WO2001090377A1 - Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001090377A1
WO2001090377A1 PCT/CN2001/000773 CN0100773W WO0190377A1 WO 2001090377 A1 WO2001090377 A1 WO 2001090377A1 CN 0100773 W CN0100773 W CN 0100773W WO 0190377 A1 WO0190377 A1 WO 0190377A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
tumor suppressor
human von
von hippel
Prior art date
Application number
PCT/CN2001/000773
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU75639/01A priority Critical patent/AU7563901A/en
Publication of WO2001090377A1 publication Critical patent/WO2001090377A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide—human von Hippel-Lindau tumor suppressor factor 14 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • VHL disease is a dominantly inherited family cancer syndrome, which makes diseased individuals susceptible to infection with a variety of tumors. The most common are hemangiomas of the central nervous system and retina, and renal cell carcinoma (RCC ), And pancreatic cancer, adrenal cancer, etc. VHL syndrome is caused by a germline mutation of the VHL tumor suppressor. VHL-associated tumors are highly vascularized (Far ida L. et. Al., Science Vol. 260, 28 May 1993).
  • VHL disease gene is a multiple tumor suppressor gene that causes some cancers including clear cell carcinoma and heman ioblas tomas of the central nervous system. It is associated with VHL syndrome and most kidney cancers.
  • the human VHL gene is located at chromosome 3 P 25- p26.
  • VHL protein negatively regulates the products of hypoxia-inducible factors, such as angiogenic vascular cell growth factor (VEGF), which are present at high levels in VHL tumor cells (Charles ES et. Al., Science Vol 284, 16 Apr il 1999). There is no TATA or CCAAT box in the promoter sequence of the human VHL gene.
  • VEGF angiogenic vascular cell growth factor
  • VHLmRM Transcription is initiated near the SP1 binding site, approximately 60 bp upstream of the first AUG codon in VHLmRM. Several transcription factor binding sites were also found upstream of the transcription start site, notably nuclear respiratory factor 1 and PAX.
  • the non-translated region (3, UTR) has some non-standard UTTAAA) multiple (A) signals. This sequence acts as an active multiple (A) signal in renal cancer cells to generate a 3, untranslated region. (3, UTR), the translation region is rich in Alu repeats.
  • a part of the protein encoded by the VHL gene is homologous to the acidic repeat domain found in the duck bile precirculation surface membrane glycoprotein of trypanosomes. VHL protein activity is mediated by destabilization of hypoxia-regulated mRNA transcripts.
  • VHL protein forms a ternary complex with elonginB and elonginC proteins, and this complex plays a key role in VHL protein function, because the complex is inactive in most tumor-derived mutations.
  • the VHL protein has two regions: the N-terminus is rich in P-sheet domains (P-domains) and smaller ⁇ -helical domains ( ⁇ -domains), most of the surface of the ⁇ -domains and a small part of the P-domains interact with elonginC; the ⁇ -domains
  • the 12-amino acid residue domain containing nearly a quarter of tumor-derived tumor-derived mutations is important for ElonginC. use.
  • This complex binds to Cul2 and then participates in regulating hypoxia-inducible protein levels, such as vascular endothelial cell growth factor.
  • hypoxia-inducible protein levels such as vascular endothelial cell growth factor.
  • Oncogenic mutations usually occur in the 35-residue domain that VHL binds to e longinC.
  • the structure of VHL is similar to the SCF (Skp-Cul lF-box protein) complex that degrades the target protein. Its function follows a similar path.
  • the SCF multiple protein is a ubiquitin-mediated proteolysis that directs many cell cycle regulatory proteins.
  • the human von Hippel-Lindau tumor suppressor 14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human von Hippel-Linau tumor suppressor 14 protein involved in these processes, and in particular the amino acid sequence of this protein was identified.
  • the newcomer von Hippel-Lindau tumor suppressor 14 protein encoding gene isolation also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human von Hippel-Lindau tumor suppressor 14.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human von Hippel-Lindau tumor suppressor 14.
  • Another object of the present invention is to provide a method for producing human von Hippel-Lindau tumor suppressor factor 14.
  • Another object of the present invention is to provide a human von Hippel-Lindau against the polypeptide of the present invention.
  • Antitumor factor 14 antibody is provided.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human von Hippel-Lindau tumor suppressor factor 14.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human von Hippel-Lindau tumor suppressor factor 14. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 484-855 in SEQ ID NO: 1; and (b) a sequence having 1-1671 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human von Hippel-Lindau tumor suppressor 14 protein, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human von Hippel-Lindau tumor suppressor factor 14 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infections, immune diseases and various inflammations or other tumor suppressors due to human von Hippel-Lindau 14 Use of a medicament for a disease caused by abnormal expression.
  • Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.
  • FIG. 1 is a comparison chart of gene chip expression profiles of the inventor von Hippel-Lindau tumor suppressor 14 and human von Hippel-Lindau tumor suppressor.
  • the upper graph is a graph of the expression profile of human von Hippel-Lindau tumor suppressor 14 and the lower graph is the graph of the expression profile of human von Hippel-Lindau tumor suppressor.
  • 1 indicates fetal kidney
  • 2 indicates fetal large intestine
  • 3 indicates fetal small intestine
  • 4 indicates fetal muscle
  • 5 indicates fetal brain
  • 6 indicates fetal bladder
  • 7 indicates non-starved L02
  • 8 indicates L02 +, lhr, As 3+
  • 9 indicates ECV304 PMA-
  • 10 means ECV304 PMA +
  • 11 means fetal liver
  • 12 means normal liver
  • 13 means thyroid
  • 14 means skin
  • 15 means fetal lung
  • 16 means lung
  • 17 means lung cancer
  • 18 means fetal spleen
  • 19 means spleen
  • 20 Indicates prostate
  • 21 indicates fetal heart
  • 22 indicates heart
  • 23 indicates muscle
  • 24 indicates testis
  • 25 indicates fetal thymus
  • 26 indicates thymus.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human von Hippel-Lindau tumor suppressor factor 14.
  • 14KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence means an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to the genome or Synthetic DNA or RM, which can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human von Hippel-Lindau tumor suppressor 14, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human von Hippel-Lindau tumor suppressor factor 14.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human von Hippel-Lindau tumor suppressor 14 when combined with human von Hippel-Lindau tumor suppressor 14.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human von Hippel-Lindau tumor suppressor factor 14.
  • Regular refers to a change in the function of human von Hippel-Lindau tumor suppressor factor 14, including an increase or decrease in protein activity, a change in binding properties, and any other biological properties and functions of human von Hippel-Lindau tumor suppressor factor 14. Or changes in immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human von Hippel-Lindau tumor suppressor factor 14 using standard protein purification techniques.
  • the substantially pure human von Hippel-Lindau tumor suppressor 14 produces a single main band on a non-reducing polyacrylamide gel.
  • the purity of human von Hippel-Lindau tumor suppressor 14 peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab,) 2 and Fv, which can specifically bind to the epitope of human von Hippel-Lindau tumor suppressor factor 14.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, It is also possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human von Hippel-Linau tumor suppressor 14 means that human von Hippel-Lindau tumor suppressor 14 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human von Hippel-Lindau tumor suppressor factor 14 using standard protein purification techniques.
  • Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
  • the purity of human von Hippel-Lindau tumor suppressor 14 polypeptide can be analyzed by amino acid sequence analysis.
  • the present invention provides a new polypeptide, Avon Hippel-Lindau tumor suppressor 14, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human von Hippel-Lindau tumor suppressor factor 14.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human von Hippel-Lindau tumor suppressor 14 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1671 bases, and its open reading frames 484-855 encode 123 amino acids.
  • this polypeptide has a similar expression profile to human von Hippel-Lindau tumor suppressor, and it can be inferred that the human von Hippel-Lindau tumor suppressor 14 is similar to human von Hi ppel-Lindau tumor suppressor.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DM can be coded or non-coded.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (the two sequences have at least 50%, preferably 70% identity).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • stringent conditions means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0. iy. SDS, 60 ° C; or (2) adding a denaturant during hybridization, such as 50 ⁇ / »( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1. /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
  • core Acid fragments
  • Nucleic acid fragments are at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides.
  • Nucleic acid fragments It can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human von Hippel-Lindau tumor suppressor factor 14.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human von Hippel-Lindau tumor suppressor 14 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cMA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • the genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human von H ippel-Lindau tumor suppressor 14 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • detecting human von Hippel-Lindau tumor suppressor 14 gene expression The protein products can be used immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RM is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human von Hippel-Lindau tumor suppressor 14 coding sequence, and the recombinant technology to produce the Polypeptide method.
  • a polynucleotide sequence encoding human von Hippel-Lindau tumor suppressor factor 14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human von Hippel-Lindau tumor suppressor 14 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human von Hippel-Lindau tumor suppressor factor 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human von Hippel-Lindau tumor suppressor 14 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • VHL disease is a dominantly inherited family cancer syndrome that makes diseased individuals susceptible to infection with a variety of tumors, such as central nervous system tumors, retinal hemangioma, renal cell carcinoma, pancreatic cancer, and adrenal cancer Et al., VHL-related tumors are highly vascularized.
  • VHL von Hippel-Linau
  • VEGF vascular cell growth factor
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human von Hippel-Lindau tumor suppressor, both of which have similar biological functions. As a multiple tumor suppressor protein in vivo, it regulates the functions of other related proteins and regulates cell division. Its abnormal expression is closely related to tumorigenesis, growth and development, and produces related diseases.
  • human von Hippel-Lindau tumor suppressor 14 in the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immune diseases. These diseases include But not limited to:
  • Tumors of various tissues tumors of the central nervous system, retinal hemangioma, renal cell carcinoma, pancreatic cancer, gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumors, uterine fibroids, neuroblastoma , Astrocytoma, ependymoma, glioblastoma, neurofibromas, colon cancer, Melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of the human von Hippel-Lindau tumor suppressor factor 14 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human von Hippel-Lindau tumor suppressor factor 14.
  • Agonists enhance human von Hippel-Linau tumor suppressor 14 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing human von Hippel-Lindau tumor suppressor 14 can be cultured with labeled human von Hippel-Lindau tumor suppressor 14 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.
  • Antagonists of human von Hippel-Lindau tumor suppressor factor 14 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human von Hippel-Lindau tumor suppressor 14 can bind to human von Hippel-Lindau tumor suppressor 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human von Hippel-Lindau tumor suppressor factor 14 can be added to a bioanalytical assay to determine the effect of compounds on human von Hippel-Lindau tumor suppressors. The effect of the interaction between factor 14 and its receptor to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human von Hi'ppel-Lindau tumor suppressor 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human von Hippel-Lindau tumor suppressor 14 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human von Hippel-Lindau tumor suppressor 14 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human von Hippel-Lindau tumor suppressor factor 14 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies against human von Hippel-Lindau tumor suppressor factor 14 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human von Hippel-Lindau tumor suppressor factor 14. '
  • Antibodies against human von Hippel-Lindau tumor suppressor 14 can be used in immunohistochemistry to detect human von Hippel-Lindau tumor suppressor 14 in biopsy specimens.
  • Monoclonal antibodies that bind to human von Hippel-Lindau tumor suppressor 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human von Hippe l-Linau tumor suppressor 14 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human von Hippel-Lindau tumor suppressor factor I 4 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human von Hippel-Lindau tumor suppressor factor 14.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of human von Hippel-Lindau tumor suppressor factor 14.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human von Hippel-Lindau tumor suppressor factor 14. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the levels of human von Hippel-Lindau tumor suppressor 14 detected in the test can be used to explain the importance of human von Hippel-Lindau tumor suppressor 14 in various diseases and to diagnose human von Hippel-Lindau tumor suppressor 14 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human von Hippel-Lindau tumor suppressor factor 14 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human von Hippel-Lindau tumor suppressor factor 14.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human von Hippel-Lindau tumor suppressor 14 to inhibit endogenous human von Hippel-Lindau tumor suppressor 14 activity.
  • a variant human von Hippel-Lindau tumor suppressor 14 may be a shortened human von Hippel-Lindau tumor suppressor 14 lacking a signaling domain.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human von Hippel-Lindau tumor suppressor 14.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human von Hippel-Lindau tumor suppressor 14 into cells.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human von Hippel-Lindau tumor suppressor factor 14 can be found in the literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding human von Hippel-Lindau tumor suppressor 14 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit human von Hippel-Lindau tumor suppressor 14 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense MA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of nucleic acid molecules, various methods can be used It can be modified by methods such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human von Hippel-Lindau tumor suppressor 14 can be used for the diagnosis of diseases related to human von Hippel-Lindau tumor suppressor 14.
  • a polynucleotide encoding human von Hippel-Lindau tumor suppressor 14 can be used to detect the expression of human von Hippel-Lindau tumor suppressor 14 or the abnormal expression of human von Hippe l-Lindau tumor suppressor 14 in a disease state.
  • the DNA sequence encoding human von Hippel-Lindau tumor suppressor factor 14 can be used to hybridize biopsy specimens to determine the expression of human von Hippel-Lindau tumor suppressor factor 14.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be fixed as a probe on a microarray or a DM chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and gene diagnosis.
  • Human von Hippel-Lindau tumor suppressor 14 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect human von Hippel-Lindau tumor suppressor 14 transcripts.
  • Human von Hippel-Lindau tumor suppressor 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human von Hippel-Lindau tumor suppressor 14 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so Northern blotting and Western blotting can be used to indirectly determine whether the gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDM or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human von Hippel-Lindau tumor suppressor 14 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human von Hippel-Linau tumor suppressor 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with an existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0722gl2 was a new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr iraerl 5'- GAAGAATGAGTCAGATATTGTGGG -3 '(SEQ ID NO: 3)
  • Primer2 5'- TGCATAACTTATTTTTATTTGTGC -3 '(SEQ ID NO: 4)
  • Priraerl is a forward sequence starting at ⁇ lbp at the 5 ′ end of SEQ ID NO: 1;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8.50, 1.5 mmol / L MgCl 2 , 200 raol / L dNTP, 1 Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Set ⁇ -act in at the same time during RT-PCR For positive control and template blank as negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1-1671bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of human von Hippel-Lindau tumor suppressor 14 gene expression
  • RNA containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7 0.) - subjected to electrophoresis on a 1.2% agarose gel 5mM sodium acetate IraM EDTA-2 2M formaldehyde. It was then transferred to a nitrocellulose membrane.
  • 32 -P-labeled DNA probes were prepared by random primer method using c- 32 P dATP.
  • the DM probe used was the human von Hippel-Lindau tumor suppressor 14 coding region sequence (484bp to 855bp) amplified by PCR as shown in FIG. 1.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0. 1 »/. SDS at 55 ° C for 30min Then, Phosphor Imager was used for analysis and quantification.
  • Example 4 In vitro expression, isolation and purification of recombinant human von Hippel-Lindau tumor suppressor 14
  • Priraer3 5'- CCCCATATGATGTTGGACTTTTTTTTCTTTTTTTTTT -3, (Seq ID No: 5)
  • Pr imer4 5'- CATGGATCCTCATACATTAATAAGGATTAAAGT -3, (Seq ID No: 6)
  • the two ends of the two primers contain Ndel and BamHI restriction sites , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the pBS-0722 g 12 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0722gl2 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5 cx by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive colonies were screened by colony PCR method and sequenced. A positive clone with the correct sequence (pET-0722gl2) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • LB containing kanamycin final concentration 3 ( ⁇ g / ml)) a liquid medium the host bacteria BL21 (P ET-0722gl2) at 37.C cultured to logarithmic phase, IPTG was added to make a final concentration ol / L, incubation was continued for 5 hours. 1 were harvested by centrifugation, disrupted bacteria by ultrasonic The supernatant was collected by centrifugation and chromatographed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified target protein human von Hippel was obtained. -Lindau tumor suppressor factor 14.
  • NH2-Met-Leu-Asp-Phe-Phe-Phe-Phe-Phe-Leu-Leu-Asp-Phe-Asn-Leu-Asn-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sephar 0S e4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human von Hippel-Lindau tumor suppressor factor 14.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (view):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) to be prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • a total of 4,000 polynucleotide sequences of various full-length cDM are used as target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DM on the glass slide to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total niRM was extracted from the human mixed tissue and specific tissues (or stimulated cell lines) of the body in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription!]
  • the fluorescent reagent Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl -2'- deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5'-triphate
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1 x SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were processed with Imagene software (Biodi scovery, USA) for data Analyze and calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un facteur humain 14 d'inhibition de la croissance tumorale von Hippel-Lindau, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, des troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant le facteur humain 14 d'inhibition de la croissance tumorale von Hippel-Lindau.
PCT/CN2001/000773 2000-05-16 2001-05-14 Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide WO2001090377A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU75639/01A AU7563901A (en) 2000-05-16 2001-05-14 Novel polypeptide - a human von hippel lindau tumour suppressor gene 14 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00115707 CN1323818A (zh) 2000-05-16 2000-05-16 一种新的多肽——人肿瘤抑制因子14和编码这种多肽的多核苷酸
CN00115707.8 2000-05-16

Publications (1)

Publication Number Publication Date
WO2001090377A1 true WO2001090377A1 (fr) 2001-11-29

Family

ID=4585151

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000773 WO2001090377A1 (fr) 2000-05-16 2001-05-14 Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1323818A (fr)
AU (1) AU7563901A (fr)
WO (1) WO2001090377A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6013436A (en) * 1994-07-08 2000-01-11 Visible Genetics, Inc. Compositions and methods for diagnosis of mutation in the von Hippel-Lindau tumor suppressor gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6013436A (en) * 1994-07-08 2000-01-11 Visible Genetics, Inc. Compositions and methods for diagnosis of mutation in the von Hippel-Lindau tumor suppressor gene

Also Published As

Publication number Publication date
CN1323818A (zh) 2001-11-28
AU7563901A (en) 2001-12-03

Similar Documents

Publication Publication Date Title
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001083743A1 (fr) Polypeptide sous-unite 11 d'adducine alpha de globule rouge humain et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088084A2 (fr) Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide
WO2001090377A1 (fr) Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001087949A1 (fr) Nouveau polypeptide, proteine pax humaine 9, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2001087972A1 (fr) Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide
WO2001092540A1 (fr) Nouveau polypeptide, facteur humain stat2 11, et polynucleotide codant ce polypeptide
WO2001083742A1 (fr) Nouveau polypeptide, proteine pax humaine 11.7, et polynucleotide codant pour ce polypeptide
WO2001083676A2 (fr) Nouveau polypeptide, phosphatase humaine 10 fortement striee, et polynucleotide codant pour ce polypeptide
WO2001075120A1 (fr) Nouveau polypeptide, alkylguanine-adn/cysteine proteine methyltransferase humaine 13, et polynucleotide codant pour ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001083683A2 (fr) Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide
WO2001096525A2 (fr) Nouveau polypeptide, unite de transposition pogo 18, et polynucleotide codant ce polypeptide
WO2001094595A1 (fr) Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide
WO2001074887A1 (fr) Nouveau polypeptide, proteine humaine 9 humsiah, et polynucleotide codant pour ce polypeptide
WO2001090131A1 (fr) Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP