WO2001092316A1 - Nouveau polypeptide, pigment photosensible 12, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, pigment photosensible 12, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001092316A1
WO2001092316A1 PCT/CN2001/000834 CN0100834W WO0192316A1 WO 2001092316 A1 WO2001092316 A1 WO 2001092316A1 CN 0100834 W CN0100834 W CN 0100834W WO 0192316 A1 WO0192316 A1 WO 0192316A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
sequence
seq
amino acid
Prior art date
Application number
PCT/CN2001/000834
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU89486/01A priority Critical patent/AU8948601A/en
Publication of WO2001092316A1 publication Critical patent/WO2001092316A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, photosensitizing pigment 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • Photosensitivity pigment is a ubiquitous plant protein that can sense light signals and function as a regulated photoreceptor.
  • proteases have also been found in eukaryotes, and their catalytic reaction sites contain structures similar to the C-terminus of photosensitivity pigments in certain plants, such as serine protein kinase, threonine protein kinase, and tyrosine protein kinase
  • histidine protein kinases in some bacteria also belong to this family.
  • the photosensitizing pigment family exists as a dimer and consists of two identical 124Kd subunits, each of which is covalently attached to a linear tetrapyrrole chromophore.
  • the tetrapyrrole chromophore is attached to the Cys site, and Cys is located in a highly conserved region and is also the most conserved amino acid residue in the entire region. This region contains such an amino acid sequence: [RGS] — [GSA] — [PV] — H—X—C—H—X (2) —Y.
  • photosensitizing pigments can mediate the effects of red light on physiological and molecular responses. After a reversible photochemical change, it can change from an inactive red light absorption state (Pr) to an active far red light absorption state (Pf r).
  • Photosensitivity pigments can sense light signals, regulate some major nuclear-encoded polypeptides at the transcription level, and can regulate many morphogenic responses, such as plant stems and stems elongation and flowering; at the cellular level, it can also produce many physiological effects, such as Regulation of chlorophyll in certain green algae.
  • nucleotide kinase 2 (NDPK2) is the main component upstream of it.
  • NDPK nucleotide kinase 2
  • Many animal protein kinases are related to some viral diseases, such as a virus that causes infant gastroenteritis-rotavirus is related to the activity of serine protein kinase in the body.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a photochrome 12.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in photochrome 12. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide that does have the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of photochrome 12 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with abnormal expression of photochrome 12 protein, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting the The amount or biological activity of the polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for the treatment of snoring, developmental or immune diseases, or other diseases caused by abnormal expression of photochrome 12.
  • FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated photochrome 12. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with photochrome 12, can cause changes in the protein and thereby regulate the activity of the protein.
  • the agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the photochrome 12.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of photochrome 12 when combined with photochrome 12.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind photochrome 12.
  • Regular refers to a change in the function of the photochromic pigment 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of the photochromic pigment 12.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify the light-sensitive pigment 12 using standard protein purification techniques. Basically pure Photosensitive pigment 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of the photochromic peptide 12 can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Cluster method divides each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the assay may be Jotun Hein percent identity between nucleic acid sequences Clus ter or a method well known in the art (Hein J., (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of photochrome 12.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated photosensitive pigment 12 means that photosensitive pigment 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the photosensitive pigment 12 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the photochromic peptide 12 can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, photosensitizing pigment 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant technology from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the present invention also includes fragments, derivatives, and analogs of photochrome 12.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the photochrome 12 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which one or more of the amino acid residues Substitution by other groups contains substituents; or (I II) such that the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a, A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by merging additional amino acid sequences into a mature polypeptide.
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 1366 bases in length and its open reading frame 990-1307 encodes 105 amino acids.
  • this peptide has a similar expression profile to that of photosensitizing pigments, and it can be inferred that the photosensitizing pigment 12 has a function similar to that of photosensitizing pigments.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DM forms include cDNA, genomic DM or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Cross When using denaturing agents, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only the same between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding photochrome 12.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the photosensitive pigment 12 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library.
  • mRM plasmid or phage cDM library.
  • kits are also commercially available (Qiagene). It is also a common method to construct a CDM library (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of transcripts of photochrome 12; (4) through immunization Technology or measurement of biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3G nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the gene or fragment of the present invention may of course Used as a probe.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of the photochrome 12 gene expression.
  • a method for amplifying DM / RM using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-cDM terminal rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a photochrome 12 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding the photosensitizing dye 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding photochrome 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant MA technology, DNA synthesis technology, and in vivo recombination technology (Satnbroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • the polynucleotide encoding the photochrome 12 or the recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant photosensitizing pigment 12 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
  • the appropriate promoter such as temperature conversion or chemical induction
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • proteases such as serine protein kinase, threonine protein kinase, and tyrosine protein kinase, etc.
  • some proteases have catalytic sites containing structures similar to the C-terminus of photosensitivity pigments in some plants. This is particularly conservative The sequence is required to form its active mot if.
  • Serine protein kinases, threonine protein kinases, and tyrosine protein kinases play important roles in the cell's second signaling system pathways, and all have effects on regulating cell growth, differentiation, and proliferation.
  • NDPK with a specifically conserved sequence of the C-terminal structure of the photosensitizing pigment can function as a tumor suppressor in humans.
  • rotavirus enteritis is associated with the activity of serine protein kinases in vivo.
  • the abnormal expression of the mot if at the specific photochromic pigment chromophore attachment site will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities in the cell's second signaling system pathway, and tumor inhibition.
  • Dysfunction, and produce related diseases such as tumors, embryonic development disorders, growth and development disorders, inflammation, etc.
  • the abnormal expression of the photosensitive pigment 10 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth and development disorders, and inflammation, and these diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • Embryonic disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vagina Atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube defects, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deaf
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebellar dysplasia, strabismus, skin, fat and muscular dysplasia such as congenital skin sagging, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • Inflammation allergic reaction, bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex Types of glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, chronic active hepatitis, emergency bowel syndrome, atrophy Gastritis, systemic lupus erythematosus, myasthenia gravis, cerebrospinal spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, pancreatitis, myocarditis, and inflammation caused by infections and trauma
  • the abnormal expression of the photosensitive pigment 12 of the present invention will also produce certain hereditary, hematological and immune system diseases.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) photosensitivity 12.
  • Agonists enhance biological functions such as sensitizing pigment 12 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing photochrome 12 can be cultured together with labeled photochrome 12 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of photochrome 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of photochromic pigment 12 can bind to photochromic pigment 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • photosensitizing pigment 12 When screening compounds as antagonists, photosensitizing pigment 12 can be added to the bioanalytical assay, and the effect of the compound on the interaction between photosensitizing pigment 12 and its receptor can be determined to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to photochromic pigments can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 12 molecules of photosensitive pigment should be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against the photochromic acid 12 epitope.
  • These antibodies include (but are not limited to): polyclonal antibodies Antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • the production of polyclonal antibodies can be obtained by directly injecting immunized animals (such as rabbits, mice, rats, etc.) with photosensitivity pigment 12, and a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to photochrome 12 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single-chain antibodies (US Pat. No. 4946778) can also be used to produce single-chain antibodies against photochrome 12.
  • Anti-photochrome 12 antibodies can be used in immunohistochemical techniques to detect photochrome 12 in biopsy specimens.
  • Monoclonal antibodies that bind to photochrome 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • high-affinity monoclonal antibodies of photochrome 12 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill the photosensitizing dye.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of photochrome 12.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of photosensitivity 12 levels. These tests are well known in the art and include FISH assays and radioimmunoassays.
  • the photosensitivity pigment 12 levels detected in the test can be used to explain the importance of photosensitivity pigment 12 in various diseases and to diagnose diseases in which photosensitivity pigment 12 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding photochrome 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of photochrome 12.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated photochrome 12 to inhibit endogenous photochrome 12 activity.
  • a variant photosensitizing pigment 12 may be a shortened photosensitizing pigment 12, which lacks a signal transduction functional domain. Although it can be combined with a downstream substrate, Lack of signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of photochrome 12.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding photochrome 12 into a cell.
  • Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a photochrome 12 can be found in existing literature (Sambrook, et al.).
  • the polynucleotide encoding the light-sensitive pigment 12 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit photochrome 12 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense MA, DM, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the solid-phase phosphate amide chemical synthesis method for oligonucleotide synthesis, which is widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DM sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • Polynucleotides encoding photochrome 12 are useful in the diagnosis of diseases related to photochrome 12.
  • Polynucleotides encoding photochrome 12 can be used to detect the expression of photochrome 12 or the abnormal expression of photochrome 12 in a disease state.
  • the DNA sequence encoding photochrome 12 can be used to hybridize biopsy specimens to determine the expression of photochrome 12.
  • Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • a DM chip also called a "gene chip”
  • RM-12 polymerase chain reaction (RT-PCR) in vitro amplification can also be used to detect the photosynthetic pigment 12 transcripts.
  • Photosensitive pigment 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type photosensitive pigment 12 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Photochrome 12 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and dose range of photosensitive pigment 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRM Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech ⁇ cDNA fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech)) to transform DH5 a to form a cDNA library.
  • Dye terminate cycle react ion sequencing ki t Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequences were compared with the existing public DM sequence database (Genebank) Comparative found wherein a cDNA sequence 0 6 l 6 b0 2 for the new DNA clones. Determination of the bidirectional clones contained inserted cDNA fragment by synthesizing a series of primers.
  • Primer2 5'- CCCCCCTAAGCTTCGTCTTCTCGC -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 ⁇ l of reaction volume in 50 ⁇ l containing 50 ol / L KCl, 10 mmol / L Tris-HCl pH 8. 5, 1. 5 mraol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol primer, 1U Taq DM polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min.
  • RT -Set ⁇ -act in as positive control and template blank as negative control at the same time.
  • Total RM was extracted by one step method [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (. P H4 0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1), centrifuged after mixing with the water absorbing layer, isopropanol is added. (0.8 volume) and centrifuge the mixture to obtain an RNA pellet. The resulting RM pellet was washed with 70% ethanol, dried and dissolved in water.
  • Primer3 5'-CATGCTAGCATGATGCCTGTAAAGTATTTGGCA-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCCTAAGCTTCGTCTTCTCGCGCAGCCG-3' (Seq ID No: 6)
  • These two primers contain Nhel and BamHI restriction sites, respectively. 5 'end of target gene And the 3 'end coding sequence, the Nhel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
  • the pBS-0616b02 plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0616b02 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 0C by the calcium chloride method.
  • Polypeptide synthesizer (product of PE company) was used to synthesize the following peptides specific to photochrome 12:
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources.
  • the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases. The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA) The distance between them is 280 ⁇ m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). J Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5 '-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargy) was used.
  • the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc not stimulated with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, un pigment photosensible 12, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant le pigment photosensible 12.
PCT/CN2001/000834 2000-05-24 2001-05-21 Nouveau polypeptide, pigment photosensible 12, et polynucleotide codant ce polypeptide WO2001092316A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU89486/01A AU8948601A (en) 2000-05-24 2001-05-21 A novel polypeptide, a phytochrome 12 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115823.6 2000-05-24
CN 00115823 CN1324812A (zh) 2000-05-24 2000-05-24 一种新的多肽——光敏色素12和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001092316A1 true WO2001092316A1 (fr) 2001-12-06

Family

ID=4585265

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000834 WO2001092316A1 (fr) 2000-05-24 2001-05-21 Nouveau polypeptide, pigment photosensible 12, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1324812A (fr)
AU (1) AU8948601A (fr)
WO (1) WO2001092316A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5268526A (en) * 1988-07-29 1993-12-07 E. I. Du Pont De Nemours And Company Overexpression of phytochrome in transgenic plants
US5945579A (en) * 1995-10-05 1999-08-31 The University Of Leicester Modification of crop plant architecture to enhance yield by causing proximity-conditional dwarfing to control shade avoidance reactions

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5268526A (en) * 1988-07-29 1993-12-07 E. I. Du Pont De Nemours And Company Overexpression of phytochrome in transgenic plants
US5945579A (en) * 1995-10-05 1999-08-31 The University Of Leicester Modification of crop plant architecture to enhance yield by causing proximity-conditional dwarfing to control shade avoidance reactions

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
THUMMLER F. ET AL., FEBS LETT., vol. 357, no. 2, 3 January 1995 (1995-01-03), pages 149 - 155, XP002905537 *

Also Published As

Publication number Publication date
AU8948601A (en) 2001-12-11
CN1324812A (zh) 2001-12-05

Similar Documents

Publication Publication Date Title
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001092316A1 (fr) Nouveau polypeptide, pigment photosensible 12, et polynucleotide codant ce polypeptide
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2002000823A2 (fr) Nouveau polypeptide, proteine d'activation enzymatique ras gtp 9.57, et polynucleotide codant ce polypeptide
WO2001090352A1 (fr) Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001081594A1 (fr) Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide
WO2001066584A1 (fr) Nouveau polypeptide, proteine humaine pax 9, et polynucleotide codant pour ce polypeptide
WO2001094532A2 (fr) Nouveau polypeptide, proteine ribosomale l39 9, et polynucleotide codant ce polypeptide
WO2002012309A1 (fr) Nouveau polypeptide, pigment photosensible 9.9, et polynucleotide codant ce polypeptide
WO2001092516A1 (fr) Nouveau polypeptide, proteine ribosomale s19e 13, et polynucleotide codant ce polypeptide
WO2001090172A1 (fr) Nouveau polypeptide, proteine ribosomale l39 13, et polynucleotide codant ce polypeptide
WO2001090379A1 (fr) Nouveau polypeptide, nucleoproteine basophile humaine 22.55, et polynucleotide codant ce polypeptide
WO2002000835A2 (fr) Nouveau polypeptide, proteine de transcription humaine 23, et polynucleotide codant ce polypeptide
WO2002012308A1 (fr) Nouveau polypeptide, proteine rs3 humaine 18, et polynucleotide codant ce polypeptide
WO2001090173A1 (fr) Nouveau polypeptide, chaperonine humaine cpn60 10, et polynucleotide codant pour ce polypeptide
WO2002020595A1 (fr) Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide
WO2001092324A1 (fr) Nouveau polypeptide, nucleoproteine humaine 10.78 basophile, et polynucleotide codant ce polypeptide
WO2002012486A1 (fr) Nouveau polypeptide, recepteur humain de la serine kinase 10.34, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP