WO2001068694A1 - Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001068694A1 WO2001068694A1 PCT/CN2001/000238 CN0100238W WO0168694A1 WO 2001068694 A1 WO2001068694 A1 WO 2001068694A1 CN 0100238 W CN0100238 W CN 0100238W WO 0168694 A1 WO0168694 A1 WO 0168694A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- human
- glycokinase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human glycokinase protein 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Hexokinase catalyzes the phosphorylation of glucose. This reversible reaction requires the participation of ATP. This reaction is the first step of the glycolysis reaction, and it is also the speed regulation step of the glycolysis reaction. It phosphorylates glucose, which is involved in glycolysis, to activate it.
- hexokinase there are four main types of hexokinase in spinal impetus: I, I I, I I I, IV.
- Class IV hexokinase is only expressed in liver cells and spleen P cells, and plays an important role in insulin secretion with a molecular weight of approximately 50 Kd.
- Class I Hexokinase is the major form of hexokinase in skeletal muscle.
- the molecular weights of class I and I I hexokinase are about 100Kd, and their Km values for glucose are slightly smaller. Structurally, they contain a small N-terminal hydrophobic membrane-binding domain followed by two very similar structures of approximately 450 residues. The first structure has lost its catalytic activity and evolved into a regulatory structure.
- hexokinase PI hexokinase PI
- PI hexokinase PI
- glucokinase hexokinase PI
- Hexokinase I is only 25% normal in red blood cells and platelets in patients with non-globular erythrocyte hemolytic anemia. In rapidly proliferating tumor tissues, the expression level of hexokinase I I is unusually high, in order to provide tumor cells with extremely high requirements for carbon source supply. Hexokinase I I may be a causative gene for non-insulin-dependent diabetes.
- the expression profile of the polypeptide of the present invention is very similar to the expression profile of human hexokinase protein 12, so their functions may be similar.
- the invention is named human hexokinase protein 10.
- human hexokinase protein 10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need in the domain to identify more human glycokinase protein 10 proteins involved in these processes, and in particular the amino acid sequence of this protein. Isolation of the new human glycokinase protein 10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human hexokinase protein 10.
- Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human hexokinase protein 10.
- Another object of the present invention is to provide a method for producing human hexokinase protein 10.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human glycokinase protein 10.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide of the present invention, human glycokinase protein 10.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human glycokinase protein 10. Invention grid.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 220-492 in SEQ ID NO: 1; and (b) a sequence having 1-921 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human hexokinase protein 10 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human hexokinase protein 10 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human glycokinase 10.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor's glycokinase protein 10 and human glycokinase protein 12.
- FIG. The upper graph is a graph of the expression profile of human glycokinase protein 10, and the lower graph is the graph of the expression profile of human glycokinase protein 12.
- Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human glycokinase protein 10.
- OkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human glycokinase protein 10, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to a human glycokinase protein 10.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human glycokinase protein 10 when combined with human glycokinase protein 10.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human glycokinase protein 10.
- Regular refers to a change in the function of human glycokinase protein 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human glycokinase protein 10. change.
- Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human glycokinase protein 10 using standard protein purification techniques. Basically Pure human hexokinase protein 10 can produce a single main band on a non-reducing polyacrylamide gel. The purity of human hexokinase protein 10 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "CTG-A” can be combined with the complementary sequence "G-AC-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as Cluster method (Higgin, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? , It can specifically bind to the epitope of human glycokinase protein 10.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human glycokinase protein 10 means that human glycokinase protein 10 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human glycokinase protein 10 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human glycokinase 10 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human hexokinase protein 10, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives, and analogs of human hexokinase protein 10.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human glycokinase protein 10 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or a UV type) in which an additional amino acid sequence is fused to a mature polypeptide sequence Column (such as the leader or secretory sequence or the sequence used to purify this polypeptide or protease sequence).
- such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 921 bases and its open reading frame 220-492 encodes 90 amino acids.
- this polypeptide has a similar expression profile to human hexokinase protein 12, and it can be deduced that the human hexokinase protein 10 has a similar function to human hexokinase protein 12.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID D NO: 2 but different from the coding region sequence shown in SEQ ID D NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human hexokinase protein 10.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding human glycokinase protein 10 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: ⁇ hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotides with common structural characteristics Fragment.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human glycokinase protein 10 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- detection of the protein product expressed by the human glycokinase protein 10 gene can be performed by immunization.
- Scientific techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human hexokinase protein 10 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology .
- a polynucleotide sequence encoding a human glycokinase protein 10 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human hexokinase protein 10 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known controllable genes in prokaryotic cells P
- WO 01/68694 A promoter expressed in a cell or eukaryotic cell or a virus thereof.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
- Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the replication initiation point, polyoma enhancers and adenovirus enhancers on the late side of the replication initiation point.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human glycokinase protein 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human hexokinase protein 10 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Hexokinase catalyzes the gallic acidification of glucose. This reversible reaction requires the participation of ATP. This reaction is the first step of the glycolysis reaction, and it is also the speed regulation step of the glycolysis reaction.
- hexokinase There are currently four types of hexokinase. Class IV hexokinase is only expressed in liver cells and spleen ⁇ cells, and plays an important role in insulin secretion. Class II hexokinase is the main form of hexokinase in skeletal muscle. Km values for glucose of type I and ⁇ hexokinase are slightly smaller. They all have specific conserved sequences to form their active rao t i f.
- Hexokinase I in red blood cells and platelets in patients with non-globular hemolytic anemia is only 25% of normal.
- the expression level of hexokinase ⁇ is unusually high, in order to provide tumor cells with extremely high requirements for carbon source supply.
- Hexokinase ⁇ may be a causative gene for non-insulin-dependent diabetes.
- the abnormal expression of the specific hexokinase mo tif will cause the abnormal function of the polypeptide containing this mo tif, which will lead to abnormal glycolysis process, and further affect the metabolic process of substances and energy. It can also affect insulin Secretion produces information regulation, or plays a role in tumor growth and proliferation, and produces related diseases such as material and energy metabolic disorders, non-insulin-dependent diabetes mellitus, non-globular erythrocyte hemolytic anemia, tumors, and embryonic development disorders , Growth and development disorders.
- the abnormal expression of the human glycokinase protein 10 of the present invention will produce various diseases, especially disorders of energy metabolism, non-insulin-dependent diabetes mellitus, aspheric erythrocyte hemolytic anemia, tumors, and embryonic development disorders. And growth disorders, these diseases include but are not limited to:
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, Thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer , Brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Malnutrition, stunting, dwarfism, sexual retardation
- the abnormal expression of the human glycokinase protein 10 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human hexokinase protein 10.
- Agonists enhance biological functions such as human glycokinase protein 10, which stimulates cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human glycokinase protein 10 can be cultured with labeled human glycokinase protein 10 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human glycokinase protein 10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human glycokinase protein 10 can bind to human glycokinase protein 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions .
- human hexokinase protein 10 When screening compounds as antagonists, human hexokinase protein 10 can be added to bioanalytical assays to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human hexokinase protein 10 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human glycokinase protein 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human glycokinase 10 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human hexokinase protein 10 epitope. These antibodies include (but are not limited to): many Cloned antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human glycokinase 10 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait.
- Techniques for preparing monoclonal antibodies to human glycokinase protein 10 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human glycokinase 10.
- Antibodies against human glycokinase 10 can be used in immunohistochemistry to detect human glycokinase 10 in biopsy specimens.
- Monoclonal antibodies that bind to human glycokinase 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human glycokinase protein 10 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human glycokinase 10 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to human glycokinase 10. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human glycokinase protein 10.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human hexokinase protein 10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The levels of human glycokinase protein 10 detected in the test can be used to explain the importance of human glycokinase protein 10 in various diseases and to diagnose diseases in which human glycokinase protein 10 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
- Polynucleotides encoding human hexokinase protein 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human glycokinase protein 10.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human hexokinase protein 10 to inhibit endogenous human hexokinase 10 activity.
- the mutated human glycokinase protein 10 can be shortened and lacks the signal transduction domain. Although it can bind to downstream substrates, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human glycokinase protein 10.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human hexokinase protein 10 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human glycokinase protein 10 can be found in the existing literature (Sambrook, et al.).
- recombinant polynucleotide encoding human glycokinase protein 10 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human glycokinase 10 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- a polynucleotide encoding human glycokinase protein 10 is useful for the diagnosis of diseases related to human glycokinase protein 10.
- the polynucleotide encoding human glycokinase protein 10 can be used to detect the expression of human glycokinase protein 10 or the abnormal expression of human glycokinase protein 10 in a disease state.
- a DNA sequence encoding human glycokinase protein 10 can be used to hybridize biopsy specimens to determine the expression of human glycokinase protein 10.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DNA chip (also called a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues.
- Human hexokinase 10 specific primers can also be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human hexokinase 10 transcripts.
- Detection of mutations in the human glycokinase protein 10 gene can also be used to diagnose human glycokinase protein 10-related diseases.
- Human Glycokinase Protein 10 Mutant Forms Included With Normal Wild Type Human Glycokinase Protein 10 DNA sequences are compared to point mutations, translocations, deletions, recombinations, and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases. .
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human glycokinase protein 10 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human glycokinase protein 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library.
- Dye termina te cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0278d09 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primer2 5'- TTTTGGGGAAACATCACAAAGAGT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l reaction volume containing 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ol / L dNTP, lOpmol primer, 1U Taq DM polymerization Enzyme (Clontech).
- the reaction was performed on a PE9600 D thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- p-actin was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-921bp shown in SEQ ID NO: 1.
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, Analysis and quantification were performed using a Phosphor Imager.
- Example 4 In vitro expression, isolation and purification of recombinant human glycokinase protein 10
- Primer3 5'- CATGCTAGCATGACTTCATTTCCTCTTCAAACT -3 '(Seq ID No: 5)
- Primer4 5'- CCCGAATTCTCACATGCTAATCTCACAAATAGT -3' (Seq ID No: 6)
- Nhel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid P ET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
- the PCR reaction was performed using the pBS-0278d09 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0278d09 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, 25 cycles total. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH50 using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR method and sequenced. The correct positive clone (pET-0278d09) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- the target protein was purified by SDS -PAGE electrophoresis, a single band was obtained at 10kDa ( Figure 2).
- the band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method.
- 15 amino acids at the N-terminus and SEQ ID NO Complete N-terminal 15 amino acid residues shown in 2
- Example 5 Production of anti-human hexokinase protein 10 antibody
- a peptide synthesizer (product of PE company) was used to synthesize the following human glycokinase 10-specific peptides: NH2-Met-Thr-Ser-Phe-Pro-Leu-Gln-Thr-Leu-Cys-Arg-Leu-Ser -Cys-Leu-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences
- the column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe for subsequent experiments.
- the film is washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see the documents DeRisi, LL., Lyer, V. & Brown, PO (1997) Science 278, 680-686. And the documents Helle, RA, Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDMs were used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280pm. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex raRNA Midi Kit (purchased from QiaGen). Light test also J Cy3dUTP (5-Amino-pr opargy 1-2 '-deoxyur i dine 5--tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) The mRNA of human mixed tissues was labeled with Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Araersham Phamacia Biotech) as a fluorescent reagent. mRNA, probes were prepared after purification. For specific steps and methods, see:
- the probes from the two types of tissues and the chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000.
- the instrument purchased from General Scanning Company, USA
- the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human glycokinase protein 10 and human glycokinase protein 12 according to the present invention are very similar.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU46295/01A AU4629501A (en) | 2000-03-15 | 2001-02-26 | A novel polypeptide - human hexokinase protein 10 and a polynucleotide sequence encoding the same |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00114901 CN1313391A (zh) | 2000-03-15 | 2000-03-15 | 一种新的多肽——人已糖激酶蛋白10和编码这种多肽的多核苷酸 |
CN00114901.6 | 2000-03-15 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001068694A1 true WO2001068694A1 (fr) | 2001-09-20 |
Family
ID=4584376
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000238 WO2001068694A1 (fr) | 2000-03-15 | 2001-02-26 | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1313391A (zh) |
AU (1) | AU4629501A (zh) |
WO (1) | WO2001068694A1 (zh) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7153666B2 (en) | 2003-07-17 | 2006-12-26 | General Atomics | Methods and compositions for determination of glycated proteins |
US7855079B2 (en) | 2006-07-25 | 2010-12-21 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
US7943385B2 (en) | 2006-07-25 | 2011-05-17 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
-
2000
- 2000-03-15 CN CN 00114901 patent/CN1313391A/zh active Pending
-
2001
- 2001-02-26 WO PCT/CN2001/000238 patent/WO2001068694A1/zh active Application Filing
- 2001-02-26 AU AU46295/01A patent/AU4629501A/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
BIOCHEM. BIOPHYS. RES. COMMUN., vol. 157, no. 3, 1988, pages 937 - 943 * |
J. BIOL. CHEM., vol. 263, no. 7, 1988, pages 3220 - 3224 * |
PROTEIN EXPR. PURIF., vol. 7, no. 1, 1996, pages 58 - 66 * |
PROTEIN EXPR. PURIF., vol. 8, no. 3, 1996, pages 374 - 380 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7153666B2 (en) | 2003-07-17 | 2006-12-26 | General Atomics | Methods and compositions for determination of glycated proteins |
US7855079B2 (en) | 2006-07-25 | 2010-12-21 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
US7943385B2 (en) | 2006-07-25 | 2011-05-17 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
US8318501B2 (en) | 2006-07-25 | 2012-11-27 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
US8338184B2 (en) | 2006-07-25 | 2012-12-25 | General Atomics | Methods for assaying percentage of glycated hemoglobin |
Also Published As
Publication number | Publication date |
---|---|
AU4629501A (en) | 2001-09-24 |
CN1313391A (zh) | 2001-09-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068694A1 (fr) | Nouveau polypeptide, proteine humaine d'hexokinase 10, et polynucleotide codant pour ce polypeptide | |
WO2001090378A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001072791A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001073063A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 13, et polynucleotide codant pour ce polypeptide | |
WO2001047998A1 (fr) | Nouveau polypeptide, proteine activant la ras gtpase 12, et polynucleotide codant pour ce polypeptide | |
WO2001072810A1 (fr) | Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001046242A1 (fr) | NOUVEAU POLYPEPTIDE, GENE σ-54 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001079435A2 (en) | A new polypeptide- human flavoprotein subunit 14 and the polynucleotide encoding it | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001047984A1 (fr) | Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001073046A1 (fr) | Nouveau polypeptide, quinine reductase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001048001A1 (fr) | Nouveau polypeptide, quinone-proteine reductase 7, et polynucleotide codant pour ce polypeptide | |
WO2001073065A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001083681A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide | |
WO2001072972A1 (fr) | Nouveau polypeptide, ribulose-biphosphate carboxylase humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001048219A1 (fr) | Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide | |
WO2001049863A1 (fr) | Nouveau polypeptide, ribulose bisphosphate carboxylase humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001048160A1 (fr) | Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide | |
WO2001081386A1 (fr) | Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |