WO2002020579A1 - Nouveau polypeptide, proteine 11 de la famille des acide phosphatases, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proteine 11 de la famille des acide phosphatases, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020579A1
WO2002020579A1 PCT/CN2001/001011 CN0101011W WO0220579A1 WO 2002020579 A1 WO2002020579 A1 WO 2002020579A1 CN 0101011 W CN0101011 W CN 0101011W WO 0220579 A1 WO0220579 A1 WO 0220579A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
family protein
acid phosphatase
phosphatase family
Prior art date
Application number
PCT/CN2001/001011
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU2001295395A priority Critical patent/AU2001295395A1/en
Publication of WO2002020579A1 publication Critical patent/WO2002020579A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide-acid phosphatase family protein 11 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • Acid phosphatase ie, orthophosphate monoester phosphohydrolase catalyzes the hydrolysis of phosphate monoesters in organisms; in some conditions, it also catalyzes the transfer of phosphoryl groups between phosphates and ethanol.
  • Acid phosphatase exists in animals and plants, and they can be divided into three different types: two are low-molecular-weight acid phosphatase; the third is high-molecular-weight acid phosphatase [Gunter Schneider, Ylva Lindqvi st et al. ,
  • High molecular weight acid phosphatase is present in human lysosomes, prostate, breast and liver tissues.
  • the study found that a member of a family of high molecular weight acid phosphatases whose catalytic activity is completed through the participation of affinity histidine, so it is also called the histidine phosphatase family [Ki rill Os tanin, Et ti H Harms et a l., 1992, J. Bi ol. Chem.,
  • Acid phosphatase is optimal under low pH (ie, acidic environment) conditions.
  • the first histidine is present at the N-terminus of the protein, which is an affinity receptor for the phosphate group in the organism, forming a phosphorylation center region, which is responsible for transporting the phosphate group; and the second histidine is present in the protein C-terminus, which acts as a donor of protons in the body.
  • Consistency sequence 1 [LIVM] -X (2)-[LIV A] -X (2)-[LIV] -XRH- [GN] -XRX- [PAS]; Consistency sequence 2: [LIVMF] -X -[LIVMFAG] -X (2)-[STAGI] -HD- [STANQ] -X-[LIVM] — X
  • the acid phosphatase family protein 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes Identification of the acid phosphatase family protein 11 protein, especially the amino acid sequence of this protein. Isolation of the gene encoding the neo-acid phosphatase 11 protein also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an acid phosphatase family protein 11.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding an acid phosphatase family protein 11.
  • Another object of the present invention is to provide a method for producing acid phosphatase family protein 11.
  • Another object of the present invention is to provide an antibody against the polypeptide-acid phosphatase family protein 11 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, the acid phosphatase family protein ⁇ .
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the acid phosphatase family protein 11.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 521-317 in SEQ ID NO: 1; and (b) a sequence having 1-3809 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the acid phosphatase family protein 11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of the acid phosphatase family protein 11 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of acid phosphatase family protein 11.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with acid phosphatase family protein 11, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the acid phosphatase family protein 11.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of acid phosphatase family protein 11 when combined with acid phosphatase family protein 11.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind acid phosphatase family protein 11.
  • “Regulation” refers to a change in the function of acid phosphatase family protein 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of acid phosphatase family protein 11.
  • Substantially pure means substantially free of other proteins, lipids ( sugars, sugars, or other substances with which it is naturally associated.
  • lipids sugars, sugars, or other substances with which it is naturally associated.
  • Pure acid phosphatase family protein 11 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of the acid phosphatase family protein 11 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a completely complementary sequence to a target nucleic acid. Pay. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244).
  • the Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The standby clusters are then allocated in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by Clus ter method or using methods known in the art such as Jot m Hein (He in J., (1990) Methods in emzurao logy 183: 625 —645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the antigenic determinant of acid phosphatase family protein 11.
  • Humanized antibody means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated acid phosphatase family protein 11 means that acid phosphatase family protein 11 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify the acid phosphatase family protein 11 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the acid phosphatase family protein 11 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, an acid phosphatase family protein 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the acid phosphatase family protein 11.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the acid phosphatase family protein 11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protease sequence)
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 3809 bases, and its open reading frames 521-817 encode 98 amino acids.
  • this peptide has a similar expression profile to the acid phosphatase family protein, and it can be deduced that the acid phosphatase family protein 11 has a similar function to the acid phosphatase family protein.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (there are at least 503 ⁇ 4, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) L ⁇ Hybridization with a denaturing agent, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1. /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding acid phosphatase family protein 11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the acid phosphatase family protein II of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecura ar Cloning, A Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RM hybridization; (2) the presence or absence of marker gene function; (3) determination of the level of acid phosphatase family protein 11 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2,000 nucleotides, and preferably within 1,000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • a protein product for detecting the expression of the acid phosphatase family protein 11 gene is available Immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Amplification of DNA / RNA by PCR (Saiki, et al. Science
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the acid phosphatase family protein 11 coding sequence, and a recombinant technology to produce the polypeptide of the present invention method.
  • the polynucleotide sequence encoding the acid phosphatase family protein 11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • An expression vector for the DNA sequence and appropriate transcriptional / translational regulatory elements include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: E.
  • coli lac or trp promoter Lambda phage PL promoter
  • eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoters , Retrovirus LTRs and other known controllable genes in prokaryotic cells Or a promoter expressed in a eukaryotic cell or its virus.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
  • Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding the acid phosphatase family protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method.
  • the steps used are well known in the art.
  • the alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant acid phosphatase family protein 11 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
  • the appropriate promoter such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • Fig. 1 is a comparison diagram of gene chip expression profiles of acid phosphatase family protein 11 and acid phosphatase family protein of the present invention.
  • the upper graph is a graph of the expression profile of the acid phosphatase family protein 11, and the lower graph is the graph of the expression profile of the acid phosphatase family protein 11.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated acid phosphatase family protein 11.
  • llkDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0311c07 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the results show that the full-length cDNA contained in the 0311c07 clone is 3809bp (as shown in Seq ID N0: 1), and has a 297bp open reading frame (0RF) from 521bp to 817bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0311c07 and named the encoded protein as acid phosphatase family protein 11.
  • Example 2 Cloning of a gene encoding acid phosphatase family protein 11 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- GTAGGCATTGACTTGGAGGCAAAA -3 '(SEQ ID NO: 3)
  • Pr imer 2 5'- TCTGGGAGGCAGAGGTTGCAGTGA -3 '(SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l KC1, 10 mmol / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L in 50 ⁇ 1 reaction volume dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 3809bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of acid phosphatase family protein 11 gene expression:
  • RNA extraction in one step [Ana l. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • RNA 20 ⁇ ⁇ RNA was applied on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde Line electrophoresis. It was then transferred to a nitrocellulose membrane. Preparation 32 P- DNA probe labeled with a- 32 P dATP by random priming method. The DNA probe used was the PCR-amplified acid phosphatase family protein 11 coding region sequence (521bp to 817bp) shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ral) and a nitrocellulose membrane to which RNA was transferred were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4)-5xSSC-5xDenhardt, s solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant acid phosphatase family protein 11
  • Primer3 5 '-CATGCTAGCATGATGCACTTTCTCATCATTAAG-3' (Seq ID No: 5)
  • Primer4 5'-CATGGATCCTCACTTGAGGCCAGGAGTTTGAGA-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively.
  • the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0311c07 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0311c07 plasmid, primers Primer-3 and Primer-3 in a total volume of 50 ⁇ 1, and 1 J was 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced.
  • the correct positive clone (pET-0311c07) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 1 ⁇ 2 g of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • DNA phenol extraction method Steps: 1) Wash cells with 1-1 10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 8 cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 7 cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight.
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of pre-hybridization solution (10 x Denhardt's; 6 x SSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After the bag was sealed, 68. C. Water shake for 2 hours.
  • pre-hybridization solution 10 x Denhardt's; 6 x SSC, 0.1 mg / ml CT DM (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance from the point is 280 ⁇ ! ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'- tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargy 1 -2'- deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'- tr iphate
  • Solut ion (purchased from TeleChem) was used for hybridization for 16 hours, and then washed with a washing solution (lx SSC, 0.2% SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). Images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, and PMA +
  • Ecv304 cell line LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer construct
  • Cell EJ bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardiac cancer.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases. .
  • Acid phosphatase catalyzes the hydrolysis of phosphate monoesters in the body; under some conditions, it also catalyzes Phosphoryl transfer between phosphate and ethanol.
  • the histidine phosphatase family is a family of high molecular weight acid phosphatases that are found in human lysosomes, prostate, breast and liver tissues. It plays an important role in lipid metabolism, cell membrane stability, and normal function of neuronal cells.
  • Histidine phosphatase-specific conserved sequences are required to form its active mot if. It can be seen that the abnormal expression of the specific histidine phosphatase mot if will cause the abnormal function of the polypeptide containing the mot if of the present invention, which may lead to abnormalities in lipid metabolism, cell membrane stability, and neuronal cell function. And produce related diseases such as diseases related to lipid metabolism disorders, organic acidemia, nervous system diseases and so on.
  • the abnormal expression of the acid phosphatase family protein 11 of the present invention will produce various diseases, especially diseases related to lipid metabolism disorders, organic acidemia, and nervous system diseases. These diseases include, but are not limited to:
  • Fatty deposition diseases fatty liver, steatosis cardiomyopathy, steatosis nephropathy
  • Cardiovascular diseases Coronary atherosclerotic heart disease such as occult heart disease, angina pectoris, myocardial infarction, dying coronary heart disease, hypertension
  • Steroid derivatives such as bile acids, sex hormones
  • Metabolic disorders (1) Bile acid metabolic disorders such as biliary cirrhosis, cholelithiasis (2) Sexual development disorders during growth and development: Precocious puberty, delayed sexual development Sexual differentiation disorder, other defects of external genital development (3) Endocrine and metabolic syndrome: Adrenal hyperfunction disease such as Cushing syndrome, aldosteronism, Adrenal insufficiency disease such as acute adrenal insufficiency, chronic adrenal function Hypoxia
  • lipoma lipoblastoma, liposarcoma, breast cancer
  • endometrioma organic acidemia propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency Glutaric acid type I
  • Nervous System Diseases Glioblastoma, Neurofibromatosis, Acute Myelitis, Spinal Compression, Trigeminal Neuralgia, Facial Paralysis, Rostral Paralysis, Sciatica, Multiple Sclerosis, Intracranial Granuloma, Parkinson's Disease, Chorea Depression, Amnesia, Huntington's disease, Epilepsy, Migraine, Dementia, Multiple sclerosis, Myasthenia gravis, Spinal muscular atrophy, Myasthenia, Myotonic dystrophy, Bradykinesia, Muscle Dystonia, neurofibromatosis, tuberous sclerosis, trigeminal neurohemangioma, ataxia capillary vasodilation, schizophrenia, depression, obsessive-compulsive disorder, phobia, neurodegeneration, Guillain-Barre syndrome Disease
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) acid phosphatase family protein 11.
  • Agonists enhance biological functions such as acid phosphatase family protein 11 to stimulate cell proliferation, and antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membranes expressing acid phosphatase family protein 11 can be expressed in the presence of drugs The formulation was cultured with labeled acid phosphatase family protein 11. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the acid phosphatase family protein 11 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of the acid phosphatase family protein 11 can bind to the acid phosphatase family protein 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
  • acid phosphatase family protein 11 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between acid phosphatase family protein 11 and its receptor. .
  • Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to the acid phosphatase family protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 11 molecules of the acid phosphatase family protein should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the acid phosphatase family protein 11 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries. .
  • Polyclonal antibodies can be produced by injecting acid phosphatase family protein 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • Various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant Wait.
  • Techniques for preparing monoclonal antibodies against acid phosphatase family protein 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta cell hybridoma technology, EBV-hybridoma technology, etc.
  • the chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son et al, PNAS , 1985, 81: 6851) 0 Only some technical production of single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against acid phosphatase family protein 11.
  • Antibodies against acid phosphatase family protein 11 can be used in immunohistochemistry to detect acid phosphatase family protein 11 in biopsy specimens.
  • Monoclonal antibodies that bind to acid phosphatase family protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • high-affinity monoclonal antibodies of acid phosphatase family protein 11 can interact with bacterial or plant toxins (such as diphtheria toxin, ricin, Ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill acid phosphatase family protein 11-positive cells .
  • the antibodies of the present invention can be used to treat or prevent diseases related to the acid phosphatase family protein 11.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of acid phosphatase family protein 11.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of acid phosphatase family protein 11.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of acid phosphatase family protein 11 detected in the test can be used to explain the importance of acid phosphatase family protein 11 in various diseases and to diagnose diseases in which acid phosphatase family protein 11 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding acid phosphatase family protein 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of acid phosphatase family protein 11.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated acid phosphatase family protein 11 to inhibit endogenous acid phosphatase family protein n activity.
  • a mutated acid phosphatase family protein 11 may be a shortened acid phosphatase family protein 11 that lacks a signal transduction domain. Although it can bind to downstream substrates, it lacks signal transduction activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of acid phosphatase family protein 11.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer the polynucleotide encoding the acid phosphatase family protein 11 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding the acid phosphatase family protein 11 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding the acid phosphatase family protein 11 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit the acid phosphatase family protein 11 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific RN A. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be encoded by The DNA sequence of the RNA is obtained by transcription in vitro or in vivo. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding the acid phosphatase family protein 11 can be used for the diagnosis of diseases related to the acid phosphatase family protein 11.
  • the polynucleotide encoding the acid phosphatase family protein 11 can be used to detect the expression of the acid phosphatase family protein 11 or the abnormal expression of the acid phosphatase family protein 11 in a disease state.
  • the DM sequence encoding acid phosphatase family protein 11 can be used to hybridize biopsy specimens to determine the expression status of acid phosphatase family protein 11. Hybridization techniques include Southern blotting,
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes in a tissue and genetic diagnosis.
  • Acid phosphatase family protein 11 specific primers can also be used to detect the transcription product of acid phosphatase family protein 11 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • Acid phosphatase family protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type acid phosphatase family protein 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of eggs. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • Somatic hybrid cells' PCR localization method is a quick way to locate DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian
  • cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping techniques, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping Resolving power and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Acid phosphatase family protein 11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dosage range of acid phosphatase family protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine 11 de la famille des acide phosphatases, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la protéine 11 de la famille des acide phosphatases.
PCT/CN2001/001011 2000-06-21 2001-06-19 Nouveau polypeptide, proteine 11 de la famille des acide phosphatases, et polynucleotide codant ce polypeptide WO2002020579A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001295395A AU2001295395A1 (en) 2000-06-21 2001-06-19 A novel polypeptide-homo acid phosphatase family protein 11 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116667 CN1329020A (zh) 2000-06-21 2000-06-21 一种新的多肽——酸性磷酸酶家族蛋白11和编码这种多肽的多核苷酸
CN00116667.0 2000-06-21

Publications (1)

Publication Number Publication Date
WO2002020579A1 true WO2002020579A1 (fr) 2002-03-14

Family

ID=4586069

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001011 WO2002020579A1 (fr) 2000-06-21 2001-06-19 Nouveau polypeptide, proteine 11 de la famille des acide phosphatases, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1329020A (fr)
AU (1) AU2001295395A1 (fr)
WO (1) WO2002020579A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1062169A (zh) * 1990-12-14 1992-06-24 菲利浦石油公司 巴斯德毕赤酵母酸性磷酸酶基因
CN1091469A (zh) * 1992-10-06 1994-08-31 马克斯普朗克科学促进协会 Ptp 1d：一种新蛋白质酪氨酸磷酸
US5716806A (en) * 1995-06-05 1998-02-10 Human Genome Sciences, Inc. Human inositiol monophosphatase H1 polynucleotides
US5853997A (en) * 1997-06-11 1998-12-29 Incyte Pharmaceuticals, Inc. Human protein phosphatase
WO1999014340A1 (fr) * 1997-09-19 1999-03-25 Incyte Pharmaceuticals, Inc. Phosphatase prl-1 humaine

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1062169A (zh) * 1990-12-14 1992-06-24 菲利浦石油公司 巴斯德毕赤酵母酸性磷酸酶基因
CN1091469A (zh) * 1992-10-06 1994-08-31 马克斯普朗克科学促进协会 Ptp 1d：一种新蛋白质酪氨酸磷酸
US5716806A (en) * 1995-06-05 1998-02-10 Human Genome Sciences, Inc. Human inositiol monophosphatase H1 polynucleotides
US5853997A (en) * 1997-06-11 1998-12-29 Incyte Pharmaceuticals, Inc. Human protein phosphatase
WO1999014340A1 (fr) * 1997-09-19 1999-03-25 Incyte Pharmaceuticals, Inc. Phosphatase prl-1 humaine

Also Published As

Publication number Publication date
CN1329020A (zh) 2002-01-02
AU2001295395A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
WO2002020579A1 (fr) Nouveau polypeptide, proteine 11 de la famille des acide phosphatases, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001092326A1 (fr) Nouveau polypeptide, phosphatase acide 13, et polynucleotide codant ce polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001072791A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant pour ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2002048356A1 (fr) Nouveau polypeptide, proteine humaine formee de cytochromes 45, et polynucleotide codant ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001090348A1 (fr) Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide
WO2001092287A1 (fr) Nouveau polypeptide, phosphatase acide 14, et polynucleotide codant ce polypeptide
WO2002020575A1 (fr) Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide
WO2001075059A2 (fr) Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide
WO2001075020A2 (fr) Nouveau polypeptide, neuroproteine humaine y 11, et polynucleotide codant pour ce polypeptide
WO2002020775A1 (fr) Nouveau polypeptide, proteine kinase cycline-dependante cdk411, et polynucleotide codant ce polypeptide
WO2001070983A1 (fr) Nouveau polypeptide, proteine antigene prostatique specifique membranaire 9, et polynucleotide codant pour ce polypeptide
WO2002011511A1 (fr) Nouveau polypeptide, modulateur negatif 11.66 de la proteine d'activation de la gtpase, et polynucleotide codant ce polypeptide
WO2002020581A1 (fr) Nouveau polypeptide, proteine 11.33 associee a l'arn polymerase ii, et polynucleotide codant ce polypeptide
WO2001073041A1 (fr) Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide
WO2002020590A1 (fr) Nouveau polypeptide, sucre phosphotransferase phosphoenolpyruvate-dependante 33, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide
WO2001055400A1 (fr) Nouveau polypeptide, site 90 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide
WO2001070789A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s5-17, et polynucleotide codant pour ce polypeptide
WO2002020798A1 (fr) Nouveau polypeptide, deshydrogenase humaine 56, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP