WO2002022816A1 - Nouveau polypeptide, proteine 14.19 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine 14.19 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002022816A1
WO2002022816A1 PCT/CN2001/001130 CN0101130W WO0222816A1 WO 2002022816 A1 WO2002022816 A1 WO 2002022816A1 CN 0101130 W CN0101130 W CN 0101130W WO 0222816 A1 WO0222816 A1 WO 0222816A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
estrogen receptor
related protein
sequence
Prior art date
Application number
PCT/CN2001/001130
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2002210339A priority Critical patent/AU2002210339A1/en
Publication of WO2002022816A1 publication Critical patent/WO2002022816A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, an estrogen receptor-related protein 14.19, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
  • the estrogen receptor exists in the nucleus of some specific cells, and it can specifically bind to estrogen, so that the cells respond to stress.
  • ER estrogen receptor
  • the abnormal phenomenon is that the charged ligand cannot normally bind to the nucleus or the receptor protein is missing from the ligand. Interaction with the nucleus (Raam S, Robert N, Pappas CA, Tamura H, 1998).
  • ER mRNAs can also be found in normal uterine tissue (Fuqua SAW, Allred DC et al., 1991). Scripture from human T-47D C. Anti-estrogen-resistant CDM clones have been isolated from breast cancer cell lines. These mutated ER cDNA strands contain frameshift mutations. The estrogen receptor-related protein encoded by them is behind the second zinc finger protein structure. Truncation, or truncation near the end of the fifth exon, is similar to the in-frame deletion of nuclear localization signals (Grahame ML, Krett NL et al., 1990).
  • the 5 'terminal nucleotide sequence of the mutated ER cDNA clone is the same as that of normal human ER raRNA, but the nucleotide sequence at the 3' end is very different.
  • Estrogen receptor-associated proteins lack important structural and functional regions, including the hormonal binding region possessed by normal ER proteins (Kumar V, Green S et al., 1987). However, in the segment where exons and introns intersect, the sequence differences between estrogen receptor-related proteins and normal estrogen receptor proteins are relatively lower than some other regions (Ponglikitmongkol M, Green S, Chambon P, 1988).
  • Estrogen receptor mutations cause low levels of binding of the receptor to estrogen. Women with heterozygous beta variant ER genes are more likely to have spontaneous abortions than those with normal two ER chains SAW, Fitzgerald ld SD et al., 1991).
  • the estrogen receptor-related protein 14.19 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the estrogen receptor-related protein 14.19 protein involved in these processes, especially the amino acid sequence of this protein is identified.
  • New estrogen receptor-related protein 14. 19 The isolation of the protein-coding genes also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an estrogen receptor-related protein 14.19.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding an estrogen receptor related protein 14.19.
  • Another object of the present invention is to provide a method for producing an estrogen receptor related protein 14.19.
  • Another object of the present invention is to provide antibodies against the polypeptide-estrogen receptor-related protein 14.19 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed against the polypeptide of the present invention, estrogen receptor-related protein 14.19.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of estrogen receptor-related protein 14.19.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the multiple The peptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 48 to 437 in SEQ ID NO: 1; and (b) a sequence having 1-468 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a screen for simulating, activating, antagonizing or inhibiting estrogen receptor related proteins.
  • a method of a 19-protein-active compound comprising utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of estrogen receptor-related protein 14.19 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of estrogen receptor-related protein 14.19.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include amino acid sequences or nucleotides A deletion, insertion, or substitution of an amino acid or nucleotide in a sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insert refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to a change from Amino acids or nucleotides replace one or more amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • Antagonist refers to a molecule that, when combined with estrogen receptor-related protein 14.19, can cause the protein to change and thereby regulate the activity of the protein.
  • An agonist can include a protein, a nucleic acid, a carbohydrate, or any other Molecules that bind to estrogen receptor-related protein 14.19.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of estrogen receptor-related protein 14.19 when combined with estrogen receptor-related protein 14.19.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to estrogen receptor related proteins 14.19.
  • “Regulation” refers to changes in the function of estrogen receptor-related protein 14.19, including the increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of estrogen receptor-related protein 14.19. Or changes in immune properties.
  • substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify estrogen receptor-related proteins using standard protein purification techniques 14.19.
  • Substantially pure estrogen receptor-related proteins 14. 19 Can produce a single main band on non-reducing polyacrylamide gels.
  • Estrogen receptor-related protein 14.19 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean strict Conditions with reduced sex allow non-specific binding because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Laser gene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MBGALIGN program can compare two or more sequences based on different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
  • the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. in J., (1990) Methods in emzumology 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? 7. It can specifically bind to the epitope of estrogen receptor-related protein 14.19.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not Components of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated estrogen receptor-related protein 14. 19 means estrogen receptor-related protein 14. 19 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify estrogen receptor related proteins using standard protein purification techniques 14.19. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Estrogen Receptor Related Protein 14. The purity of the 19 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, an estrogen receptor-related protein 14.19, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of the estrogen receptor related protein 14.19.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the estrogen receptor-related protein 14.19 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protein sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It packs The polynucleotide sequence is 468 bases in length and its open reading frames 48-437 encode 129 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to the estrogen receptor-related protein, and it can be inferred that the estrogen receptor-related protein 14.19 has similar functions to the estrogen receptor-related protein.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DM forms include cDNA, genomic MA, or synthetic DM.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
  • hybridization occurs when the identity between at least 95% and more preferably 97%.
  • polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used for nucleic acid amplification Addition techniques (such as PCR) to identify and / or isolate polynucleotides encoding estrogen receptor-related protein 14.19.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the estrogen receptor-related protein 14.19 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cMA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DM or DM-RM hybridization; (2) the presence or absence of marker gene functions; (3) the level of transcripts of estrogen receptor-related protein 14.19 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the estrogen receptor-related protein 14. 19 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods.
  • the amplified MA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PS, 1977, 74: ⁇ 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the estrogen receptor-related protein 14.19 coding sequence, and that the present invention is produced by recombinant technology Said method of polypeptide.
  • a polynucleotide sequence encoding the estrogen receptor-related protein 14.19 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide the synthesis of raRNA.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include the start of replication SV40 enhancers of 100 to 270 base pairs on the late side, polyoma enhancers and adenoviral enhancers on the late side of the origin of replication are spotted.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding an estrogen receptor-related protein 14.19 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (Method 12, using the procedure well known in the art. Alternatively, it is a MgCl 2. If If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant estrogen receptor-related protein 14. 19 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, it can be separated by various separation methods using its physical, chemical and other properties. Isolate and purify the recombinant protein. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography
  • Fig. 1 is a comparison diagram of gene chip expression profiles of estrogen receptor-related protein 14.19 and estrogen receptor-related protein of the present invention.
  • the upper graph is a graph of the expression profile of the estrogen receptor-related protein 14. 19, and the lower graph is the graph of the expression profile of the estrogen receptor-related protein.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated estrogen receptor-related protein 14.19. 14. 19kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA Isolat ion Kit product of Qiegene
  • 2ug poly (A) mRNA was cMA by reverse transcription.
  • Use Smart cDNA Cloning Kit purchased from Clontech. The 0 fragment was inserted into the multi-cloning site of the P BSK (+) vector (Clontech) and transformed into DH50.
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0140b07 was a new DM. Insert a cDNA fragment into the clone by synthesizing a series of primers Segments are measured in both directions.
  • CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imer 1 5,-GGCAGTTGCTTGTGGCCCTTGCCT-3, (SEQ ID NO: 3)
  • Pr imer2 5'- CACAAGCGGGCTTGTGACTCTTGA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer 2 is the 3 'end reverse sequence in SEQ ID. NO: 1.
  • Amplification reaction conditions the leg containing 50 ol / L KCl '10 leg ol / L Tr is- Cl, ( pH8 5.), 1. 5mmol / L MgCl 2, 200 ⁇ in a reaction volume of 50 ⁇ 1 of ⁇ / L dNTP, lOpmol primer, 1U of Taq DNA polymerase (C 1 ont ecli).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a PCR vector using a TA cloning kit (Invitroger ⁇ A Division).
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as the 1-468bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of estrogen receptor-related protein 14.19 gene expression:
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA was electrophoresis performed on a 1.2% agarose gel containing 20 ⁇ lM of 3- (N-morpholino) propanesulfonic acid (H7. 0) -5raM sodium acetate-ImM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers. The DNA probe used was the 14.19 coding region sequence (48bp to 437bp) of the PCR amplified estrogen receptor-related protein shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and an RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25 mM H 2 PO 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC- 0.1 ° / »SDS in 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant estrogen receptor-related protein 14.19
  • Pr imer 3 5'- CCCCATATGATGGCTGCCCCGTGTTTGCTGCGG -3, (Seq ID No: 5)
  • Pr imer4 5'- CATGGATCCTTATTTTTGCACTCCAGGATGCAG -3 '(Seq ID No: 6)
  • the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-0140b07 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0140b0 7 plasmid, primers? 1 ⁇ 1116: 1: -3 and? ]: 111161: -4 points and another!] Is 1 ( ⁇ 11101, Advantage polymerase Mix (Clontech)) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68.
  • the digestion product and plasmid P ET-28 (+) were double-digested with Ndel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5 a by calcium chloride method. After culturing overnight on LB plates containing kanamycin (final concentration 30 g / ml), the positive clones were screened by colony PCR method and sequenced. The positive clones with the correct sequence (pET-0140b07) were selected by calcium chloride method.
  • the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen).
  • the host strain BL21 (pET-0140b07) was cultured at 37 ° C.
  • the logarithmic growth phase add IPTG to a final concentration of 1 ol / L, and continue to culture for 5 hours. Centrifuge the bacteria, collect the bacteria by ultrasonication, and collect the supernatant by centrifugation. Use 6 histidine (6His-Tag) Binding Affinity Column His. Bind Quick Cartr idge (Novagen) for chromatography
  • the purified target protein estrogen receptor-related protein 14.19 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 14.19kDa ( Figure 2).
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following estrogen receptor-related proteins.
  • NH2-Me tA 1 aA 1 aP r o-Cy s -Leu-Leu-Ar gG 1 nG 1 y-Ar gA 1 aG 1 yA 1 a-Leu- C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunocl emistry, 1969; 6: 43. With 4mg of hemocyanin Peptide complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to estrogen receptor-related protein 14.19.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • the probes can be used to hybridize to the genome or cMA library of normal tissues or pathological tissues from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above requirements can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first class of probes, is completely identical to the gene fragment of SEQ ID NO: 1 Homologous or complementary (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; finding and screening new tissue-specific new genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And Hel le, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cMAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic instrument. After elution, the DM was fixed on the glass slide to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1> ⁇ SSC, 0.2% SDS) was used at room temperature. ) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of estrogen receptor-related proteins 14.19 and estrogen receptor-related proteins according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the estrogen receptor exists in the nucleus of some specific cells, and it can specifically bind to estrogen, so that the cells respond to stress.
  • an abnormal estrogen receptor BR
  • the abnormal phenomenon is that the charged ligand cannot normally function. Binding to the nucleus or receptor protein interacts with the nucleus in the absence of ligand
  • BR that has mutated can eventually exist in normal uterine tissues, so it is not so much a tumor-specific mutation as a genetic polymorphism. Therefore, this abnormal estrogen receptor is called an estrogen receptor-related protein.
  • the expression of low-level binding of estrogen in estrogen receptor-related protein (ER) in normal uterine tissue indicates that this is a physiological low-level binding.
  • Abnormal ER expression can affect this low-level physiological binding. In turn, it leads to the disorder of estrogen metabolism, which can lead to the occurrence of some related reproductive system tumors.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human estrogen receptor-related protein (BR) protein, and both have similar biological functions.
  • the polypeptide of the present invention regulates the low-level physiological binding of estrogen in related tissues in vivo, and its abnormal expression can affect this low-level physiological binding, which in turn leads to the occurrence of some related reproductive system tumors.
  • These diseases include but not limited to:
  • Reproductive system tumors (malignant) hydatidiform mole, chorionic epithelial cancer [uterus], (malignant) supporter cells, stromal cell tumors, (malignant) granulosa cell tumors [ovary, testis], seminoma [testis], asexual Cell tumor [ovary], embryonic cancer [testis, ovary], (malignant) teratoma [ovary, testis, mediastinum and palate tail] and tumors related to this hormone such as breast tumors, breast cancer, etc .;
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human estrogen receptor-related protein (ER) protein, and both have similar biological functions.
  • ER estrogen receptor-related protein
  • the over-expression of the polypeptide of the present invention in certain tissues in the body can affect the physiological effects of estrogen, and then lead to the development of some sexual development disorders at the developmental stage.
  • These diseases include, but are not limited to:
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) estrogen receptor related proteins 14.19.
  • Agonists enhance estrogen receptor-related proteins 14. 19 Stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing an estrogen receptor-related protein 14.19 can be cultured with a labeled estrogen receptor-related protein 14.19 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
  • Antagonists of estrogen receptor-related protein 14.19 include selected antibodies, compounds, and receptor deficiency Lost property and the like. Antagonist of estrogen receptor-related protein 14.19 can bind to and eliminate the function of estrogen receptor-related protein 14.19, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • estrogen receptor-related protein 14.19 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between estrogen receptor-related protein 14.19 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to estrogen receptor-related proteins 14.19 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally, estrogen receptor-related protein 14.19 molecules should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the estrogen receptor related protein 14.19 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting estrogen receptor-related protein 14.19 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies against estrogen receptor-related protein 14.19 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • the chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son et al, PNAS , 1985, 81: 6851) 0 Only some technical production of single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against the anti-estrogen receptor-related protein 14.19.
  • Antibodies against estrogen receptor-related proteins 14. 19 can be used in immunohistochemical techniques to detect estrogen receptor-related proteins 14. 19 in biopsy specimens.
  • Monoclonal antibodies that bind to estrogen receptor-related proteins 14. 19 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill estrogen receptor-related proteins 14. 19 Positive cells.
  • the antibodies of the invention are useful for treating or preventing diseases relating to the ninth 14.1 estrogen receptor related protein. Administration of appropriate doses of antibodies can stimulate or block the production or activity of estrogen receptor-related protein 14.19.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of estrogen receptor-related protein 14.19 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of estrogen receptor-related protein 14.19 detected in the test can be used to explain the importance of estrogen receptor-related protein 14.19 in various diseases and to diagnose estrogen receptor-related protein 14.19 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding estrogen receptor-related proteins 14. 19 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of estrogen receptor-related proteins 14.19.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated estrogen receptor-related proteins 14. 19 to inhibit endogenous estrogen receptor-related proteins 14. 19 activity.
  • a variant estrogen receptor-related protein 14.19 may be a shortened estrogen receptor-related protein 14.19 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling. active.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of estrogen receptor-related proteins.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding estrogen receptor-related proteins 14.19 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding an estrogen receptor-related protein 14.19 can be found in the literature (Sambrook, et al.).
  • recombinant polynucleotides encoding estrogen receptor-related proteins 14.19 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on. .
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense MA and DNA
  • ribozymes that inhibit estrogen receptor-related protein 14.19 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific MA. The mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any of the existing RNA or DM synthesis techniques, such as the technique for the synthesis of oligonucleotides by solid-phase phosphate amide chemical synthesis, which is widely used.
  • Antisense RNA molecules can be encoded by The DM sequence of the RNA is obtained by in vitro or in vivo transcription. This DM sequence has been integrated downstream of the MA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • Polynucleotides encoding estrogen receptor-related proteins 14.19 can be used to interact with estrogen receptor-related proteins
  • the polynucleotide encoding estrogen receptor-related protein 14. 19 can be used to detect the expression of estrogen receptor-related protein 14. 19 or the abnormal expression of estrogen receptor-related protein 14. 19 in a disease state.
  • the DNA sequence encoding estrogen receptor-related protein 14.19 can be used to hybridize biopsy specimens to determine the expression of estrogen receptor-related protein 14.19.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are available commercially.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
  • the estrogen receptor-related protein 14.19 specific primers can also be used to detect RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcripts of estrogen receptor-related protein 14.19.
  • Estrogen receptor-related protein 14.19 mutations can also be used to diagnose estrogen receptor-related protein 14.19-related diseases.
  • Estrogen receptor-related protein 14.19 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type estrogen receptor-related protein 14.19 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these MA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of the c and A clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, the cDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Estrogen receptor-related protein 14. 19 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of estrogen receptor-related protein 14.19 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Abstract

L'invention concerne un nouveau polypeptide, une protéine 14.19 associée au récepteur d'oestrogène, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de tumeurs survenant dans le système de reproduction et de dysfonctionnements du développement sexuel survenant pendant la période de développement et croissance. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine 14.19 associée au récepteur d'oestrogène.
PCT/CN2001/001130 2000-07-07 2001-07-02 Nouveau polypeptide, proteine 14.19 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide WO2002022816A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002210339A AU2002210339A1 (en) 2000-07-07 2001-07-02 A novel polypeptide- estrogen receptor related protein 14.19 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00117039.2 2000-07-07
CN 00117039 CN1333252A (zh) 2000-07-07 2000-07-07 一种新的多肽——雌激素受体相关蛋白14.19和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002022816A1 true WO2002022816A1 (fr) 2002-03-21

Family

ID=4586437

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001130 WO2002022816A1 (fr) 2000-07-07 2001-07-02 Nouveau polypeptide, proteine 14.19 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1333252A (fr)
AU (1) AU2002210339A1 (fr)
WO (1) WO2002022816A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [online] 11 August 1999 (1999-08-11), HONG H. ET AL., retrieved from GI:5726230 accession no. NCBI Database accession no. (AAD48370.1) *
DATABASE PROTEIN [online] 15 October 1996 (1996-10-15), YANG N. ET AL., retrieved from GI:1239957 accession no. NCBI Database accession no. (AAB17015.1) *
DATABASE PROTEIN [online] 20 September 1999 (1999-09-20), PETTERSSON K. ET AL., retrieved from GI:2137284 accession no. NCBI Database accession no. S58087 *

Also Published As

Publication number Publication date
AU2002210339A1 (en) 2002-03-26
CN1333252A (zh) 2002-01-30

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001074879A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2002022816A1 (fr) Nouveau polypeptide, proteine 14.19 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001096387A1 (fr) Nouveau polypeptide, proteine 9.13 associee au recepteur oestrogene, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2002000824A2 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2002012317A1 (fr) Nouveau polypeptide, proteine associee au recepteur d'oestrogene 19.03, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001094407A1 (fr) Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide
WO2001077286A2 (fr) Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001068692A1 (fr) Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide
WO2002026952A1 (fr) Nouveau polypeptide, serine/threonine proteine kinase humaine 11.22, et polynucleotide codant ce polypeptide
WO2001094577A1 (fr) Nouveau polypeptide, proteine de liaison 36 a la cobalamine, et polynucleotide codant ce polypeptide
WO2001075102A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 13, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP