WO2001098320A1 - Nouveau polypeptide, proteine kinase humaine 9 liee a p34cdc2, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine kinase humaine 9 liee a p34cdc2, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001098320A1 WO2001098320A1 PCT/CN2001/000772 CN0100772W WO0198320A1 WO 2001098320 A1 WO2001098320 A1 WO 2001098320A1 CN 0100772 W CN0100772 W CN 0100772W WO 0198320 A1 WO0198320 A1 WO 0198320A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein kinase
- human
- related protein
- p34cdc2
- hybridization
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, " ⁇ P34cdc2 related protein kinase 9, and a polynucleotide sequence encoding the polypeptide. The present invention also relates to the polynucleotide and the polypeptide Preparation method and application.Technical background
- protein kinases One of the largest known protein superfamilies identified from eukaryotes consists of protein kinases. The members of this family all have a conserved catalytic core. The conserved catalytic cores of protein serine / threonine kinases and protein tyrosine kinases are the same. . These enzymes use the Y-phosphate of ATP (or GTP) to generate phosphate monoesters, and use the ethanol groups of proteins (on serine and threonine) and / or the phenol groups of protein (on tyrosine) as phosphates. Receptor.
- This superfamily can be divided into two main sub-categories: protein serine / threonine kinases and protein tyrosine kinases.
- kinases and phosphatases play important roles in cell regulation.
- Members of the protein kinase family regulate the activity of a variety of proteins, including kinases, phosphatases, transcription factors, cyclins, metabolic enzymes, and structural proteins.
- the cell cycle is at least partially regulated by a family of protein kinases called cyclin-dependent kinases (CDKS).
- CDKS cyclin-dependent kinases
- Cyclin / cyclin-dependent kinase complexes are required at different points in the cell cycle.
- cyclin-dependent kinases regulate or mutate.
- p34cdc2 protein kinase regulates important transitions in the cell cycle.
- a variety of p34cdc2 protein kinase-related proteins have been found in humans, and they have a high degree of homology with p34cdc2 in structure. Among them, the protein products of the cdk3 gene, cdc2 and cdk2 gene act on mammalian cell cycle regulation.
- the large family of Cdc2-related kinases and the large family of cyclins co-regulate the cell cycle (van der Heuve l, S. and Har low, E., Science 1993, 262, 2050-2054) 0
- PCTAIRE-2 is a cyclin-dependent kinase and a protein serine / threonine kinase because it contains an N-terminal extension domain associated with the p34cdc2 protein kinase, also known as p34cdc2-related protein kinase.
- PCTAIRE-2 is associated with many cell proliferation diseases such as psoriasis, vascular disease and cancer (Meyer son M, Enders GH, Wu CL, Su LK, Gorka C, Ne l son C, Har low E, Tsa i LH, EMB0 J 1992 Aug; 11 (8): 2909-17).
- the human p 34cdc2-related protein kinase 9 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these The process of identifying the human p 34cdc2-associated protein kinase 9 protein, particularly the amino acid sequence of this protein. Isolation of the newcomer P 34cdc2-associated protein kinase 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolation of its coding DNA is important. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human P34cdc2-related protein kinase 9.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human P34cdc2 related protein kinase 9.
- Another object of the present invention is to provide a method for producing human P 34cdc2-related protein kinase 9.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human P 34cdc2-related protein kinase 9.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed against the human polypeptide P 34cdc2-related protein kinase 9 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human p34cd C 2 -associated protein kinase 9.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the 'polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1444-1704 in SEQ ID NO: 1; and (b) a sequence having 1-2593 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human P34cdc2 related protein kinase 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human p34cdc2-related protein kinase 9 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of psoriasis, vascular disease, various tumors, developmental disorders, inflammation, immune diseases, HIV infection or other expressions due to human p34cdc2-related protein kinase 9. Use of medicines for diseases caused by abnormalities.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor's P34cdc2 related protein kinase 9 and human p34cdc2 related protein kinase.
- the upper graph is a graph of the expression profile of human p34cd C 2 -related protein kinase 9
- the lower graph is the graph of the expression profile of human p34cdc2 -related protein kinase 9.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +,
- 11 means fetal liver
- 12 means normal liver
- 1 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 means prostate
- 21 means fetal heart
- 22 means heart
- 23 means muscle
- 24 means testis
- 25 means fetal thymus
- 26 means thymus.
- Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human p34cdc2-related protein kinase 9.
- 9KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human p34cdc2-associated protein kinase 9, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human p34cdc2-related protein kinase 9.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human p34cdc2-related protein kinase 9 when combined with human p34cdc2-related protein kinase 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human P34cdc2-related protein kinase 9.
- Regular refers to a change in the function of human p34cdc2-related protein kinase 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human p34cdc2-related protein kinase 9.
- “Substantially pure '” means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human p34cdc2-related protein kinase 9 using standard protein purification techniques. Basically Pure human p34cdc2 related protein kinase 9 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human p34cdc2 related protein kinase 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 Clus ter method checks all The distances arrange the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues that match between sequences
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and? ⁇ It can specifically bind to the epitope of human p34cdc2-related protein kinase 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human p34cdc2 related protein kinase 9 refers to human p34cdc2 related protein kinase 9 which is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human p34cdc2-related protein kinase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of the amin protein 9 can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human p34cdc2 related protein kinase 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human p34cdc2-related protein kinase 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human p34cdc2-related protein kinase 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conserved or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2593 bases, and its open reading frames 1444-1704 encode 86 amino acids.
- this polypeptide has a similar expression profile to human p34cdc2 related protein kinase, and it can be deduced that the human p34cdc2 related protein kinase 9 has similar functions as human p34cdc2 related protein kinase.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA or artificially synthesized DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- "degenerate variant" in the present invention refers to a coding region that encodes a protein or polypeptide having SEQ ID NO: 2 but is identical to the coding region shown in SEQ ID NO: 1 Sequences with different nucleic acid sequences.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1% Fi col 1, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human p34cdc2-related protein kinase 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human P34cdc2-related protein kinase 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used.
- Direct chemical synthesis of DNA sequences is the least commonly used.
- the more commonly used method is the separation of the CDM sequences.
- the standard method for isolating a CDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been developed for raRM extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; G) determining the level of human p34cdc2-associated protein kinase 9 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of human p34cdc2 related protein kinase 9 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method for amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequences of multiple clones in order to splice into full-length cDM sequences.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector or a direct use of the vector of the present invention.
- a polynucleotide sequence encoding human p34cdc2 related protein kinase 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human p34cdc2-related protein kinase 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, naval synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for MA expression, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- the recombinant vector can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CHO, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with CaCl.
- the steps used are well known in the art.
- MgCl 2 is used.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human p34cdc2-related protein kinase 9 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- PCTAIRE-2 is a cyclin-dependent kinase and a protein serine / threonine kinase because it contains an N-terminal extension domain associated with the p34cdc2 protein kinase, also known as p34cdc2-related protein kinase.
- PCTAIRE-2 is involved in many cell proliferative diseases, such as psoriasis, vascular disease, and cancer.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human p34cdc2 related protein kinase, and both have similar biological functions.
- the polypeptide of the present invention mainly regulates the cell cycle in vivo and involves cell proliferation and division. Its abnormal expression is usually closely related to the occurrence of tumors, embryonic developmental disorders, growth and development disorders, inflammation, and immune diseases, and to produce related diseases, especially psoriasis and vascular disease.
- the abnormal expression of the human p34cdc2-related protein kinase 9 of the present invention will produce various diseases, especially psoriasis, vascular disease, various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases.
- Illnesses include, but are not limited to:
- Vascular Diseases Arteriosclerosis, Coronary Heart Disease, Hypertension, Heart Valve Disease
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, astrocytoma, ependymoma, glioblastoma, neurofibromas, colon Cancer, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome Abnormal expression of the human p34cdc2-associated protein kinase 9 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially psoriasis, vascular disease, various tumors, embryonic developmental disorders, growth and development disorders. Diseases, inflammation, immune diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human p34cdc2-related protein kinase 9.
- Agonists enhance biological functions such as human p34cdc2-related protein kinase 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human p34cdc2-related protein kinase 9 can be cultured with labeled human p34cdc2-related protein kinase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of human p34cdc2-associated protein kinase 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human P34cdc2-related protein kinase 9 can bind to human p34cdc2-related protein kinase 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human P34cdc2-related protein kinase 9 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human p34cdc2-related protein kinase 9 and its receptor. .
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human p34cdc2-related protein kinase 9 can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. When screening, human P34cdc2-associated protein kinase 9 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human p34cdc2 related protein kinase 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human P34cdc2-related protein kinase 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to human P34cdc2-related protein kinase 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851).
- the existing technology for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human p34cdc2-related protein kinase 9.
- Antibodies against human p 34cdc2-related protein kinase 9 can be used in immunohistochemistry to detect human p 34cdc2-related protein kinase 9 in biopsy specimens.
- Monoclonal antibodies that bind to human p 34cdc2-related protein kinase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human p34cdc2-related protein kinase 9 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange.
- This hybrid antibody can be used to kill human p34cdc2-related protein kinase 9 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human p34cdc2-related protein kinase 9.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human p34cdc2-related protein kinase 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human p34cdc2-related protein kinase 9 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the levels of human p34cdc2-associated protein kinase 9 detected in the test can be used to explain the importance of human p34cdc2-associated protein kinase 9 in various diseases and to diagnose diseases in which human p34cdc2-associated protein kinase 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human p 34cdc2-related protein kinase 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human P 34cdc2-related protein kinase 9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human p 34cdc2 related protein kinase 9 to inhibit endogenous human p 34 cdc2 related protein kinase 9 activity.
- a variant human p34cdc2-associated protein kinase 9 may be a shortened human p34cdc2-associated protein kinase 9 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human p34cdc2-related protein kinase 9.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode human
- the p34cdc2-associated protein kinase 9 polynucleotide is transferred into the cell.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human p34cdc2-related protein kinase 9 can be found in existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human p34cdc2-related protein kinase 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human p34cdc2-related protein kinase 9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human P34 C2 related protein kinase 9 can be used for diagnosis of diseases related to human p34cdc2 related protein kinase 9.
- Polynucleotides encoding human P 34cdc2 related protein kinase 9 can be used to detect the expression of human p34cdc2 related protein kinase 9 or abnormal expression of human p34cdc2 related protein kinase 9 under disease conditions.
- a DNA sequence encoding human p34cdc2 related protein kinase 9 can be used to hybridize biopsy specimens to determine the expression of human p34cdc2 related protein kinase 9.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human p34 C dc2-related protein kinase 9 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human P 34cdc2-related protein kinase 9 transcription products.
- Human p34cdc2-associated protein kinase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human p34cdc2-associated protein kinase 9 DM sequences. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so use Nor thern printing
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition contains a safe and effective amount of the polypeptide or antagonist and does not affect Pharmaceutically effective carriers and excipients. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human p34cdc2-associated protein kinase 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human p34cdc2-related protein kinase 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech ⁇ cDNA fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ to form a cDNA library.
- Dye terminate cycle react ion sequencing ki t Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined CDM sequences were compared with the existing public DNA sequence database (Genebank). By comparison, it was found that the cDNA sequence of one of the clones 0478C08 was new DNA.
- a series of primers were synthesized to determine the inserted CDM fragment of the clone in both directions.
- Example 2 The gene encoding human p34cdc2 related protein kinase 9 was cloned by RT-PCR method. The total RNA of fetal brain cells was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA. After purification using Qiagene's kit, The following primers are used for PCR amplification:
- Primer 1 5,-GGTAAACCCCATCATACTAGCTGTGG -3, (SEQ ID NO: 3)
- Pr imer2 5'- AGGAAACAATATCAAATGCAATTT -3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence starting at the lbp at the 5 'end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was identical to the 1-2593bp shown in SEQ ID NO: 1.
- Example 3 Analysis of human p34cdc2-related protein kinase 9 gene expression by Northern blotting. Total MA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
- the tissue is homogenized with 4M guanidinium isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) and RM-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contained 50% amidoamide-25 mM KH 2 PO 4 (pH 7.4)-5 x SSC-5 x Denhardt, s solution and 200 ⁇ l 1 salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0. 1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human p34cdc2-related protein kinase 9 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
- Primer3 5,-CATGGATCCATGGAAAAATTGGGCTCCGCAAAC -3, (Seq ID No: 5)
- Primer4 5'- CCCCTCGAGTTACGGGGGTCCCACTTTTGTGAT —V (Seq ID No: 6)
- the 5 'ends of these two primers contain BamHI and Xhol restriction sites, respectively, which The latter are the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the 3 ⁇ 4mHI and Xhol restriction sites correspond to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
- the PCR reaction was performed using the pBS-0478c08 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0478c08 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. BamHI and Xhol were used to double digest the amplified product and plasmid pBT-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- Ligation products were transformed by the calcium chloride method Escherichia coli DH5a bacteria, after (final concentration of 30 ⁇ ⁇ / ⁇ 1) grown overnight in LB plates containing kanamycin, positive clones were screened by colony PCR method, and sequenced. A positive clone (pET-0478c08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration of 30 ⁇ ⁇ / ⁇ 1) in LB liquid medium, host strain BL21 (P ET-0478c08) at 37. C.
- NH2-Met-Glu-Lys-Leu-Gly-Ser-Ala-Asn-Ser-Ala-Tyr-Trp-Leu-Ser-Gln-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sephar 0S e4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody can specifically stimulate the human p34cdc2-related protein.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU15487/02A AU1548702A (en) | 2000-05-16 | 2001-05-14 | A novel peptide-human P34CDC2 related protein kinase 9 and the polynucleotide coding this novel peptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115708 CN1323894A (zh) | 2000-05-16 | 2000-05-16 | 一种新的多肽——人p34cdc2相关蛋白激酶9和编码这种多肽的多核苷酸 |
CN00115708.6 | 2000-05-16 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001098320A1 true WO2001098320A1 (fr) | 2001-12-27 |
Family
ID=4585152
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000772 WO2001098320A1 (fr) | 2000-05-16 | 2001-05-14 | Nouveau polypeptide, proteine kinase humaine 9 liee a p34cdc2, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1323894A (fr) |
AU (1) | AU1548702A (fr) |
WO (1) | WO2001098320A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0666270A2 (fr) * | 1994-02-08 | 1995-08-09 | Bristol-Myers Squibb Company | Inhibiteurs peptidiques des kinases régulatrices du cycle cellulaire p33cdk2 et p34cdc2 et de l'oncoprotéine du papillomavirus E7 humain |
-
2000
- 2000-05-16 CN CN 00115708 patent/CN1323894A/zh active Pending
-
2001
- 2001-05-14 WO PCT/CN2001/000772 patent/WO2001098320A1/fr active Application Filing
- 2001-05-14 AU AU15487/02A patent/AU1548702A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0666270A2 (fr) * | 1994-02-08 | 1995-08-09 | Bristol-Myers Squibb Company | Inhibiteurs peptidiques des kinases régulatrices du cycle cellulaire p33cdk2 et p34cdc2 et de l'oncoprotéine du papillomavirus E7 humain |
Non-Patent Citations (1)
Title |
---|
DATABASE GENBANK [online] 10 January 2000 (2000-01-10), LOFTUS B.J. ET AL., retrieved from GI:2339958 accession no. NCBI Database accession no. U91324.1 * |
Also Published As
Publication number | Publication date |
---|---|
AU1548702A (en) | 2002-01-02 |
CN1323894A (zh) | 2001-11-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001098320A1 (fr) | Nouveau polypeptide, proteine kinase humaine 9 liee a p34cdc2, et polynucleotide codant ce polypeptide | |
WO2001088112A1 (fr) | Nouveau polypeptide, kinase d'adhesion focale humaine (fak) 13, et polynucleotide codant pour ce polypeptide | |
WO2001081382A1 (fr) | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001087972A1 (fr) | Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001075059A2 (fr) | Nouveau polypeptide, proteine humaine 11 de regulation de gtp, et polynucleotide codant pour ce polypeptide | |
WO2001088147A1 (fr) | Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant | |
WO2001070960A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001064917A1 (fr) | Nouveau polypeptide, proteine kinase humaine de transduction de signal 11, et polynucleotide codant pour ce polypeptide | |
WO2001092540A1 (fr) | Nouveau polypeptide, facteur humain stat2 11, et polynucleotide codant ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001048160A1 (fr) | Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide | |
WO2001081536A2 (fr) | Nouveau polypeptide, proteine kinase ysk1 humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2002020775A1 (fr) | Nouveau polypeptide, proteine kinase cycline-dependante cdk411, et polynucleotide codant ce polypeptide | |
WO2001075029A2 (fr) | Nouveau polypeptide, facteur humain 11 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001075013A2 (fr) | Nouveau polypeptide, kinase humaine cycline-dependante 14, et polynucleotide codant pour ce polypeptide | |
WO2001094595A1 (fr) | Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide | |
WO2001075014A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase 35 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide | |
WO2001064868A1 (fr) | Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide | |
WO2001072979A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 15, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |