WO2001094595A1 - Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2001094595A1 WO2001094595A1 PCT/CN2001/000726 CN0100726W WO0194595A1 WO 2001094595 A1 WO2001094595 A1 WO 2001094595A1 CN 0100726 W CN0100726 W CN 0100726W WO 0194595 A1 WO0194595 A1 WO 0194595A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- binding protein
- octamer binding
- human
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ octamer binding protein 15 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- the P0U domain (Pi t, Oct, Unc doma in) is considered to be a regulatory factor for differentiation and development, which regulates cell division, differentiation, specialization, and the survival of several cells, especially in the early stages of embryonic development and nerves.
- the largest role in formation [L Cl in. Inves t. Volume 101, Number 6, March 1998,
- the POU domain has a highly conserved two-way 150-160 amino acid sequence, including a POU-specific domain, a short variable binding region, and a 60 amino acid POU-like domain [J. Cl in. Inves t. Volume 101, Number 6, March 1998, 1292- 1299].
- Oct-6 is a POU domain-containing protein that specifically binds to the canonical octamer structure.
- Oct-6 is expressed in cultured epidermal keratinocytes, and also in other layered multi-scale epithelial cells, and the expression level is higher than in the testis in which the protein was first found.
- Oct-6 showed significant and specific negative regulation of K5 and K14 gene expression. (K5 and K14 gene divisions are abundant in stratified keratinocytes and show a decreasing trend when cells begin to differentiate.)
- Oct-6 protein lacking the P0U domain does not exhibit this regulatory function.
- Oct-6 may play an important role in regulating the expression of stratified keratinized epithelial cells [Mol Cel l Biol 1994 May; 14 (5): 3263-751.
- Oct-6 also affects the development of the nervous system, especially the development and differentiation of Schwann cells that surround the axons of peripheral nerve fibers.
- Oct-6 is required for promyelinating cells to differentiate into myelinating cells, and Oct-6 is also required in the process of myelin formation and normal negative regulation of its own genes [Microsc Res Tech 1998 Jun 1; 41 (5): 372- 81.
- the Oct-6 mutation can change the phenotype of myelin cells, and severely cause demyelinating neuropathy [Current Opinion in Neurology Vo l. 10, No. 5, October 1997].
- the human octamer binding protein 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these Process the human octamer-binding protein 15 protein, specifically identifying the amino acid sequence of this protein. Isolation of the new human octamer binding protein 15 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human octamer binding protein 15.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human octamer binding protein 15.
- Another object of the present invention is to provide a method for producing human octamer binding protein 15.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human octamer binding protein 15.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human octamer binding protein 15.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human octamer binding protein 15. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from: (a) a sequence having positions 1867-2265 in SEQ ID NO: 1; and (b) a sequence having 1-2686 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human octamer binding protein 15 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human octamer binding protein 15 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of embryonic disorders, growth disorders, neurological diseases, various tumors, inflammation, immune diseases, blood diseases, HIV infection or Use of other drugs for diseases caused by abnormal expression of human octamer binding protein 15.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the octamer-binding protein 15 and Oct-6 protein of the present inventor.
- the upper graph is a graph of the expression profile of human octamer binding protein 15, and the lower graph is the graph of the expression profile of Oct-6 protein.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates unstarved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 represents ECV304 PMA +
- 11 represents fetal liver
- 12 represents normal liver
- 13 represents thyroid
- 14 represents skin
- 15 represents fetal lung
- 16 represents lung
- 17 represents lung cancer
- 18 represents fetal spleen
- 19 represents spleen
- 20 means top Gland
- 21 is the fetal heart
- 22 is the heart
- 23 is the muscle
- 24 is the testis
- 25 is the fetal thymus
- 26 is the thymus.
- Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human octamer binding protein 15. 15KDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human octamer binding protein 15, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human octamer binding protein 15.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human octamer binding protein 15 when bound to human octamer binding protein 15.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other human octamer binding protein W 01 9
- Regular refers to a change in the function of human octamer binding protein 15, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human octamer binding protein 15. change.
- substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
- Those skilled in the art can purify human octamer binding protein 15 using standard protein purification techniques. Basically pure human octamer binding protein 15 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human octamer binding protein 15 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged into clusters. Each cluster is then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as: Totun Hein (Hein L, (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids for conservative substitutions can include Including aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine and isoleucine Acids and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? , It can specifically bind to the epitope of human octamer binding protein 15.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human octamer binding protein 15 means that human octamer binding protein 15 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human octamer binding protein 15 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human octamer binding protein 15 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human octamer binding protein 15, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated , Or can be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human octamer binding protein 15. As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially retains the same biological function or activity of the human octamer binding protein 15 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2686 bases and its open reading frame of 1867-2265 encodes 132 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as Oct-6 protein, and it can be deduced that the human octamer binding protein 15 has similar functions to Oct-6 protein.
- the polynucleotide of the present invention may be in the form of DNA or MA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be days Naturally occurring allelic or non-naturally occurring variants.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturing agents during hybridization, such as 50% (v / v) amidine, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 973 ⁇ 4 or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human octamer binding protein 15.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human octamer-binding protein 15 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDM of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Coll Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but not (Limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the transcript level of human octamer binding protein 15; (4) through immunological techniques Or measure biological activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human octamer binding protein 15 gene.
- ELISA enzyme-linked immunosorbent assay
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human octamer binding protein 15 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
- a polynucleotide sequence encoding the human octamer binding protein 15 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- vectors usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequences encoding human octamer binding protein 15 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
- the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human octamer binding protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, Or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human octamer binding protein 15 (Science, 1984; 224: 1431). Generally, there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HP
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Oc t-6 protein has a POU domain and can specifically bind to the canonical octamer structure.
- the POU domain is considered to be a regulator of differentiation and development, which regulates cell division, differentiation, specialization, and the survival of several cells, especially in the early stages of embryonic development and in the formation of nerves.
- Oc t-6 protein plays an important role in regulating gene expression of layered keratinocytes.
- Oc t-6 also affects the development of the nervous system, especially the development and differentiation of Schwann cells that surround the peripheral nerve fiber axons.
- Oct-6 is required when the promyelin cells are differentiated into myelin cells, and 0c t-6 is also required in the process of myelin formation and normal negative regulation of its genes.
- Oct-6 mutations can change the phenotype of myelin cells, and severely cause demyelinating neuropathy.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human Oct-6 protein, and both have similar biological functions. As a regulator of differentiation and development in vivo, it regulates cell division, differentiation, and specialization. It is of great significance for embryonic development, neural formation, and epithelial cell differentiation. Whose table Dysfunction is usually closely related to embryonic developmental disorders, neurodevelopmental abnormalities, and abnormal epithelial cell differentiation, and causes related diseases.
- the abnormal expression of the human octamer binding protein 15 of the present invention will produce various diseases, especially embryonic disorders, growth disorders, neurological diseases, various tumors, inflammation, and immune diseases. Illnesses include, but are not limited to:
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
- Neurological diseases neural tube insufficiency, brain developmental malformations, neuronal migration disorders, neuroblastomas, astrocytomas, ependymal tumors, glioblastomas, neurofibromas, intracranial granulomas, dementia, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, multiple sclerosis, neuromuscular disease, neurocutaneous syndrome, schizophrenia, depression, trigeminal neuralgia
- Tumors of various tissues endometrial cancer, melanoma, gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, colon cancer, bladder cancer, uterine cancer, thymic tumor
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human octamer binding protein 15 of the present invention may also cause certain hereditary, hematological diseases, and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, growth disorders, neurological diseases, various tumors. , Inflammation, immune diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human octamer binding protein 15.
- Agonists enhance biological functions such as human octamer binding protein 15 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- a mammalian cell or a membrane preparation expressing human octamer binding protein 15 can be cultured together with a labeled human octamer binding protein 15 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human octamer binding protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human octamer binding protein 15 can bind to human octamer binding protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human octamer binding protein 15 can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human octamer binding protein 15 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
- Polypeptide molecules capable of binding to human octamer binding protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 15 molecules of human octamer binding protein should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human octamer binding protein 15 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human octamer binding protein 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human octamer binding protein 15 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Embedding antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the unique technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human octamer binding protein 15.
- Antibodies against human octamer binding protein 15 can be used in immunohistochemical techniques to detect human octamer binding protein 15 in biopsy specimens.
- Monoclonal antibodies that bind to human octamer binding protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis. '
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- Human octamer binding egg White 15 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human octamer binding protein 15 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human octamer binding protein 15.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human octamer binding protein 15.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human octamer binding protein 15 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human octamer binding protein 15 detected in the test can be used to explain the importance of human octamer binding protein 15 in various diseases and to diagnose diseases in which human octamer binding protein 15 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human octamer binding protein 15 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human octamer binding protein 15.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human octamer binding protein 15 to inhibit endogenous human octamer binding protein 15 activity.
- a variant human octamer binding protein 15 may be a shortened human octamer binding protein 15 lacking a signaling functional domain, and although it can bind to a downstream substrate, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human octamer binding protein 15.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human octamer binding protein 15 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human octamer binding protein 15 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human octamer-binding protein 15 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human octamer binding protein 15 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM and DNA and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid phase phosphoryl The technology of oligonucleotide synthesis by amine chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human octamer binding protein 15 can be used for the diagnosis of diseases related to human octamer binding protein 15.
- the polynucleotide encoding human octamer binding protein 15 can be used to detect the expression of human octamer binding protein 15 or the abnormal expression of human octamer binding protein 15 in a disease state.
- the DNA sequence encoding human octamer binding protein 15 can be used to hybridize biopsy specimens to determine the expression of human octamer binding protein 15.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
- Human octamer binding protein 15 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human octamer binding protein 15 transcripts.
- Detection of mutations in the human octamer binding protein 15 gene can also be used to diagnose human octamer binding protein 15-related diseases.
- Human octamer binding protein 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human octamer binding protein 15 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human octamer binding protein 15 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human octamer binding protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Separation Quik mRNA Isolat ion Ki t (Qiegene Co.) RM from the total poly (A) mRNA 0 2ug poly (A) mRNA is formed by reverse transcription cDNA.
- a Smart cDNA cloning kit purchased from Clontech
- the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- cDNA sequence of one of the clones 0389f04 was new DNA.
- a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
- the 0389f04 clone contains a full-length cDNA of 2686bp (as shown in Seq ID NO: 1), and has a 399bp open reading frame (0RF) from 1867bp to 2265bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- This clone P BS-0389f 04 and the encoded protein was named human octamer binding protein 15.
- Example 2 Cloning of a gene encoding human octamer binding protein 15 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed with the following primers:
- Primerl 5,-CAGTTGATGCAACTCAGTAATTTT -3, (SEQ ID NO: 3)
- Primer2 5'- AGGGGGAAACGGGGAACTATAGCA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions containing 50mmol / L KCl in a reaction volume of 50 ⁇ 1, 10mmol / L Tris-HCl pH8 5, 1. 5 face ol / L MgCl 2, 2 ( mol / L dNTP, lOpmol primer. 1U of Taq DNA polymerase (product of Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- Amplification products were purified using a QIAGEN kit and TA The cloning kit was ligated to a pCR vector (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-2686bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human octamer binding protein 15 gene expression
- RNA extraction in one step includes acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium (pH4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 (Volume) and centrifuge the mixture to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA containing 20raM 3- (N-morpholino) propanesulfonic acid (PH7. 0) was electrophoresed on a 1.2% agarose gel -5mM -lmM EDTA-2.2M sodium acetate, formaldehyde and then transferred to a nitrocellulose membrane.
- 32 ⁇ - DNA labeled with a- 32 P dATP by random priming Preparation Method Probe was the PCR-encoded human octamer binding protein 15 coding region sequence (1867bp to 2265bp) shown in Figure 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was used.
- Primer 3 5'- CCCCATATGATGGAATTTAATCCAATCTCATCT -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTTAAGAAGGAATGTGCCAGAGGCC -3, (Seq ID No: 6)
- the two ends of these two primers contain Ndel and BamHI digestion sites, respectively , followeded by the coding sequences of the 5 ,, and 3 'ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET- 2 8b (+) (Novagen, Cat. No. 69865.3). Sex endonuclease site.
- PCR reaction was performed using the pBS-0389f04 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS- 0389f04 containing 10pg, primer Primer-3 and Primer-4, respectively lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag).
- the purified human octamer binding protein 15 was purified. After SDS-PAGE electrophoresis, a single band was obtained at 15 KDa ( Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
- Example 5 Production of anti-human octamer binding protein 15 antibodies
- the following peptides specific for human octamer binding protein 15 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-Glu-Phe-Asn-Pro-I le-Ser-Ser-Arg-Lys-Ala-Ser -His-Leu-Gly-C00H (SEQ ID NO: 7).
- the peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-fixed filter is first applied
- the probe-free hybridization buffer is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30 ° /. -70%, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see the documents DeRis i, JL, Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M. Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
- the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ .
- the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. Its specific method steps There have been many reports in the literature.
- the sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Ki t (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to test fluorescently labeled Cy3dUTP (5-Amino).
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, and non-starved L0 2 cell line , L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU87485/01A AU8748501A (en) | 2000-05-09 | 2001-05-08 | Novel polypeptide- a human octamer binding protein 15 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115641.1 | 2000-05-09 | ||
CN 00115641 CN1322753A (zh) | 2000-05-09 | 2000-05-09 | 一种新的多肽——人八聚体结合蛋白15和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001094595A1 true WO2001094595A1 (fr) | 2001-12-13 |
Family
ID=4585086
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000726 WO2001094595A1 (fr) | 2000-05-09 | 2001-05-08 | Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1322753A (fr) |
AU (1) | AU8748501A (fr) |
WO (1) | WO2001094595A1 (fr) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5484732A (en) * | 1993-03-22 | 1996-01-16 | The Regents Of The University Of California | Transcription factor for regulation of the development of skin and hair |
-
2000
- 2000-05-09 CN CN 00115641 patent/CN1322753A/zh active Pending
-
2001
- 2001-05-08 WO PCT/CN2001/000726 patent/WO2001094595A1/fr active Application Filing
- 2001-05-08 AU AU87485/01A patent/AU8748501A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5484732A (en) * | 1993-03-22 | 1996-01-16 | The Regents Of The University Of California | Transcription factor for regulation of the development of skin and hair |
Also Published As
Publication number | Publication date |
---|---|
CN1322753A (zh) | 2001-11-21 |
AU8748501A (en) | 2001-12-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001083688A2 (fr) | Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001092286A1 (fr) | Nouveau polypeptide, proteine humaine 48 de liaison oct, et polynucleotide codant ce polypeptide | |
WO2001094595A1 (fr) | Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide | |
WO2001087949A1 (fr) | Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2002006471A1 (fr) | Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001083540A1 (fr) | Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (fr) | Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide | |
WO2001085752A1 (fr) | Polynucleotide codant un peptide de myosine | |
WO2001073007A1 (fr) | Nouveau polypeptide, proteine humaine 28 de liaison a un octamere, et polynucleotide codant pour ce polypeptide | |
WO2001088154A1 (fr) | Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide | |
WO2001088151A1 (fr) | Facteur 30 de regulation de transcription de microglobuline, polypeptide humain, et polynucleotide le codant | |
WO2001090377A1 (fr) | Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide | |
WO2001073012A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 36, et polynucleotide codant pour ce polypeptide | |
WO2001083544A1 (fr) | Nouveau polypeptide, proteine pax humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001074887A1 (fr) | Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide | |
WO2001088147A1 (fr) | Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant | |
WO2001072807A1 (fr) | Nouveau polypeptide, neuropeptide humain 11, et polynucleotide codant pour ce polypeptide | |
WO2001083542A1 (fr) | Nouveau polypeptide, proteine humaine p18 21, et polynucleotide codant pour ce polypeptide | |
WO2001077163A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 16, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |