Mouse IgGl-FITC (IQP 191-F) was used as an isotypic control, and mouse IgG2a-FITC (MCA929F, Sexotec) was used as a negative control. Flow cytometry was performed using the FACSCalibur system and the CellQuest software, Becton Dickinson.

The results are illustrated in Figures 36 and 37. Nine of 10 mice injected with KG-1 cells that were treated with 5 mg / kg free Doxorubicin (group 7) died three weeks after the start of treatment.

Bone marrow from mice injected with untreated KG-1 cells (group 2) contained 30% KG-1 cells on average from the population of bone marrow cells. All the mice in this group developed leukemia.

In general, almost all mice injected with KG-1 developed leukemia, with an average of 30% of KG-1 cells in the bone marrow (determined by FACS analysis). In general, the KG-1 graft was confined to the bone marrow. Less than 10% of the KG-1 cells were found in the blood. In one case, a solid tumor was observed in the peritoneal wall.

Mice injected with KG-1 cells and treated with 0.1 mg / kg of free Doxorubicin (group 6) had a statistically significantly lower percentage (p <0.05) of KG-1 cells in their bone marrow, compared with group 2.

Mice injected with KG-1 cells and treated with CONYI-Doxorubicin conjugate (group 5) had a lower percentage of KG-1 cells in their bone marrow compared with group 2 (16.3% vs. 30.4% , respectively). However, this difference was not considered statistically significant. It was found during the experiment that CONYl-Doxorubicin was contaminated with lipopolysaccharides (LPS). Consequently, the optimal concentrations of CONYI-Doxorubicin could not be used and the treatment was stopped before the end of the experiment.

Mice injected with KG-1 cells preincubated in vitro with C0NY1 or 181-scFv (groups 3 and 4, respectively) had a significantly lower percentage of KG-1 cells in their bone marrow.

The bone marrow of both the mice injected with PBS only (negative control) and the mice injected with KG-1 cells and treated with MYLOTARG® (group 9) were free of KG-1 cells. These results demonstrate that this in vivo model is a useful model for AML.

The total percentage of KG-1 cells found in the bloodstream of the different groups was very low in general, with high variations within the groups. It should be noted that a mouse treated with MYLOTARG® demonstrated a relatively high percentage of KG-1 cells in the blood, but not in the bone marrow.

The identification of leukemia cells (origin of KG-1) in the bone marrow and in the bloodstream of the mice was performed by FACS analysis, using anti-CD34 or human CD44 antibodies commercially available in parallel with Yl scFv antibodies .

On the first day of the analysis, there was no significant difference between the mice injected with KG-1 alone (group 2), which had a higher percentage of KG-1 cells in the bone marrow, compared with the mice treated with CONYI-Doxorubicin. (group 8). On the third day of the analysis this situation was reversed: the mice of group 8 had a higher percentage of KG-1 cells in the bone marrow compared with the mice of group 2. This situation may have derived from the following: A) choose mice in worse physical condition the first day, B) proliferation of KG-1 cells in group 8 mice during the days after the end of treatment, and C) the number of mice in each group was too small to generate statistically significant results.

Pharmacokinetics of CONY1 in Mice CONY 1 scFv was labeled with Bolton Hunter 12I reagent (to lysine). The labeling reaction was carried out at 4 ° C in a borate buffer (pH 9.2) with the Bolton Hunter 125I reagent, then 125 I-C0NY1 was purified on a column of PD-10 chromatography. The radioactive protein was then mixed with unlabeled CONY-1 to give a 75 μg / ml solution of CONY-1 containing 2.5x10s CPM / ml in saline.

Male Balb-C mice were pretreated with an intraperitoneal injection of 0.5 ml / mouse of 0.9% Nal. After 2 hours, the mice were injected intravenously with 0.2 ml of the labeled CONY-1 solution, which resulted in a dose of 125 μg-CONY-1 of 15 μg (5 × 0.05 CPM) per mouse.

At different hours after the injection, blood was extracted on EDTA, the mice were sacrificed, and tissues were removed. Samples and organs were taken at 5, 15 and 30 minutes and at 1, 2, 4, 8 and 24 hours after the injection. Two to four mice were used per time point. Plasma was separated and counted by gamma radioactivity or subjected to precipitation with trichloroacetic acid (TCA). After centrifugation, the TCA precipitates were subjected to gamma radioactivity counting. Samples of liver, lung, kidney, spleen and bone marrow were weighed and the gamma radioactivity was counted. The TCA radioactivity of precipitated plasma was plotted as a function of time, and the two-compartment kinetic model was adjusted. Total and specific radioactivity values of the organ / tissue were calculated. The results are shown in Figures 39, 40 and 41.

The comparison of blood and plasma radioactivity values indicated that practically all of the CONYl resided in the plasma and did not adhere to the erythrocytes. The radioactivity values of the plasma were similar to those of the TCA precipitates, indicating that they were associated with non-degraded protein. Figure 39 shows levels of CONY-1 in the plasma at different time points after administration. The values were statistically adjusted to a two compartment model, and the blood clearance values obtained were 35 and 190 minutes, respectively.

The distribution of radioactivity in different tissues at the specified time points after administration are shown as specific and total radioactivity in Figures 40 and 41, respectively. In most tissues, there was no specific accumulation of radioactivity, as is evident from the comparison of the specific activity with that of the blood. Slightly higher values were observed in the kidney at 4 hours and in the bone marrow at 4 and 8 hours; this is more likely related to the excretion of degradation products.

The results indicate that CONY-1 is secreted in mice at a hemividase of 35 minutes. The rate of excretion of the second compartment is of minor importance and may be the result of the presence of some polymeric forms of the injected material. There is no significant specific absorption of CONY-1 in body tissues, with the exception of a slight increase in bone marrow.

Production of Antibodies and Fragments Antibodies, fragments thereof, constructions thereof, peptides, polypeptides, proteins, fragments and constructions thereof can be produced in prokaryotic and eukaryotic expression systems. Methods for producing antibodies and fragments in prokaryotic and eukaryotic systems are known in the art.

A system of eukaryotic cells, defined in the present invention and discussed, refers to an expression system for producing peptides or polypeptides by genetic engineering methods, wherein the host cell is a eukaryote. The eukaryotic expression system can be a mammalian system, and the peptide or polypeptide produced in the mammalian expression system, after purification is preferably substantially free of mammalian contaminants. Other examples of a useful eukaryotic expression system include yeast expression systems.

A preferred prokaryotic system for the production of the peptide or polypeptide of the invention uses E. coli as the host for the expression vector. The peptide or polypeptide produced in the E.coli system, after purification, is substantially free of E. coli contaminating proteins. The use of a prokaryotic expression system can result in the addition of a methionine residue to the N-terminus of some or all of the sequences provided in the present invention. Removal of the methionine residue from the N-terminus after production of the peptide or polypeptide to allow full expression of the peptide or polypeptide can be performed as is known in the art, an example being with the use of Aeromonas aminopeptidase under suitable conditions (Patent United States No. 5,763,215).

Types of Antibody Fragments and Constructions The present invention provides a peptide or polypeptide comprising an antibody or antigen-binding fragment thereof, a construction thereof, or a construction of a fragment. The antibodies according to the present invention include IgG, IgA, IgD, IgE, or IgM antibodies. The IgG class encompasses several subclasses that include IgGi, IgG2, IgG3 and IgG4.

Antibody fragments according to the present invention include Fv, scFv, dsFv, Fab, Fab2 and Fd molecules. Fragments of smaller antibodies, such as fragments of Fv, are also included in the term "fragments", as long as they maintain the binding characteristics of the antibody or fragment of larger original size. Examples of such fragments would be (1) a minibody, comprising a fragment of the heavy chain only of Fv, (2) a microbody, comprising a small fractional unit of the variable region of the heavy chain of the antibody (PCT Application No. PCT / IL99 / 00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a variable region of the light chain. Constructs include, for example, multimers such as diabodies, triabodies and tetrabodies. The phrases "an antibody, a binding fragment thereof, or a complex comprising an antibody or a binding fragment thereof" and "an antibody or a fragment" encompass all of these molecules, as well as derivatives and homologs, imitations and variants thereof, unless otherwise specified or otherwise indicated based on the context and / or knowledge of the art.

Once an antibody, fragment or construct having the desired binding capabilities has been selected and / or developed, it is within the ability of the skilled artisan to use the guidance provided herein to produce constructions and fragments that maintain the characteristics of the original antibody. For example, whole antibody molecules, Fv fragments, Fab fragments, Fab2 fragments, dimers, trimers, and other constructions that maintain the desired characteristics of the antibody, fragment or construct originally selected or developed can be manufactured.

If it is desired to replace amino acids but still maintain the characteristics of the antibody or fragment, it is within the skill in the art to make conservative amino acid substitutions. Modifications such as conjugating pharmaceutical or diagnostic agents can also be made to the antibodies or fragments without altering their binding characteristics. Other modifications, such as those made to produce more stable antibodies or fragments can also be made in antibodies or fragments without altering their specificity. For example, the peptoid modification, the semi-peptide modification, the cyclic peptide modification, the N-terminus modification, the C-terminus modification, the modification of the peptide bond, the modification of the main chain, and the modification of waste. It is also within the ability of the skilled artisan to follow the guidance of the present specification to assay antibodies or modified fragments to assess whether their binding characteristics have changed.

Similarly, it is within the ability of the skilled artisan to use the guidance provided herein to alter the binding characteristics of an antibody, fragment, or construct to obtain a molecule with more desirable characteristics. For example, once an antibody having a desirable property is identified, random or directed mutagenesis can be used to generate antibody variants, and those variants can be evaluated for desirable characteristics.

Antibodies and fragments according to the present invention may also have a marker that can be inserted or attached to them to aid in the preparation and identification of them, and in diagnosis. The marker can later be removed from the molecule. Examples of useful markers include: AU1, AU5, BTag, c-myc, FLAG, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, T7, V5, and VSV-G (Jarvik and Telmer, Ann. Rev. Gen. 32, 601-618 (1998)). The marker is preferably c-myc or KAK.

Multimeric Antibodies The present invention provides a Yl or Y17 peptide or polypeptide comprising a scFv molecule. As used herein a scFv is defined as a molecule that is formed by a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and wherein the variable region of the heavy chain is connected, linked, fused or covalently linked to or associated with the variable region of the light chain.

A construct of Y1 and Y17 may be a multimer (e.g., a dimer, trimer, tetramer, and the like) of scFv molecules that incorporate one or more hypervariable domains of Yl or Y17 antibody. All constructs and fragments derived from scFv maintain improved binding characteristics so that they bind selectively and / or specifically to a target cell in favor of other cells. The selectivity and / or specificity of the binding is mainly determined by the hypervariable regions.

The hypervariable loops within the variable domains of the light and heavy chains are called Complementary Determining Regions (COR). There are CDR1, CDR2 and CDR3 regions in each of the heavy and light chains. The most variable of these regions is the CDR3 region of the heavy chain. The CDR3 region is understood to be the most exposed region of the Ig molecule, and as provided herein, the site is primarily responsible for the selective and / or specific binding characteristics observed.

The peptide of Yl and Y17 of the present invention can be constructed to fold into multivalent Fv forms. The multimeric forms of Yl and Y17 were constructed to improve the affinity and specificity of the binding and the increased hemivide in the blood.

The multivalent forms of scFv have been produced by others. One approach has been to link two scFvs with links. Another approach is to use disulfide bonds between two scFvs for ligation. The simplest approach for the production of dimeric or trimeric Fv was reported by Holliger et al, PNAS 90, 6444-6448 (1993) and A. Kortt et al, Protein Eng., 10, 423-433 (1997). One such method was designed to make scFv dimers by adding a sequence of the FOS protein region and JU to form a leucine lock between them at the scFv c-terminus. Kostelny SA et al, J Immunol. March 1, 1992; 148 (5): 1547-53; De Kruif et al, J. Biol. Chem. March 29, 1996; 271 (13): 7630-4. Another method was designed to fare tetramers by adding a streptavidin coding sequence in the c-terminus of scFv. Streptavidin is composed of 4 subunits so that when the scFv-streptavidin is folded, 4 subunits are accommodated to form a tetramer. Kipriyanov SM et al, Hum Antibodies Hybridomas, 1995; 6 (3): 93-101. In yet another method, to make dimers, trimers and tetramers, a free cistern is introduced into the protein of interest. A crosslinking agent based on peptides with variable numbers (2 to 4) of maleimide groups was used to crosslink the protein of interest with the free cisterns. Cochran JR et al, Immunity, March 2000; 12 (3): 241-50.

In this system, the phage library (described above) was designed to present scFv, which are folded in a monovalent form of the Fv region of an antibody. In addition, and also discussed above, the construction is suitable for bacterial expression. The genetic engineering scFvs comprise heavy chain and light chain variable regions linked by a flexible peptide spacer of 15 contiguously encoded amino acids. The preferred separator is (Gly4Ser) 3. The length of this separator, together with its amino acid constituents, provides a non-bulky separator, which allows the VH and VL regions to fold into a functional Fv domain that provides efficient binding to its target.

The present invention relates to? 1 and Y17 multimers prepared by any method known in the art. A preferred method for forming multimers, and especially dimers, employs the use of cysteine residues to form disulfide bonds between two monomers. In this embodiment, the dimers are formed by adding a cysteine at the carboxyl terminus of the scFvs (referred to as Yl-cis scFv or Yl dimer) to facilitate dimer formation. After the DNA construct was made (See Example 2D and 6D) and used for transfection, the Y1 dimers were expressed in a production vector and re-folded in vitro. The protein was analyzed by SDS-PAGE, HPLC, and FACS. However, none of these early attempts indicated that a dimer was formed. Therefore, the process was repeated and this time, two lots of fermentation of two liters of the antibodies were run. After expressing Yl-cis in strain BL21 of E.coli, it was re-folded into arginine. After folding again, the protein was dialyzed and purified with Q-Sepharose and gel filtration (Sephadex 75). Two peaks were detected by SDS-PAGE (not reduced) and by gel filtration. The peaks were collected separately and analyzed by FACS. The binding of the monomer and the dimer to Jurkat cells was monitored by FACS. The binding by the dimers required only 1/100 of the amount of the monomeric antibody for the same level of coloration, which indicates that the dimer has a higher avidity. The conditions for the new dye fold were determined, and a material comprising > 90% of dimers (mg amounts) after the subsequent dialysis, chromatographic and gel filtration steps. The purified dimer was characterized by gel filtration and SDS-PAGE analysis under oxidation conditions. The binding capacity of the dimer was confirmed by the radio-receptor assay, the ELISA and FACS analyzes.

To compare the binding of the scFv monomer (also called CONY1) with the dimer of Yl, in vitro binding competition experiments were performed on KG-1 cells. In addition, these experiments also compared the binding of Yl complete IgG to the monomers of scFv Yl. To do this study, a Yl IgG was labeled with biotin. This study revealed that Yl IgG competed with IgG Yl-Biotin. Non-relevant human IgG did not compete with Yl labeled IgG. Yl scFv (5 g and 10 μg) competed partially with Yl IgG-Biotin (50 ng). The studies also showed that IgGYl-FITC Ing bound to KG-1 cells (without serum.) In the same magnitude as 1 μg of Yl scFv-FITC, but in the presence of serum, most of this binding was These studies also showed that the binding of the Y1 diol is at least 20 times higher than that of the Yl scFv monomer analyzed by the radioreceptor assay, ELISA and FACS.

In yet another embodiment, a lysine-alanine-lysine was added in addition to the cysteine at the carboxyl terminus (designated Yl-cys-kak scFv). The amino acid sequence of this scFv construct is reproduced below and is also SEQ ID No. 212. 1 MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMS VRQ APGKGLEWVS GINWNGGSTG 60 61 YADSVKGRFT ISRDNAKNSL YLQMNSLRAE DTAVYYCARM RAPVIWGQGT LVTVSRGGGG 120 121 SGGGGSGGGG SSELTQDPAV SVALGQTVRI TCQGDSLRSY YASWYQQKPG QAPVLV1YGK 180 181 NNRPSGIPDR FSGSSSGNTA SLTITGAQAE DEADYYCNSR DSSGNHVVFG GGTKLTVLGG 240 241 GGCKAK Yl-cys-KAK was produced in a? -pL vector in bacteria. Expression in the? -pL vector was induced by raising the temperature to 42 ° C. Induced culture inclusion bodies were obtained and semipurified by aqueous solutions, to remove undesirable soluble proteins. The inclusion bodies were solubilized in guanidine, reduced with DTT and re-folded in vitro in an arginine / oxidized glutathione-based solution. After re-folding, the protein was dialysed and concentrated by tangential flow filtration to a buffer containing urea / phosphate. The protein was purified and concentrated by ion chromatography on a SP column.

An ELISA was performed to determine the differences in the binding between the monomer (the Yl scFv also called Yl-kak) and the Yl-cys-kak dimer (the cistern dimer) for the platelet-derived GPIb (glycocalicin) antigen. A polyclonal single chain antibody and / or a novel polyclonal anti-Vi (obtained from rabbits) and rabbit anti-HRP were used to detect binding to GPIb. The dimer was approximately 100 times more active than the monomer. For example, to achieve 0.8 OD units, 12.8 μg / ml compared to only 0.1 μg / ml of the dimer was used. Var Figure 40.

In addition, FACS analysis of binding to KG-1 cells showed that the dimer is more sensitive than the monomer when a two- or three-step binding assay was performed. The dimers directly labeled by FITC showed a slight advantage (use of 10 times less material) than the monomer. The radio receptor assay in KG-1 cells, where the dimer was used as a competitor, showed that the dimer is 30x times more efficient than the monomer.

Varying the length of the spacers is still another preferred method of forming dimers, trimers, and tetramers (often referred to in the art as diabodies, triabodies, and tetrabodies, respectively). The dimers are formed under conditions in which the separator joining the two variable chains of a scFv is shortened to generally 5 to 12 amino acid residues. This shortened separator prevents the two variable chains of the same molecule from folding into a functional Fv domain. In contrast, the domains are forced to pair with complementary domains of another molecule to create two binding domains. In a preferred method, a spacer of only 5 amino acids (Gly Ser) was used for the construction of diabodies. This dimer can be formed from two identical scFvs, or from two different populations of scFv and maintain the improved selective and / or specific activity of parental scFv and / or show increased resistance or binding affinity.

In a similar manner, triabodies are formed under conditions in which the separator that binds the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains of the same molecule from folding into a domain of Functional Fv. Instead these three separate scFv molecules associate to form a trimer. In a preferred method, the triabodies were obtained by removing this flexible separator completely. The triabody can be formed from three identical scFvs, or from two or three different scFv populations and maintain the improved selective and / or specific binding activity of the parental scFv, and / or show increased resistance or binding affinity.

The tetrabodies are formed in a similar manner under conditions in which the separator joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains of the same molecule from folding into a domain of Functional Fv. Instead, four separate scFv molecules associate to form a tetramer. The tetrabody can be formed from four identical scFvs, or from 1-4 individual units from different scFv populations and must maintain the enhanced selective and / or specific binding activity of the parental scFv, and / or show increased binding strength or affinity.

If the triabodies or tetrabodies are formed under conditions in which the spacer is generally less than 5 amino acid residues in length, it depends on the amino acid sequence of the particular scFv in the mixture and the reaction conditions.

In a preferred method, tetramers are formed through an association with biotin / streptavidin. A novel fermentation construct was created which is capable of being enzymatically labeled with biotin (referred to herein as Yl-biomarker or Yl-B). A sequence that is a substrate for the BirA enzyme was added in the C-terminus of Yl. The BirA enzyme adds a biotin to the lysine residue within the sequence. Yl-biomarker was expressed in E. coli The inclusion body material was isolated and folded again. The purity of the folded protein was > 95% and were obtained > 100 mg of a 1-L culture (small scale, non-optimized conditions). It was found that the molecular weight of this form was similar to that of scFv according to HPLC, SDS-PAGE and mass spectroscopy. It was found that Yl-biomarker was the most consistent reagent for the FACS analysis. However, when the binding of Yl-biomarker to KG-1 cells was examined in the presence of serum, high concentrations (10 times more) were required for comparable binding in the absence of serum. However, this construction offered the advantage of specific biotinylation in which the binding site of the molecule remains intact. In addition, each molecule is labeled with only one biotin, each molecule receives a biotin at the carboxyl terminus.

Limiting the labeling of a biotin / molecule in a desired location allowed the production of tetramers with streptavidin. The tetramers were formed by incubating Yl-B with streptavidin-PE.

The FACS analysis indicated that the tetramers made by Yl-biomarker and streptavidin-PE were 100 to 1,000 times more sensitive than Yl scFv monomers. The tetramers of Yl-biomarker with streptavidin-PE appear to bind specifically to one of the lines of Yl reactive cells (KG-1). The differential of this reaction, from the binding background, was very high, and offered a high sensitivity to detect low amounts of receptor. The FACS evaluation of normal whole blood with Y1BSAV tetramers indicated that no highly reactive population is present. Monocytes and granulocytes were positive at a small amount. In cell lines where a positive result was present, such as with KG-1 cells, the tetramers were at least 100 times more reactive.

Then, the tetramers were incubated with cell samples. A low dose of tetramers of Yl (5 ng) binds well to the cell line (G-1) that provides a response 10 to 20 times higher than that previously observed with other forms of Yl antibodies. A minor reaction was observed when a negative cell line was examined with varying doses of the tetramers.

Conjugates for Diagnosis and Pharmaceutical Use The antibodies and binding fragments thereof of the present invention can be associated, combined, fused or linked with different pharmaceutical agents, such as drugs, toxins and radioactive isotopes with, optionally, a pharmaceutically effective carrier, to form comparisons, fusions or conjugates of drug-peptide, which have an anti-disease and / or anti-cancer activity. Such conjugates and fusions can also be used for diagnostic purposes.

Examples of carriers useful in the invention include dextran, HPMA (a lipophilic polymer) or any other polymer. Alternatively, decorated liposomes, such as liposomes decorated with scFv Yl molecules, such as Doxil, a commercially available liposome containing large amounts of doxorubicin can be used. Such liposomes can be prepared to contain one or more desired pharmaceutical agents and mixed with the antibodies of the present invention to provide a high ratio of the drug to the antibody.

Alternatively, the binding between the antibody or fragment thereof and the pharmaceutical agent can be a direct binding. A direct link between two or more neighboring molecules can be produced through a chemical bond between elements or groups of elements in the molecules. The chemical bond can be, for example, an ionic bond, a covalent bond, a hydrophobic bond, a hydrophilic bond, an electrostatic bond or a hydrogen bond. The linkages can be, for example, amine, carboxy, amide, hydroxyl, peptide and / or disulfide bonds. The direct link can preferably be a protease resistant link.

The binding between the peptide and the pharmaceutical agent or between the peptide and the carrier, or between the carrier and the pharmaceutical agent can be through a linking compound. As used herein in the specification and claims, a linker compound is defined as a compound that joins two or more groups together. The linker can be straight or branched chain. A branched linker compound may be composed of a double branch, a triple or a four branch or a more branched compound. The linker compounds useful in the present invention include those selected from the group comprising dicarboxylic acids, malemido hydrazides, PDPH, carboxylic acid hydrazides and small peptides.

More specific examples of useful linker compounds according to the present invention include: to. Dicarboxylic acids such as succinic acid, glutaric acid and adipic acid; b. Maleimide hydracids such as N- [e-maleimidocaproic acid] hydrazide; 4- [N-maleimidomethyl] cyclohexane-1-carboxyl idrazide and N- [k-maleimidodocanoic acid] hydrazide; c. PDPH binders such as (3- [2-pyridylthio] propionyl hydrazide) conjugated to reactive sulfur hydride protein; and d. Carboxylic acid hydrazides selected from 2-5 carbon atoms.

Binding through direct coupling using small peptide bonds is also useful. For example, the direct coupling between the free sugar of, for example, the anti-cancer drug doxorubicin and a scFv can be achieved by using small peptides. Examples of small peptides include AU1, AU5, BTab, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S-AG®, T7, V5 and VSV-G.

Antibodies, and fragments thereof, of the present invention can be joined, conjugated, complexed with or otherwise associated with imaging agents (also called indicator markers), such as radioisotopes, and these conjugates can be used for diagnostic and therapeutic purposes. image. Kits comprising such radioisotope-antibody conjugates (or fragment) are provided.

Examples of useful radioisotopes for diagnosis include: indium, indium, 99rarenium, 105renium, 101renium, 99mtecnetium, 121mtelurium, 122ratelurium, 125mtelurium, 165thulium, 167thulium, 123yode, 126yodo, 131yodo, 133yodo, 81mkrypton, 33xenon, 90iterium, 2"bismuth," bromine. , 18fluor, ruthenium, ruthenium, ruthenium, ruthenium, mercury, gallium, and gallium. The preferred radioactive isotopes are opaque to X-rays or paramagnetic ions.

The reporter marker can also be a fluorescent marker molecule. Examples of fluorescent marker molecules include fluorescein phycoerythrin, or rhodamine, or modifications or conjugates thereof.

Antibodies or fragments conjugated to indicator markers can be used to diagnose or monitor diseased states. Such monitoring can be carried out in vivo, in vitro or ex vivo. When monitoring or diagnosis is carried out in vivo or ex vivo, the imaging agent is preferably physiologically acceptable in that it does not harm the patient to an unacceptable level. Acceptable levels of harm can be determined by clinicians using criteria such as the severity of the disease and the existence of other options.

The present invention for a diagnostic kit for in vivo analysis of the effectiveness of the treatment before, during and after the treatment, comprising an imaging agent comprises a peptide of the invention linked to an indicator marker molecule, or an imaging agent. The invention further provides a method for using the imaging agent for the diagnosis and imaging of a cancer, more specifically a tumor, comprising the following steps: a) putting the cells in contact with the composition, B) measuring the radioactivity bound to the cells, and therefore c) visualize the tumor.

Examples of suitable imaging agents include fluorescent dyes, such as FITC, PE and the like, and fluorescent proteins, such as green fluorescent proteins. Other examples include molecules and radioactive enzymes that react with a substrate to produce a recognizable change, such as a color change.

In one example, the kit imaging agent is a fluorescent dye, such as FITC, and the kit provides analysis of the efficacy of the treatment of cancers, more specifically blood-related cancers, for example leukemia, lymphoma and myeloma. The FACS analysis is used to determine the percentage of cells stained by the imaging agent and the intensity of staining at each stage of the disease, for example at diagnosis, during treatment, during remission and during relapse.

The antibodies, and fragments thereof, of the present invention can be bound, conjugated, or otherwise associated with anticancer agents, antileukemic agents, antiviral agents, antimetastatic agents, anti-inflammatory agents, antithrombosis agents, anti-restenosis agents, anti-aggregation agents. , anti-autoimmune agents, anti-adhesion agents, agents against cardiovascular diseases, or other agents against diseases or pharmaceutical agents. A "pharmaceutical agent" refers to an agent that is useful in the prophylactic treatment or diagnosis of a mammal that includes, but is not limited to, a human, bovine, equine, porcine, mouse, canine, feline or any other warm-blooded animal. .

Examples of such pharmaceutical agents include, but are not limited to, antiviral agents including acyclovir, ganciclovir and zidoduvin; anti-thrombosis / restenosis agents including cilostazol, sodium dalteparin, sodium reviparin, and aspirin; anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetylsalicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide, denileucine difitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti-adhesion / anti-aggregation agents including limaprost, chlorchromen and ialuronic acid.

Other examples of pharmaceutical agents include doxorubicin (adriamycin), morpholinodoxorubicin, methoxymorpholinyldoxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, morpholinodaunorubicin, methoxymorpholindaunorubicin, idarubicin, fludarahine, chlorambucil, interferon alfa , hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.

An anti-cancer agent is an agent with anti-cancer activity. For example, anticancer agents that inhibit or stop the growth of immature cancer or precancerous cells, agents that kill cancer or precancerous cells, agents that increase the susceptibility of cancer and precancerous cells to other anticancer agents and agents that inhibit the metastasis of cancer cells. In the present invention, an anti-cancer agent can also be an agent with anti-angiogenic activity that prevents, inhibits, retards or stops the vascularization of tumors.

The inhibition of the growth of a cancer cell includes, for example, (i) the prevention of cancerous or metastatic growth, (ii) the retardation of cancerous or metastatic growth, (iii) the total prevention of the growth process of the cells of cancer. cancer or the metastatic process, while leaving the cell intact and alive, or (iv) the elimination of the cancer cell.

An anti-leukemia agent is an agent with activity against leukemia. For example, antileukemia agents include agents that inhibit or stop the growth of immature leukemic or preleukemic cells, agents that eliminate leukemic or preleukemic cells, agents that increase the susceptibility of leukemic or preleukemic cells to other anti-leukemia agents, and agents that inhibit metastasis of leukemic cells. In the present invention, an anti-leukemia agent can also be an agent with anti-angiogenic activity that prevents, inhibits, retards or stops tumor vascularization.

Inhibition of the growth of a leukemia cell includes, for example (i) the prevention of leukemic or metastatic growth, (ii) the leukemic or metastatic growth retardation, (iii) the total prevention of the growth process of the leukemia cell. or of the metastatic process, while leaving the cell intact and alive; or (iv) the elimination of the leukemia cell.

Examples of anti-disease, anti-cancer and anti-leukemic agents to which antibodies and fragments of the present invention can be usefully attached include toxins, radioisotopes and pharmaceuticals.

Examples of toxins include gelonin, Pseudomonas exotoxin (PE), PE40, PE38, diphtheria toxin, ricin or modifications or derivatives thereof.

Examples of radioisotopes include gamma radiation emitters, positron emitters, X-ray emitters that can be used for localization and / or therapy, and beta radiation emitters and alpha radiation emitters that can be used for therapy.

More specific examples of therapeutic radioisotopes include ^ indium, indium, 99m, 105renium, 101renium, 9Stnetnetium, 121mtelurium, 122mtelurium, 12Smtelurium, 165tullium, 167tullium, 123yolium, 126yol, 131yld, 133yold, 81mkrypton, xenon, 90ithium, 213bismuth, 77bromo, 18fluor , Ruthenium, ruthenium, ruthenium, ruthenium, mercury, gallium, and gallium.

Non-limiting examples of anticancer and anti-leukemia pharmaceutical agents include doxorubicin (adriamycin), morpholinodoxorubicin, methoxymorpholinyldoxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, morpholinodaunorubicin, methoxymorpholinylunubicin, idarubicin, fludarabine, chlorambucil, interferon alfa, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof.

Pharmaceutical Compositions The antibodies, constructs, conjugates, and fragments of the present invention can be administered to patients who need them by any suitable method. Examples of methods include intravenous, intramuscular, subcutaneous, topical, intratracheal, intrathecal, intraperitoneal, intralymphatic, nasal, sublingual, oral, rectal, vaginal, respiratory, buccal, intradermal, transdermal or intrapleural administration.

For intravenous administration, the formulation is preferably prepared such that the amount administered to the patient is an effective amount of 0.1 mg to 1,000 mg of the desired composition. More preferably, the amount administered is in the range of 1 mg to 500 mg of the desired composition. The compositions of the invention are effective over a wide range of dosages, and depend on factors such as the details of the disease to be treated, the hemivide of the pharmaceutical composition based on peptides or polypeptides in the patient's body, the physical characteristics and chemical agents of the pharmaceutical agent and the pharmaceutical composition, the mode of administration of the pharmaceutical composition, details of the patient to be treated or diagnosed, as well as other parameters considered important by the attending physician.

The composition for oral administration may be in any suitable form. Examples include tablets, liquids, emulsions, suspensions, syrups, pills and capsules. Methods of manufacturing pharmaceutical compositions are known in the art. See, for example, Remington, The Science and Practice of Pharmacy, Alfonso R. Gennaro (Ed.) Lippincott, Williams & Wilkins (editorial).

The pharmaceutical composition can also be formulated so as to facilitate delayed, sustained, boosted or continuous release. The pharmaceutical composition may also be administered in a device, such as a sustained, sustained or sustained release device.

The pharmaceutical composition for topical administration may be in any suitable form, such as creams, ointments, lotions, patches, solutions, suspensions and gels.

The compositions comprising antibodies, constructs, conjugates, and fragments of the present invention may comprise conventional pharmaceutically acceptable diluents, excipients, carriers and the like. Tablets, pills, and capsules may include conventional excipients such as lactose, starch, and magnesium stearate. Suppositories can include excipients such as waxes and glycerol. Injectable solutions comprise sterile pyrogen-free media such as saline, and may include buffering agents, stabilizing agents or preservatives. Conventional enteric coatings can also be used.

The following examples are set forth to help understand the invention but are not intended and should not be construed as limiting its scope in any way. Although specific reagents and reaction conditions are described, modifications may be made that fall within the scope of the invention. The following examples, accordingly, are provided to further illustrate the invention.

Example 1: Preparation of Platelets 1. 1 Preparation of washed platelets The platelet concentrate in acid-citrate dextrose (ACD) was obtained from a blood bank, platelets were isolated, washed once in buffer comprising ACD and saline in a ratio of 1: 7. Platelets were centrifuged at 800 g for 10 minutes after each wash and resuspended in Tyrodes solution (2 mM MgCl2, 137 mM NaCl, 2.68 mM KC1, 3 mM NaH2P04, 0.1% glucose, 5 mM Hepes and 0.35% albumin, at pH 7.35) and the number of cells was counted. 1. 2 Preparation of platelet-rich plasma The blood was collected in a tube containing 3.8% sodium citrate. Platelet rich plasma was prepared by centrifugation at 250 x g for 10 minutes.

Example 2: Aggregation of Platelets For platelet aggregation studies, platelet rich plasma (PRP) and washed platelets were shaken at 500 rpm at 37 ° C in a whole blood Lumiaggregometer (Chronolog, Havertown, PA). The difference in the transmission of light through the platelet suspension and the suspension medium was taken as 100% aggregation. The effect of Yl on platelet aggregation was evaluated by adding a different concentration of Yl before adding the agonist, and the effect was recorded for four minutes.

Example 3: Treatment of Platelets with Endoproteases 3. 1 Rupture of platelets by Mocarhagina For the digestion of mochahagina, 108 platelets washed in TS buffer (0.01 M Tris, 0.15 M sodium chloride, pH 7.4) containing calcium chloride at 1 mM were treated with 12 μg / ml mochahagin (final concentration) for 1 hour at 22 ° C and digestion stopped by adding EDTA at 0.01 M. 3. 2 Rupture of glycocalicin by Cathepsin G 108 Platelets washed in TS buffer containing calcium chloride at 1 mM was incubated with 1.8 g of cathepsin G (final concentration) for 4 hours at 22 ° C and digestion stopped by adding PMSF at 1 mM.

Rupture of glycocalicin by Q-Sialoglycoprotein endoprotease 106 Platelets in 0.1 M Tris buffer at pH 7.4 containing 0.2% albumin and protease inhibitors (10 μ? Leupeptin, 0.24 mM PMSF) was incubated with 0.14 mg / ml of O-sialoglycoprotein endoprotease (final concentration) for 45 minutes at 37 ° C and the digestion was stopped by adding sample buffer and boiling. The used sample buffer contains 3% SDS, 12% glycerol, 50 mM TrisHCl, 2% β-mercaptoethanol, and 0.03% bromphenol blue.

Example 4: Rupture of glycocalicin by Endoproteases Rupture of glycocalicin by Mocarhagina For the digestion of mochahagin, glycocalicin in TS buffer containing 1 mM calcium chloride was incubated with 10 g / ml · of mochahagina (final concentration) for 1 hour at 22 ° C and the digestion was stopped by adding EDTA at 0.01 M. by cathepsin G For cathepsin G digestion, glycocalicin in TS buffer containing 1 mM chloride of clacio was incubated with 3.4 μg / ml of cathepsin G (final concentration) for 4 hours at 22 ° C and digestion was stopped by adding PMSF at 1 mM.

By O-Sialoglycoprotein Endoprotease Glicocalicin in 0.05 M Tris buffer at pH 7.4 was incubated with 1.2 mg / ml of O-Sialoglycoprotein endoprotease (final concentration) for 15 minutes at 37 ° C and digestion stopped by adding buffer sample (as described in Example 3 (YH) and by boiling.

Example 5: Construction of Full Size Yl IgG Complete IgG molecules have several advantages over Fv forms, including a more polongated hemivide in vivo and the potential to induce a cellular response in vivo, such as those mediated by ADCC or CDC (complement-dependent cytotoxicity; Current Immunology, 5, 83-89 (1993)). Using a molecular cloning approach described below, we have converted Yl Fv regions into full-sized IgGl molecules. The construction of Yl-IgGl was achieved by joining cDNA fragments to each other in the following order: The sequence of the heavy and light chains of Yl-IgG are presented in Figure 48. The open reading frame (ORF) of the nucleotide sequence of Yl-HC (SEQ ID No. 205), the amino acid sequence of Yl-HC (SEQ ID No. 206), the ORF of the nucleotide sequence of Yl-LC (SEQ ID No. 207) and the amino acid sequence of Yl-LC (SEQ ID No. 208).

A compatible leader sequence for a mammalian expression system: An interchangeable system was designed to allow convenient insertion of elements required for a complete IgG molecule. The following double-stranded oligonucleotides encoding a putative leader sequence were synthesized, heat fixed, and ligated into the XhoI site of the mammalian expression pBJ-2 (under the SRct5 promoter). 5'-TCGACCTCATCACCATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCA GGACACAGGGTCCTGGGCCGAT Y 5 FCGÁTCGCA A € K7fOG ^^ GAOOGTGAOCA AOCAGACiCCCA GCCATGGTGATOA-GO, Above the starting ATG codon, two elements of Kozak were included. In addition, an internal EcoRV site was introduced between the putative cleavage site of the leader sequence and the Xhol site to allow subcloning of the variable regions. This modified vector was designated pBJ-3.

The VL encoding the sequence derived from the cDNA sequence of Yl scFv was inserted between the leader sequence and the sequence encoding the constant light region. Similarly, the VH encoding the sequence derived from the cDNA sequence of Yl scFv was inserted between the leader sequence and the sequence encoding the constant heavy region. This was achieved by PCR amplification of the original pHEN-Yl vector, to obtain the VL and VH regions, individually The oligonucleotides • 5'-TTTGATATCCAGCTGGTGGAGTCTGGGGGA (sense) and 5'-GCTGACCTAGGACGGTCAGCTTGGT (counter-sense) were used for the VL PCR reaction. The cDNA product of the expected size of 350 bp was purified, sequenced and digested with the restriction enzymes EcoRV and Avrll. The same procedure was used to amplify and purify the VH cDNA region, using sense and antisense oligonucleotides -5'-GGGATATCCAGCTG (C / G) (AT) GGAGTCGGGC Y 5'-GGACTCGAGACGGTGACCAGGGTACCTTG, respectively.

Constant regions: The constant region? 3 (01 > -? 3) and the constant heavy regions CH1-CH3 obtained for the IgGl cDNA were synthesized individually as follows: For the constant CL-X3 region, RT-PCR was performed on mRNA extracted from a deposit of normal peripheral B cells (CD19 + cells) in combination with the sense oligonucleotides 5'-CCGTCCTAGGTCAGCCCAAGGCTGC and 5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT contrasentido. The PCR product of the expected size (400 bp) was purified, sequenced and digested with the restriction enzymes Avrll and Notl.

For the constant IgGl regions (? Chain), a human B cell clone (CMV, clone No. 40), immortalized in BTG, was selected for PCR amplification. It was shown that this clone secretes IgGl against CMV and was also shown to induce the response to ADCC in in vitro assays. For the cADW of CH1-CH3, the oligonucleotides 5'-ACCGCTCGAGTGC (T C) TCCACCAAGGGCCCATC (Q / C) GTCTTC (sense) and 5'-TTTGCGGCCGCTCATTTACCC (A G) GAGACAGGGAGAGGCT (counter-sense) were synthesized and used for PCR amplification. As described for the sequence encoding CL cDNA, the expected PCR product (1500 bp) was purified, sequenced and digested with the restriction enzymes Avrll and Notl. For the final expression vectors, a triple ligation procedure was carried out using the vector pBJ-3 redirected by EcoRV-Notl, the variable cDNAs of EcoRV-AvrlI and the constant regions of Avrll-Notl. The final vectors for the expression of heavy chain and light chain were designated pBJ-Yl-HC and pBJ-Yl-LC, respectively.

An additional vector, pBJ-Yl-LP, was constructed based on pBJ-YI-LC to allow double screening based on the puromycin-resistant gene (PAC). In this vector the neomycin-resistant gene of plasmid pBJ-Yl-LC was replaced with a 1600 bp fragment encoding the PAC gene (of vector pMCC-ZP).

The open reading frame (ORF) of both Yl-HC and Yl-LC and their encoded amino acid sequences are presented as SEQ ID No. 205-208.

The leader sequence is underlined. The VH and VL regions are each encoded by amino acid sequences that are in bold, followed by the sequences of the constnate region of IgGl (for the heavy chain) or of? 3 (for the light chain).

Expression of the heavy and light chain of Yl in CHO cells Vectors pBJ-Yl-HC and pBJ-Yl-LC were used individually for the transfection and selection of stable cells expressing the heavy or light chains. After G418 selection and cell growth, the protein secreted in the supernatant was analyzed for the expression of IgGl by the capture EIA assay and by immunoblot analysis, described below: Capture EIA Assay: The receptacles of 96-well plates were pre-coated with mouse anti-human IgGl Fe (Sigma). The preceding supernatant was added to the receptacles, and the presence of heavy chain IgGl was detected with the anti-γ chain-specific antibody. of biotinylated goat (Sigma), streptavidin-HRP and substrate. An ELISA plate reader monitored color development at? 405 · Immunoblot analysis: The supernatant for the preceding cells was passed over 12.5% SDS-PAGE. The expression of each chain was detected with (a) goat anti-human IgG-HRP (H + L, Sigma Cat No. A8667) for the detection of heavy chains and (b) biotinylated goat anti-human chain? Southern Biotechnology Association, Cat No. 2070-08) for the detection of light chains.

The expression of both chains was confirmed by the preceding assays, and the joint transfection was carried out to obtain full-length Yl-IgGl.

Expression? Purification of IgG-Yl Culture and Transfection of Cells: CHO cells were cultured in F-12 medium with 10% fetal calf serum and 40 g ml of gentamicin at 37 ° C in 5% CC¾ atmosphere. One day before transfection 0.8-lxlO6 cells were germinated in 90 mm dishes. The cultures were transfected with 10 pg of the light and heavy chain DNAs using the FuGene transfection reagent technique (Roche). After 2 days of growth in the non-selective medium, the cells were cultured for 10-12 days in the F-12 medium containing 550 μg / ml neomycin and 3 g / ml puromycin. The cells were trypsinized and cloned by limiting the 0.5 cell / well dilution in 96-well plates of Costar. Individual colonies were collected, grown in six-well dishes and transferred to flasks.

Determination of heavy and light chain secretion: An ELISA assay was used to determine the concentration of the secreted antibody in the supernatant of the transfected CHO cells. To determine the concentration of the antibody, the following reagents were used: monoclonal anti-human IgGl (Fc) (Sigma) as the coated antibody, goat anti-human IgG conjugate (? Chain specific) and biotin as the detector (Sigma) and Pure human IgGl, lambda (Sigma) as standard. Based on this ELISA assay the production index varied between 3-4 μg / ml.

Production and Purification of MAb from cells: Cells were developed in roller bottles at a final concentration of 1-2xl08 cells per bottle in the F-12 medium with 10% fetal calf serum, with a supplement of neomycin and puromycin. For production, cells were cultured in the same medium, but with 2% fetal calf serum for another two days.

The secreted antibody was purified on a protein G-Sepharose colony (Pharmacia). The binding was in sodium phosphate buffer at 20 mM, at pH 7.0; the elution was carried out in 0.1 M glycine buffer, at pH 2.5-3.0. The amount of the purified or purified antibody was determined by ultraviolet radiation absorbance; the purity was analyzed by SDS-PAGE. Under non-denaturing conditions the complete IgG antibody has the expected molecular weight of 160 kD. In denaturing gels the heavy and light chains have the desired molecular weight size of 55 and 28 kD, respectively.

Binding of the full-size IgG-Yl molecule: Binding experiments were performed to determine the level of binding of the IgG-Yl molecule compared to the level of binding of the scFv-Yl molecule. A two-step staining procedure was used, where 5 ng of IgG-Yl reacted with both RAJI cells (negative control, Figures 44-47a) and with Jurkat cells (positive Y1 cells, Figures 44-47b and 44- 47c). For detection, goat antihuman IgG labeled with PE was used (Figures 44-47c). Similarly, 1 μg of scFv-Yl reacted with Jurkat cells (Figures 44-47b) and PE-labeled rabbit anti-scFv was used for detection. The results indicate that both IgG-Yl and scFv-Yl bind to Jurkat cells, and approximately 103 times more scFv-Yl molecules are needed to obtain a level of detection similar to that of YgG-Yl.

Example 6: Preparation of Fab and F (ab ') 2 fragments obtained from the IgG Yl antibody Cell Culture and Transient Transfection: CHO cells were cultured in F-12 medium with a 10% supplement of fetal calf serum and 40 μg / ral of gentamicin at 3 ° C in 5% CO2 atmosphere. One day before transfection, 1-1.5-lxlO6 cells were germinated in 90-mm dishes. The cultures were transfected together with 10 μg of DNA encoding the variable variable and heavy light chains of the Yl antibody, each in a separate eukaryotic expression system. The transfection was carried out with the FuGene transfection reagent technique (Roche).

After 2 days of growth in non-selective growth media, the cells were cultured for 10-12 days in the F-12 medium containing 550 μg ml neomycin and 3 g / ml · puromycin. The cells were trypsinized and cloned by limiting the dilution of 0.5 cell / receptacle in 96-well plastic plates from Costar. The individual colonies were harvested, grown in six-well dishes and transferred to flasks for a new selection (to determine the level of expression and secretion of antibodies to growth media).

Cell Culture and Long Term Transfection: CHO cells were cultured in F-12 medium with a supplement of 10% fetal calf serum and 40 μg / ml gentamicin at 37 ° C in 5% CO2 atmosphere. One day before transfection, 0.8-lxlO5 cells were germinated in 90 mm dishes. The cultures were transfected with 10 μg of DNA encoding the variable variable and heavy light chains of the Yl antibody cloned under the CMV promoter (cytomegalovirus) and the dhfr gene under the sv-40 promoter. The transfection was carried out using the FuGene transfection reagent technique (Roche). After 2 days of growth in non-selective growth media, the cells were cultured in a medium containing 100? -5? of methotrextrate (MTX) and dialyzed fetal calf serum to select clones (after limiting dilution) that express increased levels of the complete Yl antibody.

Determination of secretion of heavy and light chains:.

An ELISA assay was established to determine the concentration of the antibody that is secreting into the supernatant of the transfected CHO cells. To quantify the concentration of the antibody, the following reagents were used: a monoclonal anti-human IgG (Fc) (Sigma) as the coated antibody, an anti-human IgG (chain specific?) Conjugate of goat and biotin as the detector (Sigma) and a purified human IgGl, lambda (Sigma) as standard.

Production and Purification of Mab from cells Cells were grown in roller bottles at a final concentration of 1-2x108 cells per bottle in F-12 medium supplemented with 10% fetal calf serum, neomycin and puromycin (as indicated above). For the production of antibodies, the cells were cultured in the same medium, but with 2% fetal calf serum for another two days.

The secreted antibody was purified on a protease G sepharose column (Pharmacia) and an ion exchange-Sepharose Q column (Pharmacia). The binding was in sodium phosphate buffer at 20 mM at pH 7.0, while the elution was in glycine buffer at 0.1 M at pH 2.5-3.0. The amount of the purified antibody was determined by ultraviolet radiation absorbance and ELISA, while its purity was analyzed by SDS-PAGE and HPLC. Under non-denaturing conditions the complete IgG antibody has the expected molecular weight of 160 kD. In denaturing gels both heavy and light chains have the expected molecular weight size of 55 and 28 kD respectively.

Fragmentation of Yl IgG in Fab and F (ab) 2: The IgG molecule is composed of two identical light chains and two identical heavy chains. These chains are held together in folds (domains) by a combination of non-covalent interactions and covalent bonds (disulfide bonds). The light chain consists of a variable domain and a constant domain. The heavy chain consists of a variable domain (VH) and three separate constant domains (CH 1, 2 and 3). The "hinge" region between the constant heavy domain one (CH1) and the constant heavy domain two (CH2) is easily accessible to the proteolytic attack by the enzymes. Does breaking at this point produce the Fab or F (ab ') fragments? and the Fe portion. The Fab portion of the molecule maintains the antigen binding capacity of the molecule, but has low non-specific binding. The Fab portion is more suitable for situations where antigen binding capabilities are desired without effector functions.

The Fab and F (ab ') 2 fragments in vivo are used as diagnostic and therapeutic agents. To manufacture tumor-specific cancer chemotherapeutic agents instead of damaging all cells, agents can bind antibodies that bind to antigens on the tumor cell surface. The use of Fab or F (ab ') 2 fragments instead of intact IgG offers several advantages: (1) Fragments can cross capillaries more easily and spread to tissue surfaces. (2) Fragments that are not bound to conjugates will be lasered more rapidly than unbound IgG intact; and, consequently, a greater amount of the fragment therapeutic agent reaches the target area.

Detailed procedure for the preparation of the Fab fragment 1 mg of purified Yl antibody was applied to a 2 ml column of Ficin Immobilized in Digestion buffer at a concentration of 2 mg / ml cysteine. HCL (for the preparation of F (ab ') 2 fragments) 200 mg / ml (for the preparation of Fab fragments), at 37 ° C for 5 hours (for Fab) and 20 hours (for F (ab') 2) . The reaction was terminated by eluting the digest with 4 ml of Immunopure Binding Buffer. Separation of the Fab or F (ab ') 2 fragments from undigested IgG and Fe fragments was done using the Protein A column with Binding buffer. The Fab or F (ab ') 2 was contained in the continuous flow. Reading the absorbance at 280 meters, the peak fractions containing the fragments were deposited. The fragments were concentrated and dialyzed against PBS using the microconcentrator with a 10,000 Dalton molecular weight cutoff. The recovery, purity and characterization of protein was determined using absorbance at 280 mm, gel electrophoresis and HPLC.

Preparation of Cell Extract (Lysate) 2xl06 cells were cultured and centrifuged in a microcentrifuge (1300 rpm, 4 ° C, 5 minutes). To wash, 0.5-1 ml of PBS was applied to the pellet and mixed gently. The mixture was centrifuged as before. Washing with 0.5-1 ml of PBS + pi was repeated and the mixture was centrifuged as above. Pellet cells were resuspended in lysis buffer (200 μl / 20? 106 pellets of cells). The lysis buffer used was 50 mM Tris at pH 7.4, 1 mm of PMSF 1% NP-40, 1 mM EDTA, although other suitable lysis buffers can be used. The suspension was incubated for 60 minutes on ice, then centrifuged (3000 rpm, 4 ° C, 5 minutes). The supernatant was collected and divided into aliquots.

Preparation of a crude membrane fraction and extraction of membrane proteins Twenty volumes of homogenization buffer were added to a volume of packed cells. The homogenization buffer used was 2% (w / v) Tween 20, 1 mM MgSO4, 2 mM CaCl2, 150 mM NaCl and 25 mM Tris-HCl, at pH 7.4. The following protease inhibitors were also added: 1 mM PMSF, 5 μg / ml Leupeptin and 5 μg / ml Aprotonin. The cells were homogenized using three to five strokes in a Potter-Elvehjem homogenizer with a rotating Teflon hand (Ültra-Torex). The sample was kept cold during homogenation, then stirred for 1 hour in an ice bath. The sample was subjected to a few additional strokes in the homogenizer, then centrifuged at 3000 g for 30 minutes at 4 ° C. The supernatant was collected and centrifuged at 45,000 g (19,000 rpm of the ss-34 rotor) for 1 hour at 4 ° C. The supernatant from the centrifugation at 45,000 g was discarded. A solution of 50 mM Tris 7.4, 1 mM EDTA, 1% NP-40 and protease inhibitors was added to the pellet and the pellet dissolved was placed on ice for one hour.

Purification of Membrane Fractions in HPLC column An RPC column (Pharmacia Type PLRP-S 300 A) was used for the purification of membrane fractions. The buffers used were (A) 20 mM Tris 8.0 and (B) 60% propanol in DDW. The flow rate was 1 ml / minute, with the exception of the wash step during which the flow rate was 2 ml / minute. The entire procedure was carried out at room temperature. The elution sample after immunoprecipitation (PI) of the Jurkat membrane fraction or KG-1 was added with a sample buffer (62 mM Tris pH 6.8, 10% glycerol, 3% SDS, 720 mM mercaptoethanol) diluted with buffer A at a ratio of 1: 4.

The sample was loaded onto the column, and the liquid from the continuous flow was collected. The column was washed with buffer A until the optical density of the flow decreased to zero.

Proteins were eluted from the column according to the following schedule: 5 minutes with 80% A, then 40 minutes with gradient of 80% -0% A and 20% -100% B. A second gradient was then applied to bring the composition of the flow to 80% of A, and this composition was used to wash the column for another 5 minutes. The elution liquid was collected in a fraction collector, in sizes of fractions of 1 ml.

Samples were evaporated to small volumes in a Speed-Vac evaporator, then analyzed using SDS-PAGE (SDS-polyacrylamide gel electrophoresis) and immunoblot.

Normal Human Plasma Purification in 0 Sepharose column 5 ml of fresh frozen normal human plasma were diluted 1:10 with the initial buffer and filtered through a 0.45 μm syringe filter (Sartorius, cat No. 16555). The initial buffer is 20 mM Tris-HCl, pH 8.0 and contains protease inhibitors (5 μg / ml leupeptin, 5 μg / ml aprotinin, and 1 mM PMSF).

A 5 ml HiTrap Sepharose Q column (Amersham Pharmacia, cat. No. 17-1154-01) was mounted to a P-1 peristaltic pump (Amersham Pharmacia). The column was washed according to the commercial protocol at a flow rate of about 4 ml / minute. The diluted filtered plasma was loaded onto the column, and the continuous flow of liquid was collected. The column was washed with 20 volumes of 0.3 M NaCl solution in the initial buffer. The proteins were eluted at 0.6 M, 0.8 M, and 1.0 M NaCl solutions in the initial buffer. The elution volumes were 50, 20 and 20 ml, respectively. The entire procedure was carried out at 4 ° C.

Eluted fractions were subjected to SDS-PAGE analysis in duplicate gels, followed by immunoblotting using biotinylated Yl and antibody 181 as a negative control. Fibrinogen was found? premium in the elution fraction of 0.6 M NaCl. The elution fraction of 1.0 M NaCl contained the compound complement 4 (CC4), lumican, prothrombin and inter-alpha inhibitor.

Purification of Normal Human Plasma in HPLC Column Normal human plasma purified with Q Sepharose was mixed with Urea (at a final concentration of at least 8M), DTT (at a final concentration of 30 M) and TFA (at a final concentration of 0.1%).

The purified plasma solution was loaded onto a 3 ml RPC column (Amersham Pharmacia) and the continuous flow of liquid was collected. The column was washed with buffer A until the optical density of the flow fell to zero. The proteins were eluted from the column according to the following schedule: 5 minutes with 90% A, then 40 minutes with a gradient of 90% -0% A and 10% -100% B. A second gradient was used then to bring the composition of the flow to 90% of A, and this composition was used to continue washing the column for another 5 minutes. The buffers used were (A) 0.1% TFA in DD and (B) 80% CAN and 0.1% FTA in DDW. The flow rate was 1 ml / minute, with the exception of the wash step, during which the flow rate was 2 ml / minute.

The liquid of the elution was collected in a collector of fractions in sizes of the fraction of 1 ml. The entire procedure was carried out at room temperature.

Samples were evaporated to small volumes in a Speed-Vac evaporator, then analyzed using SDS-PAGE and immunoblot.

Immunoblot Analysis of Yl Receptor-Filter Processing after Immunoblot The nitrocellulose membrane was blocked using 5% skim milk for one hour at room temperature. The membrane was then washed 3 times for 5 minutes each with 0.05% Tween 20 in PBS at room temperature. The membrane was incubated with 5 μg / ml Yl-biotin (or 181-biotin) in 2% skim milk in PBS for one hour at room temperature. The membrane was then washed three times for 5 minutes each with 0.05% cold Tween 20 in PBS in the cold environment (4 to 10 ° C). The membrane was then incubated in the cold environment with a 1: 1000 dilution of SAV-HRP (streptavidin-HRP) (at a final concentration of 1 g / ml) in 2% skim milk, 0.05% Tween. Dilution was carried out at room temperature (25 ° C), then the diluted SAV-HRP was chilled on ice for 10-15 minutes before use. The incubation was carried out for 1 hour with gentle agitation. After incubation with SAV-HRP, the membrane was washed, as above. The membrane was then incubated with the Super Signal mixture (Pierce) for 5 minutes as indicated by the commercial protocol, then the excess solution was diluted. The membrane was used to expose it to an X-ray film (Fuji) and the film was revealed.

Example 7: Prokaryotic expression of recombinant glycocalicin (GC) The DNA fragment encoding glycocalicin (GC, amino acid 1 to amino acid 493 of GPIbot) was cloned into a prokaryotic vector cassette that can be induced by IPTG. E. coli cells (BL21 DE3) hosts of the newly constructed plasmid grew at 37 ° C to O.D. 0.7-0.8, then at 37 ° C for 3 hours in the presence of IPTG for induction.

SDS-polyacrylamide gel loaded with glycocalicin (, AGC ") derived from semipurified human platelets or lysates of E. Coli cells (" totals ") derived from induced and non-induced cells were analyzed.The immunoblot analysis was performed with Yl- Biotinylated scFv, rabbit anti-human polyclonal glycocalicin antibody, commercially available anti-human monoclonal CD42 monoclonal antibody (SZ2 Immunotech, Serotec PM640, HIPI Pharmigen, A 51 DAKO), and polyclonal antibody against the N-terminus of GPIb (Sc-7071, Santa Cruz) .

The two polyclonal antibodies recognized both recombinant bactarian derived glycocalicin and glycocalicin derived from natural human pickets. Yl-scFv and commercially available antibodies recognized the natural human derived glycocalicin, but did not recognize the bacterial derived recombinant platelet glycocalicin. Figure 45 The prokaryotic system (eg, E.coli) lacks mechanisms of post-translational modification, such as mechanisms for glycosylation and sulfation. Therefore, the non-recognition by Yl-scFv of the glycocalicin produced in bacterial form supports the conclusion that post-translational modification, such as glycosylation and sulfation, is essential for the binding of Yl-scFv to glycocalicin.

FACS Protocol for Blood / Bone Marrow Samples Samples provided from hospitals. Patient sample of 30 μ? / Tube. Add 5 μ? / Tube of CD33-APC (for AML) or CD19-APC (for B-CLL) or CD38-APC (for Multiple Myeloma). Add 5 μ? / Tube of CD45-PerCp and 5 μ? of scFv-Yl or scFv-N31 control or CD162-PE (KPL1). Incubate tubes 30 minutes at 4 ° C with low agitation. Wash by adding 2 ml of PBS and centrifuge 5 minutes at 1200 rpm. Discard the supernatant.

For a one-step trial, continue with the lysis step.

Add 500 μ? of BD Lysine solution diluted 1:10 with ddH20 (300 μ? to the patient sample). Stir at high speed and incubate 12 minutes at 4 ° C. Wash as before. Discard the supernatant. And add 500 μ? of PBS. Samples are read in the FACS using the blood sampling facility in accordance with international standards.

For two or more assays: the termination buffer is PBS + 1% BSA + 0.05% sodium azide. Incubations and washing as before.

Lysis of red blood cells is the final step in the test, followed by the new suspension with 500 μ? PBS.

EXAMPLE 8: Construction of Triabodies The vector pHEN-Yl, which encodes the original YI, was amplified using PCR for the VL and VH regions, individually. The 5 'sense oligonucleotide -AACTCGAGTGAGCTGACACAGGACCCT and the antisense oligonucleotide 5'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the VL PCR reaction. The cDNA product of the expected size of 350 bp was purified, sequenced and digested with the restriction enzymes Xhol and Notl.

The same procedure was used to amplify the VH region (using the 5 'sense oligonucleotide -ATGAAATACCTATTGCCTACGG and the antisense oligonucleotide 5'- AACTCGAGACGGTGACCAGGGTACC). The VH PCR product was digested with the restriction enzymes Ncol and X ol. A triple ligation procedure was used in the vector pHEN, predigested with Ncol-Notl. The final vector was named pTria-Yl.

After transformation of E. coli, several classes were collected for further analysis, which included DNA sequence placement, protein expression, and bacteria extraction from the peristaltic space. SDS-PAGE under reducing conditions and immunoblot analysis were performed to confirm the size of the triabodies of? 1.

EXAMPLE 9: Diabody Construction The preceding pTria-Yl vector was made linear with the restriction enzyme Xhol, and the synthetic complementary double-stranded oligonucleotides (5 '-TCGAGAGGTGGAGGCGGT and 5'-TCGAACCGCCTCCACCTC) were previously heat-fixed and ligated into the Xhol site, between the heavy chains of Yl and light Yl. This new vector was called pDia-Yl. As described for triabodies, the DNA sequence and protein expression were confirmed.

Example 10: Expression and Purification of Diabodies and Triabodies Expression in E. coli was essentially as described for scFv-Yl. However, the purification of the diabodies and triabodies of Y1 from the periplasm of the transformed E. coli cells was different. The monomeric form of scFv Yl can be purified on an affinity column of Protein-A Sepharose beads. The multimeric forms of Yl are purified, however, ineffective with this procedure. Consequently, the periplasmic proteins extracted from the bacteria were precipitated overnight with 60% ammonium sulfate, resuspended in ¾0 and loaded onto a size exclusion column of Sephacryl-200 (Pharmacia) previously equilibrated with 0, lxPBS. The fractions were collected and analyzed by HPLC and the separate fractions containing the dimeric or trimeric forms were collected for FITC labeling and FACS analysis.

EXAMPLE 11: Union of diabodies and triabodies from Y1 to cells The FACS analysis was performed on Jurkat cells using a "three-step staining procedure". First, crude extracts or purified non-labeled scFv are stained, then mouse anti-myc antibodies and finally, anti-mouse antibodies conjugated with FITC or PE. The FACS analysis requires 5-8x105 cells, suspended again in PBS + 1% BSA. The union was carried out for 1 hour at 4 ° C. After each step, the cells were washed and resuspended in PBS + 1% BSA. After the final staining step, the cells were fixed by resuspending in PBS, 1% BSA, 2% formaldehyde and then read by FACS (Becton-Dickinson).

The binding of Yl-scFv was compared with that of the diabodies and triabodies. In this analysis, the profile of the union of the three forms was very similar, which indicates that the previous modifications in the molecule did not alter, conceal or destroy the binding affinity of Yl to its ligand.

EXAMPLE 12: A Study of the Affinity of Dimer S-S Yl Compared with CONY1 and Yl-IgG, Using a Receptor Binding Assay with KG-1 Cells The assay system consisted of the use of radioactive ligands that were prepared by iodination with 125 I using chloramine T in the construction of Yl-IgG or the Bolton-Hunter reagent (C0 Y1). The test tubes contained 5xl06 KG-1 cells per 0.2 ml and a tracer labeled with varying amounts of unlabeled competitor, in PBS + 0.1% BSA, pH 7.4. After one hour of incubation with shaking at 4 ° C, the cells were washed thoroughly with cold buffer and harvested for radioactive counting.

For the receptor radio binding (RRA) assay, 2 ng / 125 I-Yl-IgG tube was used, and the competition was performed with each of the three molecules. The results are given in Figure 46. The results presented in this figure demonstrate that the affinity of the dimer SS Yl was twice less than the majority of the complete Yl antibody and 30 times higher than that of the CONY 1. An approximate estimate of the affinity of Yl-IgG in this experiment is 2 x 10 ~ 8 M. The corresponding affinity of the dimer is, consequently 4 x 10"8 M.

In a second RRA using labeled CONYl, 100 ng / tube of 125 I-Yl-IgG was used and the competition was performed with each of the three molecules. The results are given in Figure 47. This figure shows that the affinity of the S-S dimer was 20 times higher than that of CONYl. A rough estimate of the affinity of CONY 1 in this experiment is 10"6 M. The corresponding affinity of the dimer is, accordingly, 5 x 10 ~ 8m.

EXAMPLE 13: Production of Yl-cys-kak (cysteine dimer) One liter of bacterial culture of pL-yl-cys-KAK was induced at 42 ° C for 2-3 hours. This culture was centrifuged at 5,000 RPM for 30 minutes. The pellet was suspended again in 180 ml of TE (50 mM Tris-HCl pH 7.4, 20 mM EDTA). 8 ml of lysozyme (from a material of 5 mg / ml) was added and incubated for 1 hour. 20 ml of NaCl at 5 M and 25 ml of 25% Triton were added and incubated for another hour. This mixture was centrifuged at 13,000 RPM for 60 minutes at 4 ° C. The supernatant was discarded. The pellet was suspended again in TE with the help of a "tissuemiser" (or homogenizer). This process was repeated 3-4 times until the inclusion bodies (pellets) were gray / light brown. The inclusion bodies were solubilized in 6M Guanidine-HCl, 0.1M Tris pH 7.4, 2 mM EDTA (1.5 grams of inclusion bodies in 10 ml of solubilization buffer gave 10 mg / ml soluble protein) . This was incubated for at least 4 hours. The protein concentration was measured and brought to a concentration of 10 mg / ml. DTT was added to a final concentration of 65 mM and incubated overnight at room temperature. The new folding was initiated by diluting 10 ml of protein (drop by drop) to a solution containing 0.5 M Arginine, 0.1 M Tris pH 8, 2 mM EDTA, 0.9 mM GSSG. The folded solution was again incubated at 10 ° C for 48 hours. The newly folded solubilization containing the protein was dialysed in a buffer containing 25 mM phosphate buffer at pH 6, 100 mM Urea, and concentrated to 500 ml. The concentrated dialyzed solution was bound to a SP-sepharose column, and the protein was eluted with a gradient of NaCl (up to 1M).

EXAMPLE 14: ELISA to GC (glyco-glycine) 100 ml of purified glycocalicin were incubated in plates of 96 Maxisorp flat receptacles, overnight at 4 degrees Celsius. The plate was washed with PBST (PBS + 0.05% Tween) 3 times, then 200 ml PBST-milk (PBST + 2% skim milk), for 1 hour at room temperature. The plate was washed with PBST, and the monomer or dimer (100 ml) was added in PBST-milk at different concentrations for 1 hour at room temperature. Then the plate was washed and polxclonal anti-V (obtained from rabbits with VL derived from Yl) (diluted 1: 100 in PBST-milk) was added for one hour. The plate was washed and anti-rabbit HRP was added for another hour. The plate was washed 5 times and 100 μ? of TMB substrate for approximately 15 minutes then 100 μ? of 0.5 H2SO4 to stop the reaction. The optical density of the plate was measured at 450 mm in an ELISA reader.

Post-translational modification, such as glycosylation and sulfation is essential for scFv and commercially available antibodies that bind to GC. The prokaryotic system (E.coli) lacks post-translational modification mechanisms, such as glycosylation and sulfation.

Example 15: Production of Yl tetramers A construct was designed where the following sequence, LNDIFEAQKIEWHE, was added to the C terminus of the Yl by PCR and cloning into an expression vector cassette that can be induced with IPTG. The clone was called Yl-biomarker. This sequence is a substrate for the BirA enzyme, which in the presence of free biotin, the enzyme is able to covalently connect biotin to the lysine residue (K) (phenotypic analysis of antigen-specific T lymphocytes.) Science October 4 of 1996; 274 (5284): 94-6, Altman JD et al). This construction was produced as inclusion bodies in BL21 bacterial cells. The new folding was performed as previously described. The inclusion bodies were solubilized in guanidine-DT. The new folding was done by dilution in a buffer containing arginine-Tris-EDTA. Dialysis and concentration were performed followed by HiTrapQ ion exchange purification.

The purified scFv Yl-biomarker was incubated with the enzyme BirA (purchased from Avidity) and biotin as recommended by the supplier. He Yl-biotinylated biomarker was analyzed by the HABA assay (which estimates the amount of biotin per molecule) and showed that there was around > 0.8 biotin residues / molecule.

The biotinylated Yl-biomarker was incubated on Streptavidin-PE (Phycoerythrin) to form complexes and was used in FACS experiments using KG-1 cells (positive for Yl). The sensitivity of the union increased at least 100 times due to the increase in avidity. Streptavidin can bind up to 4 biotinylated Yl-biomarker molecules.

The Yl-biomarker sequence is as follows, and it is SEQ ID No. 211: 1 MEVQLVESGG GVVRPGGSLR LSCAASGFTF DDYGMSWVRQ 41 APGKGLEWVS GIN WNGGSTG YADSVKGRFT ISRDNAKNSL 81 YLQMNSLRAE DTAVYYCARM RAPVIWGQGT LVTVSRGGGG 121 SGGGGSGGGG SSELTQDPAV SVALGQTVRI TCQGDSLRSY YAS 161 W YQQKPG QAPVLVI YG NNRPSGIPDR FSGSSSGNTA 201 SLTITGAQAE DEADYYCNSR DSSGNNVVFG GGTKLTVLGG 241 GGLNDIFEAQ KIEWHE Example 16: Characterization of the Activity of Y17 The enzyme O-Sialoglycoprotein endoprotease from Pastoral haemolytica that selectively breaks GPIb from human platelets, was used to establish the specificity of the binding of Y17 to GPIba. The O-Sialoglycoprotein endoprotease, specifically broke only glycan-containing proteins bound by O, sialylated, and does not break N-linked glycoproteins or non-glycosylated proteins. It has been reported that this enzyme breaks GPIb, which is strongly O-glycosylated, but not GPIIb-IIIa or other receptors in platelets. Incubation of platelets washed with O-Sialoglycoprotein endoprotease that broke GPIb, eliminates the binding of Y17 as well as the binding of the monoclonal antibody (MCA466S-serotec) directed against GPIbcc to GPIb as shown by immunoblots and FACS analysis. This endoprotease did not change the binding of the monoclonal antibody (anti CD61) directed against GPIIb / IIIa (Figure 4).

Example 17: Identification of the Y17 Epitope in Platelet GPIb An interesting approach to the identification of Yl epitope in platelet GPIb is to use endoprotease enzymes whose platelet GPIb cleavage sites are fully characterized. 17. 1: Effect of Mocarhagina on the Mapping of the Epitope of Yl Mocarhagina, a cobra venom metalloproteinase breaks GPIboc platelet specifically at a single site between the glu-282 and asp-283 residues, generates two stable products, a 45 kDa N-terminal fragment (His-l-Glu-282) found in the supernatant and a 100 kDa C-terminal fragment bound to the membrane.

Washed platelets were treated with mochahagin and the platelet lysates were separated on SES-polyacrylamide gels and transferred to nitrocellulose. The analysis of washed platelets treated with mochahagin by immunotransference analysis with Yl leads to the loss of the band corresponding to GPIb (135 kDa) and the binding of Y17 to the 45 kDa triptych fragment of the N term. Monoclonal antibodies, MCA466S directed against the C-terminal fragment of GPIb reacted with the 100 kDa C-terminus fragment. while the monoclonal antibody S.C.7071 recognizing the N-terminus of GPIba reacted with the same 45 kDa N-terminal fragment recognized by Y17 (Figure 14).

Treatment with glycocalicin mocarhagin gave results similar to those observed with washed platelets, which shows the binding of Yl and monoclonal antibodies, S.C.7071 to the fragment product of the 45 kDa N-terminus breakdown of GPIba (Figure 8). The results suggest that the epitope for Y17 is contained within the His-1-Glu-282 sequence. 17. 2: Effect of Cathepsin G on Epitope Mapping of Y17 Cathepsin G, a neutrophil serine protease, cleaved glycocalicin between residues leu-275 and Tyr-276 and a second cleavage site between residues Val-296 and Lys-297 . Glycocalicin treated by cathepsin G generated two N-terminus fragments, a 42 kDa fragment (Hisl-Leu275) and a large 45 kDa N-terminus fragment (Hisl-Val-296), in addition to a C-terminus fragment. 95 kDa. Glycocalicin and the glycocalicin fragments generated by the cathepsin G digestion were separated on SDS-polyacrylamide gels and transferred to nitrocellulose. Y17 was attached to the larger fragment (Hisl-Val-296), but not to the smaller fragment (Hisl-Leu275). Furthermore, the monoclonal antibody S.C. 7071 that recognizes an epitope within Hisl-Leu275 immunoblotted both fragments (Figure 12). The analysis of proteolitic fragments of the N-terminus peptide of mocarhagin and cathepsin G suggests that the amino acid sequence of BPIb Tyr-276-Glu-282 is an important recognition motif for the binding of Y17.

Example 18: Effect of Y17-scFv on vWF dependent Agglutination The effect of Y17-scFv on the vWF-dependent agglutination of the platelets was tested at different concentrations of Y17. In contrast to Yl, Y17 at a final concentration of 10, 25 or 50 μg / ml did not inhibit vWF-dependent platelet agglutination in washed platelets induced by ristocetin. The analysis of the N-terminal peptide proteolytic fragments of

Claims (264)

1. CLAIMS 1. An isolated epitope comprising the formula I [(W) 2 - P- (Y) tP] q Formula (I) wherein: is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulphated P is (A) m (A ) n (X) uo (X) u (A) n (A) mo (A) "(X) u (A) mo (A) n (A) m (X) or O (X) u (A) m (A) "O (A) m (X) u (A) n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with a negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine q is 1 to 6 z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is 0 to 2 n is 0 to 3 m is from 0 to 3 2 where if n = 0 then m > 0; where if m = 0 then n > 0; where if q is 1, r is 1 and if q is > 1 at least one of Y is sulfated; and further wherein the isolated epitope is capable of being linked by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region. comprising SEQ ID No. 8 or SEQ ID No. 20. 2. The isolated epitope of claim 1, wherein the sulfated group is a peptide or glyco or conjugated lipo. 3. The isolated epitope of claim 1, wherein: W is Glycine, Y is a Tyrosine conjugated peptide or a glyco conjugate of Asparagine, Serine or Threonine A is Glutamate,? Carboxi Glutamate or Aspartate q is 1, 2 or 34. The isolated epitope of claim 3, wherein: Y is a Tyrosine conjugated peptide q is 3 r is 1. 3 5. An isolated epitope comprising the formula (S) r (S) r (S) r (W) 2-p- (Y) rP- (Y) tP- (Y) tP (Formula II) wherein: W is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulphated P is (A) m (A) n (X) uo (X) u (A) n (A) mo (A) n (X) u (A) mo ( A) n (A) m (X) uo (X) u (A) m (A) not (A) m (X) u (A) n S is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with a negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is from 0 to 2 n is from 0 to 3 m is from 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; wherein at least one Y is sulfated; and also where the epitope 4 isolated is capable of being linked by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region comprising SEQ ID N ° 8 or SEQ ID No. 20. 6. The isolated epitope of claim 5, wherein the sulfated group is a peptide or glyco or conjugated lipo. 7. The isolated epitope of claim 5, wherein W is Glycine Y is a conjugate of Tyrosine peptide or a glyco conjugate of Asparagine, Serine or Threonine A is Glutamate,? Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline, Phenylalanine, Serine or Glycine. 8. The isolated epitope of claim 7, wherein: Y is Tyrosine conjugated peptide q is 3; and r is 1. 9. An isolated epitope comprising the formula: (S) r (S) r (S) r (G) z (X) u (E) n (D) m (Y) t (X) u (E) n (D) ) n, (Y) t (X) u (E) tt (D) m (Y) t (D) m (E) n (X) ¾ Formula tt? where: G is Glycine E is Glu amato D is Aspartate Y is Tyrosine S is sulfate or a sulfated molecule X is any amino acid except the precedents z is 0, 1 or 2 te si, 2 or 3 r is 0 or 1 u is from 0 to 2 n is from 0 to 3 m is from 0 to 3 wherein at least one Y is sulfated; where if n = 0 then m > 0; where if m = 0 then n > 0; and further wherein the isolated epitope is capable of being bound by an antibody, a fragment thereof that binds to an antigen, or a complex thereof comprising an antibody or a binding fragment thereof, comprising a first hypervariable region. comprising SEQ ID No. 8 or SEQ ID No. 20. 6 10. The isolated epitope of claim 9, wherein r is 1. 11. The isolated epitope of any of claims 1-8, wherein the natural group that is capable of being sulfated Y comprises a molecule of lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and / or lipopolysaccharide. 12. A homologue or imitation of the isolated epitope of any of claims 1-10. 13. The isolated epitope of any of claims 1-10, wherein the isolated epitope comprises at least one post-translational modification in addition to the sulfation. 14. A composition comprising the isolated epitope of any of claims 1-10. 15. The composition of claim 14, further comprising an ascending or descending region capable of improving the binding capacity of the epitope. 16. The composition of claim 15, wherein the ascending or descending region is close to the epitope. 7 17. An isolated polynucleotide encoding at least a portion of the isolated epitope of any of claims 1-10. 18. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, capable of binding to or reacting with the isolated epitope of claim 1. 19. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, capable of binding to or reacting with the isolated epitope of claim 5. 20. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, capable of binding to or reacting with the isolated epitope of claim 9. 21. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, capable of binding to or reacting with the antibody. epitope isolated from any of claims 2-4, 6-8 or 10-13. 22. A process for producing an antibody, an antigen-binding fragment thereof, or a complex thereof comprising at least one antibody or a binding fragment thereof, capable of binding to or reacting with the isolated epitope of any one of claims 1 -3, which comprises the steps of: (a) providing a phage display library; (b) providing an isolated epitope according to any of claims 1-13; (c) panning the phage display library by a phage particle having an oligopeptide or polypeptide capable of binding to the isolated epitope; and (d) producing an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, comprising the peptide or polypeptide capable of binding to the isolated epitope. 23. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, having the binding capabilities of the scFv antibody fragment of SEQ ID No. 25 or SEQ ID No. 203. 24. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, having the binding capabilities of a peptide or polypeptide, wherein the peptide or polypeptide comprises a first hypervariable region or SEQ ID No. 8 or SEQ ID No. 20. 25. The antibody, antigen-binding fragment thereof, or the complex thereof comprising at least one antibody or a binding fragment thereof of any of claims 23-24, wherein in addition the peptide or polypeptide has a second hypervariable region comprising SEQ ID No. 115 and / or a third hypervariable region comprising SEQ ID No. 114. 26. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, which is capable of binding to an epitope peptide or polypeptide of 3 to 126 amino acid residues in length and comprising at least 2 amino acids and at least one sulfated tyrosine residue. 27. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of claim 26, wherein the epitope further comprises a proline, leucine, isoleucine, serine, glycine or phenylalanine residue. 28. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of any of claims 23-27, wherein the antibody or antigen-binding fragment thereof it is capable of binding to an epitope, or a molecule of carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein and / or lipopolysaccharide. 29. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of claim 28, wherein further the epitope in the carbohydrate molecule, peptide, glycolipid, glycoprotein , lipoprotein and / or lipopolysaccharide comprises at least one sulfated group. 30. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, which is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, Gamma prima fibrinogen (? '), GPIb, heparin, lumican, 11 Compound complement 4 (CC4), interalpha inhibitor, and prothrombin. 31. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, which is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, gamma-prime fibrinogen (? '), GPIbot, heparin, lumican, compound complement 4 (CC4), interalpha inhibitor, and prothrombin and is capable of binding to at least one cell type selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. 32. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 31, which is capable of binding to each of PSGL-1, fibrinogen gamma prima (? '), GPIb and heparin. 33. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 32, capable of binding to each of PSGL-1, gamma-prime fibrinogen 12 (? '), GPIboc and heparin, and is capable of binding to at least one cell type selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. 34. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, which is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, gamma prima fibrinogen (? '), GPIbot, heparin, lumican, compound complement 4 (CC4), interalpha inhibitor, and prothrombin and which is also capable of binding to an epitope in a molecule of lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and / or lipopolysaccharide. 35. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of claim 34, wherein in addition the epitope in the lipid molecule, carbohydrate, peptide, glycolipid , glycoprotein, lipoprotein and / or lipopolysaccharide comprises at least one sulfated group. 13 36. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, which is capable of cross-reacting with two or more epitopes, each epitope comprising one or more residues of sulphated tyrosine and at least one group of two or more acidic amino acids. 37. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 36, which is capable of cross-reacting with PSGL-1. 38. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 37, which binds to QATEYEYLDYDFLPETE wherein at least one tyrosine residue is sulfated. 39. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 36, which is capable of cross-reacting with GPIb-ct. 14 40. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 36, which binds to DEGDTDLYDYYPEEDTEGD wherein at least one tyrosine residue is sulfated. 41. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 39 that binds to TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated. 42. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 39, which binds to DEGDTDLYDYYP wherein at least one tyrosine residue is sulfated. 43. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 39 that binds to YDYYPEE wherein at least one tyrosine residue is sulfated. fifteen 44. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 39 that binds to TDLYDYYP wherein at least one tyrosine residue is sulfated. 45. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 36 which is capable of cross-reacting with gamma-prime fibrinogen (? '). 46. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of the reivindication that binds to EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated. 47. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication that is capable of cross-reacting with heparin. 48. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or one fragment of union of it, of reivndication 36 that is capable of reacting in a cross way with the compound complement 4 (CC4). 49. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 48 that binds to MEANEDYEDYEYDELPAK wherein at least one tyrosine residue is sulfated. 50. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, of reivindication 36 which is capable of cross-reacting with at least one cell type selected from the group formed by B-CLL cells, AML cells, multiple myeloma cells and metastatic cells. 51. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25 which is capable of inhibiting the coiling of cells. 52. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or one binding fragment thereof, according to any of claims 18-20, 23-25 which is capable of inhibiting inflammation. 53. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25 which is capable of inhibiting the disease autoxnmune. 54. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the thrombosis. 55. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the restenosis 56. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or an antigen. binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting metastasis. 57. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the growth and / or replication of tumor cells. 58. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of increasing the mortality of tumor cells. 59. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the growth and / or the replication of leukemia cells. 60. An antibody, antigen-binding fragment thereof, or complex or thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of increasing the mortality rate of leukemia cells. 61. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of increasing the susceptibility of diseased cells to damage by anti-disease agents. 62. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of increasing the susceptibility of tumor cells to damage by anticancer agents. 63. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of increasing the susceptibility of leukemia cells to damage by anti-leukemia agents. twenty 64. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the increase in the number of tumor cells in a patient who has a tumor. 65. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of reducing the number of tumor cells in a patient who has cancer. 66. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the increase in the number of leukemia cells in a patient who has leukemia. 67. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of the claims 18-20, 23-25, which is capable of reducing the number of leukemia cells in a patient having leukemia. 68. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the formation of cell-cell complexes, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 69. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the cell-cell adhesion, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 70. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, which is capable of inhibiting the aggregation cell-cell, cell-matrix, platelet-matrix, platelet-platelet and / or cell-platelet. 22 71. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, coupled or forming a complex with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, antibacterial, antiviral, and anti-inflammatory agents. 72. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 71, wherein the agent is an antiviral agent selected from the group consisting of acyclovir , ganciclovir, and zidovudine. 73. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 71, wherein the agent is an anti-thrombosis / anti-restenosis agent selected from the group consisting of cilostazol, sodium dalteparin, sodium reviparin, and aspirin. 74. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or one binding fragment thereof, according to claim 71, wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid. 75. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 71, wherein the agent is an anti-autoimmune agent selected from the group formed by leflunomide, denileucine diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide. 76. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 71, wherein the agent is an anti-adhesion / anti-aggregation agent selected from the group consisting of limaprost, chlorchromen, and hyaluronic acid. 77. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 71, in wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents. 78. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 77, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof. 79. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 77, wherein the radioisotope is selected from the group consisting of gamma radiation emitters. , positron emitters, X-ray emitters, gamma radiation emitters, and alpha radiation emitters. 80. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 77, wherein the radioisotope is selected from the group consisting of inindium, indium, 99mrenium, 105renio, 101renio, 99mtecnetio, 121ratelurio, 122mtelurio, 125mtelurio, 155tulio, 167tulio, 123yodo, 25 It was all of it, all of it, all of it, all of it, all of it, 81kkrypton, 33xenon, 0itium, 213 bismuth, bromine, fluorine, ruthenium, ruthenium, ruthenium, ruthenium, mercury, gallium, and gallium. 81. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 77, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin (adriamycin) ), morpholinodoxorubicin, methoxymorpholinylqxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, morpholinodaunorubicin, methoximorpholindaunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof. 82. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, coupled or forming a complex with a vehicle or carrier that is capable of being coupled or forming a complex with more than one agent. 26 83. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20 or 23-25, wherein the carrier or carrier it is selected from the group consisting of dextran, lipophilic polymers, hydrophilic polymers, ???, and liposomes. 84. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, coupled or forming a complex with a radioactive isotope or other imaging agent. 85. A diagnostic kit comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 84. 86. An antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit the winding of cells. 27 87. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit inflammation. 88. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit autoimmune disease. 89. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit thrombosis. 90. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit restenosis. 28 91. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an effective amount to inhibit metastasis. 92. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit the growth and / or replication of tumor cells. 93. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to increase the mortality of tumor cells. 94. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit the growth and / or replication of leukemia cells. 95. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to increase the mortality rate of leukemia cells. 96. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to increase the susceptibility of diseased cells to damage by agents against the disease. 97. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to increase the susceptibility of tumor cells to damage by anticancer agents. 30 98. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to increase the susceptibility of leukemia cells to damage by anti-leukemia agents. 99. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to increase the number of tumor cells in a patient having a tumor. 100. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to reduce the number of tumor cells in a patient having a tumor. 101. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit the increase in the number of leukemia cells in a patient having leukemia. 102. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to reduce the number of leukemia cells in a patient who has leukemia. 103. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit cell-cell aggregation, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 104. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit complex formation 32 cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 105. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in an amount effective to inhibit cell-cell adhesion, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 106. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, coupled or complexed with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, antibacterial, antiviral, and anti-inflammatories. 107. The pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 106, wherein the agent is an antiviral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine. 108. The pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 106, wherein the agent is an antithrombosis agent. anti-restenosis selected from the group consisting of cilostazol, sodium dalteparin, reviparin sodium and aspirin. 109. The pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 106, wherein the agent is a selected anti-inflammatory agent. of the group consisting of zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid. 110. The pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 106, wherein the agent is an anti-aging agent. autoinnmne selected from the group consisting of leflunomide, denileucine diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide. 111. The pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 106, wherein the agent is an anti-aging agent. adhesion / anti-aggregation selected from the group consisting of limaprost, chlorchromen and hyaluronic acid. 112. A pharmaceutical composition according to claim 106 wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents. 113. A pharmaceutical composition according to claim 106 wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin and modifications and derivatives thereof. 114. A pharmaceutical composition according to claim 106, wherein the radioisotope is selected from the group consisting of gamma emitters, positron emitters, emitters of 35 X rays, beta radiation emitters, and alpha radiation emitters. 115. A pharmaceutical composition according to claim 106 wherein the radioisotope is selected from the group consisting of lxlindium, indium, 99mrenium, 105renium, 101renium, 99mtecnetium, 121mtelurium, 122mtelurium, 125mtelurium, 165thulium, 167thulium, 123yode, 12Sodium, 131yode, 133yodo, 81mkrypton. , 33xenón, 90itrio, 213bismuto, 77bromo, 18fluoro, ruthenium, ruthenium, ruthenium, ruthenium, mercury, gallium, and gallium. 116. A pharmaceutical composition according to claim 106, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin (adriamycin), morpholinodoxorubicin, methoxymorpholinyldoxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone , daunorubicin, morpholinodaunorubicin, methoxymorpholindaunorubicin, idarubicin, fludarabine, chlorambucil, interferon alfa, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof. 117. A pharmaceutical composition comprising an antibody, antigen-binding fragment thereof, or complex thereof. comprises at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, coupled or complexed with a carrier or carrier that is capable of being coupled or complexed with more than one agent. 118. A pharmaceutical composition according to claim 117, wherein the carrier or carrier is selected from the group consisting of dextran, lipophilic polymers, hydrophilic polymers,?, And liposomes. 119. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the winding of cells. 120. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medication that is capable of inhibiting inflammation. 121. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or one binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the autoimmune disease. 122. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a drug that is capable of inhibiting restenosis. 123. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a drug that is capable of inhibiting thrombosis. 124. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a drug that is capable of inhibiting metastasis. 125. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or one binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the growth and / or replication of tumor cells. 126. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a drug that is capable of increasing the mortality rate of tumor cells. 127. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the growth and / or replication of leukemia cells. 128. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in 1e. making a 39 drug that is able to increase the mortality rate of leukemia cells. 129. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a drug that is capable of increasing the susceptibility of diseased cells to damage by anti-disease agents. 130. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of increasing the susceptibility of tumor cells to damage by anticancer agents. 131. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a drug that is capable of increasing the susceptibility of leukemia cells to damage by anti-leukemia agents. 40 132. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the increase in the number of tumor cells in a patient who has a tumor. 133. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of reducing the number of tumor cells in a patient who has a tumor. 134. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the increase in the number of leukemia cells in a patient who has leukemia. 135. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of the 41 claims 18-20, or 23-25, in the manufacture of a medicament that is capable of reducing the number of leukemia cells in a patient having leukemia. 136. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting the formation of cell-cell complexes, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 137. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the manufacture of a medicament that is capable of inhibiting cell-cell, matrix-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet aggregation. 138. The use of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, or 23-25, in the making a 42 medicament that is capable of inhibiting the adhesion of cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet. 139. The method according to any of claims 119-138, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof is coupled or complexed with a agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, antiaggregation, antibacterial, anti-inflammatory, and anti-inflammatory agents. 140. The method according to claim 139, wherein the agent is an antiviral agent selected from the group consisting of acyclovir, ganciclovir and zidovudine. 141. The method according to claim 139, wherein the agent is an anti-thrombosis / anti-restenosis agent selected from the group consisting of cilostazol, sodium dalteparin, sodium reviparin, and aspirin. 142. The method according to claim 139, wherein the agent is an anti-inflammatory agent selected from group 43 formed by zaltoprofen, pranoprofen, droxicam, acetylsalicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indometacin, rofecoxib, and nimesulid. 143. The method according to claim 139, wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileucine diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide. 144. The method according to claim 139, wherein the agent is an anti-adhesion / anti-aggregation agent selected from the group consisting of limaprost, chlorchromen, hyaluronic acid. 145. The method according to claim 139, wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents. 146. The method according to claim 139, wherein the agent is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof. 44 147. The method according to claim 139, wherein the radioisotope is selected from the group consisting of gamma radiation emitters, positron emitters, X-ray emitters, beta radiation emitters, and alpha radiation emitters. 148. The method according to claim 139, wherein the radioisotope is selected from the group consisting of mindio, indium, 9m ore, 105renio, 101renio, 99ratenenetium, 121ratelurium, 122mtelurio, 125mtelurio, 165tulio, 167tulio, 123yodo, 126yodo, 131yodo, 133yodo, 81mkrypton , 33xenón, 90itrio, 213bismuto, "bromine, 18fluor, ruthenium, ruthenium, ruthenium, ruthenium, 107mercury, 67galio, and 149. The method according to claim 139, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin (adriamycin), morpholinodoxorubicin, methoxymorpholinyldoxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, morpholinodaunorubicin, metoximorfolinildaunorubicin, idarubicin, fludarabine, chlorambucil, interferon alfa, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof. Four. Five 150. The method according to any of claims 119-138, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, is coupled or forms a complex with a vehicle or carrier that is capable of being coupled or forming complexes with more than one agent. 151. The method of claim 150, wherein the carrier or carrier is selected from the group consisting of dextran, lipophilic polymers, hydrophilic polymers, HPMA. and liposomes. 152. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25 for use as a medicament that it is able to inhibit the winding of cells. 153. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting inflammation. 46 154. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting autoimmune disease. 155. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting restenosis. 156. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament what is capable of inhibiting thrombosis. 157. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting metastasis. 47 158. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting the growth and / or replication of tumor cells. 159. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of increasing the mortality rate of tumor cells. 160. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting the growth and / or replication of leukemia cells. 161. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any one of 48 claims 18-20, 23-25, for use as a medicament that is capable of increasing the mortality rate of leukemia cells. 162. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of increasing the susceptibility of diseased cells to damage by anti-disease agents. 163. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of increasing the susceptibility of tumor cells to damage by anticancer agents. 164. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of increasing the susceptibility of leukemia cells to damage by anti-leukemia agents. 49 165. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is able to inhibit the increase in the number of tumor cells in a patient who has a tumor. 166. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of reducing the number of tumor cells in a patient who has a tumor. 167. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting the increase in the number of leukemia cells in a patient who has leukemia. 168. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or 50 binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament that is capable of reducing the number of leukemia cells in a patient having leukemia. 169. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament which is capable of inhibiting the formation of cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet complexes. 170. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament. which is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and / or cell-platelet aggregation. 171. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 18-20, 23-25, for use as a medicament 51 which is capable of inhibiting cell-cell, cell-matrix, platelet-matrix, platelet-platelet and / or cell-platelet adhesion. 172. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 152-171, wherein the antibody, antigen binding fragment. of it, or complex thereof comprising at least one antibody or binding fragment thereof, is coupled or forms a complex with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion agents , anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, antibacterial, antiviral, and anti-inflammatory. 173. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the agent is an antiviral agent selected from the group consisting of acyclovir , ganciclovir, and zidovudine. 174. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, 52 wherein the agent is an anti-thrombosis / anti-restenosis agent selected from the group consisting of cilostazol, sodium dalteparin, sodium reviparin, and aspirin. 175. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen , pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid. 176. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the agent is an anti-autoimmune agent selected from the group formed by leflunomide, denileucine diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide. 177. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the agent is an anti-adhesion / anti-aggregation agent 53 selected from the group consisting of limaprost, chlorchromen, and hyaluronic acid. 178. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents. 179. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the toxin is selected from the group consisting of gelonin, Pseudomonas exotoxin (PE), PE40, PE38, ricin, and modifications and derivatives thereof. 180. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the radioisotope is selected from the group consisting of gamma radiation emitters. , positron emitters, X-ray emitters, gamma radiation emitters, and alpha radiation emitters. 54 181. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the radioisotope is selected from the group consisting of i indium, , 99m, 10m, 10m, 101m, 99mnet, 121motion, 122mtelury, 125mtelury, 155thulium, 167thulium, 123your, 126your, 131your, 133your, 81krypton, 33xenon, 90thium, 213bismuth, 77brom, 18fluor, 85rute, 97rutenium, 103rutenius, 105tech, 107mercury, 6 gallium, and gallium. 182. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 172, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin (adriamycin) ), morpholinodoxorubicin, methoxymorpholyldoxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, morpholinodaunorubicin, methoxymorpholinylununubicin, idarubicin, fludarabine, chlorambucil, interferon alfa, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof. 183. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to any of claims 152-171, wherein the antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof is coupled or a complex with a vehicle or carrier that is capable of being coupled or forming a complex with more than one agent. 184. The antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or a binding fragment thereof, according to claim 183, wherein the carrier or carrier is selected from the group consisting of dextran, lipophilic polymers, hydrophilic polymers, HPMA, and liposomes. 185. An isolated epitope comprising the amino acid sequence of GPIba Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated. 186. The isolated epitope of claim 185, further comprising amino acids 283-285 of GPIba. 187. An antibody, antigen-binding fragment thereof, or a complex thereof comprising at least one antibody or one 56 binding fragment thereof which is capable of binding to the epitope of claim 185, wherein the binding is enhanced when the epitope of claim 185 further comprises amino acids 283-285 of GPIba. 188. An isolated N-terminal peptide of GPIba having an apparent molecular weight of 40 kDa, said peptide comprises an epitope having the sequence YDYYPEE, wherein at least one thiorisin residue in the epitope is sulfated. 189. An isolated GPIba peptide comprising amino acids 1 to 282, wherein at least one of amino acids 276, 278 and 279 is sulfated. 190. An antibody multimer comprising at least a first and a second antigen-binding fragment, wherein at least the first or second antigen binding fragment or both are capable of crosslinking or reacting with epitope comprising the formula I [(W) z-P- (Y) t-P] q, Formula (I) where: W is any amino acid except Aspartate and Glutamate? is any naturally occurring group that is capable of being sulfated P is (A) m (A) n (X) uo (X) u (A) n (A) mo (A) n (X) u (A) mo (A) n (A) m (X) uo (X) u (A) m (A) not (A) m (X) u (A) n S is sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine q is 1 to 6 z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is 0 to 2 n is 0 to 3 m is from 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; where if q is 1, r is 1 and if q is > 1 at least one of Y is sulfated. 191. An antibody multimer of claim 190, wherein the first and second antigen binding fragment or both bind or cross-react with the epitope in which: W is Glycine, 58 And it is a conjugated peptide of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine A is Glutamate,? Carboxi Glutamate or Aspartate q is 1, 2 or 3. 192. An antibody multimer of claim 190, wherein the first and second antigen-binding fragments or both bind or cross-react with the epitope in which: And it is a tyrosine conjugated peptide q is 3 r is 1. 193. An antibody multimer comprising at least a first and a second antigen binding fragment, wherein the first or the second antigen-binding fragment or both are capable of crosslinking or reacting with an epitope comprising the formula (S) r (S) r (S) r III (W) zP- (Y) r- P- (Y) tP- (Y) tP (Formula II) wherein: W is any amino acid except Aspartate and Glutamate Y is any naturally occurring group that is capable of being sulfated P is (A) m (A) n (X) or O (X) u (A) n (A) m O (A) "(X) u (A ) m O (A) n (A) m (X) or O (X) u (A) m (A) n O (A) m (X) u (A) n? is a sulfate or a sulfated molecule X is any amino acid except Aspartate, Glutamate, or Tyrosine A is any amino acid with a negative charge or leucine, isoleucine, proline, phenylalanine, serine or glycine z is 0, 1 or 2 r is 0 or 1 t is 1, 2 or 3 u is from 0 to 2 n is from 0 to 3 m is from 0 to 3 where if n = 0 then m > 0; where if m = 0 then n > 0; wherein at least one Y is sulfated. 194. An antibody multimer of claim 193, wherein the first or the second antigen binding fragment or both binds or cross-reacts with the epitope wherein: W is Glycine Y is a conjugate of Tyrosine peptide or a glycogen conjugate of Asparagine, Serine or Threonine 60 A is Glutamate,? Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline, Phenylalanine, Serine or Glycine. 195. An antibody multimer of claim 193, wherein the first or second antigen fragment or both binds or cross-reacts with the epitope wherein: Y is Tyrosine conjugated peptide q is 3; and r is 1. 196. An antibody multimer comprising at least a first and a second antigen binding fragment, wherein the first or the second antigen-binding fragment or both are capable of crosslinking or reacting with an epitope comprising the formula (S) r (S) r (S) r III (G) z (X) u (E) n (D) m (Y) t (X) u (E) n (D) m (Y) t ( X) u (E) "(D) m (Y) t (D) m (E)" (X) u Fórmul att? wherein: G is Glycine E is Glutamate D is Aspartate Y is Tyrosine S is sulfate or a sulphated molecule 61 X is any amino acid except the preceding z is 0, 1 or 2 if, 2 or 3 r is 0 or 1 u is 0 to 2 n is 0 to 3 m is 0 to 3 where at least one Y is sulfated; where if n = 0 then m > 0; where if m = 0 then n > 0 197. An antibody multimer of claim 196, wherein the first or second antigen-binding fragment or both binds or cross-reacts with the epitope wherein r is 1. 198. An antibody multimer of claim 190, 193 or 196 wherein the multimer is a dimer, trimer or tetramer. 199. An antibody multimer of claim 198 wherein the multimer is a dimer. 200. A dimer of claim 199, wherein at least one of the first and second antigen-binding fragments is selected from scFv fragments of Y1 and Y17. 62 201. A dimer of claim 199 wherein the first and second antigen binding fragments are linked by a disulfide bridge. 202. A dimer of claim 201 wherein the first and second antigen-binding fragments are Yl-Cys A. 203. A dimer of claim 199 wherein the first and second antigen-binding fragments are linked by a polypeptide bond of 5 to 20 amino acids. 204. A dimer of claim 203 wherein the polypeptide linkage comprises 5 amino acids. 205. A dimer of claim 204 wherein the polypeptide linkage is Gly ^ Ser. 206. An antibody multimer of claim 198, wherein the multimer is a trimer. 207. A trimer of claim 206, comprising three antigen binding fragments, wherein at least one of the 63 antigen binding fragments is a scFv fragment of Yl or a scFv fragment of Y17. 208. A trimer of claim 207 wherein the antigen binding fragments are linked by a polypeptide linkage. 209. A trimer of claim 208 wherein the polypeptide linkage comprises from 1 to 5 amino acids. 210. An antibody multimer of claim 198 wherein the multimer is a tetramer. 211. A tetramer of claim 210, comprising four antigen-binding fragments, wherein at least one of the antigen-binding fragments is a scFv fragment of Yl or a scFv fragment of? 1? . 212. A tetramer of claim 211 wherein 1 antigen binding fragments are linked by a polypeptide linkage. 213. A tetramer of claim 212 wherein the polypeptide linkage comprises from 1 to 5 amino acids. 64 214. A tetramer of claim 210, wherein the four antigen binding fragments form a complex through the streptavidin-biotin association. 215. A multimer antibody of claim 198, comprising identical antigen binding fragments. 216. An antibody multimer of claim 198, wherein at least the first or second antigen binding fragment comprises a first hypervariable region comprising SEQ ID No. 8. 217. An antibody multimer of claim 198, wherein at least the first or second antigen binding fragment comprises a first hypervariable region comprising SEQ ID No. 20. 218. An antibody multimer of claim 216 or 217 wherein at least the first or second antigen binding fragment or both have a second hypervariable region comprising SEQ ID No. 115 and / or a third hypervariable region comprising the SEQ ID No. 114 65 219. A mutant antibody of any one of claims 190, 193, 196, 216, and 217 wherein the multimer is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, gamma-prime fibrinogen (? ') , GPIba, heparin, lumican, compound complement 4 (CC4), interalpha inhibitor, and prothrombin. 220. An antibody multimer of any of claims 190, 193, 196, 216, and 217 wherein the multimer is capable of binding to at least two different molecules selected from the group consisting of PSGL-1, gamma-prime fibrinogen (? ') , GPIba, heparin, lumican, compound complement 4 (CC4), interalpha inhibitor, and prothrombin and is capable of binding to at least one cell type selected from the group consisting of B-CLL cells, AML cells, myeloma cells multiple, and metastatic cells. 221. An antibody dimer comprising a first and second antigen binding fragment, wherein said first or second antigen binding fragment or both comprise a hypervariable region comprising the amino acid sequence of SEQ ID No. 8 [Yl CDR3] . 66 222. An antibody dimer comprising a first and second antigen binding fragment, wherein said first or second antigen binding fragment or both comprise a hypervariable region comprising the amino acid sequence of SEQ ID No. 20 [Y17 CDR3] . 223. An antibody dimer of claim 221 or 222, wherein said first or second antigen binding fragment or both further comprise a second hypervariable region comprising an amino acid sequence of SEQ ID No. 115 and / or a third hypervariable region. comprising SEQ ID No. 114. 224. An antibody multimer comprising a first and second antigen-binding fragment, wherein said primer or second antigen-binding fragment or both are capable of cross-reacting with one or more epitopes, each epitope comprising one or more residues of sulphated tyrosine and at least one group of two or more acidic amino acids. 225. An antibody multimer of claim 224 wherein said multimer is capable of cross-reacting with PSGL-1. 67 226. An antibody multimer of claim 224 that binds QATEYEYLDYDFLPETE wherein at least one tyrosine residue is sulfated. 227. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with GPIb-oc. 228. An antibody multimer of claim 224 that binds to DEGTDLYDYYPEEDTEGD wherein at least one tyrosine residue is sulfated. 229. An antibody multimer of claim 224 that binds to TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated. 230. An antibody multimer of claim 224 that binds to DEGDTDLYDYYP wherein at least one tyrosine residue is sulfated. 231. An antibody multimer of claim 224 that binds YDYYPEE wherein at least one tyrosine residue is sulfated. 68 232. An antibody multimer of claim 224 that binds to TDLYDYYP wherein at least one tyrosine residue is sulfated. 233. An antibody multimer of claim 224 wherein the polymer is capable of cross-reacting with gamma-prime fibrinogen. 2. 34. An antibody multimer of claim 233, which binds to EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated. 235. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with heparin. 236. An antibody multimer of claim 224 wherein the multimer is capable of cross-reacting with complement 4 (CC4). 237. An antibody multimer of claim 224 that is capable of cross-reacting with at least one cell selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. 69 238. A pharmaceutical composition comprising an antibody multimer according to any of claims 1, 4, 7, 27 and 28. 239. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to increase the mortality of the tumor cells or increase the susceptibility of the tumor cells to damage by an anti-cancer agent. 240. A pharmaceutical composition of claim 239 comprising the antibody multimer in an amount effective to inhibit the growth and / or replication of leukemia cells. 241. A pharmaceutical composition of claim 238, comprising the antibody multimer in an amount effective to inhibit abnormal adhesion cell-cell, cell-matrix, platelet-matrix, platelet-platelet, and / or platelet-cell. 242. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective for 70 increase the susceptibility of diseased cells to damage by anti-disease agents. 243. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to increase the mortality of the leukemia cells or to increase the susceptibility of the leukemia cells to damage by an anti-leukemia agent. 244. A pharmaceutical composition comprising an antibody multimer according to any of claims 190, 193, 196, 216 and 217 coupled to or forming a complex with an agent selected from the group consisting of anti-cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti-restenosis, anti-autoimmune, anti-aggregation, antibacterial, antiviral and anti-inflammatory. 245. A pharmaceutical composition of claim 244 wherein the agent is selected from the group consisting of toxins, radioisotopes, and pharmaceutical agents. 246. A pharmaceutical composition of claim 244 wherein the agent is an antiviral agent selected from the group consisting of acyclovir, ganciclovir, and zidovudine. 71 247. A pharmaceutical composition of claim 244 wherein the agent is an anti-thrombosis / anti-restenosis agent selected from the group consisting of cilostazol, sodium dalteparin, sodium reviparin, and aspirin. 248. A pharmaceutical composition of claim 244 wherein the agent is an anti-inflammatory agent selected from the group consisting of zaltoprofen, pranoprofen, droxicam, acetylsalicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indometacin, rofecoxib, and nimesulid . 249. A pharmaceutical composition of claim 244 wherein the agent is an anti-autoimmune agent selected from the group consisting of leflunomide, denileucine diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide. 250. A pharmaceutical composition of claim 244 wherein the agent is an anti-adhesion / anti-aggregation agent selected from the group consisting of limaprost, chlorchromen, and hyaluronic acid. 72 251. A pharmaceutical composition of claim 245 wherein the radioisotope is selected from the group consisting of gamma radiation emitters, positron emitters, X-ray emitters, beta radiation emitters, and alpha radiation emitters. 252. A pharmaceutical composition of claim 251 wherein the radioisotope is selected from the group consisting of: indium, indium, 99m, 10ren, 101renium, 99necnetium, 121mtelurium, 122mtelurium, 125mtelurium, 165thulium, 167thulium, 123iodo, 126iodo, 131yodo, 133yodo, 81mkrypton, 33xenón, 90itrio, 213bismuto, 77bromo, 18fluor, 95rutenio, rutuno, 103rutenio, 105rutenio, 107mercurio, 67galio, and 68galio. 253. A pharmaceutical composition of claim 245, wherein the pharmaceutical agent is selected from the group consisting of doxorubicin (adriamycin), morpholinodoxorubicin, methoxymorpholinyldoxorubicin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin , morpholinodaunorubicin, metoximorfolinildaunorubicin, idarubicin, fludarabine, chlorambucil, interferon alfa, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof. 73 254. A pharmaceutical agent of claim 244 coupled to or complexed with a carrier or carrier that is capable of being coupled or complexed with more than one agent. 255. A pharmaceutical composition of claim 254, wherein the carrier or carrier is selected from the group consisting of dextran, lipophilic polymers, hydrophilic polymers, HPMA and liposomes. 256, A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit the winding of cells. 257. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit inflammation. 258. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit the autoimmune disease. 259. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit thrombosis. 74 260. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit restenosis. 261. A pharmaceutical composition of claim 238 in an amount effective to inhibit metastasis. 262. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit the growth and / or replication of tumor cells, increase the mortality of tumor cells, or increase the susceptibility of tumor cells to damage by the agents anticancer 263. A pharmaceutical composition of claim 238 comprising the antibody multimer in an amount effective to inhibit the growth and / or replication of leukemia cells, the increase in the mortality rate of the leukemia cells or the increase in the susceptibility of the leukemia cells to damage by antileukemia agents. 264. A pharmaceutical composition of claim 238 comprising the antibody multimer in an effective amount for