WO2001068103A2 - Treatment of herpes infection using immunomodulatory polynucleotide sequences - Google Patents

Treatment of herpes infection using immunomodulatory polynucleotide sequences Download PDF

Info

Publication number
WO2001068103A2
WO2001068103A2 PCT/US2001/007841 US0107841W WO0168103A2 WO 2001068103 A2 WO2001068103 A2 WO 2001068103A2 US 0107841 W US0107841 W US 0107841W WO 0168103 A2 WO0168103 A2 WO 0168103A2
Authority
WO
WIPO (PCT)
Prior art keywords
iss
infection
sequence
individual
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/007841
Other languages
English (en)
French (fr)
Other versions
WO2001068103A9 (en
WO2001068103A3 (en
Inventor
Gary Van Nest
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dynavax Technologies Corp
Original Assignee
Dynavax Technologies Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA002402312A priority Critical patent/CA2402312A1/en
Priority to EP01957594A priority patent/EP1265622B1/en
Priority to AU2001281459A priority patent/AU2001281459C1/en
Priority to AU8145901A priority patent/AU8145901A/xx
Priority to JP2001566667A priority patent/JP2003526670A/ja
Priority to DE60142776T priority patent/DE60142776D1/de
Application filed by Dynavax Technologies Corp filed Critical Dynavax Technologies Corp
Priority to AT01957594T priority patent/ATE476984T1/de
Publication of WO2001068103A2 publication Critical patent/WO2001068103A2/en
Publication of WO2001068103A3 publication Critical patent/WO2001068103A3/en
Anticipated expiration legal-status Critical
Publication of WO2001068103A9 publication Critical patent/WO2001068103A9/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants

Definitions

  • TECHNICAL FIELD This invention is in the field of immunomodulatory polynucleotides, more particularly their use in ameliorating or preventing herpes virus infection and/or symptoms of herpes virus infection.
  • Herpes viruses cause a number of significant disorders.
  • Herpes simplex viruses can be neurovirulent (e.g., infect and replicate in central nervous system tissue), although HSV infections of the brain are rare. HSV infections in neonates and immunosuppressed individuals can be severe.
  • Herpes simplex virus- 1 (HSV-1) is primarily responsible for orolabial herpetic lesions, although genital herpes may also be caused by HSV-1.
  • Herpes simplex virus-2 (HSV-2) is the primary cause of genital herpes, and genital herpes caused by HSV-2 are generally more severe than genital herpes due to HSV-1. Additionally, HSV-2 represents a greater public health threat, as HSV-2 infection is associated with certain genital tract cancers and can be transmitted from mother to child during vaginal delivery.
  • VZV herpes virus varicella zoster virus
  • human disease varicella also known as chicken pox.
  • Primary infection leads to latent infection of dorsal root ganglia cells, giving rise to a reservoir of virus which can be reactivated.
  • Reactivation of latent VZV gives rise to a condition referred to as herpes zoster or shingles.
  • Both primary and reactivated VZV infections give rise to cutaneous lesions, although varicella symptoms can include mucosal lesions as well.
  • Genital HSV-2 is among the most commonly sexually transmitted infectious diseases in women. Clinical infection occurs in 20-30% of adults (Parr et al. (1997) J Reprod. Immunol.
  • genital HSV-2 The incidence of genital HSV-2 continues to escalate. An estimated 700,000 new cases occur each year in the U.S. alone. Reactivation is common, resulting in an estimated 25 million cases of recurrent genital herpes each year. Transmission commonly occurs through unprotected sexual contact, particularly during periods of asymptomatic viral shedding, and results in heightened morbidity and mortality when perinatal fetal transmission occurs.
  • Current treatment of genital HSV-2 includes antiviral drugs that are merely palliative, controlling symptoms and exacerbations without providing a cure. Additionally, these chemotherapeutics are costly and may be associated with adverse reactions and potential drug interactions.
  • Vaccines are a more desirable alternative to drug treatment or prophylaxis, and have been developed against HSV-2 to limit transmission or recurrence.
  • Specific vaccines that have shown efficacy in animal models and clinical studies used attenuated virus, recombinant HSV-2 surface proteins or their corresponding cDNA. Their utility, however, is counterbalanced by the need of parenteral administration, often with poorly tolerated and unapproved adjuvants, and with less than desired clinical efficacy in humans and patient acceptability.
  • Clinical control of HSV-2 currently is limited to the use of topical, oral or intravenous antiviral drugs. These agents may be effective in controlling symptoms, and may diminish transmission and recurrence rates, but are not curative. These drugs also do not prevent transmission, particularly during asymptomatic viral shedding. Clear prevention of transmission or recurrence from latency would be a preferred method of clinical control.
  • Immunologic prophylaxis against HSV-2 through vaccination has, therefore, emerged as a therapeutic alternative to chemotherapy. More specifically, highly targeted immunogenic components responsible for virus-host propagation, such as glycoprotein D, have provided the most appropriate strategy for immunization. Stokes et al. (1997) Virus Res. 50:159-174.
  • HSV-2 glycoprotein D HSV-2 glycoprotein D
  • gD2 HSV-2 glycoprotein D
  • the gD2 is an integral membrane protein, present in the viral envelope and is required for viral attachment and subsequent propagation in the host cell.
  • the mature protein is composed of 368 residues, the C- terminal portion containing the transmembrane region.
  • nucleic acid vaccines such as plasmid DNA encoding gD2
  • plasmid DNA encoding gD2 can also effectively immunize against HSV-2 by stimulation of both cellular and humoral immune responses.
  • Bourne et al. (1996) J Infect Dis. 173:800-807; Bourne et al. (1996) Vaccine 14:1230-1234.
  • all these vaccines were designed for parenteral administration, often containing unapproved or poorly tolerated adjuvants.
  • mucosal vaccination may provide more effective immunization against pathogens such as HSV-2, in essence, by inhibiting cellular attachment or neutralizing toxins at the point of exposure, e.g., within the genital mucosa, prior to pathogen and host interaction. Clements (1997) Nature Biotech. 15:622-623. These immune responses were amplified significantly with co-administration of adjuvants, such as cholera toxin ⁇ -subunit.
  • mucosal associated lymphoid tissue participates in the generation of local immune-mediated protection.
  • mucosal vaccination such as a vaginal delivery, precludes the necessity of a pyrogen-free vaccine, causes fewer adverse reactions, and is amenable to routine booster immunizations.
  • ISS immunostimulatory sequences
  • the Thl subset of helper cells is responsible for classical cell-mediated functions such as delayed-type hypersensitivity and activation of cytotoxic T lymphocytes (CTLs), whereas the Th2 subset functions more effectively as a helper for B-cell activation.
  • CTLs cytotoxic T lymphocytes
  • the type of immune response to an antigen is generally influenced by the cytokines produced by the cells responding to the antigen. Differences in the cytokines secreted by Thl and Th2 cells are believed to reflect different biological functions of these two subsets. See, for example, Romagnani (2000) Ann. Allergy Asthma Immunol. 85:9-18.
  • mice injected intradermally with Escherichia coli (E. coli) ⁇ -galactosidase ( ⁇ -Gal) in saline or in the adjuvant alum responded by producing specific IgGl and IgE antibodies, and CD4 + cells that secreted IL-4 and IL-5, but not IFN- ⁇ , demonstrating that the T cells were predominantly of the Th2 subset.
  • E. coli Escherichia coli
  • ⁇ -Gal ⁇ -galactosidase
  • mice injected intradermally (or with a tyne skin scratch applicator) with plasmid DNA (in saline) encoding ⁇ -Gal and containing an ISS responded by producing IgG2a antibodies and CD4 + cells that secreted IFN- ⁇ , but not IL-4 and IL-5, demonstrating that the T cells were predominantly of the Thl subset.
  • specific IgE production by the plasmid DNA- injected mice was reduced 66-75%. Raz et al. (1996) Proc. Natl. Acad. Sci. USA 93:5141- 5145.
  • the response to naked DNA immunization is characterized by production of IL-2, TNF ⁇ and IFN- ⁇ by antigen-stimulated CD4 + T cells, which is indicative of a Thl- type response.
  • This is particularly important in treatment of allergy and asthma as shown by the decreased IgE production.
  • the ability of immunostimulatory polynucleotides to stimulate a Thl-type immune response has been demonstrated with bacterial antigens, viral antigens and with allergens (see, for example, WO 98/55495).
  • the invention provides methods of suppressing, ameliorating and/or preventing herpes virus infection in an individual using immunostimulatory polynucleotide sequences. Accordingly, in one aspect, the invention provides methods of preventing, palliating, ameliorating, reducing and/or eliminating one or more symptoms of herpes virus infection, preferably herpes simplex virus infection, without administering an alphaherpesvirinae antigen.
  • a polynucleotide comprising an immunostimulatory sequence is administered to an individual who is at risk of being exposed to alphaherpesvirinae, has been exposed to alphaherpesvirinae or is infected with alphaherpesvirinae.
  • the ISS- containing polynucleotide is administered without any alphaherpesvirinae antigens (i.e., alphaherpesvirinae antigen is not co-administered).
  • Administration of the ISS results in reduced incidence, recurrence, and/or severity of one or more symptoms of alphaherpesvirinae infection.
  • the invention provides methods for preventing a symptom of alphaherpesvirinae infection in an individual at risk of being exposed to alphaherpesvirinae which entail administering an effective amount of a composition comprising a polynucleotide comprising an immunostimulatory sequence (ISS) (i.e., an amount of the composition sufficient to prevent a symptom of alphaherpesvirinae infection) to the individual, wherein the ISS comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae antigen is not administered in conjunction with administration of the composition (i.e., antigen is not administered with the ISS-containing polynucleotide), thereby preventing a symptom of alphaherpesvirinae infection.
  • ISS immunostimulatory sequence
  • Another embodiment of the invention provides methods for preventing a symptom of alphaherpesvirinae infection in an individual who has been exposed to alphaherpesvirinae which entail administering an effective amount of a composition comprising a polynucleotide comprising an ISS to the individual, wherein the ISS comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae antigen is not
  • the invention provides methods of reducing the level of viral shedding in an infected individual with alphaherpesvirinae, such as HSV-l or HSV-2.
  • Another embodiment of the invention provides methods of suppressing an alphaherpesvirinae infection in an individual infected with or at risk of being infected with alphaherpesvirinae which entail admimstering an effective amount of a composition comprising a polynucleotide comprising an ISS to the individual, wherein the ISS comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae antigen is not administered in conjunction with administration of the composition, thereby suppressing an alphaherpesvirinae infection.
  • Another embodiment of the invention provides methods of delaying development of an alphaherpesvirinae infection and/or a symptom of alphaherpesvirinae infection in an individual infected or at risk of being infected with alphaherpesvirinae which entail administering an effective amount of a composition comprising a polynucleotide comprising an ISS to the individual, wherein the ISS comprises the sequence 5 '-C, G-3 ' and wherein an alphaherpesvirinae antigen is not administered in conjunction with administration of the composition, thereby delaying development of wx alphaherpesvirinae infection and/or a symptom of alphaherpesvirinae infection.
  • Another embodiment of the invention provides methods of reducing duration of an alphaherpesvirinae infection in an individual infected or at risk of being infected with alphaherpesvirinae which entail administering an effective amount of a composition comprising a polynucleotide comprising an ISS to the individual, wherein the ISS comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae antigen is not administered in conjunction with administration of the composition, thereby delaying development of an alphaherpesvirinae infection.
  • the invention provides methods of reducing recurrence of a symptom of alphaherpesvirinae infection in an individual infected with alphaherpesvirinae which entail administering an effective amount of a composition comprising a polynucleotide comprising an ISS to the individual, wherein the ISS comprises the sequence 5'-C, G-3' and wherein an alphaherpesvirinae antigen is not administered in conjunction with administration of the composition, thereby reducing recurrence of a symptom of alphaherpesvirinae infection.
  • kits for use in ameliorating and/or preventing a symptom of alphaherpesvirinae infection in an individual infected with, exposed to or at risk of being exposed to alphaherpesvirinae.
  • the kits comprise a composition comprising a polynucleotide comprising an ISS, wherein the ISS comprises the sequence 5'-C 5 G-3' and wherein the kit does not comprise an alphaherpesvirinae antigen, and the kits comprise instructions for administration of the composition to an individual infected with, exposed to or at risk of being exposed to alphaherpesvirinae.
  • the ISS comprises the sequence 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, G-3' or 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, C-3'.
  • the sequence 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, G-3' or 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, C-3'.
  • ISS comprises a sequence selected from the group consisting of AACGTTCC, AACGTTCG, GACGTTCC, and GACGTTCG.
  • the ISS comprises the sequence 5'-T, C, G-3'. In some embodiments of the methods and kits of the invention, the ISS comprises the sequence TGACTGTGAACGTTCGAGATGA (SEQ ID NO: 1).
  • the individual is a mammal. In further embodiments, the mammal is human.
  • the alphaherpesvirinae is a herpes simplex virus.
  • the herpes simplex virus is a herpes simplex virus 1 (HSV-1) virus or a herpes simplex virus 2 (HSV-2) virus.
  • the alphaherpesvirinae is varicella zoster virus (VZV).
  • Figure 1 summarizes results of ISS treatment of mice infected with HSV-2.
  • the graph depicts animal survival following a lethal challenge dose of HSV-2 and subsequent treatment regimens. Animals that received an ISS treatment demonstrated improved survival as compared to animals that received non-ISS oligonucleotide treatments, PBS or no treatment.
  • FIG. 2 summarizes results of ISS treatment of guinea pigs infected with HSV-2.
  • the graphs depict cumulative mean herpetic lesions over the observation period in groups of animals receiving a single ISS treatment ("ISS 1"), receiving a total of three ISS treatments (“ISS 3”) or receiving PBS alone (“sham”).
  • Figure 3 summarizes results of ISS treatment of guinea pigs infected with HSV-2.
  • the graph depicts cumulative mean herpetic lesions over the observation period in groups of animals receiving a single ISS treatment, a single non-ISS oligonucleotide treatment, 21 acyclovir treatments or no treatment.
  • Figure 4 is a graphical depiction of the average number of genomic equivalents per shedding event from herpetic lesions in guinea pigs.
  • the invention provides methods of using immunomodulatory polynucleotides that induce anti-viral cell-mediated immune responses and promote anti-herpes virus effects.
  • the methods described herein are applicable to alphaherpesvirinae, (e.g., herpes simplex viruses as well as varicella zoster virus), and are particularly applicable to preventing and/or treating herpes simplex virus infection.
  • a polynucleotide comprising an immunostimulatory sequence an "ISS" is administered to an individual who is at risk of being exposed to alphaherpesvirinae, has been exposed to alphaherpesvirinae or is infected with alphaherpesvirinae.
  • Administration of the ISS without co-administration of a herpes virus antigen results in reduced incidence, recurrence and/or severity of one or more symptoms of alphaherpesvirinae infection in an animal model of herpes virus infection.
  • kits for ameliorating and/or preventing a symptom of herpes virus infection in exposed individuals comprise a polynucleotide comprising an ISS and instructions describing the administration of an ISS-containing polynucleotide to an individual for the intended treatment.
  • ISS administration of ISS to an art-accepted model of herpes virus infection in mice, namely mice infected with HS V-2
  • treatment with ISS resulted in decreased incidence (i.e., individuals showing symptoms of HSV-2 infection), improved survival and delays in both appearance of symptoms and time to death in symptomatic individuals.
  • an art-accepted model of acute and recurrent herpes simplex virus disease namely guinea pigs infected with HSV-2
  • treatment with ISS resulted in a significant reduction of lesion recurrences and a significant reduction in the level of viral shedding.
  • An advantage to a reduction in viral shedding Since the level of virus shedding is correlated with viral transmission, ISS treatment may be effective in a reduction in viral transmission.
  • ISS in contrast to previous reports of immune modulation by ISS, we report clinical efficacy of ISS in this viral context.
  • herpes virus refers to a virus which is a member of the family herpesviridae.
  • Herpes viruses comprise a linear DNA genome contained in a capsid.
  • the capsid comprises 162 capsomeres and is approximately 100-110 nm in diameter.
  • the capsid is surrounded by an amorphous tegument and enclosed by a envelope covered with viral glycoprotein spikes.
  • Human he ⁇ es viruses include he ⁇ es simplex virus 1 (HSV-1, also known as human he ⁇ esvirus 1), he ⁇ es simplex virus 2 (HSV-2, also known as human he ⁇ esvirus 2), varicella-zoster virus (VZV, also known as human he ⁇ esvirus 3), Epstein-Barr virus (EBV, also known as human he ⁇ esvirus 4), cytomegalovirus (CMV, also known as human he ⁇ esvirus 5), as well as human he ⁇ esviruses 6, 7, and 8.
  • HSV-1 he ⁇ es simplex virus 1
  • HSV-2 also known as human he ⁇ esvirus 2
  • VZV varicella-zoster virus
  • EBV Epstein-Barr virus
  • CMV cytomegalovirus
  • human he ⁇ esvirus 5 also known as human he ⁇ esvirus 5
  • HSV-1, HSV-2 and VZV are human members of the subfamily alphaherpesvirinae.
  • Varicella zoster virus or “VZV” refers to VZV which infects human cells.
  • Alphaherpesvirinae axe characterized by a short reproductive cycle, efficient destruction of infected cells, and the ability to establish latent infections. Active alphaherpesvirinae infections result in cutaneous, mucosal and/or sensory neuron lesions.
  • He ⁇ es simplex viruses include HSV-1 and HSV-2.
  • “Exposure” to a virus denotes encounter with virus which allows infection, such as, for example, upon contact with an infected individual.
  • An individual is “seronegative” for a virus if antibodies specific to the virus cannot be detected in blood or serum samples from the individual using methods standard in the art, such as ELISA.
  • an individual is “seropositive” for a virus if antibodies specific for the virus can be detected in blood or serum samples from the individual using methods standard in the art, such as ELISA.
  • An individual is said to "seroconvert” for a virus when antibodies to the virus can be detected in blood or serum from an individual who was previously seronegative.
  • An individual who is "at risk of being exposed" to a he ⁇ es virus is an individual who may encounter the virus such that the virus infects the individual (i.e., virus enters cells and replicates).
  • an individual at risk of being exposed to HSV-1 is any individual who is seronegative for HSV-1.
  • an individual at risk of being exposed to the virus is an individual who is seronegative for HSV-2 and who is engaging in one or more high risk behaviors (i.e., oral sex or sexual relations without the use of barrier prophylactics).
  • An individual at risk of being exposed to VZV is an individual who comes in close proximity to another individual who has active primary or recurrent VZV lesions.
  • “Suppressing" he ⁇ es virus infection indicates any aspect of viral infection, such as viral replication, time course of infection, amount (titer) of virus, lesions, and/or one or more symptoms is curtailed, inhibited, or reduced (in terms of severity and/or duration) in an individual or a population of individuals treated with an ISS-containing polynucleotide in accordance with the invention as compared to an aspect of viral infection in an individual or a population of individuals not treated in accordance with the invention.
  • Reduction in viral titer includes, but is not limited to, elimination of the virus from an infected site or individual.
  • Viral infection can be assessed by any means known in the art, including, but not limited to, measurement of virus particles, viral nucleic acid or viral antigens and detection of one or more symptoms of viral infection and detection and/or measurement of anti-virus antibodies.
  • Anti-virus antibodies are widely used to detect and monitor viral infection and generally are commercially available.
  • "Palliating" a disease or one or more symptoms of a disease or infection means lessening the extent and/or time course of undesirable clinical manifestations of a disease state or infection in an individual or population of individuals treated with an ISS in accordance with the invention.
  • "delaying" development of a viral infection or a symptom of viral infection means to defer, hinder, slow, retard, stabilize, and/or postpone development of the disease or symptom when compared to not using the method(s) of the invention. This delay can be of varying lengths of time, depending on the history of the disease and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease.
  • “Reducing severity of a symptom” or “ameliorating a symptom” of viral infection means a lessening or improvement of one or more symptoms of viral infection as compared to not administering an ISS-containing polynucleotide. "Reducing severity” also includes shortening or reduction in duration of a symptom. For alphaherpesvirinae, these symptoms are well known in the art and include, but are not limited to, cutaneous or mucosal lesions (e.g., cutaneous, oral or genital he ⁇ etic sores) and viral shedding (e.g., virus excretion). "Reducing duration of viral infection” means the length of time of viral infection (usually indicated by symptoms) is reduced, or shortened, as compared to not administering an ISS-containing polynucleotide.
  • Preventing a symptom of infection by a he ⁇ es virus means that the symptom does not appear after exposure to the virus.
  • Reducing recurrence refers to a reduction in frequency, severity and/or quantity of one or more recurrent viral symptoms in an infected individual or a population of infected individuals. When applied to a population of individuals, “reducing recurrence” means a reduction in the mean or median frequency, severity, quantity and/or duration of recurrent viral symptoms.
  • infected individual refers to an individual who has been infected by a he ⁇ es virus.
  • symptoms of infection include seropositivity (for any of the alphaherpesvirinae), orolabial he ⁇ etic lesions (for HSV-1), genital he ⁇ etic lesions (for HSV-2 and occasionally for HSV-1), the disease varicella, also known as the chicken pox (for VZV), as well as other symptoms known in the art.
  • a “biological sample” encompasses a variety of sample types obtained from an individual and can be used in a diagnostic or monitoring assay.
  • the definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom, and the progeny thereof.
  • the definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as proteins or polynucleotides.
  • biological sample encompasses a clinical sample, and also includes cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluid, and tissue samples.
  • “Viral titer” is a term well known in the art and indicates the amount of virus in a given biological sample. Amount of virus are indicated by various measurements, including, but not limited to, amount of viral nucleic acid; presence of viral particles; replicating units (RU); plaque forming units (PFU). Generally, for fluid samples such as blood and urine, amount of virus is determined per unit fluid, such as milliliters. For solid samples such as tissue samples, amount of virus is determined per weight unit, such as grams. Methods for determining amount of virus are known in the art and described herein.
  • mammals include, but are not limited to, humans, farm animals, sport animals, rodents, primates and certain pets. Vertebrates also include, but are not limited to, birds (i.e., avian individuals) and reptiles (i.e., reptilian individuals).
  • ISS refers to polynucleotide sequences that effect a measurable immune response as measured in vitro, in vivo and/or ex vivo.
  • measurable immune responses include, but are not limited to, antigen-specific antibody production, secretion of cytokines, activation or expansion of lymphocyte populations such as NK cells, CD4 + T lymphocytes, CD8 + T lymphocytes, B lymphocytes, and the like.
  • the ISS sequences preferentially activate a Thl-type response.
  • a polynucleotide for use in methods of the invention contains at least one ISS.
  • polynucleotide and “oligonucleotide” include single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded RNA (ssRNA) and double-stranded RNA (dsRNA), modified oligonucleotides and oligonucleosides or combinations thereof.
  • the polynucleotide can be linearly or circularly configured, or the polynucleotide can contain both linear and circular segments.
  • Adjuvant refers to a substance which, when added to an immunogenic agent such as antigen, nonspecifically enhances or potentiates an immune response to the agent in the recipient host upon exposure to the mixture.
  • an “effective amount” or a “sufficient amount” of a substance is an amount sufficient to effect beneficial or desired results, including clinical results.
  • An effective amount can be administered in one or more administrations.
  • a “therapeutically effective amount” is an amount to effect beneficial clinical results, including, but not limited to, alleviation of one or more symptoms associated with viral infection as well as prevention of disease (e.g., prevention of one or more symptoms of infection).
  • a microcarrier is considered “biodegradable” if it is degradable or erodable under normal mammalian physiological conditions. Generally, a microcarrier is considered biodegradable if it is degraded (i.e., loses at least 5% of its mass and/or average polymer length) after a 72 hour incubation at 37° C in normal human serum. Conversely, a microcarrier is considered “nonbiodegradable” if it is not degraded or eroded under normal mammalian physiological conditions.
  • a microcarrier is considered nonbiodegradable if it not degraded (i.e., loses less than 5% of its mass and/or average polymer length) after at 72 hour incubation at 37° C in normal human serum.
  • the term "immunostimulatory sequence-microcarrier complex" or "ISS-MC complex” refers to a complex of an ISS-containing polynucleotide and a microcarrier.
  • the components of the complex may be covalently or non-covalently linked.
  • Non-covalent linkages may be mediated by any non-covalent bonding force, including by hydrophobic interaction, ionic (electrostatic) bonding, hydrogen bonds and/or van der Waals attractions.
  • the linkage is generally via a hydrophobic moiety (e.g., cholesterol) covalently linked to the ISS.
  • a hydrophobic moiety e.g., cholesterol
  • the term “comprising” and its cognates are used in their inclusive sense; that is, equivalent to the term “including” and its corresponding cognates.
  • a symptom of viral infection includes one or more additional symptoms.
  • the invention provides methods for preventing one or more symptoms of he ⁇ es virus infection, treating, reducing severity of and/or delaying development of one or more symptoms of he ⁇ es virus infection and reducing recurrence of one or more symptoms of he ⁇ es virus infection by administering an ISS-containing polynucleotide (used interchangeably herein with "ISS") to an individual without administering a he ⁇ es virus antigen.
  • ISS ISS-containing polynucleotide
  • the he ⁇ es virus may be any of the alphaherpesvirinae, preferably one of the he ⁇ es simplex viruses.
  • An ISS-containing composition which does not include a he ⁇ es virus antigen is administered to an individual at risk of exposure to, exposed to, infected with and/or exhibiting one or more symptoms of infection by alphaherpesvirinae.
  • Individuals receiving ISS are preferably mammal, more preferably human.
  • he ⁇ es virus antigen is not administered to the individual in conjunction with administration of an ISS (i.e., is not administered in a separate administration at or about the time of administration of the ISS).
  • the level (e.g., magnitude or amount) of viral shedding is reduced after administration of ISS.
  • the individual is at risk of being exposed to virus. Determination of an at risk individual is based on one or more factors that are associated with disease development and are generally known by, or can be assessed by, a skilled clinician. At risk individuals may be especially suitable candidates to receive ISS, as these individuals are generally considered to be particularly susceptible to developing symptoms of infection, which could also further lead to other complications. For example, in the context of HSV- 1 infection, any non-infected individual is considered at risk, due to the wide spread prevalence of HSV- 1 infection. In the context of HSV-2 infection, an individual at risk is an individual who practices unsafe sexual practices (e.g., engages in oral-genital or genital-genital contact without the use of barrier-type prophylactics). Other examples of at risk individuals are those who are immunocompromised. An individual at risk of being exposed to VZV is an individual who comes in close proximity to another individual who has active primary or recurrent VZV lesions.
  • the individual is, or has been, exposed to and/or infected by virus. Exposure to virus is generally indicated by sufficient contact with an infected individual or infected location. Exposure can also be indicated by development of one or more symptoms associated with viral infection. Infection by virus may be indicated by any of the above, as well as detection of virus or anti-virus antibodies (i.e., the individual becomes seropositive) in a biological sample from the individual.
  • the methods of this invention entail administering a polynucleotide comprising an ISS (or a composition comprising such a polynucleotide).
  • the immunomodulatory polynucleotide contains at least one ISS, and can contain multiple ISSs.
  • the ISSs can be adjacent within the polynucleotide, or they can be separated by additional nucleotide bases within the polynucleotide. Alternately, multiple
  • ISSs may be delivered as individual polynucleotides.
  • ISS have been described in the art and may be readily identified using standard assays which indicate various aspects of the immune response, such as cytokine secretion, antibody production, NK cell activation and T cell proliferation. See, e.g., WO 97/28259; WO 98/16247; WO 99/11275; Krieg et al. (1995); Yamamoto et al. (1992); Ballas et al. (1996); Klinman et al. (1997); Sato et al. (1996); Pisetsky (1996a); Shimada et al. (1986) Jpn. J. Cancer Res. 77:808-816; Cowdery et al. (1996) J. Immunol. 156:4570-4575; Roman et al. (1997); and Lipford et al. (1997a).
  • the ISS can be of any length greater than 6 bases or base pairs and generally comprises the sequence 5'-cytosine, guanine-3', preferably greater than 15 bases or base pairs, more preferably greater than 20 bases or base pairs in length.
  • the cytosine of the 5'-cytosine, guanine-3' sequence is unmethylated.
  • An ISS may also comprise the sequence 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, G-3'.
  • An ISS may also comprise the sequence 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, C- 3'.
  • an ISS may comprise (i.e., contain one or more of) the sequence 5'-T, C, G-3'.
  • an ISS may comprise the sequence 5'-C, G, pyrimidine, pyrimidine, C, G-3' (such as 5'-CGTTCG-3').
  • an ISS may comprise the sequence 5'-C, G, pyrimidine, pyrimidine, C, G, purine, purine-3'.
  • an ISS comprises the sequence 5 '-purine, purine,
  • C, G, pyrimidine, pyrimidine-3' (such as 5'-AACGTT-3').
  • an ISS may comprise the sequence 5'-purine, T, C, G, pyrimidine, pyrimidine-3'.
  • an ISS-containing polynucleotide is less than about any of the following lengths (in bases or base pairs): 10,000; 5,000; 2500; 2000; 1500; 1250;
  • an ISS-containing polynucleotide is greater than about any of the following lengths (in bases or base pairs): 8; 10; 15; 20; 25; 30; 40; 50; 60; 75; 100; 125; 150; 175; 200; 250;
  • ISS can be any of a range of sizes having an upper limit of 10,000; 5,000; 2500; 2000;
  • the ISS comprises any of the following sequences:
  • GACGCTCC GACGTCCC; GACGTTCC; GACGCCCC; AGCGTTCC; AGCGCTCC;
  • AGCGTCCC AGCGCCCC; AACGTCCC; AACGCCCC; AACGTTCC; AACGCTCC; GGCGTTCC; GGCGCTCC; GGCGTCCC; GGCGCCCC; GACGCTCG; GACGTCCG;
  • GACGCCCG GACGTTCG; AGCGCTCG; AGCGTTCG; AGCGTCCG; AGCGCCCG;
  • AACGTCCG AACGCCCG
  • AACGTTCG AACGCTCG
  • GGCGTTCG GGCGCTCG
  • the immunomodulatory polynucleotide comprises the sequence 5'-TGACTGTGAACGTTCGAGATGA-3' (SEQ ID NO.-l).
  • the ISS comprises any of the following sequences:
  • GACGCU GACGUC; GACGUU; GACGUT; GACGTU; AGCGUU;AGCGCU;
  • the ISS comprises any of the following sequences:
  • GABGCTCC GABGTCCC; GABGTTCC; GABGCCCC; AGBGTTCC; AGBGCTCC;
  • AGBGTCCC AGBGCCCC; AABGTCCC; AABGCCCC; AABGTTCC; AABGCTCC; GGBGTTCC; GGBGCTCC; GGBGTCCC; GGBGCCCC; GABGCTCG; GABGTCCG;
  • GABGCCCG GABGTTCG; AGBGCTCG; AGBGTTCG; AGBGTCCG; AGBGCCCG;
  • AABGTCCG AABGCCCG; AABGTTCG; AABGCTCG; GGBGTTCG; GGBGCTCG;
  • GGBGTCCG GGBGCCCG; GABGCTBG; GABGTCBG; GABGCCBG; GABGTTBG; AGBGCTBG; AGBGTTBG; AGBGTCBG; AGBGCCBG; AABGTCBG; AABGCCBG;
  • AABGTTBG AABGCTBG; GGBGTTBG; GGBGCTBG; GGBGTCBG; GGBGCCBG, where B is 5-bromocytosine.
  • the ISS comprises any of the following sequences:
  • GABGCUCC GABGUCCC; GABGUTCC; GABGTUCC; GABGUUCC; AGBGUUCC; AGBGTUCC; AGBGUTCC; AGBGCUCC; AGBGUCCC; AABGUCCC; AABGUUCC;
  • AABGUTCC AABGTUCC
  • AABGCUCC GGBGUUCC
  • GGBGUTCC GGBGTUCC
  • GGBGCUCC GGBGUCCC; GABGCUCG; GABGUCCG; GABGUUCG;
  • GABGUTCG GABGTUCG; AGBGCUCG; AGBGUUCG; AGBGUTCG; AGBGTUCG;
  • AABGTUBG AABGCUBG
  • GGBGUUBG GGBGUTBG
  • GGBGTUBG GGBGCUBG
  • the ISS comprises any of the sequences:
  • the immunomodulatory polynucleotide comprises the sequence 5'-TCGTCGAACGTTCGTTAACGTTCG-3' (SEQ ID NO:9).
  • An ISS and/or ISS-containing polynucleotide may contain modifications.
  • Modifications of ISS include any known in the art, but are not limited to, modifications of the 3' -OH or 5' -OH group, modifications of the nucleotide base, modifications of the sugar component, and modifications of the phosphate group. Various such modifications are described below.
  • An ISS may be single stranded or double stranded DNA, as well as single or double-stranded RNA or other modified polynucleotides.
  • An ISS may or may not include one or more palindromic regions, which may be present in the motifs described above or may extend beyond the motif.
  • An ISS may comprise additional flanking sequences, some of which are described herein.
  • An ISS may contain naturally-occurring or modified, non- naturally occurring bases, and may contain modified sugar, phosphate, and/or termini.
  • phosphate modifications include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (bridging or non-bridging), phosphotriester and phosphorodithioate and may be used in any combination. Other non-phosphate linkages may also be used.
  • polynucleotides of the present invention comprise phosphorothioate backbones.
  • Sugar modifications known in the field, such as 2'-alkoxy- RNA analogs, 2'-amino-RNA analogs and 2'-alkoxy- or amino-RNA/DNA chimeras and others described herein, may also be made and combined with any phosphate modification.
  • Examples of base modifications include, but are not limited to, addition of an electron- withdrawing moiety to C-5 and/or C-6 of a cytosine of the ISS (e.g., 5-bromocytosine, 5- chlorocytosine, 5-fluorocytosine, 5-iodocytosine).
  • the ISS can be synthesized using techniques and nucleic acid synthesis equipment which are well known in the art including, but not limited to, enzymatic methods, chemical methods, and the degradation of larger polynucleotide sequences. See, for example, Ausubel et al. (1987); and Sambrook et al. (1989).
  • the individual units When assembled enzymatically, the individual units can be ligated, for example, with a ligase such as T4 DNA or RNA ligase.
  • a ligase such as T4 DNA or RNA ligase.
  • Polynucleotide degradation can be accomplished through the exposure of an polynucleotide to a nuclease, as exemplified in U.S. Patent No. 4,650,675.
  • the ISS can also be isolated using conventional polynucleotide isolation procedures. Such procedures include, but are not limited to, hybridization of probes to genomic or cDNA libraries and synthesis of particular native sequences by the polymerase chain reaction.
  • Circular ISS can be isolated, synthesized through recombinant methods, or chemically synthesized. Where the circular ISS is obtained through isolation or through recombinant methods, the ISS will preferably be a plasmid.
  • the chemical synthesis of smaller circular oligonucleotides can be performed using any method described in the literature. See, for instance, Gao et al. (1995) Nucleic Acids Res. 23:2025-2029; and Wang et al. (1994) Nucleic Acids Res. 22:2326-2333. The techniques for making polynucleotides and modified polynucleotides are known in the art.
  • Naturally occurring DNA or RNA, containing phosphodiester linkages is generally synthesized by sequentially coupling the appropriate nucleoside phosphoramidite to the 5'-hydroxy group of the growing polynucleotide attached to a solid support at the 3'- end, followed by oxidation of the intermediate phosphite triester to a phosphate triester.
  • the polynucleotide sequence Once the desired polynucleotide sequence has been synthesized, the polynucleotide is removed from the support, the phosphate triester groups are deprotected to phosphate diesters and the nucleoside bases are deprotected using aqueous ammonia or other bases.
  • the ISS can also contain phosphate-modified polynucleotides. Synthesis of polynucleotides containing modified phosphate linkages or non-phosphate linkages is also know in the art. For a review, see Matteucci (1997) "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (D.J. Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY.
  • the phosphorous derivative (or modified phosphate group) which can be attached to the sugar or sugar analog moiety in the polynucleotides of the present invention can be a monophosphate, diphosphate, triphosphate, alkylphosphonate, phosphorothioate, phosphorodithioate or the like.
  • the preparation of the above-noted phosphate analogs, and their inco ⁇ oration into nucleotides, modified nucleotides and polynucleotides, per se, is also known and need not be described here in detail. Peyrottes et al. (1996) Nucleic Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucleic Acids Res.
  • Polynucleotides with phosphorothioate backbones can be more immunogenic than those with phosphodiester backbones and appear to be more resistant to degradation after injection into the host.
  • ISS-containing polynucleotides used in the invention can comprise ribonucleotides
  • the sugar moiety can be pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, and a sugar "analog" cyclopentyl group.
  • the sugar can be in pyranosyl or in a furanosyl form.
  • the sugar moiety is preferably the furanoside of ribose, deoxyribose, arabinose or 2'-0-alkylribose, and the sugar can be attached to the respective heterocyclic bases either in ⁇ or ⁇ anomeric configuration.
  • Sugar modifications include, but are not limited to, 2 '-alkoxy-RNA analogs, 2'-amino-RNA analogs and 2 '-alkoxy- or amino-RNA DNA chimeras.
  • the heterocyclic bases, or nucleic acid bases, which are inco ⁇ orated in the ISS can be the naturally-occurring principal purine and pyrimidine bases, (namely uracil or thymine, cytosine, adenine and guanine, as mentioned above), as well as naturally- occurring and synthetic modifications of said principal bases.
  • the ISS can include one or several heterocyclic bases other than the principal five base components of naturally-occurring nucleic acids.
  • the heterocyclic base in the ISS includes, but is not limited to, uracil-5-yl, cytosin-5-yl, adenin-7-yl, adenin-8-yl, guanin-7-yl, guanin-8-yl, 4-aminopyrrolo [2.3-d] pyrimidin-5-yl, 2-amino-4-oxopyrolo [2,3-d] pyrimidin-5-yl, 2-amino-4-oxopyrrolo [2.3-d] pyrimidin-3-yl groups, where the purines are attached to the sugar moiety of the ISS via the 9-position, the pyrimidines via the 1 -position, the pyrrolopyrimidines via the 7-position and the pyrazolopyrimidines via the 1 -position.
  • the ISS may comprise at least one modified base as described, for example, in the commonly owned international application WO 99/62923.
  • modified base is synonymous with “base analog”, for example, "modified cytosine” is synonymous with “cytosine analog.”
  • modified nucleosides or nucleotides are herein defined as being synonymous with nucleoside or nucleotide “analogs.”
  • base modifications include, but are not limited to, addition of an electron- withdrawing moiety to C-5 and/or C-6 of a cytosine of the ISS.
  • the electron-withdrawing moiety is a halogen.
  • modified cytosines can include, but are not limited to, azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil, 5,6- dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil, 5-nitrocytosine, uracil, and any other pyrimidine analog or modified pyrimidine.
  • base-modified nucleosides and the synthesis of modified polynucleotides using said base-modified nucleosides as precursors, has been described, for example, in U.S. Patents 4,910,300, 4,948,882, and 5,093,232.
  • These base-modified nucleosides have been designed so that they can be inco ⁇ orated by chemical synthesis into either terminal or internal positions of an polynucleotide.
  • Such base-modified nucleosides, ' present at either terminal or internal positions of an polynucleotide can serve as sites for attachment of a peptide or other antigen.
  • ISS-microcarrier complexes comprise an ISS-containing polynucleotide bound to a microcarrier (MC).
  • ISS-MC complexes comprise an ISS bound to the surface of a microcarrier (i.e., the ISS is not encapsulated in the MC), adsorbed within a microcarrier (e.g., adsorbed to PLGA beads), or encapsulated within a MC (e.g., inco ⁇ orated within liposomes).
  • ISS-containing oligonucleotides bound to microparticles have previously been shown to have immunostimulatory activity in vitro (Liang et al.,
  • Microcarriers are not soluble in pure water, and are less than about 50-60 ⁇ m in size, preferably less than about 10 ⁇ m in size, more preferably from about 10 nm to about 10 ⁇ m, 25 nm to about 5 ⁇ m, 50 nm to about 4.5 ⁇ m or 1.0 ⁇ m to about 2.0 ⁇ m in size.
  • Microcarrers may be any shape, such as spherical, ellipsoidal, rod-shaped, and the like, although spherical microcarriers are normally preferred.
  • Preferred microcarriers have sizes of or about 50 nm, 200 nm, 1 ⁇ m, 1.2 ⁇ m, 1.4 ⁇ m, 1.5 ⁇ m, 1.6 ⁇ m, 1.8 ⁇ m, 2.0 ⁇ m, 2.5 ⁇ m or 4.5 ⁇ m.
  • the "size" of a microcarier is generally the "design size” or intended size of the particles stated by the manufacturer. Size may be a directly measured dimension, such as average or maximum diameter, or may be determined by an indirect assay such as a filtration screening assay. Direct measurement of microcarrier size is typically carried out by microscopy, generally light microscopy or scanning electron microscopy (SEM), in comparison with particles of known size or by reference to a micrometer.
  • SEM scanning electron microscopy
  • microcarriers are considered to be of a stated size if measurements show the microcarriers are + about 5-10% of the stated measurement. Size characteristics may also be determined by dynamic light scattering. Alternately, microcarrier size may be determined by filtration screening assays. A microcarrier is less than a stated size if at least 97% of the particles pass through a "screen- type” filter (i.e., a filter in which retained particles are on the surface of the filter, such as polycarbonate or polyethersulfone filters, as opposed to a "depth filter” in which retained particles lodge within the filter) of the stated size.
  • a "screen- type” filter i.e., a filter in which retained particles are on the surface of the filter, such as polycarbonate or polyethersulfone filters, as opposed to a "depth filter” in which retained particles lodge within the filter
  • a microcarrier is larger than a stated size if at least about 97% of the microcarrier particles are retained by a screen-type filter of the stated size.
  • at least about 97% microcarriers of about 10 ⁇ m to about 10 nm in size pass through a 10 ⁇ m pore screen filter and are retained by a 10 nm screen filter.
  • Microcarriers may be solid phase (e.g., polystyrene beads) or liquid phase (e.g., liposomes, micelles, or oil droplets in an oil and water emulsion).
  • Liquid phase microcarriers include liposomes, micelles, oil droplets and other lipid or oil-based particles.
  • liquid phase microcarrier is oil droplets within an oil-in-water emulsion.
  • oil-in-water emulsions used as microcarriers comprise biocompatible substituents such as squalene.
  • Liquid phase microcarriers are normally considered nonbiodegradable, but may be biodegradable liquid phase microcarriers may be produced by inco ⁇ oration of one or more biodegradable polymers in the liquid microcarrier formulation.
  • the microcarrier is oil droplets in an oil-in- water emulsion prepared by emulsification of squalene, sorbitan trioleate, TWEEN 80® in an aqueous pH buffer.
  • Solid phase microcarriers for use in ISS-microcarrier complexes may be made from biodegradable materials or nonbiodegradable materials, and may include or exclude agarose or modified agarose microcarriers.
  • Useful solid phase biodegradable microcarriers include, but are not limited to: biodegradable polyesters, such as poly(lactic acid), poly(glycolic acid), and copolymers (including block copolymers) thereof, as well as block copolymers of poly(lactic acid) and poly(ethylene glycol); polyorthoesters such as polymers based on 3,9-diethylidene-2,4,8,10-tetraoxaspiro[5.5]undecane (DETOSU); polyanhydrides such as poly(anhydride) polymers based on sebacic acid, p- (carboxyphenoxy)propane, or ?-(carboxyphenoxy)hexane; polyanhydride imides, such as polyanhydride polymers based on sebac
  • microcarriers may be covalently modified to inco ⁇ orate one or more moieties for use in linking the ISS, for example by addition of amine groups for covalent linking using amine-reactive crosslinkers.
  • the ISS-microcarrier complexes may be covalently or non-covalently linked.
  • Covalently linked ISS-MC complexes may be directly linked or be linked by a crosslinking moiety of one or more atoms (typically the residue of a crosslinking agent).
  • the ISS may be modified to allow or augment binding to the MC (e.g., by inco ⁇ oration of a free sulfhydryl for covalent crosslinking or addition of a hydrophobic moieties such as lipids, steroids, sterols such as cholesterol, and te ⁇ enes, for hydrophobic bonding), although unmodified ISS may be used for formation of non-covalent ISS-MC complex formation by electrostatic interaction or by base pairing (e.g. , by base pairing at least one portion of the
  • ISS-containing polynucleotides may be linked to solid phase microcarriers or other chemical moieties to facilitate ISS-MC complex formation using conventional technology known in the art, such as use of available heterobifunctional crosslinkers (e.g., succinimidyl 4-(N- maleimidomethyl)cyclohexane-l-carboxylate or its sulfo-derivatives for covalently linking an amine-derivatized microcarrier and an ISS modified to contain a free sulfhydryl) or by addition of compounds such as cholesterol (e.g., by the method of Godard et al. (1995) Eur. J. Biochem.
  • heterobifunctional crosslinkers e.g., succinimidyl 4-(N- maleimidomethyl)cyclohexane-l-carboxylate or its sulfo-derivatives for covalently linking an amine-derivatized microcarrier and an ISS modified to contain a free s
  • modified nucleosides or nucleotides such as are known in the art, can be inco ⁇ orated at either terminus, or at internal positions in the ISS. These can contain blocked functional groups which, when deblocked, are reactive with a variety of functional groups which can be present on, or attached to, the microcarrier or a moiety which would facilitate binding to a microcarrier.
  • noncovalently linked ISS-MC complexes utilize a binding pair (e.g., an antibody and its cognate antigen or biotin and streptavidin or avidin), where one member of the binding pair is bound to the ISS and the microcarrier is derivatized with the other member of the binding pair (e.g., a biotinylated ISS and a streptavidin-derivatized microcarrier may be combined to form a noncovalently linked ISS-MC complex).
  • a binding pair e.g., an antibody and its cognate antigen or biotin and streptavidin or avidin
  • Non-covalent ISS-MC complexes bound by electrostatic binding typically exploit the highly negative charge of the polynucleotide backbone.
  • microcarriers for use in non-covalently bound ISS-MC complexes are generally positively charged (e.g. , cationic) at physiological pH (e.g., about pH 6.8-7.4).
  • the microcarrier may intrinsically possess a positive charge, but microcarriers made from compounds not normally possessing a positive charge may be derivatized or otherwise modified to become positively charged (e.g., cationic).
  • the polymer used to make the microcarrier may be derivatized to add positively charged groups, such as primary amines.
  • positively charged compounds may be inco ⁇ orated in the formulation of the microcarrier during manufacture (e.g., positively charged surfactants may be used during the manufacture of poly (lactic acid)/poly(glycolic acid) copolymers to confer a positive charge on the resulting microcarrier particles.
  • Solid phase microspheres are prepared using techniques known in the art. For example, they can be prepared by emulsion-solvent extraction/evaporation technique.
  • biodegradable polymers such as polyanhydrates, poly(alkyl- ⁇ - cyanoacrylates) and poly( ⁇ -hydroxy esters), for example, poly(lactic acid), poly(glycolic acid), poly(D,L-lactic-co-glycolic acid) and poly(caprolactone), are dissolved in a suitable organic solvent, such as methylene chloride, to constitute the dispersed phase (DP) of emulsion.
  • DP is emulsified by high-speed homogenization into excess volume of aqueous continuous phase (CP) that contains a dissolved surfactant, for example, polyvinylalcohol (PVA) or polyvinylpirrolidone (PVP).
  • PVA polyvinylalcohol
  • PVP polyvinylpirrolidone
  • Surfactant in CP is to ensure the formation of discrete and suitably-sized emulsion droplet.
  • the organic solvent is then extracted into the CP and subsequently evaporated by raising the system temperature.
  • the solid microparticles are then separated by centrifugation or filtration, and dried, for example, by lyophilization or application of vaccum, before storing at 4 °C.
  • cationic lipids or polymers for example, l,2-dioleoyl-l,2,3-trimethylammoniopropane (DOTAP), cetyltrimethylammonium bromide (CTAB) or polylysine, are added either to DP or CP, as per their solubility in these phases.
  • DOTAP l,2-dioleoyl-l,2,3-trimethylammoniopropane
  • CTAB cetyltrimethylammonium bromide
  • polylysine are added either to DP or CP, as per their solubility in these phases.
  • Physico-chemical characteristics such as mean size, size distribution and surface charge of dried microspheres may be determined. Size characteristics are determined, for example, by dynamic light scattering technique and the surface charge was determined by measuring the zeta potential.
  • ISS-containing polynucleotides can be adsorbed onto the cationic microspheres by overnight aqueous incubation of ISS and the particles at 4 °C. Microspheres are characterized for size and surface charge before and after ISS association. Selected batches may then evaluated for activity as described herein.
  • An ISS-containing polynucleotide may be administered before, during and/or after exposure to a he ⁇ es virus.
  • An ISS polynucleotide may also be administered before, during and/or after infection by a he ⁇ es virus.
  • An ISS polynucleotide may also be administered before or after onset of symptoms of he ⁇ es virus infection. Accordingly, administration of ISS-containing polynucleotide may be at various times with respect to exposure to, infection by and/or onset of symptoms of infection by virus. Further, there may be one or more administrations.
  • the ISS-containing polynucleotide may be administered on any schedule selected by the clinician, such as daily, every other day, every three days, every four days, every five days, every six days, weekly, biweekly, monthly or at ever longer intervals (which may or may not remain the same during the course of treatment). Where multiple administrations are given, the ISS- containing polynucleotide may be given in 2, 3, 4, 5,6, 7, 8, 9, 10 or more separate administrations.
  • ISS-containing polynucleotide When ISS-containing polynucleotide is administered to an individual at risk of exposure to virus (i. e. , before infection), ISS-containing polynucleotide is preferably administered less than about 14 days before exposure to virus, preferably less than about 10 days before exposure to virus, more preferably less than about 7 days before exposure to virus, even more preferably less than about 5 days before exposure to virus. In some embodiments, ISS-containing polynucleotide is administered about 3 days before exposure to virus.
  • the ISS-containing polynucleotide is administered after exposure to a he ⁇ es virus, but prior to appearance of symptoms. This embodiment is particularly relevant with respect to HSV-2 and VZV.
  • the ISS-containing polynucleotide is administered less than about three days after exposure, more preferably less than about one day, 12 hours, six hours or two hours after exposure, if the time of exposure is known or suspected.
  • the ISS-containing polynucleotide is administered after appearance of at least one symptom of he ⁇ es virus infection.
  • ISS-containing polynucleotide is administered within about 28, 21, 14, 7, 5 or 3 days following appearance of a symptom of he ⁇ es virus infection.
  • some infected individuals exhibiting symptoms will already have undertaken one or more courses of treatment with another therapy. In such individuals, or in individuals who failed to appreciate the import of their symptoms, the ISS-containing polynucleotide may be administered at any point following infection.
  • treatments employing an ISS-containing polynucleotide may also be employed in conjunction with other treatments or as 'second line' treatments employed after failure of a 'first line' treatment. Treatments for he ⁇ es virus infection are known in the art.
  • ISS polynucleotides may be formulated in any form known in the art, such as dry powder, semi-solid or liquid formulations.
  • ISS polynucleotides preferably administered in a liquid formulation, although solid or semi- solid formulations may also be acceptable, particularly where the ISS polynucleotide is formulated in a slow release depot form.
  • ISS polynucleotides are generally formulated in liquid or dry powder form for topical administration, although semi-solid formulations may be useful.
  • ISS polynucleotide formulations may contain additional components such as salts, buffers, bulking agents, osmolytes, antioxidants, detergents, surfactants and other pharmaceutically-acceptable excipients as are known in the art.
  • additional components such as salts, buffers, bulking agents, osmolytes, antioxidants, detergents, surfactants and other pharmaceutically-acceptable excipients as are known in the art.
  • liquid ISS polynucleotide formulations made in USP water for injection and are sterile, isotonic and pH buffered to a physiologically-acceptable pH, such as about pH 6.8 to 7.5.
  • ISS-containing polynucleotides may be formulated in delivery vehicles such as liposomes, oil/water emulsion or slow release depot formulations. Methods of formulating polynucleotides in such forms are well known in the art. ISS-containing polynucleotide formulations may also include or exclude immunomodulatory agents such as adjuvants and immunostimulatory cytokines, which are well known in the art.
  • a suitable dosage range or effective amount is one that provides the desired reduction of symptoms and/or suppression of viral infection and depends on a number of factors, including the particular he ⁇ es virus, ISS sequence of the polynucleotide, molecular weight of the polynucleotide and route of administration. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dosage range may be selected from, for example, an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 3040, 50 60, 80, 100, 200, 300, 400 or 500 ⁇ g/kg up to an independently selected upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 ⁇ g/kg.
  • an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 3040, 50 60, 80, 100, 200, 300, 400 or 500 ⁇ g/kg up to an independently selected upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 ⁇ g/kg.
  • a dose may be about any of the following: 0.1 to 100 ⁇ g/kg, 0.1 to 50 ⁇ g/kg, 0.1 to 25 ⁇ g/kg, 0.1 to 10 ⁇ g/kg, 1 to 500 ⁇ g/kg, 100 to 400 ⁇ g/kg, 200 to 300 ⁇ g/kg, 1 to 100 ⁇ g/kg, 100 to 200 ⁇ g/kg, 300 to 400 ⁇ g/kg, 400 to 500 ⁇ g/kg, 500 to 1000 ⁇ g/kg, 500 to 5000 ⁇ g/kg, or 500 to 10,000 ⁇ g/kg.
  • parenteral routes of administration require higher doses of ISS compared to more direct application to infected tissue, as do ISS-containing polynucleotides of increasing length.
  • Polynucleotides comprising an ISS may be administered by systemic (e.g., parenteral) or local (e.g., topical) administration.
  • the ISS-containing polynucleotide(s) is topically administered.
  • Topical administration may be at the site of infection (e.g., genital region in the case of HSV-2), it may be at a site of a symptom (e.g. , a he ⁇ etic lesion) or it may be at the site of possible exposure to he ⁇ es virus (e.g., gential region).
  • the ISS-containing polynucleotide(s) is injected locally into the area of lesion(s). Intralesional injection may be at the site of infection (e.g., genital region in the case HSV-2) or it may be at a site of a symptom (e.g., a he ⁇ etic lesion).
  • the ISS-containing polynucleotide is administered parenterally. Parenteral routes of administration include, but are not limited to, transdermal, transmucosal, nasopharyngeal, pulmonary and direct injection.
  • Parenteral admimstration by injection may be by any parenteral injection route, including, but not limited to, intravenous (IV), intraperitoneal (IP), intramuscular (IM), subcutaneous (SC) and intradermal (ID) routes.
  • Transdermal and transmucosal admimstration may be accomplished by, for example, inclusion of a carrier (e.g., dimethylsulfoxide, DMSO), by application of electrical impulses (e.g., iontophoresis) or a combination thereof.
  • a carrier e.g., dimethylsulfoxide, DMSO
  • electrical impulses e.g., iontophoresis
  • a variety of devices are available for transdermal administration which may be used in accordance with the invention.
  • Nasopharyngeal and pulmonary routes of administration include, but are not limited to, intranasal, inhalation, transbronchial and transalveolar routes.
  • the ISS-containing polynucleotide may thus be administered by inhalation of aerosols, atomized liquids or powders.
  • Devices suitable for administration by inhalation of ISS-containing compositions include, but are not limited to, nebulizers, atomizers, vaporizers, and metered-dose inhalers.
  • Nebulizers, atomizers, vaporizers and metered-dose inhalers filled with or employing reservoirs containing formulations comprising the ISS-containing polynucleotide(s) are among a variety of devices suitable for use in inhalation delivery of the ISS-containing polynucleotide(s).
  • Other methods of delivering to respiratory mucosa include delivery of liquid formulations, such as by nose drops.
  • IV, IP, IM and ID administration may be by bolus or infusion administration.
  • administration may be by bolus, infusion or by implantable device, such as an implantable minipump (e.g. , osmotic or mechanical minipump) or slow release implant.
  • implantable minipump e.g. , osmotic or mechanical minipump
  • the ISS polynucleotide(s) may also be delivered in a slow release formulation adapted for IV, IP, IM, ID or SC administration.
  • Administration by inhalation is preferably accomplished in discrete doses (e.g., via a metered dose inhaler), although delivery similar to an infusion may be accomplished through use of a nebulizer.
  • Admimstration via the transdermal and transmucosal routes may be continuous or pulsatile.
  • administration of an ISS-containing polynucleotide results in prevention, palliation, and/or improvement in one or more symptoms of he ⁇ es virus infection.
  • the exact form of prevention, palliation or improvement will depend on the particular he ⁇ es virus, but includes reduction in size and/or duration of he ⁇ etic lesions (for all alphaherpesvirinae), reduction in symptoms of varicella (for VZV) or reduction in frequency or number of recurrent he ⁇ etic lesions (for all alphaherpesvirinae).
  • admimstration of an ISS-containing polynucleotide results in a reduction in viral titer (which indicates suppression of viral infection).
  • viral shedding e.g., virus excretion
  • the level e.g., magnitude or amount
  • Viral shedding can occur with or without symptoms at the time of primary, initial or recurrent infection and may be detected, for example, by examination of tissue scrapings from suspected areas of infection for the presence of virus or virus nucleic acid.
  • viral infection is suppressed, which may be indicated by any one or more of a number of parameters, including, but not limited to, extent of one or more symptoms and viral titer.
  • recurrence which is generally indicated by appearance of one or more symptoms associated with infection, is reduced.
  • Symptoms of infection may be assessed before and after administration of ISS- containing polynucleotide by the individual or the clinician. As will be apparent to one of skill in the art, the symptoms will vary depending on the particular he ⁇ es virus and the site of the symptoms. Symptoms of he ⁇ es simplex virus infection, which are well known in the art, include he ⁇ etic lesion, viral shedding, and, in some cases, neurovirulence. Symptoms of VZV infection include cutaneous and mucosal varicella lesions and fever and in recurrences, cutaneous lesions and neuropathy, particular of sensory nerves. Viral titer may be assessed in biological samples using standard methods of the art.
  • Levels of viral nucleic acid may be assessed by isolating nucleic acid from the sample and blot analysis using a viral polynucleotide sequence as a probe, or PCR analysis. Another method is to perform in situ hybridization with virus-specific probes. Other assays include biological measures such as quantitation of plaque forming units (PFU) or virus induced cytopathic effects (CPE), such as formation of syncytia. Extent or amount of viral particles may be measured from any infected area, such as infected tissue or mucosal discharge.
  • PFU plaque forming units
  • CPE virus induced cytopathic effects
  • viral titer When the sample is a liquid, viral titer is calculated in some indication of number or amount of virus or virus particles (e.g., infectious particles, plaque forming units, infectious doses, or median tissue culture infectious doses (TCID 50)) per unit volume. In solid samples, such as a tissue sample, viral titer is calculated in virus particles per unit weight.
  • virus or virus particles e.g., infectious particles, plaque forming units, infectious doses, or median tissue culture infectious doses (TCID 50)
  • Reduction is indicated by comparing viral titer to viral titer measured at an earlier time point, and/or comparing to an estimated titer (based, for example, on animal or clinical studies) that represents untreated infection.
  • Kits of the Invention The invention provides kits for carrying out the methods of the invention.
  • kits may be used for any one or more of the following (and, accordingly, may contain instructions for any one or more of the following uses): treating alphaherpesvirinae infection in an individual infected with alphaherpesvirinae; reducing viral shedding (including reducing the probability and/or risk of alphaherpesvirinae transmission); preventing alphaherpesvirinae infection in an individual at risk of being infected with alphaherpesvirinae; preventing alphaherpesvirinae infection in an individual who has been exposed to alphaherpesvirinae; preventing one or more symptoms of alphaherpesvirinae infection in an individual at risk of being exposed to alphaherpesvirinae; preventing one or more symptoms of alphaherpesvirinae infection in an individual who has been exposed to alphaherpesvirinae; reducing severity one or more symptoms of alphaherpesvirinae infection in an individual inf
  • kits of the invention comprise one or more containers comprising an ISS- containing polynucleotide and a set of instructions, generally written instructions although electronic storage media (e.g., magnetic diskette or optical disk) containing instructions are also acceptable, relating to the use and dosage of the ISS-containing polynucleotide for the intended treatment (e.g.
  • the instructions included with the kit generally include information as to dosage, dosing schedule, and route of administration for the intended treatment.
  • the containers of ISS may be unit doses, bulk packages (e.g., multi-dose packages) or sub-unit doses.
  • kits of the invention do not include any packages or containers which contain viral antigens from the alphaherpesvirinae the kit is intended to to be used to treat. Accordingly, neither the container comprising the ISS-containing polynucleotide nor any other containers in the kit contain alphaherpesvirinae viral antigens.
  • the ISS component of the kit may be packaged in any convenient, appropriate packaging.
  • the ISS is a freeze-dried formulation
  • an ampoule with a resilient stopper is normally used, so that the drug may be easily reconstituted by injecting fluid through the resilient stopper.
  • Ampoules with non-resilient, removable closures (e.g. , sealed glass) or resilient stoppers are most conveniently used for injectable forms of ISS.
  • prefilled syringes may be used when the kit is supplied with a liquid formulation of the ISS-containing polynucleotide.
  • the kit may contain the ISS in an ointment for topical formulation in appropriate packaging.
  • packages for use in combination with a specific device such as an inhaler, nasal administration device (e.g., an atomizer) or an infusion device such as a minipump.
  • any ISS-containing polynucleotide described herein may be used, such as, for example, any polynucleotide comprising any of the following ISS: the sequence 5'-cytosine, guanine-3', the sequence 5'-T, C, G-3', the sequence 5'-C, G, pyrimidine, pyrimidine, C, G-3', the sequence 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, G-3', the sequence 5 '-purine, purine, C, G, pyrimidine, pyrimidine, C, C-3'; the sequence SEQ ID NO: 1; the sequence SEQ ID NO: 9; the sequence 5'-purine, purine, B, G, pyrimidine, pyrimidine-3' wherein B is 5-bromocytosine or the sequence 5 '-purine, purine, B, G, pyrimidine, pyrimidine, C, G-3' wherein B is
  • Example 1 Delay of HSV disease development in mice by administration of ISS
  • HSV-2 strain 186 Outbred Swiss Webster mice, vaginally infected with HSV-2 strain 186, were used as a model of HSV infection.
  • the first indication of viral infection is hair loss and erythema (HLE) near the vagina occurring, on average, 5 days after inoculation.
  • the next stage of infection is indicated by chronic wetness (CW) due to loss of bladder control, on average, 6 days after inoculation.
  • CW chronic wetness
  • a portion (about 50% of infected mice) of the animals develop hind limb paralysis (HLP) at approximately the same time point. Death, which is often preceded by evidence of CNS disease, occurs an average of 7-9 days after viral inoculation.
  • mice in the second and third groups were treated topically with 100 ⁇ g of an ISS-containing phosphorothioate oligonucleotide (5'-TGACTGTGAACGTTCGAGATGA-3') (SEQ ID NO:l) suspended in phosphate-buffered saline (PBS).
  • the groups were treated 2 or 6 hours after inoculation.
  • Treatment with ISS resulted in decreased incidence (i. e. , individuals showing symptoms of HSV-2 infection), improved survival and delays in both appearance of symptoms and time to death in symptomatic individuals. For those individuals which died during the experiment, average time to death was increased by an average of over two days in animals treated with ISS two hours after infection.
  • Example 2 Reduction of HSV lesions in guinea pigs by administration of ISS
  • Recurrent HSV-2 disease and aspects of the primary disease, including vesicular ulcerative lesion formation and asymptomatic shedding, are effectively modeled by inoculation of the guinea pig vagina with HSV-2 (Milligan et al. (1995) Virol 206:234-
  • mice are infected by instillation of HSV-2 after calcium- alginate swabbing as described in Example 1. Three to five days after inoculation, cutaneous lesions develop and in some cases urinary retention is observed. The animals are scored daily for lesion severity using a 4 point scale (Bourne et al. (1996) J. Infect. Dis. 173:800-807). Primary disease resolves by 14 days after inoculation (day 14 post- inoculation, dl4 PI). From day 15 through 70 after inoculation, the animals are scored daily for the development of recurrent lesions.
  • One of the two ISS treated groups received two additional ISS injections on days 42 and 63 post-inoculation (PI) (Group #3).
  • Daily scoring of recurrent lesions was completed on each animal to determine the impact of ISS on recurrence frequency. These scores were averaged daily for each groups and the cumulative totals are depicted in Figure 2.
  • the graph on the left shows the period of time immediately following the first ISS injection (days 22-41), while the graph on the right shows the data over the entire observation period (day 22 through day 78).
  • guinea pigs were intravaginally inoculated with 5 x 10 5 pfu HSV-2, strain MS, as described above.
  • the infected animals were divided into groups and received treatments as outlined in Table 3. TABLE 3
  • Recurrent disease was monitored from day 15-56 post inoculation. Vaginal swabs of animals were done on days 21-43 and PCR analysis performed to determine the level of viral shedding. To evaluate the effect of ISS therapy on recurrent disease, cumulative 1 number of recurrent lesions were monitored over time and the mean calculated for the group. Results from this experiment are depicted in Figure 3.
  • a single topical treatment with ISS at day 21 significantly decreased the cumulative mean recurrent lesion days compared to animals treated with non-ISS control oligonucleotide or untreated animals.
  • the acyclovir (ACV) group also showed a significant reduction in cumulative recurrent mean lesion days, however this group received a total of 21 treatments spread over 7 days to achieve this effect.
  • the frequency of viral shedding was 20% of days for all groups. Thus, the frequency of viral shedding was unaffected by ISS treatment. However, as shown in Figure 4, the magnitude of viral shedding was significantly reduced in the group receiving a single topical treatment with ISS as compared to the control groups.
  • the p value (p ⁇ 0.001) was calculated by ANOVA analysis using Dunn's Multiple Comparison test and is valid for both the untreated group and the non-ISS control oligonucleotide group. Magnitude of virus shedding is correlated with viral transmission. Since ISS treatment resulted in a reduction in the magnitude of viral shedding, ISS treatment may be effective in a reduction in viral transmission.
  • Example 3 ISS demonstrates no direct activity on viral replication
  • ISS appears to have no direct activity on viral replication.
  • Vero cells a cell line derived from African Green monkey kidney, were pre-treated with varying concentrations of ISS or non-ISS oligonucleotides for varying times prior to the addition of HSV- 1 or HSV-2. Oligonucleotides were used at 1 ⁇ g/ml or 10 ⁇ g/ml and the cells were incubated with the oligonucleotides for 30 seconds, 10 minutes or 24 hours. Viral titers were calculated as a percent of control titer generated by cells not treated with the oligonucleotides. The experimental conditions and results are summarized in Table 4
  • SEQ ID NO: 10 98 96 103 103 97 99 HSV-1 or HSV-2 virus was pre-treated with varying concentrations of ISS or non- ISS oligonucleotides for 10 minutes prior to adding the mixture to plated Vero cells. Oligonucleotides were used at 1 ⁇ g/ml or 10 ⁇ g/ml. Viral titers were calculated as a percent of control titer generated by cells not treated with the oligonucleotides. The experimental conditions and results are summarized in Table 5. The data are expressed as percent of control titer.
  • SEQ ID NO-.9 100 100 99 101 97 99

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2001/007841 2000-03-10 2001-03-12 Treatment of herpes infection using immunomodulatory polynucleotide sequences Ceased WO2001068103A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP01957594A EP1265622B1 (en) 2000-03-10 2001-03-12 Treatment of herpes infection using immunomodulatory polynucleotide sequences
AU2001281459A AU2001281459C1 (en) 2000-03-10 2001-03-12 Treatment of herpes infection using immunomodulatory polynucleotide sequences
AU8145901A AU8145901A (en) 2000-03-10 2001-03-12 Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
JP2001566667A JP2003526670A (ja) 2000-03-10 2001-03-12 免疫調節性ポリヌクレオチド配列を使用するヘルペス感染の症候の寛解法
DE60142776T DE60142776D1 (de) 2000-03-10 2001-03-12 Behandlung von herpes infektion mit anwendung von immunomodulatore polynukleotide sequenzen
CA002402312A CA2402312A1 (en) 2000-03-10 2001-03-12 Treatment of herpes infection using immunomodulatory polynucleotide sequences
AT01957594T ATE476984T1 (de) 2000-03-10 2001-03-12 Behandlung von herpes infektion mit anwendung von immunomodulatore polynukleotide sequenzen

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US18855600P 2000-03-10 2000-03-10
US60/188,556 2000-03-10
US09/802,518 US7157437B2 (en) 2000-03-10 2001-03-09 Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US09/802,518 2001-03-09

Publications (3)

Publication Number Publication Date
WO2001068103A2 true WO2001068103A2 (en) 2001-09-20
WO2001068103A3 WO2001068103A3 (en) 2002-08-08
WO2001068103A9 WO2001068103A9 (en) 2003-03-06

Family

ID=26884207

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/007841 Ceased WO2001068103A2 (en) 2000-03-10 2001-03-12 Treatment of herpes infection using immunomodulatory polynucleotide sequences

Country Status (8)

Country Link
US (2) US7157437B2 (https=)
EP (1) EP1265622B1 (https=)
JP (1) JP2003526670A (https=)
AT (1) ATE476984T1 (https=)
AU (2) AU8145901A (https=)
CA (1) CA2402312A1 (https=)
DE (1) DE60142776D1 (https=)
WO (1) WO2001068103A2 (https=)

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001068144A3 (en) * 2000-03-10 2002-05-16 Dynavax Tech Corp Biodegradable immunomodulatory formulations and methods for use thereof
WO2001068143A3 (en) * 2000-03-10 2002-05-16 Dynavax Tech Corp Immunomodulatory formulations and methods for use thereof
WO2002052002A3 (en) * 2000-12-27 2003-09-04 Dynavax Tech Corp Immunomodulatory polynucleotides and methods of using the same
WO2003030934A3 (en) * 2001-10-06 2003-11-06 Qiagen Gmbh Cpg formulations and related methods
WO2004087203A3 (en) * 2003-04-02 2004-12-23 Coley Pharmaceutical Group Ltd Immunostimulatory nucleic acid oil-in-water formulations for topical application
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
RU2314817C2 (ru) * 2005-11-22 2008-01-20 Светлана Николаевна Козлова Способ лечения неврологических повреждений у детей
EP1992635A1 (en) 2002-12-23 2008-11-19 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US7488490B2 (en) 1997-03-10 2009-02-10 University Of Iowa Research Foundation Method of inducing an antigen-specific immune response by administering a synergistic combination of adjuvants comprising unmethylated CpG-containing nucleic acids and a non-nucleic acid adjuvant
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7727712B2 (en) 2000-03-10 2010-06-01 Dynavax Technologies Corporation Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US7758876B2 (en) 2002-11-01 2010-07-20 The United States Of America As Represented By The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory CpG oligonucleotides
US7919477B2 (en) 2000-01-14 2011-04-05 The United States Of America As Represented By The Department Of Health And Human Services Multiple CpG oligodeoxynucleotides and their use to induce an immune response
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US8030285B2 (en) 1999-04-12 2011-10-04 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US8226957B2 (en) 2000-03-10 2012-07-24 Dynavax Technologies Corporation Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences
US8309527B2 (en) 1994-07-15 2012-11-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8586555B2 (en) 2001-08-07 2013-11-19 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
US8871732B2 (en) 2002-12-23 2014-10-28 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US9028845B2 (en) 2001-06-21 2015-05-12 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same-IV
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9994443B2 (en) 2010-11-05 2018-06-12 Selecta Biosciences, Inc. Modified nicotinic compounds and related methods
US10933129B2 (en) 2011-07-29 2021-03-02 Selecta Biosciences, Inc. Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US7223398B1 (en) * 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US20020028784A1 (en) * 2000-03-10 2002-03-07 Nest Gary Van Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
US20020107212A1 (en) * 2000-03-10 2002-08-08 Nest Gary Van Methods of reducing papillomavirus infection using immunomodulatory polynucleotide sequences
WO2003020884A2 (en) 2001-08-14 2003-03-13 The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services Method for rapid generation of mature dendritic cells
WO2003054161A2 (en) 2001-12-20 2003-07-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services USE OF CpG OLIGODEOXYNUCLEOTIDES TO INDUCE ANGIOGENESIS
TWI235440B (en) * 2004-03-31 2005-07-01 Advanced Semiconductor Eng Method for making leadless semiconductor package
CN101171033A (zh) 2005-03-04 2008-04-30 戴纳瓦克斯技术公司 包含具免疫刺激序列iss之寡核苷酸的疫苗:其中iss与抗原缀合并通过缓冲条件和其他赋形剂稳定
CN103800906B (zh) 2009-03-25 2017-09-22 德克萨斯大学系统董事会 用于刺激哺乳动物对病原体的先天免疫抵抗力的组合物
EP3756684A1 (en) 2009-05-22 2020-12-30 Genocea Biosciences, Inc. Vaccines against herpes simplex virus type 2: compositions and methods for eliciting an immune response
JP6055776B2 (ja) 2010-11-24 2016-12-27 ジェノセア バイオサイエンシーズ, インコーポレイテッド 単純ヘルペスウイルス2型に対するワクチン:免疫応答を誘発する組成物及び方法
AU2012340712B2 (en) 2011-11-23 2017-09-14 Genocea Biosciences, Inc. Nucleic acid vaccines against Herpes Simplex Virus type 2: compositions and methods for eliciting an immune response
WO2016044839A2 (en) 2014-09-19 2016-03-24 The Board Of Regents Of The University Of Texas System Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds
US10350288B2 (en) 2016-09-28 2019-07-16 Genocea Biosciences, Inc. Methods and compositions for treating herpes

Family Cites Families (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4650675A (en) 1983-08-18 1987-03-17 The Children's Medical Center Corporation Oligonucleotide conjugates
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5015733A (en) 1983-12-20 1991-05-14 California Institute Of Technology Nucleosides possessing blocked aliphatic amino groups
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US4849513A (en) 1983-12-20 1989-07-18 California Institute Of Technology Deoxyribonucleoside phosphoramidites in which an aliphatic amino group is attached to the sugar ring and their use for the preparation of oligonucleotides containing aliphatic amino groups
US4910300A (en) 1985-12-11 1990-03-20 Chiron Corporation Method for making nucleic acid probes
US5093232A (en) 1985-12-11 1992-03-03 Chiron Corporation Nucleic acid probes
US5124246A (en) 1987-10-15 1992-06-23 Chiron Corporation Nucleic acid multimers and amplified nucleic acid hybridization assays using same
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
US5616461A (en) 1992-05-14 1997-04-01 Dana-Farber Cancer Institute Assay for antiviral activity using complex of herpesvirus origin of replication and cellular protein
US5849719A (en) 1993-08-26 1998-12-15 The Regents Of The University Of California Method for treating allergic lung disease
WO1995026204A1 (en) * 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6239116B1 (en) * 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
EP1167379A3 (en) 1994-07-15 2004-09-08 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20030050263A1 (en) 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US5874089A (en) 1995-10-02 1999-02-23 Georgetown University School Of Medicine Protecting against canine oral papillomavirus (copy)
CA2244946C (en) 1996-01-30 2010-04-13 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
ATE292980T1 (de) 1996-10-11 2005-04-15 Univ California Immunostimulierende oligonucleotidekonjugate
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
DK1005368T3 (da) 1997-03-10 2010-01-04 Ottawa Hospital Res Inst Anvendelse af nukleinsyrer, der indeholder ikke-metyleret CpG dinukleotid i kombination med alun som hjælpestoffer
WO1998052962A1 (en) 1997-05-19 1998-11-26 Merck & Co., Inc. Oligonucleotide adjuvant
EP1003531B1 (en) 1997-05-20 2007-08-22 Ottawa Health Research Institute Processes for preparing nucleic acid constructs
EP1003850B1 (en) 1997-06-06 2009-05-27 The Regents of the University of California Inhibitors of dna immunostimulatory sequence activity
JP4663113B2 (ja) 1997-09-05 2011-03-30 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 抗原刺激顆粒球媒介炎症を予防または軽減するための免疫刺激オリゴヌクレオチドの使用
GB9727262D0 (en) 1997-12-24 1998-02-25 Smithkline Beecham Biolog Vaccine
AU760549B2 (en) 1998-04-03 2003-05-15 University Of Iowa Research Foundation, The Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
CA2328602A1 (en) 1998-05-06 1999-11-11 University Of Iowa Research Foundation Methods for the prevention and treatment of parasitic infections and related diseases using cpg oligonucleotides
JP2002514397A (ja) 1998-05-14 2002-05-21 コーリー ファーマシューティカル ゲーエムベーハー CpGオリゴヌクレオチドを用いる造血調節の方法
US6562798B1 (en) 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
JP2002521489A (ja) 1998-07-27 2002-07-16 ユニバーシティ オブ アイオワ リサーチ ファウンデーション CpGオリゴヌクレオチドの立体異性体および関連する方法
ATE326239T1 (de) 1998-09-18 2006-06-15 Dynavax Tech Corp Verfahren zur behandlung von ig-e assozierten krankheiten und zusammensetzungen zur verwendung in diesen verfahren
AU6425999A (en) 1998-10-09 2000-05-01 Dynavax Technologies Corporation Anti hiv compositions comprising immunostimulatory polynucleotides and hiv antigens
HK1045099A1 (zh) 1999-04-20 2002-11-15 Smithkline Beecham Biologicals S.A. 含有rsv抗原和cpg寡核苷酸的疫苗
EP1177439B1 (en) 1999-04-29 2004-09-08 Coley Pharmaceutical GmbH Screening for immunostimulatory dna functional modifiers
US6514948B1 (en) 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
ATE419869T1 (de) 1999-08-19 2009-01-15 Dynavax Tech Corp Methode zur modulierung eines immunantwortes mit immunstimulierenden sequencen und zusammensetzungen dafür
CA2398756A1 (en) 2000-01-31 2001-08-02 Eyal Raz Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
AU4175101A (en) 2000-02-23 2001-09-03 Univ California Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
US20020028784A1 (en) 2000-03-10 2002-03-07 Nest Gary Van Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
US20020107212A1 (en) 2000-03-10 2002-08-08 Nest Gary Van Methods of reducing papillomavirus infection using immunomodulatory polynucleotide sequences
US20020098199A1 (en) 2000-03-10 2002-07-25 Gary Van Nest Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US20030129251A1 (en) 2000-03-10 2003-07-10 Gary Van Nest Biodegradable immunomodulatory formulations and methods for use thereof
US20010046967A1 (en) 2000-03-10 2001-11-29 Gary Van Nest Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
EP1267618A1 (en) 2000-03-28 2003-01-02 The Regents Of The University Of California Methods for increasing a cytotoxic t lymphocyte response in vivo
US20020142978A1 (en) 2000-04-07 2002-10-03 Eyal Raz Synergistic improvements to polynucleotide vaccines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8008266B2 (en) 1994-07-15 2011-08-30 University Of Iowa Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US8309527B2 (en) 1994-07-15 2012-11-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US7488490B2 (en) 1997-03-10 2009-02-10 University Of Iowa Research Foundation Method of inducing an antigen-specific immune response by administering a synergistic combination of adjuvants comprising unmethylated CpG-containing nucleic acids and a non-nucleic acid adjuvant
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8030285B2 (en) 1999-04-12 2011-10-04 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US8389495B2 (en) 1999-04-12 2013-03-05 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Olioodeoxynucleotide and its use to induce an immune response
US8741869B2 (en) 1999-04-12 2014-06-03 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US8232259B2 (en) 2000-01-14 2012-07-31 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Multiple CpG oligodeoxynucleotide and their use to induce an immune response
US7919477B2 (en) 2000-01-14 2011-04-05 The United States Of America As Represented By The Department Of Health And Human Services Multiple CpG oligodeoxynucleotides and their use to induce an immune response
US7183111B2 (en) 2000-03-10 2007-02-27 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US8226957B2 (en) 2000-03-10 2012-07-24 Dynavax Technologies Corporation Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences
US8124590B2 (en) 2000-03-10 2012-02-28 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US7727712B2 (en) 2000-03-10 2010-06-01 Dynavax Technologies Corporation Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
WO2001068143A3 (en) * 2000-03-10 2002-05-16 Dynavax Tech Corp Immunomodulatory formulations and methods for use thereof
WO2001068144A3 (en) * 2000-03-10 2002-05-16 Dynavax Tech Corp Biodegradable immunomodulatory formulations and methods for use thereof
EP2067487A3 (en) * 2000-03-10 2009-07-29 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
US7250403B2 (en) 2000-03-10 2007-07-31 Dynavax Technologies Corporation Biodegradable immunomodulatory formulations and methods for use thereof
US7157437B2 (en) 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US8372413B2 (en) 2000-12-27 2013-02-12 Dynavax Technologies Corporation Immunomodulatory polynucleotides and methods of using the same
WO2002052002A3 (en) * 2000-12-27 2003-09-04 Dynavax Tech Corp Immunomodulatory polynucleotides and methods of using the same
US9028845B2 (en) 2001-06-21 2015-05-12 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same-IV
US8586555B2 (en) 2001-08-07 2013-11-19 Dynavax Technologies Corporation Immunomodulatory compositions, formulations, and methods for use thereof
CN100438908C (zh) * 2001-10-06 2008-12-03 梅瑞尔有限公司 CpG制剂及相关方法
WO2003030934A3 (en) * 2001-10-06 2003-11-06 Qiagen Gmbh Cpg formulations and related methods
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US8481055B2 (en) 2002-11-01 2013-07-09 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory CpG oligonucleotides
US7758876B2 (en) 2002-11-01 2010-07-20 The United States Of America As Represented By The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory CpG oligonucleotides
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US9422564B2 (en) 2002-12-23 2016-08-23 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US7745606B2 (en) 2002-12-23 2010-06-29 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
EP1992635A1 (en) 2002-12-23 2008-11-19 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US11312965B2 (en) 2002-12-23 2022-04-26 Trisalus Life Sciences, Inc. Immunostimulatory sequence oligonucleotides and methods of using the same
US8871732B2 (en) 2002-12-23 2014-10-28 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
US10196643B2 (en) 2002-12-23 2019-02-05 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
WO2004087203A3 (en) * 2003-04-02 2004-12-23 Coley Pharmaceutical Group Ltd Immunostimulatory nucleic acid oil-in-water formulations for topical application
RU2314817C2 (ru) * 2005-11-22 2008-01-20 Светлана Николаевна Козлова Способ лечения неврологических повреждений у детей
US9764031B2 (en) 2010-05-26 2017-09-19 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9066978B2 (en) 2010-05-26 2015-06-30 Selecta Biosciences, Inc. Dose selection of adjuvanted synthetic nanocarriers
US9994443B2 (en) 2010-11-05 2018-06-12 Selecta Biosciences, Inc. Modified nicotinic compounds and related methods
US10933129B2 (en) 2011-07-29 2021-03-02 Selecta Biosciences, Inc. Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses

Also Published As

Publication number Publication date
DE60142776D1 (de) 2010-09-23
ATE476984T1 (de) 2010-08-15
US20070060540A1 (en) 2007-03-15
WO2001068103A9 (en) 2003-03-06
JP2003526670A (ja) 2003-09-09
US7157437B2 (en) 2007-01-02
AU2001281459B8 (en) 2005-09-29
WO2001068103A3 (en) 2002-08-08
EP1265622B1 (en) 2010-08-11
AU2001281459B2 (en) 2005-09-15
CA2402312A1 (en) 2001-09-20
AU8145901A (en) 2001-09-24
US20060264391A1 (en) 2006-11-23
AU2001281459C1 (en) 2006-08-31
EP1265622A2 (en) 2002-12-18

Similar Documents

Publication Publication Date Title
EP1265622B1 (en) Treatment of herpes infection using immunomodulatory polynucleotide sequences
AU2001281459A1 (en) Treatment of herpes infection using immunomodulatory polynucleotide sequences
CA2402268C (en) Immunostimulatory polynucleotide sequences for use in preventing and treating respiratory viral infections
AU2001245627B8 (en) Immunostimulatory polynucleotide sequences for use in preventing and treating viral infections
EP1261353B1 (en) Immunostimulatory polynucleotide sequences for use in preventing and treating viral infections
AU2001243587A1 (en) Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences.
AU2001242032B2 (en) Immunostimulatory polynucleotide sequences for use in suppressing hepatitis virus infection
AU2001245627A1 (en) Immunostimulatory polynucleotide sequences for use in preventing and treating viral infections
AU2001243588A1 (en) Immunostimulatory polynucleotide sequences for use in preventing and treating viral infections
AU2001242032A1 (en) Immunostimulatory polynucleotide sequences for use in suppressing hepatitis virus infection

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2402312

Country of ref document: CA

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 566667

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2001281459

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2001957594

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001957594

Country of ref document: EP

COP Corrected version of pamphlet

Free format text: PAGE 7, DESCRIPTION, REPLACED BY CORRECT PAGE 7

WWG Wipo information: grant in national office

Ref document number: 2001281459

Country of ref document: AU