WO2001079426A2 - Nouveau polypeptide, proteine humaine atm 20 de l'ataxie cinetique-telangiectasie, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine humaine atm 20 de l'ataxie cinetique-telangiectasie, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001079426A2
WO2001079426A2 PCT/CN2001/000370 CN0100370W WO0179426A2 WO 2001079426 A2 WO2001079426 A2 WO 2001079426A2 CN 0100370 W CN0100370 W CN 0100370W WO 0179426 A2 WO0179426 A2 WO 0179426A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
ataxia
atm protein
human
Prior art date
Application number
PCT/CN2001/000370
Other languages
English (en)
Chinese (zh)
Other versions
WO2001079426A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU56052/01A priority Critical patent/AU5605201A/en
Publication of WO2001079426A2 publication Critical patent/WO2001079426A2/fr
Publication of WO2001079426A3 publication Critical patent/WO2001079426A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, namely a human ataxia-capillary expansion ATM protein 20, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Ataxia-telangiectasia is an autosomal recessive disorder that produces conditions involving the degradation of cerebellar function, immune deficiency, chromosomal instability, and radiation sensitivity, and is even easier than the average individual Suffering from cancer.
  • This disease is caused by AT-associated gene mutations (A-T associated mutations). The proportion of people who develop the disease is low. One in 40,000 to 100,000 births is characterized by progressive , Neurological degradation.
  • ATM patient's gene mutation is located on chromosome llq22_23 (Gat ti et a 1., 1998), contains an open reading frame (0RF), is composed of 9168 nucleotides, and its encoded amino acid belongs to a long protein family.
  • the protein in sequence is the same source as the catalytic site of phosphatidylinositol-3 (PI-3) kinase (Savitsky et al., 1995b). It is interesting to find an additional ATM enhancer at the intron 3 site, including a TATA box, located upstream of the first exon coding region.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of human motor ataxia-capillary expansion ATM protein, so their functions may also be similar.
  • the present invention is named as human motor ataxia-capillary expansion ATM protein 20.
  • human ataxia-capillary expansion ATM protein 20 protein regulates cells It plays an important role in important functions of the body such as division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more human ataxia-capillary expansion ATM protein 20 proteins involved in these processes In particular, the amino acid sequence of this protein is identified.
  • Isolation of motor ataxia-capillary expansion ATM protein 20 protein encoding genes in newcomers also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ataxia-capillary expanded ATM protein 20.
  • Another object of the present invention is to provide a method for producing human motor ataxia-capillary expansion ATM protein 20.
  • Another object of the present invention is to provide an antibody against the human ataxia-capillary expansion ATM protein 20 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the human ataxia-capillary dilatation ATM protein 20 against the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for the definitive treatment of diseases associated with abnormalities of human motor ataxia-capillary expansion ATM protein 20.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 206-745; and (b) a sequence of positions 1-1741 in SEQ ID NO: 1.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human motor ataxia-capillary expansion ATM protein 20 protein activity, which comprises utilizing the polypeptide of the present invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human motor ataxia-capillary dilated ATM protein 20 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of ataxia-capillary telangiectasia, breast cancer, leukemia, lymphoma, other tumors, immune diseases, developmental disorders, inflammation, blood Disease, HIV infection, or other diseases caused by abnormal motor ataxia-capillary expansion ATM protein 20 expression.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants may also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” means the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Is missing.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human ataxia-capillary-expanding ATM protein 20, causes the protein to change, thereby regulating the activity of the protein.
  • Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human motor ataxia-capillary expansion ATM protein 20.
  • Antagonist or “inhibitor” refers to a biological activity that blocks or regulates human ataxia-capillary expansion ATM protein 20 when combined with human ataxia-capillary expansion ATM protein 20 Or immunologically active molecules: Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human ataxia-capillary expansion ATM protein 20.
  • Regular refers to any change in the function of human motor ataxia-capillary expansion ATM protein 20, including any increase or decrease in protein activity, changes in binding characteristics, and any of human motor ataxia-capillary expansion ATM protein 20. Changes in other biological, functional or immune properties.
  • substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ataxia-capillary expanded ATM protein 20 using standard protein purification techniques. Basically pure human ataxia-capillary expansion ATM protein 20 can produce a single main band on a non-reducing polyacrylamide gel. The purity of human sports ataxia-capillary expansion ATM protein 20 peptide is available Amino acid sequence analysis
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” means that the degree of mutual flutter can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. This kind of inhibition of hybridization can be performed under conditions of reduced stringency (Southern blotting or Nor thern blotting) to detect substantially homologous sequences or hybridization probes can compete and inhibit completely homologous sequences and targets Binding of sequences under conditions of reduced stringency. This does not mean strict Conditions with reduced sex allow non-specific binding because conditions with reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs, and then distributes each pair in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or by a method known in the art such as Jotun Hein. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between amino acid sequences.
  • Amino acids used for conservative substitutions may include aspartic acid and glutamine Acids; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine, isoleucine, and valine; glycine and Alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a specific 1) NA or RNA sequence.
  • Antisense strand means a nucleic acid strand that is complementary to the “sense strand”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be an alkyl, acyl or amino group in which the atom is replaced.
  • a nucleic acid derivative may encode a polypeptide that retains the main biological properties of the natural molecule.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to human motor ataxia ⁇ -the epitope of capillary expanded ATM protein 20.
  • Humanized antibody refers to a chromosomal body in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • an "isolated" substance is removed from its original environment (for example, its natural environment if it is naturally occurring), for example, a naturally occurring polynucleotide or polypeptide exists in a living animal It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
  • Such an isolated polynucleotide may be part of a vector, or it may be such a multi-core
  • the glycoside or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human ataxia-capillary expansion ATM protein 20 refers to human ataxia-capillary expansion ATM protein 20 which is substantially free of other proteins, lipids, and sugars naturally associated with it.
  • Those skilled in the art can purify human ataxia-capillary expansion ATM protein 20 using standard protein purification techniques. Basically pure peptides can produce a single main band on non-reduced polyacrylamide gels: human ataxia-capillary expansion ATM protein 20 The purity of the peptide can be divided by amino acid sequence "
  • the present invention provides a novel polypeptide-human ataxia-capillary expansion ATM protein 20, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of human motor ataxia-capillary expanded ATM protein 20.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human ataxia-capillary expansion ATM protein 20 of the present invention.
  • the tablet, derivative or analog of the peptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and The substituted base acid may or may not be encoded by a genetic codon; or
  • (II) a type in which a group on one A or more A amino acid residue is substituted with another group to include a substituent; or (II) a type in which the mature polypeptide and another compound (such as Compounds that extend the half-life of a polypeptide, such as a polyethylene glycol) fusion; or (IV) a polypeptide sequence (such as a leader sequence or a secretion sequence or a polypeptide used to purify the polypeptide in which an additional amino acid sequence is fused into a mature peptide) Sequences or proprotein sequences) as set forth herein, such fragments, derivatives and Analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1741 bases in length and its open reading frame 206-745 encodes 179 amino acids.
  • this peptide has a similar expression profile with human ataxia-capillary expansion ATM protein, which can be inferred that the human ataxia-capillary expansion ATM protein 20 has human ataxia Dysregulation-Capillary expansion ATM protein has similar functions.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic I) NA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • "degenerate variant” means in the present invention that encodes a gene having SEQ II ) A protein or polypeptide of N0: 2 but a nucleic acid sequence that differs from the coding region sequence shown in SEQ ID NO: 1
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence
  • polynucleotide encoding a polypeptide means a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • a variant of this polynucleotide can be a naturally occurring allelic variant or a naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants .:
  • an allelic variant is a polynucleotide replacement form, which may be one or more :, Nucleotide substitutions, deletions, or insertions that do not substantially alter the function of the polypeptide it encodes
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to a polynucleoside under the stringent conditions described herein Acid hybridizable polynucleotide.
  • “strict conditions” means: (1) hybridization at lower ionic strength and higher temperature: 'first off, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) adding a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1W i co ll, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. Also, the hybridizable polynucleotide-encoding polypeptide is mature as shown in SEQ ID NO: 2 Peptides are identical Biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 1 nuclei Glycylic acid or more.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human ataxia-capillary expansion ATM protein 20.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the human ataxia-capillary-expanded ATM protein 20 of the present invention can be obtained by a variety of methods, for example, polynucleotides can be isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) screening of antibodies expressing cultures to detect polynuclear clones with common structural characteristics Nucleotide fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A La bora tory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymeric makeup, even very few expression products can be cloned.
  • genes of the present invention can be selected from these cDNA X libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human motor ataxia-capillary expansion ATM protein 20 transcription (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for the heterozygote is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably It is at least 50 nucleotides, preferably at least 100 nucleus.
  • the length of the probe is usually within 2000 nucleotides, preferably 1000 nucleotides ⁇ .
  • the probe used here The needle is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention, and the gene itself or a fragment of the invention can of course be used as a probe.
  • X DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product for detecting human motor ataxia-capillary expansion ATM protein 20 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using human ataxia-capillary expansion ATM protein 20 coding sequence, and the recombinant technology to produce the present A method of inventing the polypeptide.
  • a polynucleotide sequence encoding human ataxia-capillary expanded ATM protein 20 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational control elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ataxia-capillary expansion ATM protein 20 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector, and refers to Guide mRM synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ataxia-capillary expanded ATM protein 20 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector Engineered host cells.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S 2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ataxia-capillary expanded ATM protein 20 (Scence, 1 984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of gene chip expression profiles of ataxia-capillary dilated ATM protein 20 and human ataxia-capillary dilated ATM protein of the present invention.
  • the upper graph is a graph of the expression profile of human ataxia-capillary expansion ATM protein 20, and the lower graph is the graph of the expression profile of human ataxia-capillary expansion ATM protein 20.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human ataxia-capillary expanded ATM protein 20.
  • 20KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Example 1 Human Motor Ataxia-Cloning of Capillary Expanded ATM Protein 20
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smar t cDNA cloning kit purchased from C1 on t ech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0982bll, was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
  • the 0982bll clone contained a full-length cDNA of 1741bp (as shown in Seq ID NO: 1), and a 540bp open reading frame (0RF) from 206b P to 745bp, encoding a new protein (such as Seq ID NO: 2).
  • a new protein such as Seq ID NO: 2
  • this clone pBS-0982bll and encoded the protein named human ataxia-capillary expansion ATM protein 20.
  • Example 2 The gene encoding human ataxia-capillary expansion ATM protein 20 was cloned by RT-PCR using fetal brain cell total RNA as a template, and oligo-dT as a primer was used for reverse transcription to synthesize cDNA.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- AGCTTCAATAATAGACATTTATTG -3 '(SEQ ID NO: 3)
  • Primer2 5'- GCGAGAAGACGAAGCTTAGGGGGG -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 mmol / L KC1, 10raraol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ / L dNTP, lOpmol primer, 1U in a reaction volume of 50 ⁇ 1 Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1741bp shown in SEQ ID NO: 1.
  • Example 3 Analysis of human ataxia-capillary expansion ATM protein 20 gene expression by Nor them blotting method:
  • Electrophoresis was performed on a 1.2% agarose gel containing 2 g of RNA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. Then Transfer to a nitrocellulose membrane. A 32 P dATP was used to prepare a 32 P-labeled DNA probe by a random primer method.
  • the DNA probe used was a PCR-amplified human motor ataxia shown in FIG. 1- Capillary-expanded ATM protein 20 coding region sequence (206bp to 745bp).
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C overnight.
  • the solution contains 50% formamide-25mM KH 2 P0 4 (pH7.4) _5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA.
  • the filter membrane is at 1 X SSC- 0.1 % SDS was washed at 55 ° C for 30 min. Then, analysis and quantification were performed using Phosphor Imager.
  • Example 4 Recombinant human ataxia-capillary expansion ATM protein 20 in vitro expression, isolation and purification according to SEQ ID NO: 1 And the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:
  • Primer 3 5'- CCCCATATGATGACCTCACCCAAACCTCATCAT —3, (Seq ID No: 5)
  • Primer4 5'- CCCGAATTCTCACTGCAACCTCCGCCTCCTGGG -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3).
  • the pBS-0982bll plasmid containing the full-length target gene was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing P BS-0982bl 1 plasmid 10 pg, archimer Pr imer-3 and Pr imer- 4 points, and 1 J is lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1 . Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 rain, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method.
  • the host strain BL21 (pET-0982bll) was cultured at 37 ° C to the logarithmic growth phase, and IPT (; was added to a final concentration of 1 Binol / L, continue to culture for 5 hours. Centrifuge to collect the bacteria, sonicate the bacteria, centrifuge to collect the supernatant, and use an affinity chromatography column His. Bind Quick Cartridge that can bind to 6 histidines (6His-Tag). (Products of Novagen) were subjected to chromatography to obtain the purified human target ataxia-capillary expansion ATM protein 20 of the target protein.
  • the titer of antibodies in rabbit serum was determined by ELI SA using a 15 g / ml bovine serum albumin peptide complex-coated titer plate.
  • Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a Sepharose 4B column activated by cyanogen bromide, and the anti-peptide protein 20 binding was separated from the total I gG by affinity chromatography.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They all use the same stepwise hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the probes from the hybridization are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: The first type of probe Are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are oligonucleotides that are partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention Acid fragments.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. , Chai, A., Shalom, I)., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The sample post-processing steps of this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy 3dUTP was separately reverse-transcribed.
  • Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1> SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • the scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1). It can be seen from the figure that the expression profile of the human motor ataxia-capillary expansion ATM protein 20 and the human motor ataxia-capillary expansion ATM protein according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immunity Sexually transmitted diseases.
  • Ataxia-Capillary telangiectasia is an autosomal recessive disorder with symptoms such as ataxia of the cerebellum, telangiectasia, defective immune system, and susceptibility to malignant tumors (especially leukemia and lymphoma).
  • Ataxia-capillary telangiectasia is caused by ataxia-capillary telangiectasia mutation gene (ATM, mu t a t ed i n A-T) mutation.
  • ATM gene products play a role in the regulation of the cell cycle and also play a role in the response to DNA damage.
  • A-T heterozygotes are susceptible to tumors, especially breast cancer in women.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human motor ataxia-capillary expansion ATM protein, both of which have similar biological functions. It has various important functions in the body, mainly regulating the physiological functions of various tissues and organs in the body such as the immune system, cell proliferation, cerebellum, capillaries, etc. Abnormal expression will cause abnormalities in the above-mentioned tissue cells and cause related diseases.
  • human ataxia-capillary dilatation ATM protein 20 of the present invention will produce various diseases, especially ataxia-capillary telangiectasia, breast cancer, leukemia, lymphoma, other tumors, immunity Sexual diseases, developmental disorders, inflammation, these diseases include but are not limited to: tumors of various tissues: breast cancer, leukemia, lymphoma, stomach cancer, liver cancer, lung cancer, esophageal cancer, thyroid tumor, uterine fibroids, neuroblastoma, Astrocytoma, Ependyma, Glioblastoma, Neurofibromatosis, Colon Cancer, Melanoma, Bladder Cancer, Uterine Cancer, Endometrial Cancer, Colon Cancer, Thymic Tumor, Nasopharyngeal Cancer, Laryngeal Cancer, Trachea Tumors, fibromas, fibrosarcomas, lipomas, liposarcoma immune diseases: common variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, primary B
  • congenital abortion congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, mental retardation, brain development disorder, Skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing syndrome, sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • the abnormal expression of the human motor ataxia-capillary expansion ATM protein 20 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially ataxia-capillary telangiectasia, breast cancer, leukemia, lymphoma Stomach tumors, other tumors, immune diseases, developmental disorders, inflammation, certain hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human motor ataxia-capillary expansion ATM protein 20. Agonists enhance human motor ataxia-capillary expansion ATM protein 20 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation such as various cancers.
  • mammalian cells or membrane preparations expressing human ataxia-capillary expansion ATM protein 20 can be cultured with labeled human ataxia-capillary expansion ATM protein 20 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human motor ataxia-capillary expansion ATM protein 20 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human ataxia-capillary expansion ATM protein 20 can bind to human ataxia-capillary expansion ATM protein 20 and eliminate its function, or inhibit the production of the polypeptide, or with the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
  • human ataxia-capillary expansion ATM protein 20 can be added to the bioanalytical assay. The effect of this interaction is used to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Peptide molecules capable of binding to human ataxia-capillary expanded ATM protein 20 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, generally, human motor ataxia-capillary expansion ATM protein 20 molecules should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the human motor ataxia-capillary expansion ATM protein 20 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct immunization of animals (such as rabbits, mice, rats, etc.) with human ataxia-capillary expansion ATM protein 20, and various adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Animals such as rabbits, mice, rats, etc.
  • various adjuvants can be used to enhance the immune response, including but It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human motor ataxia-capillary expansion ATM protein 20 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), three tumors Technology, human beta-cell hybridoma technology, EBV-hybridoma technology Surgery.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human ataxia-capillary expanded ATM protein 20.
  • Anti-human ataxia-capillary expansion ATM protein 20 antibody can be used in immunohistochemistry to detect human ataxia-capillary expansion ATM protein 20 in biopsy specimens.
  • Monoclonal antibodies that bind to human motor ataxia-capillary expanded ATM protein 20 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ataxia-capillary expansion ATM protein 20 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ataxia-capillary expansion ATM protein 20 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human ataxia-capillary expansion ATM protein 20.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human motor ataxia-capillary expansion ATM protein 20.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human motor ataxia-capillary expansion ATM protein 20 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • Human ataxia-capillary expansion ATM protein 20 levels detected in the test can be used to explain the importance of human ataxia-capillary expansion ATM protein 20 in various diseases and to diagnose human motor activity Ataxia-A disease in which capillary expansion ATM protein 20 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human ataxia-capillary expanded ATM protein 20 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormalities in cell proliferation, development, or metabolism caused by the lack of expression or abnormal / inactive expression of human motor ataxia-capillary expanded ATM protein 20.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human ataxia-capillary expansion ATM protein 20 to inhibit endogenous human ataxia-capillary expansion ATM protein 20 activity.
  • a variant of human ataxia-capillary expansion ATM protein 20 may be shortened and human ataxia-capillary expansion ATM protein 20 lacking a signaling domain, although Can bind to downstream substrates but lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal ataxia-capillary expansion ATM protein 20 expression or activity.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ataxia-capillary expansion ATM protein 20 into cells .
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human ataxia-capillary expanded ATM protein 20 can be found in existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding human ataxia-capillary expanded ATM protein 20 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human motor ataxia-capillary expansion ATM protein 20 mRNA are also within the scope of the present invention.
  • Ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using thiophosphate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ataxia-capillary expansion ATM protein 20 can be used for the diagnosis of diseases related to human ataxia-capillary expansion ATM protein 20.
  • Polynucleotides encoding human ataxia-capillary expansion ATM protein 2 0 can be used to detect human ataxia-capillary expansion ATM protein 2 0 or human motor ataxia in disease state- Abnormal expression of capillary-expanded ATM protein 20.
  • the DNA sequence encoding human ataxia-capillary expansion ATM protein 20 can be used to hybridize biopsy specimens to determine the expression of human ataxia-capillary expansion ATM protein 20. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • Detection of mutations in the human ataxia-capillary expansion ATM protein 20 gene can also be used to diagnose human ataxia-capillary expansion ATM protein 20-related diseases.
  • Human ataxia-capillary expansion ATM protein 20 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type ataxia-capillary expansion ATM protein 20 DNA sequences Wait. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c-leg bank.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in e.g., V.Mckusick, Me n delia n Inheritance in Man (available through Johns Hopkins University Welch Medical Library available online). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for staining Structural changes in the body, such as deletions or translocations that are visible from the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human motor ataxia-Capillary expansion ATM protein 20 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ataxia-capillary-expanding ATM protein 20 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une protéine humaine ATM 20 de l'ataxie cinétique-télangiectasie, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de l'ataxie-télangiectasie, du cancer du sein, des leucémies, des lymphomes, d'autres tumeurs, des maladies immunitaires, des troubles du développement, des inflammations, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine humaine ATM 20 de l'ataxie cinétique-télangiectasie.
PCT/CN2001/000370 2000-03-22 2001-03-19 Nouveau polypeptide, proteine humaine atm 20 de l'ataxie cinetique-telangiectasie, et polynucleotide codant pour ce polypeptide WO2001079426A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56052/01A AU5605201A (en) 2000-03-22 2001-03-19 A novel polypeptide, a human kinetic ataxia telangiectasia protein atm20 and thepolynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00115022.7 2000-03-22
CN00115022A CN1314381A (zh) 2000-03-22 2000-03-22 一种新的多肽——人运动性共济失调－毛细管扩张atm蛋白20和编码这种多肽的多核苷税

Publications (2)

Publication Number Publication Date
WO2001079426A2 true WO2001079426A2 (fr) 2001-10-25
WO2001079426A3 WO2001079426A3 (fr) 2002-02-07

Family

ID=4584493

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000370 WO2001079426A2 (fr) 2000-03-22 2001-03-19 Nouveau polypeptide, proteine humaine atm 20 de l'ataxie cinetique-telangiectasie, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1314381A (fr)
AU (1) AU5605201A (fr)
WO (1) WO2001079426A2 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104178487B (zh) * 2013-05-20 2017-09-19 中南大学湘雅医院 Atm基因突变体及其应用

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BLACK G.C. ET AL.: 'Coats' disease of the retina (unilateral retinal telangiectasis) caused by somatic mutation in the NDP gene: a role for norrin in retinal angiogenesis' HUM. MOL. GENET. vol. 8, no. 11, 1999, pages 2031 - 2035 *
CLAVERIE J.M. AND MAKALOWSKI W.: 'Alu alert' NATURE vol. 371, no. 6500, 1994, page 752 *
DATABASE GENBANK [Online] 19 October 1999 'Homo sapiens chromosome 14 BAC 98L12' Database accession no. AC008015 *
FUCHS S. ET AL.: 'A missense point mutation (Leu13Arg) of the Norrie disease gene in a large Cuban kindred with Norrie disease' HUM. MOL. GENET. vol. 3, no. 4, 1994, pages 655 - 656 *
MATSUMURA M. ET AL.: 'Stabilization of phage T4 lysozyme by engineered disulfide bonds' PROC. NATL. ACAD. SCI. USA vol. 86, no. 17, 1989, pages 6562 - 6566 *

Also Published As

Publication number Publication date
AU5605201A (en) 2001-10-30
WO2001079426A3 (fr) 2002-02-07
CN1314381A (zh) 2001-09-26

Similar Documents

Publication Publication Date Title
WO2001079426A2 (fr) Nouveau polypeptide, proteine humaine atm 20 de l'ataxie cinetique-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001055189A1 (fr) NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2001064720A1 (fr) Nouveau polypeptide, lamine humaine 14, et polynucleotide codant pour ce polypeptide
WO2001048004A1 (fr) Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide
WO2001081420A1 (fr) Nouveau polypeptide, laminine 19, et polynucleotide codant pour ce polypeptide
WO2001072796A1 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide
WO2001079423A2 (fr) Nouveau polypeptide, proteine humaine bcr 10, et polynucleotide codant pour ce polypeptide
WO2001072793A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001066770A1 (fr) Nouveau polypeptide, signal peptidase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001074893A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide
WO2001079436A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 10, et polynucleotide codant pour ce polypeptide
WO2001047998A1 (fr) Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide
WO2001081399A1 (fr) Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide
WO2001075019A2 (fr) Nouveau polypeptide, proteine humaine de mutation 11 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001048200A1 (fr) Nouveau polypeptide, proteine de jonction intercellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001081535A2 (fr) Nouveau polypeptide, proteine pax humaine 9.9, et polynucleotide codant pour ce polypeptide
WO2001079437A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 14, et polynucleotide codant pour ce polypeptide
WO2001081398A1 (fr) Nouveau polypeptide, proteine pax humaine 16, et polynucleotide codant pour ce polypeptide
WO2001074995A2 (fr) Nouveau polypeptide, protéine humaine de mutation 15 de l'ataxie telangiectasie, et de polynucléotide codant pour ce polypeptide
WO2001073061A1 (fr) Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide
WO2001072817A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001074875A1 (fr) Nouveau polypeptide, tyrosine kinase humaine 17, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP