WO2001060970A2 - Zinc finger domains and methods of identifying same - Google Patents

Zinc finger domains and methods of identifying same Download PDF

Info

Publication number
WO2001060970A2
WO2001060970A2 PCT/KR2001/000244 KR0100244W WO0160970A2 WO 2001060970 A2 WO2001060970 A2 WO 2001060970A2 KR 0100244 W KR0100244 W KR 0100244W WO 0160970 A2 WO0160970 A2 WO 0160970A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
domain
polypeptide
sequence
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2001/000244
Other languages
English (en)
French (fr)
Other versions
WO2001060970A3 (en
Inventor
Jin-Soo Kim
Young-Do Kwon
Hyun-Won Kim
Eun Hyun Ryu
Moon Sun Hwang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Toolgen Inc
Original Assignee
Toolgen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Toolgen Inc filed Critical Toolgen Inc
Priority to EP01910136A priority Critical patent/EP1259597B1/en
Priority to CN018062520A priority patent/CN1416467B/zh
Priority to NZ521293A priority patent/NZ521293A/en
Priority to AU37719/01A priority patent/AU781103B2/en
Priority to CA002400772A priority patent/CA2400772C/en
Priority to JP2001560342A priority patent/JP4156840B2/ja
Priority to IL15114901A priority patent/IL151149A0/xx
Priority to DE60127819T priority patent/DE60127819T2/de
Publication of WO2001060970A2 publication Critical patent/WO2001060970A2/en
Publication of WO2001060970A3 publication Critical patent/WO2001060970A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity

Definitions

  • This invention relates to DNA-binding proteins such as transcription factors
  • genes are regulated at the transcriptional level by polypeptide transcription factors that bind to specific DNA sites within in the gene, typically in promoter or enhancer regions. These proteins activate or repress transcriptional initiation by RNA polymerase at the promoter, thereby regulating expression of the target gene.
  • Many transcription factors, both activators and repressors are modular in structure. Such modules can fold as structurally distinct domains and have specific functions, such as DNA binding, dimerization, or interaction with the transcriptional machinery. Effector domains such as activation domains or repression domains retain their function when transferred to DNA-binding domains of heterologous transcription factors (Brent and Ptashne, (1985) Cell 43:729-36; Dawson et al, (1995) Mol. Cell Biol. 15:6923-31).
  • the three-dimensional structures of many DNA-binding domains including zinc finger domains, homeodomains, ⁇ and helix-turn-helix domains, have been determined from NMR and X-ray crystallographic data.
  • the invention provides a rapid and scalable cell-based method for identifying and constructing chimeric transcription factors.
  • Such transcription factors can be used, for example, for altering the expression of endogenous genes in biomedical and bioengineering applications.
  • the transcription factors are assayed in vivo, i.e., in intact, living cells.
  • novel nucleic acid binding domains that can be discovered, for example, by applying the method in a screen of genomic sequences.
  • the invention features a method of identifying a peptide domain that recognizes a target site on a DNA.
  • This method is sometimes referred to herein as the "domain selection method” or the "in vivo screening method.”
  • the method includes providing (1) cells containing a reporter construct and (2) a plurality of hybrid nucleic acids.
  • the reporter construct has a reporter gene operably linked to a promoter that has both a recruitment site and a target site.
  • the reporter gene is expressed above a given level when a transcription factor recognizes (i.e., binds fo a degree above background) both the recruitment site and the target site of the promoter, but not when the transcription factor recognizes only the recruitment site of the promoter.
  • Each hybrid nucleic acid of the plurality encodes a non-naturally occurring protein with the following elements: (i) a transcription activation domain, (ii) a DNA binding domain that recognizes the recruitment site, and (iii) a test zinc finger domain.
  • the amino acid sequence of the test zinc finger domain varies among the members of the plurality of hybrid nucleic acids.
  • the method further includes: contacting the plurality of nucleic acids with the cells under conditions that permit at least one of the plurality of nucleic acids to enter at least one of the cells; maintaining the cells under ' conditions permitting expression of the hybrid nucleic acids in the cells; identifying a cell that expresses the reporter gene above the given level as an indication that the cell contains a hybrid nucleic acid encoding a test zinc finger domain that recognizes the target site.
  • the DNA binding domain i.e., the domain that recognizes the recruitment site and does not vary among members of the plurality, can include, for example, one, two, three, or more zinc finger domains.
  • the cells utilized in the method can be prokaryotic or eukaryotic.
  • Exemplary eukaryotic cells are yeast cells, e.g. Saccharomyces cerevisiae, Schizosaccharomyces pombe, or, Pichia pasteuris; insect cells such as Sf9 cells; and mammalian cells such as fibroblasts or lymphocytes.
  • the "given level” is the amount of expression observed when the transcription factor recognizes the recruitment site, but not the target site. The "given level” in some cases may be zero (at least within the limits of detection of the assay used).
  • the method can include an additional step of amplifying a source nucleic acid encoding the test zinc finger domain from a nucleic acid, e.g., genomic DNA, an mRNA mixture, or a cDNA mixture, to produce an amplified fragment.
  • a source nucleic acid e.g., genomic DNA, an mRNA mixture, or a cDNA mixture
  • the source nucleic acid can be amplified using an oligonucleotide primer.
  • the oligonucleotide primer can be one of a set of degenerate oligonucleotides (e.g., a pool of specific oligonucleotides having different nucleic acid sequences, or a specific oligonucleotide having a non-natural base such as inosine) that anneals to a nucleic acid encoding a conserved domain boundary.
  • the primer can be a specific oligonucleotide.
  • the amplified fragments are utilized to produce a hybrid nucleic acid for inclusion in the plurality of hybrid nucleic acids used in the aforementioned method. '
  • the method can further include the steps of (i) identifying a candidate zinc finger domain amino acid sequence in a sequence database; (ii) providing a candidate nucleic acid encoding the candidate zinc finger domain amino acid sequence; and (iii) utilizing the candidate nucleic acid to construct a hybrid nucleic acid for inclusion in the plurality of hybrid nucleic acids used in the aforementioned method.
  • the database can include records for multiple amino acid sequences, e.g., known and/or predicted proteins, as well as multiple nucleic acid sequences such as cDNAs, ESTs, genomic DNA, or genomic DNA computationally processed to remove predicted introns.
  • the method can be repeated to identify a second test zinc finger domain that recognizes a second target site, e.g., a site other than that recognized by the first test zinc finger domain.
  • a nucleic acid can be constructed that encodes both the first and the second identified test zinc finger domains.
  • the encoded hybrid protein would specifically recognize a target site that includes the target site of the first test zinc finger domain and the target site of the second test zinc finger domain.
  • the invention also features a method of determining whether a test zinc finger domain recognizes a target site on a promoter.
  • This method is sometimes referred to herein as the "site selection method.”
  • the method includes the steps of providing a reporter construct and a hybrid nucleic acid.
  • the reporter gene is operably linked to a promoter that includes a recruitment site and a target site, and is expressed above a given level when a transcription factor recognizes both the recruitment site and the target site of the promoter, but not when the transcription factor recognizes only the recruitment site of the promoter.
  • the hybrid nucleic acid encodes a non-naturally occurring protein with the following elements: (i) a transcription activation domain, (ii) a DNA binding domain that recognizes the recruitment site, and (iii) a test zinc finger domain.
  • the method further includes: contacting the reporter construct with a cell under conditions that permit the reporter construct to enter the cell; prior to, after, or concurrent with the aforementioned step, contacting the hybrid nucleic acid with the cell under conditions that permit the hybrid nucleic acid to enter the cell; maintaining the cell under conditions permitting expression of the hybrid nucleic acid in the cell; and detecting reporter gene expression in the cell.
  • a level of reporter gene expression greater than the given level is an indication that the test ' zinc finger- domain recognizes the target site. '
  • the reporter construct and the hybrid nucleic acid can be contained in separate plasmids.
  • the two plasmids can be introduced into the cell simultaneously or consecutively.
  • One or both plasmids can contain selectable markers.
  • the reporter construct and the hybrid nucleic acid can also be contained on the same plasmid, in which case only one contacting step is required to introduce both nucleic acids into a cell.
  • one or both of the nucleic acids are stably integrated into a genome of a cell.
  • the transcriptional activation domain can be replaced with a transcriptional repression domain, and a cell is identified in which the level of reporter gene expression is decreased to a level below the given level.
  • Another method of the invention facilitates the rapid determination of a binding preference of a test zinc fmger domain by fusing two cells.
  • the method includes: providing a first cell containing the reporter gene; providing a second cell containing the hybrid nucleic acid; fusing the first and second cells to form a fused cell; maintaining the fused cells under conditions permitting expression of the hybrid nucleic acids in the fused cell; and detecting reporter gene expression in the fused cell, wherein a level of reporter gene expression greater than the given level is an indication that the test zinc fmger domain recognizes the target site.
  • the first and second cells can be tissue culture cells or fungal cells.
  • An exemplary implementation of the method utilizes S. cerevisiae cells.
  • the first cell has a first mating type, e.g., MATa; the second cell has a second mating type different from the first, e.g., MAT ⁇ .
  • the two cells are contacted with one another, and yeast mating produces a single cell (e.g., MATa/ ⁇ ) with a nucleus containing the genomes of both the first and second cells.
  • the method can including providing multiple first cells, all of the same first mating type where each first cell has a reporter construct with a different target site. Multiple second cells, all of the same second mating type and each having a different test zinc fmger domain, are also provided.
  • a matrix is generated of multiple pair-wise matings, e.g., all possible pair-wise matings.
  • the method is applied to determine the binding preference of multiple test zinc finger domains for multiple binding sites, e.g., a complete set of possible target sites.
  • the invention also provides a method of assaying a binding preference-of a test zinc fmger domain.
  • the method includes providing (1) cells, essentially all of which contain a hybrid nucleic acid, and (2) a plurality of reporter constructs.
  • Each reporter construct of the plurality has a reporter gene operably linked to a promoter with a recruitment site and a target site.
  • the reporter gene is expressed above a given level when a transcription factor recognizes both the recruitment site and the target site of the promoter, but not when the transcription factor binds only the recruitment site of the promoter.
  • the second target site varies among the members of the plurality of reporter constructs.
  • the hybrid nucleic acid encodes a hybrid protein with the following elements: (i) a transcription activation domain, (ii) a DNA binding domain that recognizes the recruitment site, and (iii) a test zinc fmger domain.
  • the method further includes: contacting the plurality of reporter constructs with the cells under conditions that permit at least one of the plurality of reporter constructs to enter at least one of the cells; maintaining the cells under conditions permitting expression of the nucleic acids in the cells; identifying a cell that contains a reporter construct in the cell and that expresses the reporter construct above the given level as an indication that the reporter construct in the cell has a target site recognized by the zinc fmger domain.
  • a plurality of cells, each with a different target site, can be identified by the above method if the test zinc fmger domain has a binding preference for more than one target site.
  • the method can further include identifying the cell that exhibits the highest level of reporter gene expression.
  • a threshold level of reporter gene expression is determined, e.g., an increase in reporter gene expression of 2, 4, 8, 20, 50, 100, 1000 fold or greater, and all cells exhibiting reporter gene expression above the threshold are selected.
  • the target binding site for example, can be between two and six nucleotides long.
  • the plurality of reporter constructs can include every possible combination of
  • the invention features a method of identifying a plurality of zinc finger domains.
  • the method includes: carrying out the domain selection method to identify a first test zinc finger domain and carrying out the domain selection method again to identify a second test zinc fmger domain that recognizes a target site different from a target site of the first test zinc fmger domain.
  • 'Also featured is a method of generating a nucleic acid encoding a chimeric zinc finger protein, the method includes carrying out the domain selection method twice to identify a first and second test zinc finger domain and constructing a nucleic acid encoding a polypeptide including the first and second test zinc fmger domains.
  • the nucleic acid can encode a hybrid protein that includes the two domains that specifically recognize a site that includes two subsites. The subsites are the target site of the first test zinc fmger domain and target site of the second test zinc fmger domain.
  • the invention features a method of identifying a DNA sequence recognized by zinc fmger domains.
  • the method includes: carrying out the site selection method to identify a first binding preference for a first test zinc fmger domain, and carrying out the site selection method again to identify a second binding preference for a second test zinc fmger domain.
  • a nucleic acid can be constructed which encodes both the first and the second identified test zinc fmger domains.
  • the nucleic acid can encode a hybrid protein including the two domains that specifically recognizes a site that includes the target site of the first test zinc finger domain and target site of the second test zinc fmger domain.
  • the invention also features a method of identifying a peptide domain that recognizes a target site on a DNA.
  • the method includes providing (1) cells containing a reporter construct and (2) a plurality of hybrid nucleic acids.
  • the reporter construct has a reporter gene operably linked to a promoter that has both a recruitment site and a target site.
  • the reporter gene is expressed below a given level when a transcription factor recognizes (i.e., binds to a degree above background) both the recruitment site and the target site of the promoter, but not when the transcription factor recognizes only the recruitment site of the promoter.
  • Each hybrid nucleic acid of the plurality encodes a non-naturally occurring protein with the following elements: (i) a transcription repression domain, (ii) a DNA binding domain that recognizes the recruitment site, and (iii) a test zinc finger domain.
  • the amino acid sequence of the test zinc finger domain varies among the members of the plurality of hybrid nucleic acids.
  • the method further includes: contacting the plurality of nucleic acids with the cells under conditions that permit at least one of the plurality of nucleic acids to enter at least one of the cells; maintaining the cells under conditions permitting expression of the hybrid nucleic acids in the cells; identifying a cel that expresses the reporter gene below the given level as an indication that the cell contains a hybrid nucleic acid encoding a test zinc fmger domain that recognizes the target site. Additional embodiments of this method are as for the similar method utilizing a transcription activation domain. Likewise, any other selection method described herein can be performed using a transcriptional repression domain in place of a transcriptional activation domain.
  • the invention features certain purified polypeptides and isolated nucleic acids.
  • Purified polypeptide of the invention include polypeptide having the amino acid sequence:
  • Nucleic acids of the invention include nucleic acids encoding the aforementioned polypeptides.
  • purified polypeptides of the invention can have amino acids sequence 50%, 60%, 70%, 80%, 90%, 93%, 95%, 96%; 98%, 99%, or 100% identical to SEQ ID NOs: 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 125, 127,-129, 131, 133, 135, 137, 141, 143, 145, 147, 149, or 151.
  • the polypeptides can be identical to SEQ ID NOs: 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 141, 143, 145, 147, 149, or 151 at the amino acid positions corresponding to the nucleic acid contacting residues of the polypeptide.
  • the polypeptides differ from SEQ ID NOs: 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 141, 143, 145, 147, 149, or 151 at at least one of the residues corresponding to the nucleic acid contacting residues of the polypeptide.
  • the purified polypeptides can also include one or more of the following: a heterologous DNA binding domain, a nuclear localization signal, a small molecular binding domain (e.g., a steroid binding domain), an epitope tag or purification handle, a catalytic domain (e.g., a nucleic acid modifying domain, a nucleic acid cleavage domain, or a DNA repair catalytic domain) and/or a transcriptional function domain (e.g., an activation domain, a repression domain, and so forth).
  • a heterologous DNA binding domain e.g., a nuclear localization signal
  • a small molecular binding domain e.g., a steroid binding domain
  • an epitope tag or purification handle e.g., a catalytic domain (e.g., a nucleic acid modifying domain, a nucleic acid cleavage domain, or a DNA repair catalytic domain)
  • a transcriptional function domain
  • the invention also includes isolated nucleic acid sequences encoding the aforementioned polypeptides, and isolated nucleic acid sequences that hybridize under high stringency conditions to a single stranded probe, the sequence of the probe consisting of SEQ ID NO:22, 24, 26, 28, 30, 32, 34, 36, 38, 40; 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 102, 104, 106, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 140, 142, 144, 146, 148, or 150 or the complements thereof.
  • the invention further includes a method of expressing in a cell a polypeptide of the invention fused to a heterologous nucleic acid binding domain.
  • the method includes introducing into a cell a nucleic acid encoding the aforementioned fusion protein.
  • a nucleic acid of the invention can be operably regulated by a heterologous nucleic acid sequence, e.g., an inducible promoter (e.g., a steroid hormone regulated promoter, a small-molecule regulated promoter, or an engineered inducible system such as the tetracycline Tet-On and Tet-Off systems).
  • an inducible promoter e.g., a steroid hormone regulated promoter, a small-molecule regulated promoter, or an engineered inducible system such as the tetracycline Tet-On and Tet-Off systems.
  • base contacting positions refers to the four amino acid positions of zinc fmger domains that structurally correspond to amino acids arginine 73, aspartic acid 75, glutamic acid 76, and arginine 79 of SEQ ID NO:21. These positions are also referred to as positions -1, 2, 3, and 6.
  • the query sequence is aligned to the zinc fmger domain of interest such that the cysteine and histidine residues of the query sequence are aligned with those of fmger 3 of Zif268.
  • the ClustalW WWW Service at the European Bioinformatics Institute http://www2.ebi.ac.uk/clustalw; Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680 provides one convenient method of aligning sequences.
  • heterologous refers to a polypeptide that is introduced into a context by artifice, and that does not occur naturally in the same context. In distinction from an endogenous entity, a heterologous polypeptide can have a polypeptide sequence flanking it on at least one side that does not flank it in any naturally occurring polypeptide.
  • hybrid refers to a polypeptide which comprises amino acid sequences derived from either (i) at least two different naturally occurring sequences; (ii) at least an artificial sequence (i.e., a sequence that does not occur naturally) and a naturally occurring sequence; or (iii) at least two different artificial sequences. Examples of artificial sequences include mutants of a naturally occurring sequence and de novo designed sequences.
  • hybridizes under stringent conditions refers to conditions for hybridization in 6X sodium chloride/sodium citrate (SSC) at 45°C, followed by two washes in 0.2 X SSC, 0.1% SDS at 65°C.
  • SSC sodium chloride/sodium citrate
  • binding preference refers to the discriminative property of a polypeptide for selecting one nucleic acid binding site relative to another. For example, when the polypeptide is limiting in quantity relative to the nucleic acid binding sites, a greater amount of the polypeptide will bind the preferred site relative to the other site in an in vivo or in vitro assay described herein.
  • the term “recognizes” refers to the ability of a polypeptide to discriminate between one nucleic acid binding site and a second competing site such that, e.g., in the context of an assay described herein, the polypeptide remains bound to the first site in the presence of an excess of the second site.
  • the polypeptide may not have sufficient affinity for the first site to bind alone, but may be assayed when fused as in a hybrid polypeptide of the invention to another nucleic acid binding domain that binds a nearby recruitment site.
  • degenerate oligonucleotides refers to both (a) a population of different oligonucleotides, and (b) a single species of oligorr ⁇ cleotide that can anneal to more than one sequence, e.g., an oligonucleotide with an unnatural nucleotide such as inosine.
  • the present invention provides numerous benefits.
  • the ability to select a DNA binding domain that recognizes a particular sequence permits the design of novel polypeptides that bind to specific site on a DNA.
  • the invention facilitates the customized generation of novel polypeptides that can regulate the expression of a selected target, e.g., a gene required by a pathogen can be repressed, a gene required for cancerous growth can be repressed, a gene poorly expressed or encoding a mutated protein can be activated and overexpressed, and so forth.
  • the use of zinc fmger domains is particularly advantageous.
  • the zinc fmger motif recognizes very diverse DNA sequences.
  • the structure of naturally occurring zinc fmger proteins is modular.
  • the zinc fmger protein Zif268, also called “Egr-l,” is composed of a tandem array of three zinc fmger domains.
  • Fig. 1 is the x-ray crystallographic structure of zinc fmger protein Zif268, consisting of three fingers complexed with DNA (Pavletich and Pabo, (1991) Science 252:809-817).
  • Each fmger independently contacts 3-4 basepairs of the DNA recognition site.
  • the subsite contacted by each fmger can be regarded as an independent molecular recognition event.
  • High affinity binding is achieved by the cooperative effect of having multiple zinc fmger modules in the same polypeptide chain.
  • an in vivo selection step enables one to identify directly those polypeptides that bind to a specific site on a DNA in the intracellular milieu.
  • the factors associated with recognition in a cell can be vastly different from the factors present during an in vitro selection scenario.
  • a polypeptide in a eukaryotic nucleus, a polypeptide must compete with the myriad other nuclear proteins for a specific nucleic acid binding site.
  • a nucleosome or another chromatin protein can occupy, occlude, or compete for the binding site. Even if unbound, the conformation of a nucleic acid in the cell is subject to bending, supercoiling, torsion, and unwinding.
  • polypeptide itself is exposed to proteases and chaperones, among other factors. Moreover, the polypeptide is confronted with an entire genome of possible binding sites, and hence must be endowed with a high specificity for the desired site in order to survive the selection process. In contrast to in vivo selection, an in vitro selection can select for the highest affinity binder rather than the highest specificity binder.
  • reporter gene to indicate the binding ability of an expressed polypeptide chimera not only is efficient and simple, but also obviates the need to develop a complex interaction code that accounts for the energetics of the protein- nucleic acid interface and the immense number of peripheral factors, such as surrounding residues and nucleotides that also affect the binding interface.
  • the present invention avails itself of all the zinc fmger domains present in the human genome, or any other genome. This diverse sampling of sequence space occupied by the zinc fmger domain structural fold may have the additional advantages inherent in, eons of natural selection. Moreover, by utilizing domains from the host species, a DNA binding protein engineered for a gene therapy application by the methods described herein has a reduced likelihood of being regarded as foreign by the host immune response.
  • Fig. 1 is a depiction of the three dimensional structure of the Zif268 zinc fmger protein that consists of three fmger domains and binds the DNA sequence, 5'- GCG TGG GCG T-3'. The black circles represent the location of the zinc ion.
  • Fig. 2 is an illustration of the hydrogen-bonding interactions between amino acid residues of Zif268 and DNA bases. Amino acid residues at positions -1, 2, 3, and 6 along the ⁇ -helix interact with the bases at specific positions. The bold lines represent ideal hydrogen bonding, while the dotted lines represent potential hydrogen bonding.
  • Fig. 3 is a recognition code table that summarizes the interactions between DNA bases and amino acid residues at positions -1, 2, 3, and 6 along the ⁇ -helix of a zinc fmger domain.
  • Fig. 4 is a depiction of he positions of amino acid residues and their corresponding 3 base triplets. The bold lines represent the main interactions observed, while the dotted line represents an auxiliary interaction.
  • Fig. 5 is a diagram illustrating the principles of the in vivo selection system disclosed herein.
  • zinc fmger domain A recognizes the target sequence (designated XXX X) and activates the transcription of H1S3 reporter gene.
  • yeast colonies grow on a medium lacking histidine.
  • zinc fmger domain B does not recognize the target sequence and thus the reporter gene remains repressed.
  • no colonies grow on a medium lacking histidine.
  • AD represents the transcriptional activation domain.
  • Fig. 6 is a list of 10-bp sequences found in long terminal repeats (LTR) of - HIN-1 and in the promoter region of CCR5, a human gene encoding a coreceptor for HIN-1 (SEQ ID ⁇ Os:l-5, respectively).
  • LTR long terminal repeats
  • CCR5 CCR5
  • SEQ ID ⁇ Os:l-5 a human gene encoding a coreceptor for HIN-1
  • Fig. 7 is a depiction of the base sequences of the binding sites linked to the reporter gene (SEQ ID NOs:6-17, respectively).
  • Each binding site consists of a tandem array of 4 composite binding sequences.
  • Each composite binding sequence was constructed by connecting truncated binding sequence 5'-GG GCG-3' recognized by finger 1 and finger 2 of Zif268 to 4-bp target sequences. _
  • Fig 8 is a diagram of pPCFMS-Zif, a plasmid that can be used for the construction of a library of hybrid plasmids (SEQ ID NOs: 18 and 19).
  • Fig 9 is a representation of the base sequence for the gene coding for Zif268 zinc fmger protein inserted into pPCFMS-Zif and the corresponding translated amino acid sequences (SEQ ID NOs:20 and 21, respectively). Sites recognized by restriction enzymes are underlined.
  • Fig. 10 is a photograph of a culture plate having yeast cells obtained from retransformation and cross transformation using zinc finger proteins selected by the in vivo selection system.
  • Fig. 11 is a list of some DNA sequences of zinc finger domains selected by the in vivo system from a zinc finger library derived from the human genome and amino acid sequences encoded by the DNA sequences (SEQ ID NOs:22-33).
  • the DNA sequences corresponding to the degenerate PCR primers used to amplify DNA segments encoding zinc fmger domains from the human genome are underlined.
  • the four potential base-contacting positions are indicated, and the ami ⁇ o acid residues are shown in bold.
  • the two Cys residues and two His residues that are expected to coordinate with the zinc ion are shown in italics.
  • the invention features a novel screening method for determining the nucleic acid binding preferences of test zinc fmger domains.
  • the method is easily adapted to a variety of DNA binding domains, a variety of sources for these domains, and a number of library designs, reporter genes, and selection and screening systems.
  • the screening method can be implemented as a high-throughput platform. Information obtained from the screening method is readily applied to a method of designing artificial nucleic acid binding proteins.
  • the design method appropriates the binding preferences of test zinc fmger domains to guide the modular assembly of a chimeric nucleic acid binding protein.
  • a designed protein can be further optimized or varied with the screening method.
  • the invention utilizes collections of nucleic " acid binding domains with differing binding specificities.
  • a variety of protein structures are known to bind nucleic acids with high affinity and high specificity. These structures are used repeatedly in a myriad of different proteins to specifically control nucleic acid function (for reviews of structural motifs which recognize double stranded DNA, see, e.g., Pabo and Sauer (1992) Annu. Rev. Biochem. 61 :1053-95; Patikoglou and Burley (1997) Annu. Rev. Biophys. Biomol. Struct. 26:289-325; Nelson (1995) Curr Opin
  • nucleic acid binding domains include:
  • Zinc fingers are small polypeptide domains of approximately 30 amino acid residues in which there are four amino acids, either cysteine or histidine, appropriately spaced such that they can coordinate a zinc ion (Fig. 1 ; for reviews, see, e.g., Klug and Rhodes, (1987) Trends Biochem. Sci.12:464-469(1987); Evans and Hollenberg, (1988) Cell 52:1-3; Payre and Vincent, (1988) FEBS Lett. 234:245-250; Miller et al., (1985) EMBO J. 4: 1609-1614; Berg, (1988) Proc. Natl. Acad. Sci. U.S.A.
  • zinc fmger domains can be categorized according to the-identity of the residues that coordinate the zinc ion, e.g., as the Cys 2 -Hls 2 class, the Cys 2 -Cys 2 class, the Cys,-CysHis class, and so forth.
  • the zinc coordinating residues of Cys,- His 2 zinc fingers are typically spaced as follows: X a -X-C-X 2 . 5 -C-X 3 -X a -X 5 - ⁇ -X,-H- X 3 .
  • ⁇ (psi) is a hydrophobic residue (Wolfe et al., (1999) Annu. Rev. Biophys. Biomol. Struct. 3:183-212) (SEQ ID NO:76), wherein "X" represents any amino acid, wherein X a is phenylalanine or tyrosine, the subscript indicates the number of amino acids, and two subscripts indicate a typical range of intervening amino acids. Typically, the intervening amino acids fold to form an anti-parallel ⁇ - sheet that packs against an -helix, although the anti-parallel ⁇ -sheets can be short, non-ideal, or non-existent.
  • a zinc finger DNA-binding protein normally consists of a tandem array of three or more zinc fmger domains.
  • the zinc fmger domain (or "ZFD") is one of the most common eukaryotic DNA-binding motifs, found in species from yeast to higher plants and to humans. By one estimate, there are at least several thousand zinc fmger domains in the human genome alone. Zinc fmger domains can be isolated from zinc fmger proteins.
  • Non- limiting examples of zinc fmger proteins include CF2-II, Kruppel, WT1, basonuclin, BCL-6/LAZ-3, erythroid Kruppel-like transcription factor, transcription factors Spl, Sp2, Sp3, and Sp4, transcriptional repressor YY1, EGRl/Krox24, EGR2/Krox20, EGR3/Pilot, EGR4/AT133, Evi-1, GLI1, GLI2, GLI3, HIV-EP1/ZNF40, HIV-EP2, KRl. ZfX, ZfY, and ZNF7.
  • Homeodomains are simple eukaryotic domains that- consist of a N-terminal arm that contacts the DNA minor groove, followed by three ⁇ -helices that contact the major groove (for a review, see, e.g., Laughon, (1991) Biochemistry 30:11357-67). The third ⁇ -helix is positioned in the major groove and contains critical DNA-contacting side chains.
  • Homeodomains have a characteristic highly- conserved motif present at the turn leading into the third ⁇ -helix. The motif includes an invariant tryptophan that packs into the hydrophobic core of the domain.
  • Homeodomains are commonly found in transcription factors that determine cell identity and provide positional information during organismal development. Such classical homeodomains can be found in the genome in clusters such that the order of the homeodomains in the cluster approximately corresponds to their expression pattern along a body axis. Homeodomains can be identified by alignment with a homeodomain, e.g., Hox-1, or by alignment with a homeodomain profile or a homeodomain hidden Markov Model (HMM; see below), e.g., PF00046 of the Pfam database or "HOX" of the SMART database (http://smart.embl-heidelberg.de/), or by the Prosite motif PDOC00027 as mentioned above.
  • HMM homeodomain hidden Markov Model
  • Helix-turn-helix proteins This DNA binding motif is common among many prokaryotic transcription factors. There are many subfamilies, e.g., the Lad family, the AraC family, to name but a few. The two helices in the name refer to a first ⁇ -helix that packs against and positions a second ⁇ -helix in the major groove of DNA. These domains can be identified by alignment with a HMM, e.g., HTH_ARAC, HTH_ARSR, HTH_ASNC, HTH_CRP, HTH_DEOR, HTH_DTXR, HTH_GNTR, HTH CLR, HTHJLACI, HTH_LUXR, HTH_MARR, HTH_MERR, and
  • HTH_XRE profiles available in the SMART database http://smart.embl- heidelberg.de/).
  • Helix-loop-helix proteins This DNA binding domain is commonly found among homo- and hetero-dimeric transcription factors, e.g., MyoD, fos, jun, El l , and myogenin.
  • the domain consists of a dimer, each monomer contributing two ⁇ -helices and intervening loop.
  • the domain can be identified by alignment with a HMM, e.g., the "HLH" profile available in the SMART database (http://smart.embl- heidelberg.de/).
  • HMM e.g., the "HLH" profile available in the SMART database
  • helix-loop-helix proteins are typically dimeric, monomeric versions can be constructed by engineering a polypeptide linker between the two subunits such that a single open reading frame encodes both the two subunits and the linker.
  • a variety of methods can be used to identify structural domains. Computational Methods.
  • the amino acid sequence of a DNA binding domain isolated by a method described herein can be compared to a database of known sequences, e.g., an annotated database of protein sequences or an annotated database which includes entries for nucleic acid binding domains.
  • databases of uncharacterized sequences e.g., unannotated genomic, EST or full-length cDNA sequence; of characterized sequences, e.g., SwissProt or PDB; and of domains,- e.g., Pfam, ProDom (http://www.tooulouse.inra.fr/), and SMART (Simple- Modular Architecture Research Tool, http://smart.embl- heidelberg.de/) can provide a source of nucleic acid binding domain sequences. Nucleic acid sequence databases can be translated in all six reading frames for the purpose of comparison to a query amino acid sequence.
  • Nucleic acid sequences that are flagged as encoding candidate nucleic acid binding domains can be amplified from an appropriate nucleic acid source, e.g., genomic DNA or cellular RNA. Such nucleic acid sequences can be cloned into an expression vector. The procedures for computer-based domain identification can be interfaced with an oligonucleotide synthesizer and robotic systems to produce nucleic acids encoding the domains in a high-throughput platform.
  • Cloned nucleic acids encoding the candidate domains can also be stored in a host expression vector and shuttled easily into an expression vector, e.g., into a translational fusion vector with Zif268 fingers 1 and 2, either by restriction enzyme mediated subcloning or by site-specific, recombinase mediated subcloning (see U.S. Patent No. 5,888,732).
  • the high-throughput platform can be used to generate multiple microtitre plates containing nucleic acids encoding different candidate nucleic acid binding domains.
  • the Prosite profiles PS00028 and PS50157 can be used to identify zinc finger domains. In a SWISSPROT release of 80,000 protein sequences, these profiles detected 3189 and 2316 zinc fmger domains, respectively. Profiles can be constructed from a multiple sequence alignment of related proteins by a variety of different techniques. Gribskov and co-workers (Gribskov et al, (1990) Meth. Enzymol 183:146-159) utilized a symbol comparison table to convert a " multiple sequence alignment supplied with residue frequency distributions into weights for each position. See, for example, the PROSITE database and the work of Luethy et al, (1994) Protein Sci. 3:139-1465.
  • HMM's representing a DNA binding domain of interest
  • a database of such models e.g., the Pfam database, release 2.1.
  • a database can be searched, e.g., using the default parameters, with the HMM in order to find additional domains (see, e.g., http://www.sanger.ac.ulc/Software/Pfam/HMM_search for default parameters).
  • the user can optimize the parameters.
  • a threshold score can be selected to filter the database of sequences such that sequences that score above the threshold are displayed as candidate domains.
  • the SMART database of HMM's (Simple Modular Architecture Research Tool, http://smart.embl-heidelberg.de/; Schultz et al, (1998) Proc. Natl Acad. Sci. USA 95:5857 and Schultz et al, (2000) Niicl Acids Res 28:231) provides a catalog of zinc fmger domains (ZnF_C2H2; ZnF_C2C2; ZnF_C2HC; ZnF_C3Hl ; ZnF_C4; ZnF_CHCC; ZnF_GATA; and ZnF_NFX) identified by profiling with the hidden Markov models of the HMMer2 search program (Durbin et al, (1998) Biological sequence analysis: probabilistic models of proteins and nucleic acids.
  • Hybridization-based Methods A collection of nucleic acids encoding various forms of a DNA binding domain can be analyzed to profile sequences encoding conserved amino- and carboxy-terminal boundary sequences. Degenerate oligonucleotides can be designed to hybridize to sequences encoding such conserved boundary sequences. Moreover, the efficacy of such degenerate oligonucleotides can be estimated by comparing their composition to the frequency of possible annealing sites in known genomic sequences. Multiple rounds of design can be used to optimize the degenerate oligonucleotides.
  • the method permits the screening of a collection of nucleic acids encoding
  • DNA binding domains for example, in the form of a plasmid, phagemid, or phage library
  • the collection can encode a diverse group of DNA binding domains, even domains of different structural folds.
  • the collection encodes domains of a single structural fold such as a zinc fmger domain.
  • the collection is composed of nucleic acids encoding a structural domain that is assembled from a degenerate patterned library.
  • a degenerate patterned library For example, in the instance of zinc fingers, an alignment of known zinc fingers can be utilized to identify the optimal amino acids at each position. Alternatively, structural studies and mutagenesis experiments can be used to determine the preferred properties of amino acids at each position.
  • Any nucleic acid binding domain can be used as a structural scaffold for introducing mutations. In particular, positions in close proximity to the nucleic acid binding interface or adjacent to a position so located can be targeted for mutagenesis.
  • a mutated test zinc finger domain can be constrained at any mutated position to a subset of possible amino acids by using a patterned degenerate library.
  • Degenerate codon sets can be used to encode the profile at each position. For example, codon sets are available that encode only hydrophobic residues, aliphatic residues, or hydrophilic residues.
  • the library can be selected for full-length clones that encode folded polypeptides. Cho et al ((2000) J. Mol. Biol 297(2):309-19) provides a method for producing such degenerate libraries using degenerate oligonucleotides, and also provides a method of selecting library nucleic acids that encode full-length polypeptides. Such nucleic acids can be easily inserted into an expression plasmid using convenient restriction enzyme cleavage sites or transposase or recombinase recognition sites for the selection methods described herein.
  • Selection of the appropriate codons and the relative proportions of each nucleotide at a given position can be determined by simple examination of a table representing the genetic code, or by computational algorithms. For example, Cho et al, supra, describe a computer program that accepts a desired degenerate protein sequence and outputs a preferred oligonucleotide design that encodes the sequence.
  • a library of domains can be constructed from genomic DNA or cDNA of eukaryotic organisms such as humans. Multiple methods are available for doing this. For example, a computer search of available amino acid sequences can be used to identify the domains, as described above.
  • a nucleic acid encoding each domain can be isolated and inserted into a vector appropriate for the expression in cells, e.g., a vector containing a promoter, an activation domain, and a selectable marker.
  • degenerate -- oligonucleotides that hybridize to a conserved motif are used to amplify, e.g., by PCR, a large number of related domains containing the motif.
  • Kruppel-like Cys 2 His, zinc fingers can be amplified by the method of Agata et al, (1998) Gene 213:55-64. This method also maintains the naturally occurring zinc fmger domain linker peptide sequences, e.g., sequences with the pattern: Thr-Gly-(Glu/Gln)- (Lys/Arg)-Pro-(Tyr/Phe) (SEQ ID NO:78). Moreover, screening a collection limited to domains of interest, unlike screening a library of unselected genomic or cDNA sequences, significantly decreases library complexity and reduces the likelihood of missing a desirable sequence due to the inherent difficulty of completely screening large libraries'.
  • the human genome contains numerous zinc fmger domains, many of which are uncharacterized and unidentified. It is estimated that there are thousands of genes encoding proteins with zinc fmger domains (Pellegrino and Berg, (1991) Proc. Natl Acad. Sci. USA 88:671-675). These human zinc fmger domains represent an extensive collection of diverse domains from which novel DNA-binding proteins can be constructed. If each zinc fmger domain recognizes a unique 3- to 4-bp sequence, the total number " of domains required to bind every possible 3- to 4-bp sequence is only 64 to 256 (4 3 to 4 4 ). It is possible that the natural repertoire of the human genome contains a sufficient number of unique zinc fmger domains to span all possible recognition sites.
  • zinc fmger domains are a valuable resource for constructing artificial chimeric DNA-binding proteins.
  • Naturally occurring zinc finger domains unlike artificial mutants derived from the human genome, have evolved under natural selective pressures and therefore may be naturally optimized for binding specific DNA sequences and in vivo function.
  • Zinc fmger domains with desired DNA recognition properties can be identified using the following in vivo screening system.
  • a composite binding ' site of interest is inserted upstream of a reporter gene such that recruitment of a transcriptional activation domain to the composite binding site results in increased reporter gene transcription above a given level.
  • An expression plasmid that encodes a hybrid protein consisting of a test zinc fmger domain fused to a fixed DNA binding domain and a transcriptional activation domain is constructed.
  • the composite binding site includes at least two elements, a recruitment site and a target site.
  • the system is engineered such that the fixed DNA binding domain recognizes the recruitment site.
  • the binding affinity of the fixed DNA binding domain for the recruitment site is such that in vivo it alone is insufficient for transcriptional activation of the reporter gene. This can be verified by a control experiment.
  • the fixed DNA binding domain when expressed in cells, should not be able to activate transcription of the reporter gene above a nominal level. Some leaky or low- level activation is tolerable, as the system can be sensitized by other means (e.g., by use of a competitive inhibitor for the reporter).
  • the fixed DNA binding domain is expected not to bind stably to the recruitment site.
  • the fixed DNA binding domain can bind to the recruitment site with a dissociation constant (K d ) of approximately 0.1 nM, 1 nM, 1 ⁇ M, 10 ⁇ M, 100 ⁇ M, or greater.
  • K d dissociation constant
  • the K d of the DNA binding domain for the target site can be measured in vitro by an electrophoretic mobility shift assay (EMS A) in the absence of a test zinc finger domain or in the absence of a test zinc fmger domain with specificity for the second target site.
  • EMS A electrophoretic mobility shift assay
  • a functional test zinc fmger domain that recognizes the target site, e.g., the variable site of the composite binding site, is necessary for the hybrid protein to bind stably to the composite binding site in cells, and thereby to activate the reporter gene.
  • the binding preference of the test zinc finger domain for the target site results in an increase in reporter gene expression relative to the given level.
  • the fold increase of reporter gene expression obtained by dividing the observed level by the given level can be approximately v 2, 4, 8, 20, 50, 100, 1000 fold or greater.
  • the K d of the transcription factor comprising the DNA binding domain tod the test zinc fmger domain is decreased, e.g., relative to a transcription factor lacking a test zinc fmger domain with specificity for the target site.
  • the dissociation constant (K d ) of a transcription factor complexed to a target site for which it has specificity can be approximately 50 nM, 10 nM, 1 nM, 0.1 nM, 0.01 nM or less.
  • the K d can be determined in vitro by EMS A.
  • Fixed DNA binding domains include modular domains isolated from naturally occurring DNA-binding proteins, e.g., a naturally occurring DNA-binding protein that has multiple domains or that is an oligomer. For example, both of two known zinc fingers, e.g., fingers 1 and 2 of Zif268, can be used as the fixed DNA binding domain.
  • nucleic acid binding domains e.g., a domain family described herein, such as a homeodomain, a helix- turn-helix domain, or a helix-loop-helix domain, or a nucleic acid binding domain well characterized in the art
  • a fixed DNA binding domain suitable for the system.
  • Appropriate selection of a recruitment site that is recognized 6 ' y'the fixed DNA binding domain is also necessary.
  • the recruitment site can be a subsite within the natural binding site for the naturally occurring DNA binding protein from which the fixed DNA binding domain is obtained. If necessary, mutations can be introduced either into the fixed domain or into the recruitment site, in order to sensitize the system.
  • Cells suitable for the in vivo screening system include both eukaryotic and prokaryotic cells.
  • Exemplary eukaryotic cells include yeast cells, e.g., Saccharomyces cerevisiae, Saccharomyces pombe, and Pichia pastoris cells.
  • the yeast one-hybrid system using Saccharomyces cerevisiae, was modified to select zinc finger domains using the aforementioned screening system.
  • reporter plasmids that encode the H7S3 reporter gene were prepared.
  • the predetermined 4-bp target DNA sequences were connected to a truncated binding sequence to provide composite binding sequences for the DNA-binding domains, and each of the composite binding sequences was operably linked to the reporter gene on separate plasmids. '
  • the hybrid nucleic acid sequence encodes a transcriptional activation domain linked to a DNA-binding domain comprising a truncated DNA-binding domain and a zinc finger domain.
  • binding sites used herein are not necessarily contiguous, although contiguous sites are frequently used. Flexible and/or extensible linkers between nucleic acid binding domains can be used to construct proteins that recognize noncontiguous sites.
  • a polypeptide composed of fmger 1 and fmger 2 of Zif268 and devoid of fmger 3 can be used as a fixed DNA- binding domain.
  • f ger 1 refers to the zinc fmger domain located at the N-terminal end, fmger 2, the zinc fmger domain in the middle, and fmger 3 the zinc fmger domain at the C-terminal end.
  • any two zinc fmger domains whose binding site is characterized can be used as a fixed DNA- binding domain.
  • Other useful fixed DNA-binding domains may be derived from other zinc fmger proteins, such as Spl, CF2-II, YY1, Kruppel, WT ⁇ , Egr2, or POU-domain proteins, such as Octl, Oct2, and Pitl. These are provided by way of example and the present invention is not limited thereto. ' ⁇ " -
  • the base sequence of 5'-GGGCG-3' generated by deleting 4-bp from the 5' end of the optimal
  • Zif268 recognition sequence (5'-GCG TGG GCG-3), can be used as a recmitment site. Any target sequence of 3 to 4 bp can be linked to this recruitment site, to yield a composite binding sequence.
  • Transcriptional activation domains that may be used in the present invention include but are not limited to the Gal4 activation domain from yeast and the VP16 domain from herpes simplex virus.
  • activation domain function can be emulated by fusing a domain that can recruit a wild-type RNA polymerase alpha subunit C-terminal domain or a mutant alpha sub unit C-terminal domain, e.g., a C-terminal domain fused to a protein interaction domain.
  • Repression domains If desired, a repression domain instead of an activation domain can be fused to the DNA binding domain.
  • eukaryotic repression domains include ORANGE, groucho, and WRPW (Dawson et al. , (1995) Mol. Cell Biol 15:6923-31).
  • a toxic reporter gene and/or a non-selectable marker can be used to screen for decreased expression.
  • the reporter gene can be a selectable marker, e.g., a gene that confers drug resistance or an auxotrophic marker.
  • drug resistance genes include S. cerevisiae cyclohexamide resistance (CYH), S. cerevisiae canavanine resistance gene (CAN1), and the hygromycin resistance gene.
  • S. cerevisiae auxotrophic markers include the URA3, HIS3, LEU1, ADE1 and TRP1 genes. When an auxotrophic marker is the reporter gene, cells that lack a functional copy of the auxotrophic gene and so the ability to produce a particular metabolite are utilized.
  • Selection for constructs encoding test zinc finger domains that bind a target site is achieved by maintaining the cells in medium lacking the metabolite.
  • the H7S5 gene can be used as a selectable marker in combination with a his 3 ' yeast strain. After introduction of constmcts encoding the hybrid transcription factors, the cells are grown in the absence of histidine.
  • Selectable markers for use in mammalian cells such as thymidine kinase, neomycin resistance, and ⁇ PRT, are also well known to the skilled artisan.
  • the reporter gene encodes a protein whose presence can be easily detected and/or quantified.
  • exemplary reporter genes include lacZ, chloramphenicol acetyl transferase (CAT), luciferase, green fluorescent protein (GFP), beta-glucuronidase (GUS), blue fluorescent protein (BFP), and derivatives of GFP, e.g., with altered or enhanced fluorescent properties (Clontech Laboratories, Inc. CA).
  • Colonies of cells expressing lacZ can be easily detected by growing the colonies on plates containing the colorimetric substrate X-gal.
  • GFP expression can be detected by monitoring fluorescence emission upon excitation. Individual GFP expressing cells can be identified and isolated using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • the system can be constructed with two reporter genes, e.g., a selectable reporter gene and a non-selectable reporter gene.
  • the selectable marker facilitates rapid identification of the domain of interest, as under the appropriate growth conditions, only cells bearing the domain of interest grow.
  • the non-selectable reporter provides a means of verification, e.g., to distinguish false-positives, and a means of quantifying the extent of binding.
  • the two reporters can be integrated at separate locations in the genome, integrated in tandem in the genome, contained on the same extrachromosomal element (e.g., plasmid) or contair ed on separate extrachromosomal elements.
  • Fig. 5 illustrates the principle of the modified one-hybrid system used to select desired zinc fmger domains.
  • the DNA-binding domain of the hybrid transcription factor is composed of (a) a tmncated DNA-binding domain consisting of fmger 1 and fmger 2 of Zif268 and (b) zinc fmger domain A or B.
  • the base sequence of the binding site located at the promoter region of the reporter gene is a composite binding sequence (5'-XXXXGGGCG-3'), which consists of a 4-bp target sequence (nucleotides 1 to 4, 5'-XXXX-3'), and a tmncated binding sequence (nucleotides 5 to 9, 5'-GGGCG-3').
  • the hybrid transcription factor can bind the composite binding sequence stably. This stable binding leads to expression of the reporter gene through the action of the activation domain (AD in Fig. 5) of the hybrid transcription factor.
  • the hybrid transcription factor when HIS3 is used as a reporter gene, the transformed yeast grows in medium devoid of histidine.
  • lacZ when used as a reporter gene, the transformed yeast grows as a blue colony in a medium containing X-gal, a substrate of the lacZ protein.
  • the zinc fmger domain (B in Fig. 5) of the hybrid transcription factor fails to recognize the target sequence expression of the reporter gene is not induced. As a result, the transformed yeast cannot grow in the medium devoid of histidine (when H7S3 is used as a reporter gene) or grows as a white colony in a medium containing X-gal (when lacZ is used as a reporter gene).
  • the selection method using this modified one-hybrid system is advantageous because zinc finger domains selected by virtue of this procedure are demonstrated to function in the cellular milieu. Thus, the domains are presumably able to fold, enter the nucleus, and withstand intracellular proteases and other potentially damaging intracellular agents. Furthermore, the modified one-hybrid system disclosed herein allows the isolation of desired zinc finger domains quickly and easily. The modified one-hybrid system requires only a single round of transformation of yeast cells to isolate the desired zinc fmger domains.
  • the selection method described herein can be utilized to identify a zinc fmger domain from a genome e.g., a genome of a plant or animal species " (e.g., a mammal, e.g., a human).
  • the method can also be utilized to identify a zinc fmger domain from a library of mutant zinc fmger domains prepared, for example, by random mutagenesis.
  • the two methods can be used in conjunction. For example, if a zinc fmger domain cannot be isolated from the human genome for a particular 3- bp or 4-bp DNA sequence, a library of zinc fmger domains prepared by random or directed mutagenesis can be screened for such a domain.
  • modified one-hybrid system in yeast is a preferred means to select zinc fmger domains that recognize and bind the given target sequences
  • systems other than yeast one-hybrid selection can be used.
  • phage display selection may be used to screen a library of naturally occurring zinc fmger domains derived from a genome of a eukaryotic organism.
  • the present invention encompasses the use of the one-hybrid method in a variety of cultured cells.
  • a reporter gene operably linked to target sequences may be introduced into prokaryotic or animal or plant cells in culture, and the cultured cells may then be transfected with plasmids, phages, or viruses encoding a library of zinc fmger domains. Desired zinc finger domains recognizing target sequences may then be obtained from the isolated cells in which the reporter gene is activated.
  • the zinc finger domains selected via the method of the present invention can be used as building blocks to make new DNA-binding proteins by appropriate rearrangement and recombination.
  • a novel DNA-binding protein recognizing the promoter region of human CCR5 a coreceptor of HIV-1, can be constructed as follows.
  • the promoter region of human CCR5 contains the following 10- bp sequence: 5'-AGG GTG GAG T-3' (SEQ ID NO:4) (Fig. 6).
  • These three zinc finger domains can be connected with appropriate linkers and attached to a regulatory domain such as the VP16 domain and the GAL4 domain or repression domains such as the
  • KRAB domain in order to generate novel transcription factors that specifically bind to the CCR5 promoter.
  • These zinc finger proteins could be used in gene therapy to help prevent proliferation of HIV-1.
  • the following method allows rapid measurement of the relative in vivo binding affinity for each domain in a collection for multiple possible DNA-binding sites or even all possible DNA-binding sites.
  • a large collection of nucleic acids encoding nucleic acid binding domains is generated.
  • Each nucleic acid binding domain is encoded as the test zinc fmger domain in a hybrid nucleic acid construct, and expressed in -a yeast strain of one mating type.
  • a first set of yeast strains expressing all available or desired domains is generated.
  • a second set of yeast strains containing reporter constructs for putative target sites for the- domains in the reporter construct is constracted in the opposite mating type.
  • the method requires performing many or all of the possible pairwise matings in order to create a matrix of fused cells, each having a different test zinc fmger domain and a different target site reporter construct. Each fused cell is assayed for reporter gene expression. The method thereby rapidly and effortlessly determines the binding preferences of the tested domains.
  • a collection of domains is identified, e.g., by searching a genomics database for putative domains that fit a given profile.
  • the collection can include, for example, ten to twenty domains, or all the identified domains, possibly thousands or more.
  • Nucleic acids encoding the domains identified from the database are amplified using synthetic oligonucleotides. Manual and automated methods for designing such synthetic oligonucleotides are routine in the art. Nucleic acids encoding additional domains can be amplified with degenerate primers. Nucleic acids encoding the domains of the collection are cloned into the yeast expression plasmid described above, thus creating fusion proteins of the domains and the first, two fingers of Zif268 and a transcription activation domain. The amplification and cloning steps can be done in a microtitre plate format in order to clone nucleic acids encoding the multiple domains.
  • a recombinational cloning method can be used to rapidly insert multiple amplified nucleic acids encoding the domains into the yeast expression vector.
  • This method which is described in U.S. Patent No. 5,888,732 and the "Gateway" manual (Life Technologies-Invitrogen, CA, USA), entails including customized sites for a site-specific recombinase at the ends of the amplification primers.
  • the expression vector contains an additional site or sites at the position for insertion of amplified nucleic acid encoding the domain. These sites are designed to lack stop codons.
  • Restriction enzyme-mediated and/or recombination cloning can be used to insert nucleic acids encoding each of the identified domains into an expression vector.
  • the vectors can be propagated in bacteria, and frozen in indexed -microtitre plates, such that each well contains a cell harboring a nucleic acid encoding one of the different, unique DNA-binding domains.
  • Isolated plasmid DNA is obtained for each domain and transformed into a yeast cell, e.g., a Saccharomyces cerevisiae MATa cell.
  • a yeast cell e.g., a Saccharomyces cerevisiae MATa cell.
  • the transformed cells are grown in minimal medium under nutritional conditions selecting for the marker.
  • Such cells can also be frozen and stored, e.g., in microtitre plates, for later use.
  • a second set of yeast strains is constructed, e.g., in a Saccharomyces cerevisiae MATa cell.
  • This set of yeast strains contains a variety of different reporter vectors.
  • Each yeast strain bearing an expression vector with a unique DNA-binding domain is then mated to each yeast strain of the reporter gene set.
  • diploids can easily be selected. Such diploids have both the reporter and the expression plasmids.
  • the cells are also maintained under nutritional • - conditions that select for both the reporter and the expression plasmids.
  • Reporter gene expression can be detected in a high-volume format, e.g., in microtitre plates.
  • a plate containing the matrix of mated cells can be scamied for fluorescence.
  • a new DNA-binding protein can be rationally constracted to recognize a target 9-bp or longer DNA sequence by mixing and matching appropriate zinc fmger ⁇ domains.
  • the modular stmcture of zinc fmger domains facilitates their rearrangement to construct new DNA-binding proteins.
  • zinc fmger domains in the naturally-occurring Zif268 protein are positioned tandemly along the DNA double helix. Each domain independently recognizes a different 3-4 bp DNA segment.
  • a database of zinc finger domains The one -hybrid selection system described above can be utilized to identify one or more zinc fmger domains for each possible 3 or 4 basepair binding site.
  • the results can be stored as a matrix or database, e.g., a relational database.
  • the database can include an indication of the relative affinity of the zinc fmger domains that bind each site.
  • Such zinc fmger domains can also be tested in the context of multiple different fusion proteins to verify their specificity. Moreover, particular binding sites for which a paucity of domains is available can be the target of additional selection screens. Libraries for such selections can be prepared by mutagenizing a zinc fmger domain that binds a similar yet distinct site. A complete matrix of zinc finger domains for each possible binding site is not essential, as the domains can be staggered relative to the target binding site in order to best utilize the domains available. Such staggering can be accomplished both by parsing the binding site in the most useful 3 or 4 basepair binding sites, and also by varying the linker length between zinc fmger domains.
  • zinc fmger domains that have high specificity for a desired site can be flanked by other domains that bind with higher affinity, but lesser specificity.
  • the In vivo screening method described herein can used to test fhe-z ' /z vivo function, affinity, and specificity of an artificially assembled zinc fmger protein and derivatives thereof.
  • the method can be used to optimize such assembled proteins, e.g., by creating libraries of varied linker composition, zinc fmger domain modules, zinc finger domain compositions, and so forth.
  • Parsing a target site The target 9-bp or longer DNA sequence is parsed into 3 or 4 bp segments. Zinc fmger domains are identified (e.g.,- from a database described above) that recognize each parsed 3 or 4 bp segment. Longer target sequences, e.g., 20 bp to 500 bp sequences, are also suitable targets as 9 bp, 12 bp, and 15 bp subsequences can be identified within them. In particular, subsequences amenable for parsing into sites well represented in the database can serves as initial design targets. Constructing Assembled Modules.
  • Polypeptide sequences are designed to contain multiple zinc fmger domains that recognize adjacent 3 or 4 bp subsites, or nearby subsites.
  • a nucleic acid sequence encoding the designed polypeptide sequence can be synthesized. Methods for constmcting synthetic genes are routine in the art. Such methods include gene constmction from custom synthesized oligonucleotides, PCR mediated cloning, and mega-primer PCR. Multiple nucleic acid sequences can be synthesized, e.g., to form a library.
  • the library nucleic acids can be designed such that the sequences encoding a domain at any given position vary such that they encode different zinc fmger domains -whose recognition specificity is suitable for that position.
  • Sexual PCR and "DNA ShufflingTM" can be used to vary the identity of zinc fmger domains at each position.
  • DNA binding domains can be connected by a variety of linkers.
  • linkers The utility and design of linkers are well known in the art.
  • a particularly useful linker is a peptide linker that is encoded by nucleic acid.
  • PCT WO 99/45132 and Kim and Pabo ((1998) Proc. Natl. Acad. Sci. USA 95:2812-7) describe the design of peptide linkers suitable for joining zinc finger domains.
  • peptide linkers are available that form random coil, ⁇ -helical or ⁇ - pleated tertiary structures.
  • Polypeptides that form suitable flexible linkers are" well known in the art (see, e.g., Robinson and Sauer (1998) Proc Natl Acad Sci US A.
  • Flexible linkers typically include glycine, because this amino acid, which lacks a side chain, is unique in its rotational freedom. Serine or threonine can be interspersed in the linker to increase hydrophilicity.
  • amino acids capable of interacting with the phosphate backbone of DNA can be utilized in order to increase binding affinity. Judicious use of such amino acids allows for balancing increases in affinity with loss of sequence specificity.
  • ⁇ -helical linkers such as the helical linker described in Pantoliano et al. (1991) Biochem. 30:10117-10125, can be used.
  • Linkers can also be designed by computer modeling (see, e.g., U.S. Pat. No. 4,946,778). Software for molecular modeling is commercially available (e.g., from Molecular Simulations, Inc., San Diego).
  • the linker is optionally optimized, e.g., to reduce antigenicity and/or to increase stability, using standard mutagenesis techniques and appropriate biophysical tests as practiced in the art of protein engineering, and functional assays as described herein.
  • the peptide that occurs naturally between zinc fingers can be used as a linker to join fingers together.
  • a typical such naturally occurring linker is: Thr-Gly-(Glu or Gln)-(Lys or Arg)-Pro-(Tyr or Phe) (SEQ ID NO:78) (Agata et al , supra).
  • Dimerization Domains An alternative method of linking DNA binding domains is the use of dimerization domains, especially heterodimerization domains
  • DNA binding domains are present in separate polypeptide chains.
  • a first polypeptide encodes DNA binding domain A, linker, and domain B
  • a second polypeptide encodes domain C, linker, and domain D.
  • An artisan can select a dimerization domain from the many well-characterized dimerization domains.
  • a particularly adaptable dimerization domain is the coiled-coil motif, e.g., a dimeric parallel or anti-parallel coiled-coil. Coiled-coil sequences that preferentially form heterodimers are also available (Lumb and Kim, (1995) Biochemistry 34:8642-8648).
  • Another species of dimerization domain is one in which dimerization is triggered by a small molecule or by a signaling event. For example, a dimeric form of FK506 can be used to dimerize two FK506 binding protein (FKBP) domains Such dimerization domains can be utilized to provide additional levels of regulation.
  • a nucleic acid binding domain or a protein designed by a method described herein, e.g., by modular assembly can be assayed or used in vivo.
  • domains can be selected to bind to a target site, e.g., to a promoter site of a gene required for cell proliferation.
  • a protein can be designed that includes (1) the selected domains that respectively bind to subsites spanning the target promoter site, and (2) a DNA repression domain, e.g., a WRPW domain.
  • a nucleic acid sequence encoding a designed protein can be cloned into an expression vector, e.g., an inducible expression vector as described in Kang and Kim, (2000) JBiol Chem 275:8742.
  • the inducible expression vector can include an inducible promoter or regulatory sequence.
  • inducible promoters include steroid-hormone responsive promoters (e.g., ecdysone-responsive, estrogen-responsive, and glutacorticoid-responsive promoters), the terracyclin "Tet-On" and "Tet-Off ' systems, and metal-responsive promoters.
  • the construct can be transfected into tissue culture cells or into embryonic stem cells to generate a transgenic organism as a model subject.
  • the efficacy of the designed protein can be determined by inducing expression of the protein and assaying cell proliferation of the tissue culture cell or assaying for developmental changes and/or tumor growth in a transgenic animal model.
  • the level of expression of the gene being targeted can be assayed by routine methods to detect mRNA, e.g., RT-PCR or Northern blots.
  • a more complete diagnostic includes purifying mRNA from cells expressing and not expressing the designed protein.
  • the two pools of mRNA are used to probe a microarray containing probes to a large collection of genes, e.g., a collection of genes relevant to the condition of interest (e.g., cancer) or a collection of genes identified in the organism's genome.
  • a microarray containing probes to a large collection of genes, e.g., a collection of genes relevant to the condition of interest (e.g., cancer) or a collection of genes identified in the organism's genome.
  • Such an assay is particularly valuable for determining the specificity of the designed protein. If the protein binds with high affinity but little specificity, it may cause pleiotropic and undesirable effects by affecting expression of genes in addition to the contemplated target. Such effects are revealed by a global analysis of transcripts.
  • the designed protein can be produced in a subject cell or subject organism in order to regulate an endogenous gene.
  • the designe'd protein is configured, as described above, to bind to a region of the endogenous gene and to provide a transcriptional activation or repression function.
  • the expression of a nucleic acid encoding the designed protein can be operably linked to an inducible promoter. By modulating the concentration of the inducer for the promoter, the expression of the endogenous gene can be regulated in a concentration dependent manner.
  • each domain can be verified by a biochemical ⁇ assay such as EMS A, DNase footprinting, surface plasmon resonance, or column binding.
  • the substrate for binding can be a synthetic oligonucleotide encompassing the target site.
  • the assay can also include non-specific DNA as a competitor, or specific DNA sequences as a competitor. Specific competitor DNAs can include the recognition site with one, two, or three nucleotide mutations.
  • a biochemical assay can be used to measure not only the affinity of a domain for a given site, but also its affinity to the site relative to other sites. Rebar and Pabo, (1994) Science 263 : 671-673 describe a method of obtaining apparent K d constants for zinc fmger domains from EMS A.
  • Example 1 Construction of plasmids for hybrid transcription factor expression.
  • An expression plasmid expressing a zinc finger transcription factor was prepared by modification of pPC86 (Chevray and Nathans, (1991) Proc. Natl Acad. Sci. USA 89:5789-5793). Manipulations of DNA were performed as described in Ausubel et al. (Current Protocols in Molecular Biology (1998), John Wiley and Sons, Inc.). A DNA fragment encoding Zif268 zinc fmger protein was inserted between the Sail and EcoRI recognition sites of pPC86 to generate pPCFM-Zif.
  • the resultrof this cloning step is a translational fusion protein encoding the yeas't Gal4 activation domain followed by the three Zif268 zinc fingers. Transformation of pPCFM-Zif into yeast cells results in expression of a hybrid transcription factor comprising the yeast Gal4 activation domain and the Zif268 zinc fingers.
  • the DNA sequence encoding the Zif268 zinc fmger protein as cloned in pPCFM-Zif is shown in Fig. 9.
  • the plasmid pPCFMS-Zif was utilized as a vector for constructing libraries of zinc fmger domains (Fig. 8).
  • pPCFMS-Zif was constracted by insertion of an oligonucleotide cassette containing a stop codon and a Pstl recognition site in front of the finger 3 coding region of pPCFM-Zif.
  • the oligonucleotide cassette was formed by annealing two synthetic oligonucleotides: 5'- TGCCTGCAGCATTTGTGGGAGGAAGTTTG-3 ' (S ⁇ Q ID NO:79); and 5 '-
  • the plasmid was used as a vector for the generation of zinc fmger domain libraries as described in "Example 2" below.
  • each oligonucleotide included a 21-nucleotide-long common tail at its 5' end for second round PCR (rePCR) and a specific sequence that annealed to the nucleic acid encoding the individual zinc fmger domain.
  • the sequences of the forward and back primers were 5'-ACCCACACTGGCCAGAAACCCN 48 . 5l - 3' (SEQ ID NO: 108) and 5'-GATCTGAATTCATTCACCGGTN 42 . 45 - 3' (SEQ ID NO:109), respectively, where N 48.51 and N 42.45 correspond to the customized sequence for annealing to the nucleic acid encoding the zinc finger domain.
  • DNA was prepared by amplifying template nucleic acid with an equimolar misture of two oligonucleotides. PCR conditions consisted of a first cycle at 94°C for 3 minutes followed by 5 cycles of 94°C for 1 minutes , 50°C for 1 minutes , and 72°C for 30 seconds.
  • the double stranded DNA encoding each zinc fmger domain was then used as a template in second round PCR.
  • the rePCR primers had two regions, one region that is identical to yeast vector pPCFM-Zif and a second region that is identical to the 21 - nucleotide-long common tail sequence described above.
  • the sequence of forward primer was
  • reaction mixture contained 2.5 pmoles of each primer, 1.5mM Mg 2+ , 2 units of Taq polymerase and 0.01 units of Pfu polymerase in 25 ul. Reactions were carried out at 94°C for 3 min, then cycled through 20 cycles of 94°C for 1 min, 65°C for lmin, and 72°C for 30 sec.
  • Gap repair cloning was performed by transforming the mixture of rePCR products and linearized pPCFM-Zif vector that had been digested with Mscl and EcoRI into yeast YW1 cells.
  • the region identical to the yeast vector pPCFM-Zif allows for homologous recombination with the vector in cells.
  • a plasmid library of naturally occurring zinc fmger domains was prepared by cloning zinc fmger domains from the human genome. DNA segments encoding zinc fmger domains were amplified from template human genomic DNA (purchased from Promega Corporation, Madison, WI, USA) using PCR and degenerate oligonucleotide primers.
  • the DNA sequences of the degenerate PCR primers used to clone human zinc finger domains were as follows; 5'- GCGTCCGGACNCAYACNGGNSARA -3' (SEQ ID NO:81) and 5'- CGGAATTCANNBRWANGGYYTYTC -3' (SEQ ID NO: 82), wherein R represent G and A; B represents G, C, and T; S represents G and C; W represents A and T; Y represents C and T; and N represents A, C, G, and T.
  • the degenerate PCR primers anneal to nucleic acid sequences coding for an amino acid profile, His-Thr-Gly-(Glu or Gln)-(Lys or Arg)-Pro-(Tyr or Phe) (SEQ ID NO: 83), that is found at the junction between zinc finger domains in many naturally occurring zinc finger proteins (Agata et al. (1998) Gene 213:55-64).
  • the buffer composition of the PCR reaction was 50 mM KC1, 3 mM MgCl,, 10 mM Tris pH 8.3. Taq DNA polymerase was added and the reaction mixture was incubated at 94°C for 30 seconds, at 42°C for 60 seconds, and'then at 72°C for 30 seconds. This cycle was repeated 35 times, and was followed by a final incubation at 72°C for 10 minutes.
  • the PCR products were cloned into pPCFMS-Zif as follows: The PCR products were electrophoresed, and the DNA segments corresponding to about 120 bp were isolated. After digestion with BspEl and EcoRI, the 120-bp DNA segments were ligated into pPCFMS-Zif.
  • the DNA-binding domain of the hybrid transcription factor encoded by this plasmid library consists of fmger 1 and finger 2 of Zif268 and a zinc fmger domain derived from the human genome.
  • the plasmid library was prepared from a total of 10 ⁇ Escherichia coli transformants. This library construction scheme retains the naturally occurring linker sequence found between zinc fmger domains.
  • a library of mutant zinc finger domains was prepared by random mutagenesis. Finger 3 of Zif26.8 was used as a polypeptide framework.- Random mutations were introduced at positions -1, 2, 3, 4, 5, and 6 along the ⁇ -helix, corresponding respectively to the arginine at position 73, aspartic acid at position 75, glutamic acid at position 76, arginine at position 77, lysine at position 78, and arginine at position 79 of SEQ ID NO:21 (within fmger 3 of Zif268). At each of the nucleic acid sequence positions encoding these amino acids, a randomized codon, 5'-(G/A/C) (G/A/C/T) (G/C)-3, was introduced.
  • This randomized codon encodes any one of 16 amino acids (excluding four amino acids: tryptophan, tyrosine, cysteine and phenyialanine). Also excluded are all three possible stop codons.
  • the randomized codons were introduced with an oligonucleotide cassette constructed from two oligonucleotides:
  • AGAAGATTC-3' (SEQ ID NO:84); and 5'-CTCCCCGCGGTTCGCCGGTGTGGATTCTGATATGSNBSNBAAGSNB SNB3NBSNBTGAGAATCTTCTATCACAAG-3' (SEQ ID NO:85), wherein B represents G, T, and C; S represents G and C; and N represents A, G, C, and T.
  • the DNA duplex cassette was synthesized by reaction with Klenow polymerase for 30 minutes. After digestion with Aval and S ⁇ cII, the DNA duplex was ligated into pPCFMS-Zif digested with SgrAI and S ⁇ cII. Plasmids were isolated from about 10 9 E. coli transformants.
  • Reporter plasmids including the yeast HIS3 gene were prepared by modification of pRS315His (Wang and Reed (1993) Nature 364:121-126).
  • the reporter plasmids also contain the LEU1 marker under its natural promoter for the purpose of selecting transformants bearing the plasmid.
  • the Sail recognition site in pRS315His was removed by ligating the small fragment of pRS315His after digestion with Sail and BamHI and the large fragment of pRS315His after digestion - with BamHI and Xh ⁇ to make pRS315His ⁇ Sal.
  • a new Sail recognition site was created within the promoter region of the HIS 3 gene by inserting an oligonucleotide duplex into pRS315His ⁇ Sal between the BamHI and Smal site.
  • the sequences of the two oligonucleotides that were annealed to produce the inserted duplex are 5'-CTAGACCCGGGAATTCGTCGACG-3' " (SEQ ID NO:86); and
  • the target sequences were derived from 10-bp DNA sequences (Fig. 6) found in the LTR region of HIV-1 : 5'-GAC ATC GAG C-3' (SEQ ID NO:l) HIV-1 LTR (-124/-115)
  • Each of these 10-bp DNA sequence can be parsed into component 4-bp target sites in order to identify a zinc fmger domain that recognizes each region of the site.
  • zinc fmger domains can be coupledlo produce a DNA binding protein that recognizes the site in vivo.
  • the underlined portions in Fig. 6 depict examples of 4-bp target sequences.
  • Each of these 4-bp target sequences was connected to the 5-bp recraitment sequence, 5'-GGGCG-3', that is recognized by fmger 1 and fmger 2 of Zif268.
  • the resulting 9- bp sequences constitute composite binding sequences.
  • Each composite binding sequence has the following format: 5'-XXXXGGGCG-3 ⁇ where XXXX is the 4-bp target sequence and the adjacent 5'-
  • GGGCG-3' is the recraitment sequence.
  • Fig. 7 recites the DNA sequences of the inserted tandem arrays of composite binding sites, each of which was operably linked to the reporter gene in pRS315HisMCS.
  • Each tandem array contains 4 copies of a composite binding sequence.
  • two oligonucleotides were synthesized, annealed and ligated into pRS315HisMCS restricted with Sail and Xyn ⁇ l site to make a reporter plasmid.
  • Example 5 Construction of reporter plasmids A set of reporter plasmids that includes a pair of reporters (one having l ⁇ cZ, the other having H7S3) for each 3 basepair subsite was constracted as follows: Reporter plasmids were constracted by inserting the desired target sequences into pRS315 ⁇ isMCS and pLacZi. For each 3 basepair target site, two oligonucleotides were synthesized, annealed, and inserted into the Sail and Xmal site of pRS315HisMCS and of pLacZi to make reporter plasmids.
  • the DNA sequences of the oligonucleotides were as follows: 5'- CCGGT NNNTGGGCG TAC NNNTGGGCG TCA NNNTGGGCG -3' (SEQ ID NO:88) and 5'- TCGA CGCCCANNN TGA CGCCCANNN GTA CGCCCANNN A -3' (SEQ ID NO:89). Total 64 pairs of oligonucleotides were synthesized and inserted into the two reporter plasmids.
  • Example 6 Selection of zinc finger domains with desired DNA-binding specificity
  • yeast cells were transformed first with a reporter plasmid and then 'a library of-hybrid plasmids encoding hybrid transcription factors.
  • Yeast transformation and screening procedures were carried out as described in Ausubel et al. (Current Protocols in Molecular Biology (1998), John Wiley and Sons, Inc.).
  • Yeast strain yWAM2 (MATa (alpha) ⁇ gal4 gal80 URA3::GALl-lacZ lys!801 his3- ⁇ 200 trpl- 63 leul ade2-101CYHl) was used.
  • yeast cells were first transformed with a reporter plasmid containing the composite binding sequence 5'-GAGCGGGCG-3' (the 4-bp target sequence is underlined), which was operably linked to the reporter gene. Then, the plasmid library of mutant zinc fmger domains prepared by random mutagenesis was introduced into the transformed yeast cells. About 10 6 colonies were obtained in medium lacking both leucine and tryptophan. Because the reporter plasmid and the zinc fmger domain expression plasmids contain yeast LEU2 and TRP1 genes, respectively, as a marker, yeast cells were grown in medium lacking both leucine and tryptophan in order to select for cells that contain both the reporter and the zinc finger domain expression plasmid.
  • the library of zinc fmger domains derived from the human genome was transformed into cells bearing the reporter plasmids.
  • the transformation was performed on five different host cell strains, each strain containing one of five different target sequences operably linked to the reporter gene. About 10 3 colonies were obtained per transformation in medium lacking both leucine and tryptophan. Transformants were grown on petri plates containing synthetic medium lacking leucine and tryptophan. After incubation, transformed cells were collected by applying a 10% sterile glycerol solution to the plates, scraping the colonies into the solution, and retrieving the solution. Cells were stored as frozen aliquots in the glycerol solution.
  • AT 3-aminotriazole
  • the plasmids encoding zinc finger transcription factor were isolated, and the DNA sequences of selected zinc fmger domains were determined.
  • the amino acid sequence of each selected zinc finger domain was deduced from the DNA sequence.
  • Each zinc fmger domain was named after the four amino acid residues at base-contacting positions, namely positions -1, 2, 3, and 6 along the alpha-helix. The results are shown in Table 1.
  • Identified zinc finger domains are named by the four amino acids found at base-contacting positions. Analysis of the sequences showed that in some cases the same zinc fmger domain was obtained repeatedly.
  • the numbers in the parenthesis in Table 1 represent how many times the same zinc fmger domains have been obtained. For example, two zinc fingers having CSNR at the four base contacting positions were identified as binding the GAGC nucleic acid site (see column 3, "GAGC/human genome").
  • the four-letter identifiers in the six columns to the right are the descriptors of the zinc finger domains isolated for each target sequence. Although these names are indicative of the amino acid residues at base contacting positions, they are not sequences of polypeptides.
  • Fig. 11 The full DNA sequences encoding selected human zinc finger domains and their translated amino acid sequences are shown in Fig. 11.
  • the DNA sequence that is complementary to the degenerate PCR primers used to amplify DNA segments encoding zinc fmger domains in the human genome is underlined. This sequence may differ from the original base sequence of reported human genome sequence due to either allelic differences or alterations introducing during " amplification.
  • zinc fmger domains identified by screening in accordance with the present invention either were novel polypeptides or corresponded to anonymous open reading frames.
  • zinc fmger domains designated as HSNK (contained in the sequence reported in GenBank accession number AF155100) and VSTR (contained in the sequence reported in GenBank accession number AF02577) are found in proteins whose function is as yet unknown.
  • the results described herein not only indicate that these zinc fmger domains are able to function as sequence- specific DNA-binding domains, but also document their preferred binding site preference in the context of chimeric proteins.
  • the present invention reveals that zinc finger domains obtained from the human genome can be used as modular building blocks to construct novel DNA-binding proteins.
  • Human zinc finger domains of the present invention were obtained as a result of their functionality in vivo when connected to the C-terminus of fmger 1 and fmger 2 of Zif268.
  • the identified zinc fmger domains can recognize specific sequence in an artificial context, and are suitable as modular building blocks for designing synthetic transcription factors.
  • yeast mating was used to eliminate the need for repetitively transforming yeast cells and to search for positive binders to each of the 64 reporter constructs with a single transformation.
  • YWI was derived from yWAM2 by selecting a clone resistant to 5-fluoroorotic acid (FOA) in order to generate a ura3- derivative of yWAM2.
  • the plasmid library of zinc fmger domains were introduced into the YWI cells by yeast transformation. Cells from approximately 10 6 independently transformed colonies were collected by scraping plates with a 10% glycerol solution. The solution was frozen in aliquots. Each pair of 64 reporter plasmids (derived from pLacZi or pRS315His) also was cotransfected into yeast strain YPH499. Transformants containing both reporter plasmids were harvested and frozen. After thawing, the yeast cells were grown on minimal media to m'id-log phase.
  • the two cell types were then mixed and allowed to mate in YPD for 5 h. Diploid cells were selected on minimal media containing X-gal and AT.(1 mM) but lacking tryptophan, leucine, uracil, and histidine. After several days, blue colonies that grew on the selective plate were isolated. The plasmids encoding zinc fmger domains were isolated from blue colonies, and the DNA sequences of the selected zinc fmger domains were dete ⁇ nined.
  • the nucleic acids isolated from the blue colonies were individually retransformed into YWI cells.
  • retransformed YWI cells were mated to YPH499 cells containing each of the 64 LacZ reporter plasmids in a 96-well plate, and then spread onto minimal media containing X-gal but lacking tryptophan and uracil.
  • the DNA binding affinities and specificities of a zinc finger domain for 64 target sequences were determined by the intensity of blue color. Control experiments with the Zif268 zinc fmger domains indicated that positive interactions between a zinc fmger domain and a binding site yielded dark to pale blue colonies, (whose blue intensity is proportional to the binding affinity) and that negative interactions yielded white colonies.
  • the amino acid residues of selected zinc fmger domains at the critical base- contacting positions were compared with those anticipated from the zinc finger domain-DNA interaction code (Fig. 3). Most of zinc finger domains showed expected patterns, i.e. the amino acid residues at the critical positions match well those predicted from the code.
  • the consensus amino acid residues in zinc fmger domains selected from the library generated by random mutagenesis were R (Arg; 7 out of 14) ⁇ or K (Lys; 2 out of 14) at position -1, N (Asp; 6 out of 14) at position 3, and R (9 out of 14) at position 6 (Table 1).
  • These zinc fmger domains were selected with the GAGC plasmid.
  • the reporter plasmid in which the composite binding sequence, 5'- GAGCGGGCG-3', is operably linked to the reporter gene is referred to as the GAGC plasmid.
  • the other reporter plasmids in which the sequence, 5'- XXXXGGGCG-3 ' , is operably linked to the reporter gene are referred to, as the XXXX plasmids.
  • These amino acid residues at critical base-contacting positions exactly match those expected from the code.
  • S serine residue
  • a serine residue is capable of forming a hydrogen bond with any of the four bases.
  • residues at position 2 usually play only a minor role in base recognition (Pavletich and Pabo (1991) Science 252, 809-817).
  • the amino acid residues in zinc fmger domains obtained from the human genome also match those expected from the code quite well.
  • the consensus amino acid residues at position -1, 3, and 6 in the zinc fmger domains obtained with the GAGC plasmid were R, N, and R, respectively (Table 1, column 3). These amino acids are exactly those anticipated from the code.
  • the amino acid residues at position -1, 3, and 6 in the zinc fmger domain obtained with the GCTT plasmid were V, T, and R, respectively (Table 1, column 4).
  • the T and R residues are exactly those expected from the code.
  • the amino acid residues predicted from the code at position -1 that would interact with the base T (underlined) of the GCTT site are L, T or N.
  • the VSTR zinc finger domain, which was selected with the GCTT plasmid contained V (valine), a hydrophobic amino acid similar to L (leucine) at this position.
  • amino acid residues in selected zinc fmger domains match those predicted from the code at least at two positions out of the three critical positions.
  • amino acid residues in selected zinc fmger domains that are expected from the code are underlined in Table 1.
  • Yeast cells were first co-transformed with a reporter plasmid and a hybrid plasmid encoding a zinc fmger domain. Yeast transformants were inoculated into minimal medium lacking leucine and tryptophan and incubated for 36 hours. About 1 ,000 cells in the growth medium were spotted directly onto solid medium lacking leucine, tryptophan, and histidine (designated as - histidine in Fig. 10) and onto solid medium lacking leucine and tryptophan (designated as + histidine in Fig. 10). These cells were then incubated for 50 hours at 30°C. The results are shown in Fig. 10.
  • the KTNR zinc fmger domain isolated from the random mutant library was originally selected with the GAGC reporter plasmid. As expected, colonies were formed only with the GAGC plasmid. Zinc finger domains obtained from the library derived from the human genome also showed expected specificity. For example, HSNK, which had been selected with the GACT plasmid, allowed cell growth only with the GACT plasmid when retransformed into yeast cells. VSTR, which had been selected with the GCTT plasmid, showed the highest activity with the GCTT plasmid. RDER, which was selected with the GAGT plasmid, has the same amino acid residues at the four base-contacting positions as does fmger 3 of Zif268.
  • this zinc fmger domain showed sequence specificity similar to that of fmger 3.
  • SSNR selected with the GAGC and GAGT plasmids, allowed cell growth on histidine- deficient medium with the GAGC plasmid but not with the GAGT plasmid.
  • QSTN obtained with the AC AT plasmid, did not allow cell growth with any of the plasmids tested in this assay.
  • this zinc fmger domain was able to bind to the ACAT sequence tightly in vitro as demonstrated below.
  • Example 10 Gel shift assays Zinc finger proteins containing zinc fmger domains selected using the modified one-hybrid system were expressed in E. coli, purified, and used in gel shift assays.
  • Zinc fmger proteins were expressed in E. coli strain BL21 as fusion proteins connected to GST (Glutathione-S-transferase).
  • the fusion proteins were purified using glutathione affinity chromatography (Pharmacia Biotech, Piscataway, ⁇ J) and then digested with thrombin, which cleaves the connecting site between the GST moiety and zinc finger proteins.
  • Purified zinc fmger proteins contained finger 1 and fmger 2 of Zif268 and selected zinc fmger domains at the C-terminus.
  • probe D ⁇ As were synthesized, annealed, labeled with 32 P using T4 polynucleotide kinase, and used in gel shift assays.
  • GCGT 5'-CCGGGTCGCGHGIGGGCGGTACCG-3' (SEQ ID NO: 90) 3'-CAGCGCGCACCCGCCATGGCAGCT-5' (SEQ ID NO:91)
  • ACAT 5'-CCGGGTCGGACAT.GGGCGGTACCG-3' (SEQ ID NO: 100) 3'-CAGCCTGTACCCGCCATGGCAGCT-5'_ (SEQ ID NO.101)
  • Zinc finger protein Probe DNA Dissociation • Growth of Constant (nM) Yeast
  • the Zif268 protein used as a control allowed cell growth with the GCGT and GAGT reporter plasmids, and the dissociation constants measured in vitro using corresponding probe DNAs were 0.024 nM and 0.17 nM, respectively.
  • the Zif268 protein did not allow cell growth with other plasmids, and the dissociation constants measured using 5 corresponding probe DNAs were higher than 1 nM. '
  • Zinc fmger proteins containing novel zinc fmger domains also showed similar results.
  • the KTNR protein showed strong affinity for the GAGC probe DNA, with a dissociation constant of 0.17 nM, but not for the GCGT or GACT probe ' DNA, with dissociation constants of 5.5 nM or 30 nM, respectively.
  • This protein o allowed cell growth only with the GAGC plasmid.
  • the QSTV protein which was selected with the ACAT reporter plasmid, was 5 not able to promote cell growth with any of the other reporter plasmids when retransformed into yeast. Gel shift assays demonstrated that this protein bound the ACAT probe DNA more tightly than it did the other probe DNAs. That is, QSTV bound the ACAT probe DNA 13 times or 4.3 times stronger than it did the GCTT or GCGT probe DNA respectively.
  • Zinc finger proteins that bind with a dissociation constant of greater than 1 nM, but less than 5 nM can also be 5 useful, e.g., in the context of a chimeric zinc fmger protein having four zinc fmger domains.
  • TG-ZFD-001 "CSNR1" was identified by in vivo screening from human 0 genomic sequence. Its amino acid sequence is YKCKQCGKAFGCPSNLRRHGRTH (SEQ ID NO:23). It is encoded by the human nucleic acid sequence: 5'- TATAAATGTAAGCAATGTGGGAAAGCTTTTGGATGTCCCTCAAACCTTCGAA
  • TG-ZFD-001 "CSNR1" demonstrates recognition specificity for the 3-bp target sequence sequences GAA
  • GAC GAC
  • GAG GCG
  • EMS A the TG-ZFD-001 "CSNR" fusion to fingers 1 and 2 of Zif268 and the GST purification handles has an apparent K d of 0.17 nM for the GAC containing site, 0.46 nM for the GAG containing site, and 2.7 nM for the GCG containing site.
  • TG-ZFD-001 "CSNRl" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAA, GAC, or GAG.
  • TG-ZFD-002 "HSNK” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCKECGKAFNHSSNFNKHHRIH (SEQ ID NO:25). It is encoded by the human nucleic acid sequence: 5'- TATAAGTGTAAGGAGTGTGGGAAAGCCTTCAACCACAGCTCCAACTTCAATA AACACCACAGAATCCAC-3' (SEQ ID NO:24).
  • TG-ZFD-002 "HSNK” demonstrates recognition specificity for the 3-bp target sequence GAC. Its binding site preference is GAC > GAG > GCG as determined by in vivo screening results and EMS A.
  • EMS A the TG-ZFD-002 "HSNK” fusion to fingers 1 and 2 of Zif268 and the GST purification handles has an apparent I of 0.32 nM for the GAC containing site, 3.5 nM for the GAG containing site, and 42 nM for the GCG containing site.
  • TG-ZFD-002 "HSNK” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAC.
  • TG-ZFD-003 "SSNR" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECKECGKAFSSGSNFTRHQRIH (SEQ ID NO:27). It is encoded by the human nucleic acid sequence: 5'-
  • TG-ZFD-003 "SSNR" demonstrates recognition specificity for the 3-bp target sequence GAG. Its binding site preference is GAG > GAC > GCG as determined by in vivo screening results and
  • EMS A the TG-ZFD-003 "SSNR" fusion to fingers 1 and 2 of Zif268 and the GST purification handles has an apparent K d of 0.45 nM for the GAG containing site, 0.61 nM for the GAC containing site, and 3.8 nM for the GCG containing site.
  • TG-ZFD-003 "SSNR" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAG, or GAC.
  • TG-ZFD-004 "RDER1" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • YVCDVEGCTWKFARSDELNRHKKRH (SEQ ID NO:29). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-004 "RDER1" As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-004 "RDER1" demonstrates recognition specificity for the 3-bp target sequence GCG. Its binding site preference is GCG > GTG, GAG > GAC as determined by in vivo screening results and EMS A. In EMS A, the TG-ZFD-004 "RDERl” fusion to fingers 1 and 2 of Zif268 and the GST purification handles has an apparent K d of 0.027 nM for the
  • TG-ZFD-004 "RDER1" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GCG, GTG or GAG.
  • TG-ZFD-005 "QSTV” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECNECGKAFAQNSTLRVHQRIH (SEQ ID NO:31). It is encoded by the human nucleic acid sequence: 5'- TATGAGTGTAATGAATGCGGGAAAGCTTTTGCCCAAAATTCAACTCTCAGAG TACACCAGAGAATTCAC-3' (SEQ LD NO:30).
  • TG-ZFD-005 "QSTV” demonstrates recognition specificity for the 3-bp target sequence AC A. Its binding site preference is ACA > GCG > GCT as determined by EMS A.
  • EMSA the TG- - ZFD-005 "QSTV" fusion to fingers 1 and 2 of Zif268 and the GST purification handles has an apparent K d of 2.3 nM for the ACA containing site, 9.8 nM for the GCG containing site, and 29 nM for the GCT containing site.
  • TG-ZFD-005 "QSTV" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence ACA. -
  • TG-ZFD-006 "VSTR” was identified by in vivo screening ' from human genomic sequence. Its amino acid sequence is: YECNYCGKTFSVSSTLIRHQRIH (SEQ ID NO:33) . It is encoded by the human nucleic acid sequence: 5'-
  • TG-ZFD-006 "VSTR” demonstrates recognition specificity for the 3-bp target sequence GCT. Its binding site preference is GCT > GCG > GAG as determined by in vivo screening results and EMSA.
  • EMSA the TG-ZFD-006 "VSTR" fusion to fingers 1 and 2 of Zif268 and the GST purification handles has an apparent K d of 0.53 nM for the GCT containing site, 0.76 for the GCG containing site, and 1.4 nM for the GAG containing site.
  • TG-ZFD-006 "VSTR" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GCT or GCG.
  • TG-ZFD-007 "CSNR2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YQCNICGKCFSCNSNLHRHQRTH (SEQ ID NO:35). It is encoded by the human nucleic acid sequence: 5 '-TATC AGTGCAACATTTGCGGAAAATGTTTCTCCTGC AACTCC AACCTCC A
  • CAGGCACCAGAGAACGCAC -3' (SEQ ID NO:34).
  • CSNR2 As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-007 "CSNR2" demonstrates recognition specificity for 3-bp target sequences GAA, GAC, and GAG. Its binding site preference is GAA > GAC > GAG as determined by in vivo screening" results.
  • TG-ZFD-007 "CSNR2" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAA, GAC, or GAG.
  • TG-ZFD-008 "QSHR1" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YACHLCGKAFTQSSHLRRHEKTH (SEQ ID NO:37). It is encoded by the human nucleic acid sequence: 5'-TATGCATGTCATCTATGTGGAAAAGCCTTCACTCAGAGTTCTCACCTTAG AAGACATGAGAAAACTCAC -3' (SEQ ID NO:36).
  • TG-ZFD-008 "QSHR1" As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-008 "QSHR1" demonstrates recognition specificity for 3-bp target sequences GGA, GAA, and AGA. Its binding site preference is GGA > GAA > AGA as determined by in vivo screening results.
  • TG-ZFD-008 "QSHR1" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA, GAA, or AGA.
  • TG-ZFD-009 "QSHR2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCGQCGKFYSQVSHLTRHQKIH (SEQ ID NO: 39). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-009 "QSHR2" demonstrates recognition specificity for the 3-bp target sequence GGA.
  • TG-ZFD-009 "QSHR2" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA.
  • Example 20 TG-ZFD-010 "QSHR3" TG-ZFD-010 "QSHR3" was identified by in vivo screening from human . genomic sequence. Its amino acid sequence is: YACHLCGKAFTQCSHLRRHEKTH (SEQ ID NO:41). It is encoded by the human nucleic acid sequence: 5'-TATGCATGTCATCTATGTGGAAAAGCCTTCACTCAGTGTTCTCACCTTAG AAGACATGAGAAAACTCAC-3' (SEQ ID NO:40). As a polypeptide fusion to fingers 1 and 2 of Zif2 " 68, TG-ZFD-010 "QSHR3" demonstrates recognition specificity for 3-bp target sequences GGA and GAA. Its binding site preference is GGA > GAA as determined by in vivo screening results.
  • TG-ZFD-010 "QSHR3" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA or GAA.
  • TG-ZFD-011 "QSHR4" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YACHLCAKAFIQCSHLRRHEKTH (SEQ ID NO:43). It is encoded by the human nucleic acid sequence: 5'-TATGCATGTCATCTATGTGCAAAAGCCTTCATTCAGTGTTCTCACCTTAGA AGACATGAGAAAACTCAC -3' (SEQ ID NO:42).
  • TG-ZFD-011 "QSHR4" demonstrates recognition specificity for 3-bp target sequences GGA and GAA.- Its binding site preference is GGA > GAA as determined by in vivo screening results.
  • TG-ZFD-011 "QSHR4" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA or GAA.
  • TG-ZFD-012 "QSHR5" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YVCRECGRGFRQHSHLVRHKRTH (SEQ ID NO:45). It is encoded by the human nucleic acid sequence: 5'-TATGTTTGCAGGGAATGTGGGCGTGGCTTTCGCCAGCATTCACACCTGGT CAGACACAAGAGGACACAT -3' (SEQ LD NO:44).
  • TG-ZFD-012 "QSHR5" demonstrates recognition specificity for 3-bp target sequences GGA, AGA, GAA, and CGA. Its binding site preference is GGA > AGA > GAA > CGA as determined by in vivo screening results.
  • TG-ZFD-012 "QSHR5" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA, AGA, GAA, or CGA.
  • Example 23 TG-ZFD-013 "QSNR1"
  • TG-ZFD-013 "QSNR1” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: FECKDCGKAFIQKSNLIRHQRTH (SEQ ID NO:47). It is encoded by the human nucleic acid sequence: 5'-TTTGAGTGTAAAGATTGCGGGAAAGCTTTCATTCAGAAGTCAAACCTCA TCAGACACCAGAGAACTCAC-3' (SEQ ID NO:46).
  • TG-ZFD-013 "QSNR1" demonstrates recognition specificity for the 3-bp target sequence GAA.
  • TG-ZFD-013 "QSNR1" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAA.
  • TG-ZFD-014 "QSNR2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YVCRECRRGFSQKSNLIRHQRTH (SEQ ID NO:49). It is encoded by the human nucleic acid sequence: 5'-TATGTCTGCAGGGAGTGTAGGCGAGGTTTTAGCCAGAAGTCAAATCTCA TC AGAC ACC AGAGGACGC AC-3 ' (SEQ ID NO:48).
  • TG-ZFD-014 "QSNR2" demonstrates recognition specificity for the 3-bp target sequence GAA.
  • TG-ZFD-014 "QSNR2" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAA.
  • TG-ZFD-015 "QSNV1" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECNTCRKTFSQKSNLIVHQRTH (SEQ ID NO:51): It is encoded by the human nucleic acid sequence:
  • TG-ZFD-015 "QSNV1" demonstrates recognition specificity for 3-bp target sequences AAA and CAA. Its binding site preference is AAA > CAA as determined by in vivo screening results.
  • TG-ZFD-015 "QSNV1" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence AAA or CAA.
  • TG-ZFD-016 "QSNV2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YVCSKCGKAFTQSSNLTVHQKIH (SEQ ID NO:53). It is encoded by the human nucleic acid sequence: 5 '-TATGTTTGCTCAAAATGTGGGAAAGCCTTCACTCAGAGTTCAAATCTGAC
  • TG-ZFD-016 "QSNV2" As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-016 "QSNV2" demonstrates recognition specificity for 3-bp target sequences AAA and CAA. Its binding site preference is AAA > CAA as determined by in vivo screening results. TG-ZFD-016 "QSNV2" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence AAA or CAA.
  • Example 27 TG-ZFD-017 "QSNV3" TG-ZFD-017 "QSNV3" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCDECGKNFTQSSNLIVHKPJH (SEQ ID NO:55). It is encoded by the human nucleic acid sequence: 5'-TACAAATGTGACGAATGTGGAAAAAACTTTACCCAGTCCTCCAACCTTA TTGTACATAAGAGAATTCAT -3' (SEQ ID NO:54). As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-017 "QSNV3" demonstrates recognition specificity for a 3-bp target sequence AAA.
  • TG-ZFD-017 "QSNN3" can be used as a module to construct a chimeric D ⁇ A binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a D ⁇ A site containing the sequence AAA.
  • TG-ZFD-018 "QSNV4" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • YECDVCGKTFTQKSNLGVHQRTH (SEQ ID NO:57). It is encoded by the human nucleic acid sequence: 5'-TATGAATGTGATGTGTGTGGAAAAACCTTCACGCAAAAGTCAAACCTTG GTGTACATCAGAGAACTCAT -3' (SEQ ID NO:56).
  • TG-ZFD-018 "QSNV4" demonstrates recognition specificity for the 3-bp target sequence AAA.
  • TG-ZFD-018 "QSNV4" can be used as a module to cohstract a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence AAA.
  • Example 29 TG-ZFD-019 "QSSR1" TG-ZFD-019 "QSSR1" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCPDCGKSFSQSSSLIRHQRTH (SEQ ID NO:59). It is encoded by the human nucleic acid sequence: 5'-TATAAGTGCCCTGATTGTGGGAAGAGTTTTAGTCAGAGTTCCAGCCTCAT TCGCCACCAGCGGACACAC-3' (SEQ TD NO:58). As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-019 "QSSR1" demonstrates recognition specificity for 3-bp target sequences GTA and GCA. Its binding site preference is GTA > GCA as determined by in vivo screening results.
  • TG-ZFD-019 can be used as a module to constmct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GTA or -GCA.
  • TG-ZFD-020 "QSSR2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECQDCGRAFNQNSSLGRHKRTH (SEQ ID NO:61). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-020 "QSSR2" demonstrates recognition specificity for the 3-bp target sequence GTA.
  • TG-ZFD-020 "QSSR2” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GTA.
  • Example 31 TG-ZFD-021 "QSTR"
  • TG-ZFD-021 "QSTR" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCEECGKAFNQSSTLTRHKIVH (SEQ ID NO:63). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-021 "QSTR" demonstrates recognition specificity for 3-bp target sequences GTA and GCA. Its binding site preference is GTA > GCA as determined by in vivo screening results.
  • TG-ZFD-021 "QSTR" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GTA or GCA.
  • TG-ZFD-022 "RSHR” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCMECGKAFNRRSHLTRHQRIH (SEQ ID NO:65). It is encoded by the human nucleic acid sequence: 5'-TATAAGTGCATGGAGTGTGGGAAGGCTTTTAACCGCAGGTCACACCTCA CACGGCACCAGCGGATTCAC-3' (SEQ LD NO:64).
  • TG-ZFD-022 "RSHR" demonstrates recognition specificity for the 3-bp target sequence GGG.
  • TG-ZFD-022 "RSHR" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGG.
  • TG-ZFD-023 "VSSR" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YTCKQCGKAFSVSSSLRRHETTH (SEQ ID NO:67). It is encoded by the human nucleic acid sequence: 5'-TATACATGTAAACAGTGTGGGAAAGCCTTCAGTGTTTCCAGTTCCCTTCG AAGACATGAAACCACTCAC-3' (SEQ ID NO:66).
  • VSSR demonstrates recognition specificity for 3-bp target sequences GTT, GTG, and ⁇ GTA. Its binding site preference is GTT > GTG > GTA as determine'd by in vivo screening results.
  • TG-ZFD-023 "VSSR" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GTT, GTG, or GTA.
  • TG-ZFD-024 "QAHR” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCKECGQAFRQRAHLIRHHKLH
  • TG-ZFD-024 "QAHR” demonstrates recognition specificity for the 3-bp target sequence GGA as determined by in vivo screening results.
  • TG-ZFD-024 "QAHR” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA
  • Example 35 TG-ZFD-025 "QFNR” TG-ZFD-025 “QFNR” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCHQCGKAFIQSFNLRRHERTH (SEQ ID NO: 105). It is encoded by the human nucleic acid sequence: 5'-TATAAGTGTCATCAATGTGGGAAAGCCTTTATTCAATCCTTTAACCTTC GAAGACATGAGAACTCAC-3' (SEQ ID NO: 104). As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-025 "QFNR" demonstrates recognition specificity for the 3-bp target sequence GAC as determined by in vivo screening results.
  • TG-ZFD-025 "QFNR" can be used as a module to constmct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAC.
  • TG-ZFD-026 "QGNR" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: FQCNQCGASFTQKGNLLRHIKLH (SEQ ID NO: 107). It is encoded by the human nucleic acid sequence: 5'-TTCCAGTGTAATCAGTGTGGGGCATCTTTTACTCAGAAAGGTAACCTCC TCCGCCACATTAAACTGCAC-3' (SEQ ID NO: 106).
  • TG-ZFD-026 "QGNR" demonstrates recognition specificity for the 3-bp target sequence GAA as determined by in vivo screening results.
  • TG-ZFD-026 "QGNR" can be used as a module to constmct a chimeric DNA- binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAA.
  • TG-ZFD-028 "QSHT” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YKCEECGKAFRQSSHLTTHKIIH
  • TG-ZFD-028 "QSHT" demonstrates recognition specificity for the 3-bp target sequence AGA, CGA, TGA, and GGA. Its binding site preference is (AGA and CGA) > TGA > GGA as determined by in vivo screening results.
  • TG-ZFD-028 "QSHT” can be used as a module to constmct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence AGA, CGA, TGA, and GGA.
  • TG-ZFD-029 "QSHV” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECDHCGKSFSQSSHLNVHKRTH (SEQ ID NO: 113). It is encoded by the human nucleic acid sequence: 5'-TATGAGTGTGATCACTGTGGAAAATCCTTTAGCCAGAGCTCTCATCTGAA
  • TGTGCACAAAAAAAGAACTCAC-3' (SEQ ID NO:112).
  • TG-ZFD-029 "QSHV" demonstrates recognition specificity for the 3-bp target sequence CGA, AGA, and TGA. Its binding site preference is CGA > AGA > TGA as determined by in vivo screening results.
  • TG-ZFD-029 "QSHV" can be used as a module to constmct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence CGA, AGA, and TGA.
  • TG-ZFD-030 "QSNI" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YMCSECGRGFSQKSNLIIHQRTH (SEQ ID NO: 115). It is encoded by the human nucleic acid sequence: 5'-TACATGTGCAGTGAGTGTGGGCGAGGCTTCAGCCAGAAGTCAAACCTC ATCATACACCAGAGGACACAC-3' (SEQ ID NO:114).
  • TG-ZFD-030 "QSNI" demonstrates recognition specificity for the 3-bp target sequence AAA and CAA as determined by in vivo screening results.
  • TG-ZFD-030 "QSNI" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence AAA or CAA.
  • TG-ZFD-031 "QSNR3" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECEKCGKAFNQSSNLTRHKKSH
  • TG-ZFD-031 "QSNR3" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAA.
  • TG-ZFD-032 "QSSR3" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:YECNECGKFFSQSSSLIRHRRSH (SEQ ID NO: 119). It is encoded by the human nucleic acid sequence: 5'-TATGAGTGCAATGAATGTGGGAAGTTTTTTAGCCAGAGCTCCAGCCTCA- TTAGACATAGGAGAAGTCAC-3 ' (SEQ ID NO: 118).
  • TG-ZFD-032 "QSSR3" demonstrates recognition specificity for the 3-bp target sequence GTA and GCA. Its binding site preference is GTA > GCA as determined by in vivo screening results.
  • TG-ZFD-032 "QSSR3" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger dorrrains,_e.g., for the purpose of recognizing a DNA site containing the sequence GTA or GCA.
  • TG-ZFD-033 "QTHQ" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECHDCGKSFRQSTHLTQHRRIH
  • CTCAGCACCGGAGGATCCAC-3' (SEQ ID NO:120).
  • TG-ZFD-033 "QTHQ" demonstrates recognition specificity for the 3-bp target sequence AGA, TGA, and
  • TG-ZFD-033 "QTHQ" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence AGA, TGA, and CGA.
  • TG-ZFD-034 "QTHR1" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YECHDCGKSFRQSTHLTRHRRIH (SEQ ID NO: 123). It is encoded by the human nucleic acid sequence: 5'-TATGAGTGTCACGATTGCGGAAAGTCCTTTAGGCAGAGCACCCACCTCA CTCGGCACCGGAGGATCCAC-3' (SEQ ID NO: 122).
  • TG-ZFD-034 "QTHR1" demonstrates recognition specificity for the 3-bp target sequence GGA, GAA, and AGA . Its binding site preference is GGA > (GAA and AGA) as determined by in vivo screening results.
  • TG-ZFD-034 "QTHR1" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA, GAA, and AGA.
  • TG-ZFD-035 "QTHR2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: HKCLECGKCFSQNTHLTRHQRT (SEQ ID NO: 125). It is encoded by the human nucleic acid sequence: 5'-CACAAGTGCCTTGAATGTGGGAAATGCTTCAGTCAGAACACCCATCTG ACTCGCCACCAACGCACCCAC-3' (SEQ ID NO: 124). As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-035 "QTHR2" demonstrates recognition specificity for the 3-bp target sequence GGA as determined by in vivo screening results.
  • TG-ZFD-035 "QTHR2" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc finger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGA.
  • TG-ZFD-036 "RDER2" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • YHCDWDGCGWKFARSDELTRHYRKH (SEQ ID NO: 127). It is encoded ⁇ y the human nucleic acid sequence:
  • TG-ZFD-036 "RDER2" demonstrates recognition specificity for the 3-bp target sequence GCG and GTG. Its binding site preference is GCG > GTG as determined by in vivo screening results.
  • TG-ZFD-036 "RDER2" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GCG and GTG.
  • TG-ZFD-037 "RDER3" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • YRCSWEGCEWRFARSDELTRHFRKH (SEQ ID NO: 129). It is encoded by the human nucleic acid sequence: 5 ' -TAC AGATGCTC ATGGGAAGGGTGTGAGTGGCGTTTTGC AAGAAGTGAT
  • GAGTTAACCAGGCACTTCCGAAAGCAC-3' (SEQ ID NO: 128).
  • TG-ZFD-037 “RDER3” demonstrates recognition specificity for the 3-bp target sequence GCG and GTG as determined by in vivo screening results.
  • TG-ZFD-037 “RDER3” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GCG and GTG.
  • Example 47 TG-ZFD-038 "RDER4" TG-ZFD-038 "RDER4" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: FSCSWKGCERRFARSDELSRHRRTH (SEQ ID NO: 131). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-038 "RDER4" demonstrates recognition specificity for the 3-bp target sequence GCG and GTG as determined by in vivo screening results.
  • TG-ZFD-038 "RDER4" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GCG and GTG.
  • TG-ZFD-039 "RDER5" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: FACSWQDCNKKFARSDELARHYRTH (SEQ ID NO:133). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-039 "RDER5" demonstrates recognition specificity for the 3-bp target sequence GCG as determined by in vivo screening results.
  • TG-ZFD-039 "RDER5" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GCG.
  • TG-ZFD-040 "RDER6” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • YHCNWDGCGWKFARSDELTRHYRKH (SEQ ID NO: 135). It is encoded by the human nucleic acid sequence:
  • GAGCTCACGCGCCACTACCGAAAGCAC-3' SEQ ID NO:134.
  • TG-ZFD-040 "RDER6” demonstrates recognition specificity for the 3-bp target sequence GCG and GTG. Its binding site preference is GCG > GTG as determined by in vivo screening results.
  • TG-ZFD-040 "RDER6” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., 'for the purpose of recognizing a DNA site containing the sequence GCG and GTG.
  • TG-ZFD-041 "RDHR1" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • FLCQYCAQRFGRKDHLTRHMKKSH (SEQ ID NO: 137). It is encoded by the human nucleic acid sequence:
  • CTCGACATATGAAGAAGAGTCAC-3' (SEQ ID NO: 136).
  • TG-ZFD-041 "RDHR1" demonstrates recognition specificity for the 3-bp target sequence GAG and GGG as determined by in vivo screening results.
  • TG-ZFD-041 "RDHR1" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAG and GGG.
  • TG-ZFD-043 "RDHT” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: FQCKTCQRKFSRSDHLKTHTRTH (SEQ ID NO.T41). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-043 "RDHT” demonstrates recognition specificity for the 3-bp target sequence TGG, AGG, CGG, and GGG as determined by in vivo screening results.
  • TG-ZFD-043 "RDHT” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence TGG, AGG, CGG, and GGG.
  • TG-ZFD-044 "RDKI” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: FACEVCGVRFTRNDKLKIHMRKH (SEQ ID NO: 143). It is encoded by the human nucleic acid sequence: 5'-TTTGCCTGCGAGGTCTGCGGTGTTCGATTCACCAGGAACGACAAGCTGA AGATCCACATGCGGAAGCAC-3' (SEQ ID NO: 142).
  • TG-ZFD-044 "RDKI” demonstrates recognition specificity for the 3-bp target sequence GGG as determined by in vivo screening results.
  • TG-ZFD-044 "RDKI” can be used as a module to construct a chimeric DNA - binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGG.
  • TG-ZFD-045 "RDKR” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is:
  • YVCDVEGCTWK ⁇ ARSDKLNRHKKRH (SEQ ID NO: 145). It is encoded by the human nucleic acid sequence:
  • TG-ZFD-045 "RDKR” can be used as a module to constmct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GGG and AGG.
  • TG-ZFD-046 "RSNR" was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YICRKCGRGFSRKSNLIRHQRTH (SEQ ID NO: 147). It is encoded by the human nucleic acid sequence: 5 '-TATATTTGCAGAAAGTGTGGACGGGGCTTTAGTCG'GAAGTCCAACCTTA TCAGACATCAGAGGACACAC-3' (SEQ ID NO: 146).
  • TG-ZFD-046 "RSNR” As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-046 "RSNR" demonstrates recognition specificity for the 3-bp target sequence GAG and GTG. Its binding site preference is GAG > GTG as determined by in vivo screening results. TG-ZFD-046 "RSNR" can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAG and GTG.
  • Example 55 TG-ZFD-047 "RTNR” TG-ZFD-047 "RTNR” was identified by in vivo screening from human genomic sequence. Its amino acid sequence is: YLCSECDKCFSRSTNLIRHRRTH (SEQ ID NO: 149). It is encoded by the human nucleic acid sequence: 5'-TATCTATGTAGTGAGTGTGACAAATGCTTCAGTAGAAGTACAAACCTCA TAAGGCATCGAAGAACTCAC-3' (SEQ ID NO: 148). As a polypeptide fusion to fingers 1 and 2 of Zif268, TG-ZFD-047 "RTNR" demonstrates recognition specificity for the 3-bp target sequence GAG as determined by in vivo screening results.
  • TG-ZFD-047 "RTNR” can be used as a module to construct a chimeric DNA binding protein comprising multiple zinc fmger domains, e.g., for the purpose of recognizing a DNA site containing the sequence GAG.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Analytical Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Finger-Pressure Massage (AREA)
  • Measurement And Recording Of Electrical Phenomena And Electrical Characteristics Of The Living Body (AREA)
  • Materials For Medical Uses (AREA)
  • Analysing Materials By The Use Of Radiation (AREA)
  • Adornments (AREA)
PCT/KR2001/000244 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same Ceased WO2001060970A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP01910136A EP1259597B1 (en) 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same
CN018062520A CN1416467B (zh) 2000-02-18 2001-02-17 锌指结构域及其鉴定方法
NZ521293A NZ521293A (en) 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same
AU37719/01A AU781103B2 (en) 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same
CA002400772A CA2400772C (en) 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same
JP2001560342A JP4156840B2 (ja) 2000-02-18 2001-02-17 ジンクフィンガードメイン及びその同定方法
IL15114901A IL151149A0 (en) 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same
DE60127819T DE60127819T2 (de) 2000-02-18 2001-02-17 Zink-Finger Domänen und Verfahren zur Identifizierung derselben

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20000007730 2000-02-18
KR2000/7730 2000-02-18

Publications (2)

Publication Number Publication Date
WO2001060970A2 true WO2001060970A2 (en) 2001-08-23
WO2001060970A3 WO2001060970A3 (en) 2002-02-07

Family

ID=36628390

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2001/000244 Ceased WO2001060970A2 (en) 2000-02-18 2001-02-17 Zinc finger domains and methods of identifying same

Country Status (11)

Country Link
US (2) US20020061512A1 (https=)
EP (1) EP1259597B1 (https=)
JP (2) JP4156840B2 (https=)
CN (1) CN1416467B (https=)
AT (1) ATE359365T1 (https=)
AU (1) AU781103B2 (https=)
CA (1) CA2400772C (https=)
DE (1) DE60127819T2 (https=)
IL (1) IL151149A0 (https=)
NZ (1) NZ521293A (https=)
WO (1) WO2001060970A2 (https=)

Cited By (223)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004022575A3 (en) * 2002-09-05 2004-06-24 Toolgen Inc Bioinformatics analysis of cellular effects of artificial transcription factors
EP1417344A4 (en) * 2001-08-17 2005-01-26 Toolgen Inc ZINC FINGER DOMAIN LIBRARIES
WO2005014791A2 (en) 2003-08-08 2005-02-17 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
WO2004108883A3 (en) * 2003-06-10 2005-02-17 Toolgen Inc Transducible dna-binding proteins
WO2005061705A1 (en) * 2003-12-23 2005-07-07 Toolgen, Inc. Regulation of prokaryotic gene expression with zinc finger proteins
US7029847B2 (en) 2000-05-16 2006-04-18 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
US7063854B1 (en) 1998-09-30 2006-06-20 Corixa Corporation Composition and methods for WTI specific immunotherapy
EP1451297A4 (en) * 2001-12-07 2006-06-28 Toolgen Inc PHENOTYPIC SCANNING OF CHIMERIC PROTEINS
US7115272B1 (en) 1998-09-30 2006-10-03 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
EP1532178A4 (en) * 2002-06-11 2006-10-25 Scripps Research Inst Artificial transcription factors
US7144581B2 (en) 2000-10-09 2006-12-05 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7323181B2 (en) 1998-09-30 2008-01-29 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7329410B1 (en) 1998-09-30 2008-02-12 Corixa Corporation Compositions and method for WT1 specific immunotherapy
KR100812110B1 (ko) * 2006-10-24 2008-03-12 한국과학기술원 징크 핑거 단백질과 원핵 생물의 전사 인자를 포함하는인공 전사 인자의 제조 및 이의 이용
US7393318B2 (en) 2000-05-16 2008-07-01 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
CN100398652C (zh) * 2002-12-09 2008-07-02 图尔金株式会社 调节性锌指蛋白
US7407776B2 (en) 2003-09-19 2008-08-05 Sangamo Biosciences, Inc. Engineered zinc finger proteins for regulation of gene expression
KR100857125B1 (ko) 2004-05-25 2008-09-11 주식회사 툴젠 단일클론 항체 생산을 증가시키는 폴리펩타이드, 이를코드하는 핵산 및 이의 용도
US7553494B2 (en) 2001-08-24 2009-06-30 Corixa Corporation WT1 fusion proteins
WO2009151591A2 (en) 2008-06-10 2009-12-17 Sangamo Biosciences, Inc. Methods and compositions for generation of bax- and bak-deficient cell lines
WO2010021692A1 (en) 2008-08-22 2010-02-25 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
WO2010065123A1 (en) 2008-12-04 2010-06-10 Sangamo Biosciences, Inc. Genome editing in rats using zinc-finger nucleases
WO2010077319A1 (en) 2008-12-17 2010-07-08 Dow Agrosciences Llc Targeted integration into the zp15 locus
EP2206782A1 (en) 2006-05-25 2010-07-14 Sangamo BioSciences, Inc. Methods and compositions for gene inactivation
EP2213731A1 (en) 2006-05-25 2010-08-04 Sangamo BioSciences, Inc. Variant foki cleavage half-domains
WO2010090744A1 (en) 2009-02-04 2010-08-12 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathies
WO2011002503A1 (en) 2009-06-30 2011-01-06 Sangamo Biosciences, Inc. Rapid screening of biologically active nucleases and isolation of nuclease-modified cells
US7901693B2 (en) 1998-09-30 2011-03-08 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
EP2292274A1 (en) 2004-09-16 2011-03-09 Sangamo BioSciences, Inc. Compositions and methods for protein production
US7919313B2 (en) 2007-07-12 2011-04-05 Sangamo Biosciences, Inc. Methods and compositions for inactivating alpha 1,6 fucosyltransferase (FUT8) gene expression
EP2395081A1 (en) 2006-08-11 2011-12-14 Dow AgroSciences LLC Zinc finger nuclease-mediated homologous recombination
WO2012012667A2 (en) 2010-07-21 2012-01-26 Sangamo Biosciences, Inc. Methods and compositions for modification of a hla locus
EP2412812A1 (en) 2006-12-14 2012-02-01 Dow AgroSciences LLC Optimized non-canonical zinc finger proteins
US8110379B2 (en) 2007-04-26 2012-02-07 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US8153399B2 (en) 2008-10-29 2012-04-10 Sangamo Biosciences, Inc. Methods and compositions for inactivating glutamine synthetase gene expression
WO2012047598A1 (en) 2010-09-27 2012-04-12 Sangamo Biosciences, Inc. Methods and compositions for inhibiting viral entry into cells
WO2012051343A1 (en) 2010-10-12 2012-04-19 The Children's Hospital Of Philadelphia Methods and compositions for treating hemophilia b
WO2012139045A1 (en) 2011-04-08 2012-10-11 Gilead Biologics, Inc. Methods and compositions for normalization of tumor vasculature by inhibition of loxl2
US8313925B2 (en) 2005-07-26 2012-11-20 Sangamo Biosciences, Inc. Zinc finger proteins and method for inactivating a dhfr gene in a chinese hamster ovary cell
US8399218B2 (en) 2007-09-27 2013-03-19 Dow Agrosciences, Llc Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes
WO2013044008A2 (en) 2011-09-21 2013-03-28 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
WO2013074999A1 (en) 2011-11-16 2013-05-23 Sangamo Biosciences, Inc. Modified dna-binding proteins and uses thereof
EP2597155A1 (en) 2007-10-25 2013-05-29 Sangamo BioSciences, Inc. Methods and compositions for targeted integration
EP2615106A1 (en) 2010-02-08 2013-07-17 Sangamo BioSciences, Inc. Engineered cleavage half-domains
WO2013112917A1 (en) 2012-01-27 2013-08-01 Sanbio, Inc. Methods and compositions for modulating angiogenesis and vasculogenesis
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US8563314B2 (en) 2007-09-27 2013-10-22 Sangamo Biosciences, Inc. Methods and compositions for modulating PD1
EP2660318A1 (en) 2010-02-09 2013-11-06 Sangamo BioSciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
WO2013166315A1 (en) 2012-05-02 2013-11-07 Dow Agrosciences Llc Targeted modification of malate dehydrogenase
WO2013169802A1 (en) 2012-05-07 2013-11-14 Sangamo Biosciences, Inc. Methods and compositions for nuclease-mediated targeted integration of transgenes
US8586526B2 (en) 2010-05-17 2013-11-19 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US8592645B2 (en) 2009-10-22 2013-11-26 Dow Agrosciences Llc Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
WO2014011237A1 (en) 2012-07-11 2014-01-16 Sangamo Biosciences, Inc. Methods and compositions for the treatment of lysosomal storage diseases
WO2014011901A2 (en) 2012-07-11 2014-01-16 Sangamo Biosciences, Inc. Methods and compositions for delivery of biologics
WO2014036219A2 (en) 2012-08-29 2014-03-06 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
WO2014039702A2 (en) 2012-09-07 2014-03-13 Dow Agrosciences Llc Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
WO2014039872A1 (en) 2012-09-07 2014-03-13 Dow Agrosciences Llc Engineered transgene integration platform (etip) for gene targeting and trait stacking
WO2014059173A2 (en) 2012-10-10 2014-04-17 Sangamo Biosciences, Inc. T cell modifying compounds and uses thereof
EP2727600A1 (en) 2009-07-28 2014-05-07 Sangamo BioSciences, Inc. Methods and compositions for treating trinucleotide repeat disorders
US8772008B2 (en) 2009-05-18 2014-07-08 Sangamo Biosciences, Inc. Methods and compositions for increasing nuclease activity
US8771985B2 (en) 2010-04-26 2014-07-08 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using zinc-finger nucleases
US8772453B2 (en) 2010-05-03 2014-07-08 Sangamo Biosciences, Inc. Compositions for linking zinc finger modules
WO2014130955A1 (en) 2013-02-25 2014-08-28 Sangamo Biosciences, Inc. Methods and compositions for enhancing nuclease-mediated gene disruption
WO2014165612A2 (en) 2013-04-05 2014-10-09 Dow Agrosciences Llc Methods and compositions for integration of an exogenous sequence within the genome of plants
US8871905B2 (en) 2009-03-20 2014-10-28 Sangamo Biosciences, Inc. Modification of CXCR4 using engineered zinc finger proteins
US8895264B2 (en) 2011-10-27 2014-11-25 Sangamo Biosciences, Inc. Methods and compositions for modification of the HPRT locus
US8956828B2 (en) 2009-11-10 2015-02-17 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
WO2015031619A1 (en) 2013-08-28 2015-03-05 Sangamo Biosciences, Inc. Compositions for linking dna-binding domains and cleavage domains
WO2015057976A1 (en) 2013-10-17 2015-04-23 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells
WO2015057980A1 (en) 2013-10-17 2015-04-23 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
WO2015066643A1 (en) 2013-11-04 2015-05-07 Dow Agrosciences Llc Optimal soybean loci
WO2015066638A2 (en) 2013-11-04 2015-05-07 Dow Agrosciences Llc Optimal maize loci
WO2015066636A2 (en) 2013-11-04 2015-05-07 Dow Agrosciences Llc Optimal maize loci
WO2015070212A1 (en) 2013-11-11 2015-05-14 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US9045763B2 (en) 2005-07-26 2015-06-02 Sangamo Biosciences, Inc. Linear donor constructs for targeted integration
US9074224B2 (en) 2009-08-03 2015-07-07 Recombinetics, Inc. Methods and compositions for targeted gene modification
WO2015143046A2 (en) 2014-03-18 2015-09-24 Sangamo Biosciences, Inc. Methods and compositions for regulation of zinc finger protein expression
US9161995B2 (en) 2011-07-25 2015-10-20 Sangamo Biosciences, Inc. Methods and compositions for alteration of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
EP2947146A1 (en) 2004-02-05 2015-11-25 Sangamo BioSciences, Inc. Methods and compositions for targeted cleavage and recombination
US9217026B2 (en) 2006-11-13 2015-12-22 Sangamo Biosciences, Inc. Method of inactivating a glucocorticoid receptor gene in an isolated cell
WO2016005449A1 (en) 2014-07-08 2016-01-14 Vib Vzw Means and methods to increase plant yield
WO2016011029A2 (en) 2014-07-14 2016-01-21 Washington State University Nanos knock-out that ablates germline cells
WO2016011381A1 (en) 2014-07-18 2016-01-21 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Reducing cxcr4 expression and/or function to enhance engraftment of hematopoietic stem cells
US9249428B2 (en) 2003-08-08 2016-02-02 Sangamo Biosciences, Inc. Methods and compositions for targeted genomic deletion
US9255250B2 (en) 2012-12-05 2016-02-09 Sangamo Bioscience, Inc. Isolated mouse or human cell having an exogenous transgene in an endogenous albumin gene
US9267123B2 (en) 2011-01-05 2016-02-23 Sangamo Biosciences, Inc. Methods and compositions for gene correction
WO2016044416A1 (en) 2014-09-16 2016-03-24 Sangamo Biosciences, Inc. Methods and compositions for nuclease-mediated genome engineering and correction in hematopoietic stem cells
US9394531B2 (en) 2008-05-28 2016-07-19 Sangamo Biosciences, Inc. Compositions for linking DNA-binding domains and cleavage domains
WO2016118726A2 (en) 2015-01-21 2016-07-28 Sangamo Biosciences, Inc. Methods and compositions for identification of highly specific nucleases
WO2016161446A1 (en) 2015-04-03 2016-10-06 Dana-Farber Cancer Institute, Inc. Composition and methods of genome editing of b-cells
US9506120B2 (en) 2007-09-27 2016-11-29 Sangamo Biosciences, Inc. Rapid in vivo identification of biologically active nucleases
US9522936B2 (en) 2014-04-24 2016-12-20 Sangamo Biosciences, Inc. Engineered transcription activator like effector (TALE) proteins
EP3118308A1 (en) 2008-04-30 2017-01-18 SanBio, Inc. Neural regenerating cells with alterations in dna methylation
WO2017023570A1 (en) 2015-08-06 2017-02-09 The Curators Of The University Of Missouri Pathogen-resistant animals having modified cd163 genes
US9574211B2 (en) 2014-05-13 2017-02-21 Sangamo Biosciences, Inc. Methods and compositions for prevention or treatment of a disease
US9616090B2 (en) 2014-07-30 2017-04-11 Sangamo Biosciences, Inc. Gene correction of SCID-related genes in hematopoietic stem and progenitor cells
EP3156504A1 (en) 2009-08-11 2017-04-19 Sangamo BioSciences, Inc. Organisms homozygous for targeted modification
WO2017106528A2 (en) 2015-12-18 2017-06-22 Sangamo Biosciences, Inc. Targeted disruption of the t cell receptor
WO2017106537A2 (en) 2015-12-18 2017-06-22 Sangamo Biosciences, Inc. Targeted disruption of the mhc cell receptor
WO2017123757A1 (en) 2016-01-15 2017-07-20 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of neurologic disease
US9757420B2 (en) 2014-07-25 2017-09-12 Sangamo Therapeutics, Inc. Gene editing for HIV gene therapy
US9771403B2 (en) 2013-12-09 2017-09-26 Sangamo Therapeutics, Inc. Methods and compositions for treating hemophilia
WO2017165655A1 (en) 2016-03-23 2017-09-28 Dana-Farber Cancer Institute, Inc. Methods for enhancing the efficiency of gene editing
US9816074B2 (en) 2014-07-25 2017-11-14 Sangamo Therapeutics, Inc. Methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells
US9834787B2 (en) 2009-04-09 2017-12-05 Sangamo Therapeutics, Inc. Targeted integration into stem cells
WO2018013840A1 (en) 2016-07-13 2018-01-18 Vertex Pharmaceuticals Incorporated Methods, compositions and kits for increasing genome editing efficiency
US9873894B2 (en) 2013-05-15 2018-01-23 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
WO2018029034A1 (en) 2016-08-09 2018-02-15 Vib Vzw Cellulose synthase inhibitors and mutant plants
WO2018039448A1 (en) 2016-08-24 2018-03-01 Sangamo Therapeutics, Inc. Engineered target specific nucleases
WO2018039440A1 (en) 2016-08-24 2018-03-01 Sangamo Therapeutics, Inc. Regulation of gene expression using engineered nucleases
US9914930B2 (en) 2012-09-07 2018-03-13 Dow Agrosciences Llc FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US9937207B2 (en) 2013-03-21 2018-04-10 Sangamo Therapeutics, Inc. Targeted disruption of T cell receptor genes using talens
WO2018067697A1 (en) 2016-10-04 2018-04-12 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
US9957501B2 (en) 2015-06-18 2018-05-01 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
WO2018081775A1 (en) 2016-10-31 2018-05-03 Sangamo Therapeutics, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
US9970001B2 (en) 2014-06-05 2018-05-15 Sangamo Therapeutics, Inc. Methods and compositions for nuclease design
WO2018106782A1 (en) 2016-12-08 2018-06-14 Case Western Reserve University Methods and compositions for enhancing functional myelin production
WO2018195418A1 (en) 2017-04-20 2018-10-25 Oregon Health & Science University Human gene correction
WO2018208837A1 (en) 2017-05-08 2018-11-15 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
WO2019005957A1 (en) 2017-06-30 2019-01-03 Precision Biosciences, Inc. GENETICALLY MODIFIED T CELLS COMPRISING A MODIFIED INTRON IN THE ALPHA T CELL RECEPTOR GENE
US10179918B2 (en) 2015-05-07 2019-01-15 Sangamo Therapeutics, Inc. Methods and compositions for increasing transgene activity
US10233465B2 (en) 2013-11-04 2019-03-19 Dow Agrosciences Llc Optimal soybean loci
WO2019070541A1 (en) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. HPV-SPECIFIC BINDING MOLECULES
WO2019070856A1 (en) 2017-10-03 2019-04-11 Precision Biosciences, Inc. MODIFIED EPIDERMAL GROWTH FACTOR RECEPTOR PEPTIDES FOR USE IN GENETICALLY MODIFIED CELLS
US10260062B2 (en) 2010-01-22 2019-04-16 Sangamo Therapeutics, Inc. Targeted genomic alteration
WO2019089913A1 (en) 2017-11-01 2019-05-09 Precision Biosciences, Inc. Engineered nucleases that target human and canine factor viii genes as a treatment for hemophilia a
EP3492593A1 (en) 2013-11-13 2019-06-05 Children's Medical Center Corporation Nuclease-mediated regulation of gene expression
WO2019143678A1 (en) 2018-01-17 2019-07-25 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
WO2019143677A1 (en) 2018-01-17 2019-07-25 Vertex Pharmaceuticals Incorporated Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency
WO2019143675A1 (en) 2018-01-17 2019-07-25 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
US10370680B2 (en) 2014-02-24 2019-08-06 Sangamo Therapeutics, Inc. Method of treating factor IX deficiency using nuclease-mediated targeted integration
US10415046B2 (en) 2012-12-13 2019-09-17 Dow Agrosciences Llc Precision gene targeting to a particular locus in maize
US10435441B2 (en) 2015-09-23 2019-10-08 Sangamo Therapeutics, Inc. HTT repressors and uses thereof
WO2019195491A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cells expressing a recombinant receptor, related polynucleotides and methods
WO2019195492A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Methods of producing cells expressing a recombinant receptor and related compositions
US10450585B2 (en) 2015-07-13 2019-10-22 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
WO2020072677A1 (en) 2018-10-02 2020-04-09 Sangamo Therapeutics, Inc. Methods and compositions for modulation of tau proteins
US10639383B2 (en) 2015-11-23 2020-05-05 Sangamo Therapeutics, Inc. Methods and compositions for engineering immunity
US10648001B2 (en) 2012-07-11 2020-05-12 Sangamo Therapeutics, Inc. Method of treating mucopolysaccharidosis type I or II
WO2020132659A1 (en) 2018-12-21 2020-06-25 Precision Biosciences, Inc. Genetic modification of the hydroxyacid oxidase 1 gene for treatment of primary hyperoxaluria
US10724020B2 (en) 2016-02-02 2020-07-28 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
WO2020206231A1 (en) 2019-04-05 2020-10-08 Precision Biosciences, Inc. Methods of preparing populations of genetically-modified immune cells
WO2020205838A1 (en) 2019-04-02 2020-10-08 Sangamo Therapeutics, Inc. Methods for the treatment of beta-thalassemia
WO2020206248A1 (en) 2019-04-03 2020-10-08 Precision Biosciences, Inc. Genetically-modified immune cells comprising a microrna-adapted shrna (shrnamir)
US10808020B2 (en) 2015-05-12 2020-10-20 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
WO2020219726A1 (en) 2019-04-23 2020-10-29 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
WO2020223571A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified cd247 locus, related polynucleotides and methods
WO2020223535A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a recombinant receptor from a modified tgfbr2 locus, related polynucleotides and methods
US10889834B2 (en) 2014-12-15 2021-01-12 Sangamo Therapeutics, Inc. Methods and compositions for enhancing targeted transgene integration
WO2021016608A1 (en) 2019-07-25 2021-01-28 Precision Biosciences, Inc. Compositions and methods for sequential stacking of nucleic acid sequences into a genomic locus
WO2021035054A1 (en) 2019-08-20 2021-02-25 Precision Biosciences, Inc. Lymphodepletion dosing regimens for cellular immunotherapies
WO2021035170A1 (en) 2019-08-21 2021-02-25 Precision Biosciences, Inc. Compositions and methods for tcr reprogramming using fusion proteins
US10960085B2 (en) 2016-09-07 2021-03-30 Sangamo Therapeutics, Inc. Modulation of liver genes
WO2021067864A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for treatment of prion disease
WO2021067871A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing alpha-synuclein expression
WO2021087358A1 (en) 2019-11-01 2021-05-06 Sangamo Therapeutics, Inc. Gin recombinase variants
WO2021087305A1 (en) 2019-10-30 2021-05-06 Precision Biosciences, Inc. Cd20 chimeric antigen receptors and methods of use for immunotherapy
WO2021113543A1 (en) 2019-12-06 2021-06-10 Precision Biosciences, Inc. Methods for cancer immunotherapy, using lymphodepletion regimens and cd19, cd20 or bcma allogeneic car t cells
EP3838287A2 (en) 2016-07-27 2021-06-23 Case Western Reserve University Compounds and methods of promoting myelination
US11072660B2 (en) 2016-10-03 2021-07-27 Juno Therapeutics, Inc. HPV-specific binding molecules
WO2021151012A1 (en) 2020-01-22 2021-07-29 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing tau expression
WO2021158915A1 (en) 2020-02-06 2021-08-12 Precision Biosciences, Inc. Recombinant adeno-associated virus compositions and methods for producing and using the same
US11110154B2 (en) 2014-05-08 2021-09-07 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's Disease
WO2021202513A1 (en) 2020-03-31 2021-10-07 Elo Life Systems Modulation of endogenous mogroside pathway genes in watermelon and other cucurbits
WO2021224395A1 (en) 2020-05-06 2021-11-11 Cellectis S.A. Methods for targeted insertion of exogenous sequences in cellular genomes
WO2021224416A1 (en) 2020-05-06 2021-11-11 Cellectis S.A. Methods to genetically modify cells for delivery of therapeutic proteins
WO2021231259A1 (en) 2020-05-11 2021-11-18 Precision Biosciences, Inc. Self-limiting viral vectors encoding nucleases
WO2021231661A2 (en) 2020-05-13 2021-11-18 Juno Therapeutics, Inc. Process for producing donor-batched cells expressing a recombinant receptor
WO2021260186A1 (en) 2020-06-26 2021-12-30 Juno Therapeutics Gmbh Engineered t cells conditionally expressing a recombinant receptor, related polynucleotides and methods
US11219695B2 (en) 2016-10-20 2022-01-11 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of Fabry disease
US11235026B2 (en) 2007-09-27 2022-02-01 Sangamo Therapeutics, Inc. Methods and compositions for modulating PD1
WO2022035793A1 (en) 2020-08-10 2022-02-17 Precision Biosciences, Inc. Antibodies and fragments specific for b-cell maturation antigen and uses thereof
WO2022046760A2 (en) 2020-08-25 2022-03-03 Kite Pharma, Inc. T cells with improved functionality
WO2022067122A1 (en) 2020-09-25 2022-03-31 Sangamo Therapeutics, Inc. Zinc finger fusion proteins for nucleobase editing
WO2022076547A1 (en) 2020-10-07 2022-04-14 Precision Biosciences, Inc. Lipid nanoparticle compositions
WO2022087527A1 (en) 2020-10-23 2022-04-28 Elo Life Systems, Inc. Methods for producing vanilla plants with improved flavor and agronomic production
WO2022098787A1 (en) 2020-11-04 2022-05-12 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified invariant cd3 immunoglobulin superfamily chain locus and related polynucleotides and methods
WO2022101641A1 (en) 2020-11-16 2022-05-19 Pig Improvement Company Uk Limited Influenza a-resistant animals having edited anp32 genes
US11401512B2 (en) 2018-02-08 2022-08-02 Sangamo Therapeutics, Inc. Engineered target specific nucleases
WO2022165111A1 (en) 2021-01-28 2022-08-04 Precision Biosciences, Inc. Modulation of tgf beta signaling in genetically-modified eukaryotic cells
US11421007B2 (en) 2018-04-18 2022-08-23 Sangamo Therapeutics, Inc. Zinc finger protein compositions for modulation of huntingtin (Htt)
US11453639B2 (en) 2019-01-11 2022-09-27 Acuitas Therapeutics, Inc. Lipids for lipid nanoparticle delivery of active agents
US11471489B2 (en) 2018-04-05 2022-10-18 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2022226316A1 (en) 2021-04-22 2022-10-27 Precision Biosciences, Inc. Compositions and methods for generating male sterile plants
US11504389B2 (en) 2016-12-01 2022-11-22 Sangamo Therapeutics, Inc. Tau modulators and methods and compositions for delivery thereof
US11512287B2 (en) 2017-06-16 2022-11-29 Sangamo Therapeutics, Inc. Targeted disruption of T cell and/or HLA receptors
WO2023064872A1 (en) 2021-10-14 2023-04-20 Precision Biosciences, Inc. Combinations of anti-bcma car t cells and gamma secretase inhibitors
WO2023070003A1 (en) 2021-10-19 2023-04-27 Precision Biosciences, Inc. Gene editing methods for treating alpha-1 antitrypsin (aat) deficiency
WO2023081900A1 (en) 2021-11-08 2023-05-11 Juno Therapeutics, Inc. Engineered t cells expressing a recombinant t cell receptor (tcr) and related systems and methods
US11655275B2 (en) 2017-05-03 2023-05-23 Sangamo Therapeutics, Inc. Methods and compositions for modification of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
WO2023091910A1 (en) 2021-11-16 2023-05-25 Precision Biosciences, Inc. Methods for cancer immunotherapy
US11661611B2 (en) 2017-11-09 2023-05-30 Sangamo Therapeutics, Inc. Genetic modification of cytokine inducible SH2-containing protein (CISH) gene
WO2023105244A1 (en) 2021-12-10 2023-06-15 Pig Improvement Company Uk Limited Editing tmprss2/4 for disease resistance in livestock
WO2023122722A1 (en) 2021-12-22 2023-06-29 Sangamo Therapeutics, Inc. Novel zinc finger fusion proteins for nucleobase editing
US11690921B2 (en) 2018-05-18 2023-07-04 Sangamo Therapeutics, Inc. Delivery of target specific nucleases
WO2023131637A1 (en) 2022-01-06 2023-07-13 Vib Vzw Improved silage grasses
WO2023131616A1 (en) 2022-01-05 2023-07-13 Vib Vzw Means and methods to increase abiotic stress tolerance in plants
WO2023144199A1 (en) 2022-01-26 2023-08-03 Vib Vzw Plants having reduced levels of bitter taste metabolites
EP4234570A2 (en) 2018-09-18 2023-08-30 Sangamo Therapeutics, Inc. Programmed cell death 1 (pd1) specific nucleases
US11834686B2 (en) 2018-08-23 2023-12-05 Sangamo Therapeutics, Inc. Engineered target specific base editors
US11857641B2 (en) 2019-02-06 2024-01-02 Sangamo Therapeutics, Inc. Method for the treatment of mucopolysaccharidosis type I
WO2024013514A2 (en) 2022-07-15 2024-01-18 Pig Improvement Company Uk Limited Gene edited livestock animals having coronavirus resistance
US11976019B2 (en) 2020-07-16 2024-05-07 Acuitas Therapeutics, Inc. Cationic lipids for use in lipid nanoparticles
WO2024100604A1 (en) 2022-11-09 2024-05-16 Juno Therapeutics Gmbh Methods for manufacturing engineered immune cells
WO2024161021A1 (en) 2023-02-03 2024-08-08 Juno Therapeutics Gmbh Methods for non-viral manufacturing of engineered immune cells
US12083188B2 (en) 2017-12-01 2024-09-10 Encoded Therapeutics, Inc. Engineered DNA binding proteins
WO2024216118A1 (en) 2023-04-14 2024-10-17 Precision Biosciences, Inc. Muscle-specific expression cassettes
WO2024216116A1 (en) 2023-04-14 2024-10-17 Precision Biosciences, Inc. Muscle-specific expression cassettes
US12129223B2 (en) 2021-12-16 2024-10-29 Acuitas Therapeutics, Inc. Lipids for use in lipid nanoparticle formulations
WO2024238723A1 (en) 2023-05-16 2024-11-21 Omega Therapeutics, Inc. Methods and compositions for modulating pcsk9 expression
WO2024238726A1 (en) 2023-05-16 2024-11-21 Omega Therapeutics, Inc. Methods and compositions for modulating methylation of a target gene
WO2025004001A1 (en) 2023-06-30 2025-01-02 Takeda Pharmaceutical Company Limited Htt repressors and uses thereof
WO2025019742A1 (en) 2023-07-19 2025-01-23 Omega Therapeutics, Inc. Methods and compositions for modulating ctnnb1 expression
EP4534678A2 (en) 2017-12-18 2025-04-09 Syngenta Crop Protection AG Targeted insertion sites in the maize genome
US12329857B2 (en) 2018-09-21 2025-06-17 Acuitas Therapeutics, Inc. Systems and methods for manufacturing lipid nanoparticles and liposomes
WO2025194124A1 (en) 2024-03-14 2025-09-18 Tessera Therapeutics, Inc. Modified st1cas9 guide nucleic acids
WO2025235563A1 (en) 2024-05-07 2025-11-13 Omega Therapeutics, Inc. Epigenetic modulation for upregulation of genes
WO2025235851A1 (en) 2024-05-10 2025-11-13 Juno Therapeutics, Inc. Genetically engineered t cells expressing a cd19 chimeric antigen receptor (car) and uses thereof for allogeneic cell therapy
US12516350B2 (en) 2019-05-29 2026-01-06 Encoded Therapeutics, Inc. Compositions and methods for selective gene regulation
US12516098B2 (en) 2017-08-08 2026-01-06 Sangamo Therapeutics, Inc. Chimeric antigen receptor mediated cell targeting
US12583816B2 (en) 2018-10-18 2026-03-24 Acuitas Therapeutics, Inc. Lipids for lipid nanoparticle delivery of active agents
WO2026083329A1 (en) 2024-10-18 2026-04-23 Precision Biosciences, Inc. Methods of nuclease-initiated homology directed repair and replacement and compositions and uses thereof
WO2026083328A1 (en) 2024-10-18 2026-04-23 Precision Biosciences, Inc. Base editing nucleotide sequences using homology directed repair

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2002225187A1 (en) * 2001-01-22 2002-07-30 Sangamo Biosciences, Inc. Zinc finger polypeptides and their use
US8799501B2 (en) * 2002-04-30 2014-08-05 Hewlett-Packard Development Company, L. P. System and method for anonymously sharing and scoring information pointers, within a system for harvesting community knowledge
AU2005232665B2 (en) * 2004-04-08 2010-05-13 Sangamo Therapeutics, Inc. Methods and compositions for treating neuropathic and neurodegenerative conditions
FR2955480B1 (fr) 2010-01-26 2012-01-06 Christian Choux Dispositif d'osteosynthese de la paroi thoracique
JP2014530607A (ja) * 2011-10-11 2014-11-20 アリオフタ・アーゲーAliophtha Ag 人工転写因子の送達による受容体発現の調節
CN102634535B (zh) * 2012-04-12 2014-11-26 西北农林科技大学 一种基于锌指蛋白插入载体的随机锌指蛋白库的构建方法

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5763209A (en) * 1988-09-26 1998-06-09 Arch Development Corporation Methods and materials relating to the functional domains of DNA binding proteins
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5096815A (en) * 1989-01-06 1992-03-17 Protein Engineering Corporation Generation and selection of novel dna-binding proteins and polypeptides
US5283173A (en) * 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US6107059A (en) * 1992-04-29 2000-08-22 Affymax Technologies N.V. Peptide library and screening method
WO1994010300A1 (en) * 1992-10-30 1994-05-11 The General Hospital Corporation Interaction trap system for isolating novel proteins
US6242568B1 (en) * 1994-01-18 2001-06-05 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6140466A (en) * 1994-01-18 2000-10-31 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US5882941A (en) * 1994-05-04 1999-03-16 Massachusette Institute Of Technology Programmable genotoxic agents and uses therefor
USRE39229E1 (en) * 1994-08-20 2006-08-08 Gendaq Limited Binding proteins for recognition of DNA
US6326166B1 (en) * 1995-12-29 2001-12-04 Massachusetts Institute Of Technology Chimeric DNA-binding proteins
US5789538A (en) * 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
US5869250A (en) * 1996-12-02 1999-02-09 The University Of North Carolina At Chapel Hill Method for the identification of peptides that recognize specific DNA sequences
GB9710809D0 (en) * 1997-05-23 1997-07-23 Medical Res Council Nucleic acid binding proteins
US20030022293A1 (en) * 1997-09-18 2003-01-30 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US6534261B1 (en) * 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) * 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6453242B1 (en) * 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
AU776576B2 (en) * 1999-12-06 2004-09-16 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6689558B2 (en) * 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
AU2001263155A1 (en) * 2000-05-16 2001-11-26 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
AU2002228841C1 (en) * 2000-12-07 2006-11-23 Sangamo Biosciences, Inc Regulation of angiogenesis with zinc finger proteins

Cited By (461)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7662386B2 (en) 1998-09-30 2010-02-16 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7329410B1 (en) 1998-09-30 2008-02-12 Corixa Corporation Compositions and method for WT1 specific immunotherapy
US7368119B2 (en) 1998-09-30 2008-05-06 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7901693B2 (en) 1998-09-30 2011-03-08 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7655249B2 (en) 1998-09-30 2010-02-02 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7323181B2 (en) 1998-09-30 2008-01-29 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7115272B1 (en) 1998-09-30 2006-10-03 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
US7063854B1 (en) 1998-09-30 2006-06-20 Corixa Corporation Composition and methods for WTI specific immunotherapy
US7029847B2 (en) 2000-05-16 2006-04-18 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
US7393318B2 (en) 2000-05-16 2008-07-01 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
US7144581B2 (en) 2000-10-09 2006-12-05 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
AU2002324352B2 (en) * 2001-08-17 2006-06-15 Toolgen, Inc. Zinc finger domain libraries
EP1417344A4 (en) * 2001-08-17 2005-01-26 Toolgen Inc ZINC FINGER DOMAIN LIBRARIES
US7553494B2 (en) 2001-08-24 2009-06-30 Corixa Corporation WT1 fusion proteins
US7915393B2 (en) 2001-08-24 2011-03-29 Corixa Corporation Compositions and methods for WT1 specific immunotherapy
EP1451297A4 (en) * 2001-12-07 2006-06-28 Toolgen Inc PHENOTYPIC SCANNING OF CHIMERIC PROTEINS
EP1532178A4 (en) * 2002-06-11 2006-10-25 Scripps Research Inst Artificial transcription factors
WO2004022575A3 (en) * 2002-09-05 2004-06-24 Toolgen Inc Bioinformatics analysis of cellular effects of artificial transcription factors
CN100398652C (zh) * 2002-12-09 2008-07-02 图尔金株式会社 调节性锌指蛋白
WO2004108883A3 (en) * 2003-06-10 2005-02-17 Toolgen Inc Transducible dna-binding proteins
US9260726B2 (en) 2003-08-08 2016-02-16 Sangamo Biosciences, Inc. Targeted integration and expression on exogenous nucleic acid sequences
EP2927318A1 (en) 2003-08-08 2015-10-07 Sangamo BioSciences, Inc. Methods and compositions for targeted cleavage and recombination
EP3222715A1 (en) 2003-08-08 2017-09-27 Sangamo BioSciences, Inc. Methods and compositions for targeted cleavage and recombination
US9249428B2 (en) 2003-08-08 2016-02-02 Sangamo Biosciences, Inc. Methods and compositions for targeted genomic deletion
US9752140B2 (en) 2003-08-08 2017-09-05 Sangamo Therapeutics, Inc. Methods and compostions for targeted genomic deletion
WO2005014791A2 (en) 2003-08-08 2005-02-17 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7407776B2 (en) 2003-09-19 2008-08-05 Sangamo Biosciences, Inc. Engineered zinc finger proteins for regulation of gene expression
WO2005061705A1 (en) * 2003-12-23 2005-07-07 Toolgen, Inc. Regulation of prokaryotic gene expression with zinc finger proteins
EP2947146A1 (en) 2004-02-05 2015-11-25 Sangamo BioSciences, Inc. Methods and compositions for targeted cleavage and recombination
KR100857125B1 (ko) 2004-05-25 2008-09-11 주식회사 툴젠 단일클론 항체 생산을 증가시키는 폴리펩타이드, 이를코드하는 핵산 및 이의 용도
US8034598B2 (en) 2004-08-06 2011-10-11 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US8771986B2 (en) 2004-08-06 2014-07-08 Sangamo Biosciences, Inc. Engineered cleavage half-domains
EP2292274A1 (en) 2004-09-16 2011-03-09 Sangamo BioSciences, Inc. Compositions and methods for protein production
US9376685B2 (en) 2005-07-26 2016-06-28 Sangamo Biosciences, Inc. Linear donor constructs for targeted integration
US9045763B2 (en) 2005-07-26 2015-06-02 Sangamo Biosciences, Inc. Linear donor constructs for targeted integration
US9765360B2 (en) 2005-07-26 2017-09-19 Sangamo Therapeutics, Inc. Linear donor constructs for targeted integration
US8313925B2 (en) 2005-07-26 2012-11-20 Sangamo Biosciences, Inc. Zinc finger proteins and method for inactivating a dhfr gene in a chinese hamster ovary cell
US7914796B2 (en) 2006-05-25 2011-03-29 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US11648267B2 (en) 2006-05-25 2023-05-16 Sangamo Therapeutics, Inc. Methods and compositions for gene inactivation
EP2447279A1 (en) 2006-05-25 2012-05-02 Sangamo BioSciences, Inc. Methods and compositions for gene inactivation
US9434776B2 (en) 2006-05-25 2016-09-06 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
EP2213731A1 (en) 2006-05-25 2010-08-04 Sangamo BioSciences, Inc. Variant foki cleavage half-domains
US8569253B2 (en) 2006-05-25 2013-10-29 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
EP2206782A1 (en) 2006-05-25 2010-07-14 Sangamo BioSciences, Inc. Methods and compositions for gene inactivation
US7951925B2 (en) * 2006-05-25 2011-05-31 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
US8524221B2 (en) 2006-05-25 2013-09-03 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
EP2765195A1 (en) 2006-05-25 2014-08-13 Sangamo BioSciences, Inc. Methods and compositions for gene inactivation
EP2395081A1 (en) 2006-08-11 2011-12-14 Dow AgroSciences LLC Zinc finger nuclease-mediated homologous recombination
KR100812110B1 (ko) * 2006-10-24 2008-03-12 한국과학기술원 징크 핑거 단백질과 원핵 생물의 전사 인자를 포함하는인공 전사 인자의 제조 및 이의 이용
US8242242B2 (en) 2006-10-24 2012-08-14 Korea Advanced Institute Of Science And Technology Preparation of an artificial transcription factor comprising zinc finger protein and transcription factor of prokaryote, and a use thereof
WO2008050935A1 (en) * 2006-10-24 2008-05-02 Korea Advanced Institute Of Science And Technology A preparation of an artificial transcription factor comprising zinc finger protein and transcription factor of prokaryote, and a use thereof
US9217026B2 (en) 2006-11-13 2015-12-22 Sangamo Biosciences, Inc. Method of inactivating a glucocorticoid receptor gene in an isolated cell
US10907175B2 (en) 2006-11-13 2021-02-02 Sangamo Therapeutics, Inc. Isolated human cell with an inactivated glucocorticoid receptor gene
US20160076056A1 (en) * 2006-11-13 2016-03-17 Sangamo Biosciences, Inc. Method of inactivating a glucocorticoid receptor gene in an isolated cell
US11884930B2 (en) 2006-11-13 2024-01-30 Sangamo Biosciences, Inc. Method of inactivating a glucocorticoid receptor gene in an isolated cell
EP2415873A1 (en) 2006-12-14 2012-02-08 Dow AgroSciences LLC Optimized non-canonical zinc finger proteins
EP3070169A1 (en) 2006-12-14 2016-09-21 Dow AgroSciences LLC Optimized non-canonical zinc finger proteins
EP2412812A1 (en) 2006-12-14 2012-02-01 Dow AgroSciences LLC Optimized non-canonical zinc finger proteins
EP2415872A1 (en) 2006-12-14 2012-02-08 Dow AgroSciences LLC Optimized non-canonical zinc finger proteins
US8110379B2 (en) 2007-04-26 2012-02-07 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US9267154B2 (en) 2007-04-26 2016-02-23 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US11649468B2 (en) 2007-04-26 2023-05-16 Sangamo Therapeutics, Inc. Targeted integration into the PPP1R12C locus
US8822221B2 (en) 2007-04-26 2014-09-02 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US9914940B2 (en) 2007-04-26 2018-03-13 Sangamo Therapeutics, Inc. Targeted integration into the PPP1R12C locus
EP2527435A2 (en) 2007-07-12 2012-11-28 Sangamo BioSciences, Inc. Methods and compositions for inactivating alpha 1,6 fucosyltransferase (FUT 8) gene expression
US9890395B2 (en) 2007-07-12 2018-02-13 Sangamo Therapeutics, Inc. Methods and compositions for inactivating alpha 1,6 fucosyltransferase (FUT8) gene expression
US8772025B2 (en) 2007-07-12 2014-07-08 Sangamo Biosciences, Inc. Methods and compositions for inactivating alpha 1,6 fucosyltransferase (FUT8) gene expression
US7919313B2 (en) 2007-07-12 2011-04-05 Sangamo Biosciences, Inc. Methods and compositions for inactivating alpha 1,6 fucosyltransferase (FUT8) gene expression
US9322036B2 (en) 2007-07-12 2016-04-26 Sangamo Biosciences, Inc. Methods and compositions for inactivating alpha 1,6 fucosyltransferase (FUT8) gene expression
EP3072973A1 (en) 2007-09-27 2016-09-28 Dow AgroSciences LLC Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes
US9121072B2 (en) 2007-09-27 2015-09-01 Sangamo Biosciences, Inc. Rapid screening of biologically active nucleases and isolation of nuclease-modified cells
US9506120B2 (en) 2007-09-27 2016-11-29 Sangamo Biosciences, Inc. Rapid in vivo identification of biologically active nucleases
US9115409B2 (en) 2007-09-27 2015-08-25 Sangamo Biosciences, Inc. Rapid screening of biologically active nucleases and isolation of nuclease-modified cells
US10046028B2 (en) 2007-09-27 2018-08-14 Sangamo Therapeutics, Inc. Methods and compositions for modulating PD1
US9402879B2 (en) 2007-09-27 2016-08-02 Sangamo Biosciences, Inc. Methods and compositions for modulating PD1
US10344289B2 (en) 2007-09-27 2019-07-09 Dow Agrosciences Llc Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes
US8889390B2 (en) 2007-09-27 2014-11-18 Dow Agrosciences Llc Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes
US8563314B2 (en) 2007-09-27 2013-10-22 Sangamo Biosciences, Inc. Methods and compositions for modulating PD1
US11235026B2 (en) 2007-09-27 2022-02-01 Sangamo Therapeutics, Inc. Methods and compositions for modulating PD1
US8399218B2 (en) 2007-09-27 2013-03-19 Dow Agrosciences, Llc Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes
EP2597155A1 (en) 2007-10-25 2013-05-29 Sangamo BioSciences, Inc. Methods and compositions for targeted integration
US8936936B2 (en) 2007-10-25 2015-01-20 Sangamo Biosciences, Inc. Methods and compositions for targeted integration
USRE50635E1 (en) 2008-04-30 2025-10-14 Sanbio, Inc. Neural regenerating cells with alterations in DNA methylation
US10316288B2 (en) 2008-04-30 2019-06-11 Sanbio, Inc. Neural regenerating cells with alterations in DNA methylation
EP3851520A1 (en) 2008-04-30 2021-07-21 SanBio, Inc. Neural regenerating cells with alterations in dna methylation
EP3118308A1 (en) 2008-04-30 2017-01-18 SanBio, Inc. Neural regenerating cells with alterations in dna methylation
US11608492B2 (en) 2008-05-28 2023-03-21 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
US9394531B2 (en) 2008-05-28 2016-07-19 Sangamo Biosciences, Inc. Compositions for linking DNA-binding domains and cleavage domains
US9982245B2 (en) 2008-05-28 2018-05-29 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
US10822599B2 (en) 2008-05-28 2020-11-03 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
EP2910568A2 (en) 2008-06-10 2015-08-26 Sangamo BioSciences, Inc. Methods and compositions for generation of BAX- and BAK-deficient cell lines
WO2009151591A2 (en) 2008-06-10 2009-12-17 Sangamo Biosciences, Inc. Methods and compositions for generation of bax- and bak-deficient cell lines
US8597912B2 (en) 2008-06-10 2013-12-03 Sangamo Biosciences, Inc. Methods and compositions for generation of Bax-and Bak-deficient cell lines
US10113207B2 (en) 2008-08-22 2018-10-30 Sangamo Therapeutics, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US9631186B2 (en) 2008-08-22 2017-04-25 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
EP2789691A1 (en) 2008-08-22 2014-10-15 Sangamo BioSciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US9200266B2 (en) 2008-08-22 2015-12-01 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
WO2010021692A1 (en) 2008-08-22 2010-02-25 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US10689717B2 (en) 2008-08-22 2020-06-23 Sangamo Therapeutics, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US11149321B2 (en) 2008-08-22 2021-10-19 Sangamo Therapeutics, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US8703489B2 (en) 2008-08-22 2014-04-22 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US8153399B2 (en) 2008-10-29 2012-04-10 Sangamo Biosciences, Inc. Methods and compositions for inactivating glutamine synthetase gene expression
US9388426B2 (en) 2008-10-29 2016-07-12 Sangamo Biosciences, Inc. Methods and compositions for inactivating glutamine synthetase gene expression
EP3156494A1 (en) 2008-12-04 2017-04-19 Sangamo BioSciences, Inc. Genome editing in rats using zinc-finger nucleases
US9206404B2 (en) 2008-12-04 2015-12-08 Sangamo Biosciences, Inc. Method of deleting an IgM gene in an isolated rat cell
WO2010065123A1 (en) 2008-12-04 2010-06-10 Sangamo Biosciences, Inc. Genome editing in rats using zinc-finger nucleases
WO2010077319A1 (en) 2008-12-17 2010-07-08 Dow Agrosciences Llc Targeted integration into the zp15 locus
US8329986B2 (en) 2008-12-17 2012-12-11 Dow Agrosciences, Llc Targeted integration into the Zp15 locus
US8551945B2 (en) 2009-02-04 2013-10-08 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathies
WO2010090744A1 (en) 2009-02-04 2010-08-12 Sangamo Biosciences, Inc. Methods and compositions for treating neuropathies
EP3354275A1 (en) 2009-02-04 2018-08-01 Sangamo Therapeutics, Inc. Methods and compositions for treating neuropathies
US8871905B2 (en) 2009-03-20 2014-10-28 Sangamo Biosciences, Inc. Modification of CXCR4 using engineered zinc finger proteins
US9717759B2 (en) 2009-03-20 2017-08-01 Sangamo Therapeutics, Inc. Modification of CXCR4 using engineered zinc finger proteins
US9834787B2 (en) 2009-04-09 2017-12-05 Sangamo Therapeutics, Inc. Targeted integration into stem cells
US8772008B2 (en) 2009-05-18 2014-07-08 Sangamo Biosciences, Inc. Methods and compositions for increasing nuclease activity
US8772009B2 (en) 2009-05-18 2014-07-08 Sangamo Biosciences, Inc. Methods and compositions for increasing nuclease activity
WO2011002503A1 (en) 2009-06-30 2011-01-06 Sangamo Biosciences, Inc. Rapid screening of biologically active nucleases and isolation of nuclease-modified cells
US9234016B2 (en) 2009-07-28 2016-01-12 Sangamo Biosciences, Inc. Engineered zinc finger proteins for treating trinucleotide repeat disorders
EP2727600A1 (en) 2009-07-28 2014-05-07 Sangamo BioSciences, Inc. Methods and compositions for treating trinucleotide repeat disorders
US10646543B2 (en) 2009-07-28 2020-05-12 Sangamo Therapeutics, Inc. Methods and compositions for treating trinucleotide repeat disorders
US9943565B2 (en) 2009-07-28 2018-04-17 Sangamo Therapeutics, Inc. Methods and compositions for treating trinucleotide repeat disorders
US9074224B2 (en) 2009-08-03 2015-07-07 Recombinetics, Inc. Methods and compositions for targeted gene modification
EP3156504A1 (en) 2009-08-11 2017-04-19 Sangamo BioSciences, Inc. Organisms homozygous for targeted modification
EP3428289A1 (en) 2009-08-11 2019-01-16 Sangamo Therapeutics, Inc. Organisms homozygous for targeted modification
US10827731B2 (en) 2009-08-11 2020-11-10 Sangamo Therapeutics, Inc. Method of inactivating the IPK1 gene in corn
US8592645B2 (en) 2009-10-22 2013-11-26 Dow Agrosciences Llc Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
US10017775B2 (en) 2009-10-22 2018-07-10 Dow Agrosciences Llc Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
EP2722392A2 (en) 2009-10-22 2014-04-23 Dow AgroSciences LLC Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
US9631201B2 (en) 2009-10-22 2017-04-25 Sangamo Biosciences, Inc. Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis
US11439666B2 (en) 2009-11-10 2022-09-13 Sangamo Therapeutics, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US10155011B2 (en) 2009-11-10 2018-12-18 Sangamo Therapeutics, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US8956828B2 (en) 2009-11-10 2015-02-17 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US10260062B2 (en) 2010-01-22 2019-04-16 Sangamo Therapeutics, Inc. Targeted genomic alteration
EP4328304A2 (en) 2010-02-08 2024-02-28 Sangamo Therapeutics, Inc. Engineered cleavage half-domains
US11725218B2 (en) 2010-02-08 2023-08-15 Sangamo Therapeutics, Inc. Artificial nucleases comprising engineered cleavage half-domains
US8962281B2 (en) 2010-02-08 2015-02-24 Sangamo Biosciences, Inc. Engineered cleavage half-domains
EP2615106A1 (en) 2010-02-08 2013-07-17 Sangamo BioSciences, Inc. Engineered cleavage half-domains
US9765361B2 (en) 2010-02-08 2017-09-19 Sangamo Therapeutics, Inc. Engineered cleavage half-domains for generating nuclease-mediated genomic modifications in a cell
US11136599B2 (en) 2010-02-08 2021-10-05 Sangamo Therapeutics, Inc. Artifical nucleases comprising engineered cleavage half-domains
US10640790B2 (en) 2010-02-08 2020-05-05 Sangamo Therapeutics, Inc. Artificial nucleases including engineered FokI cleavage half-domains
US10066242B2 (en) 2010-02-08 2018-09-04 Sangamo Therapeutics, Inc. Artificial nucleases comprising engineered cleavage half-domains
US9376689B2 (en) 2010-02-08 2016-06-28 Sangamo Biosciences, Inc. Engineered cleavage half-domains
EP3594333A1 (en) 2010-02-08 2020-01-15 Sangamo Therapeutics, Inc. Engineered cleavage half-domains
US9150879B2 (en) 2010-02-08 2015-10-06 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US8623618B2 (en) 2010-02-08 2014-01-07 Sangamo Biosciences, Inc. Engineered cleavage half-domains
EP2660318A1 (en) 2010-02-09 2013-11-06 Sangamo BioSciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US9970028B2 (en) 2010-02-09 2018-05-15 Sangamo Therapeutics, Inc. Targeted genomic modification with partially single-stranded donor molecules
US9005973B2 (en) 2010-02-09 2015-04-14 Sangamo Biosciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US9255259B2 (en) 2010-02-09 2016-02-09 Sangamo Biosciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US9567573B2 (en) 2010-04-26 2017-02-14 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using nucleases
US8771985B2 (en) 2010-04-26 2014-07-08 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using zinc-finger nucleases
EP3636766A1 (en) 2010-05-03 2020-04-15 Sangamo Therapeutics, Inc. Compositions for linking zinc finger modules
US9163245B2 (en) 2010-05-03 2015-10-20 Sangamo Biosciences, Inc. Compositions for linking zinc finger modules
US8772453B2 (en) 2010-05-03 2014-07-08 Sangamo Biosciences, Inc. Compositions for linking zinc finger modules
US11661612B2 (en) 2010-05-17 2023-05-30 Sangamo Therapeutics, Inc. DNA-binding proteins and uses thereof
US10253333B2 (en) 2010-05-17 2019-04-09 Sangamo Therapeutics, Inc. DNA-binding proteins and uses thereof
US9783827B2 (en) 2010-05-17 2017-10-10 Sangamo Therapeutics, Inc. DNA-binding proteins and uses thereof
US8912138B2 (en) 2010-05-17 2014-12-16 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
EP3156062A1 (en) 2010-05-17 2017-04-19 Sangamo BioSciences, Inc. Novel dna-binding proteins and uses thereof
US9493750B2 (en) 2010-05-17 2016-11-15 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US9322005B2 (en) 2010-05-17 2016-04-26 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US8586526B2 (en) 2010-05-17 2013-11-19 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US10858416B2 (en) 2010-07-21 2020-12-08 Sangamo Therapeutics, Inc. Methods and compositions for modification of a HLA locus
WO2012012667A2 (en) 2010-07-21 2012-01-26 Sangamo Biosciences, Inc. Methods and compositions for modification of a hla locus
US8945868B2 (en) 2010-07-21 2015-02-03 Sangamo Biosciences, Inc. Methods and compositions for modification of a HLA locus
US10072062B2 (en) 2010-07-21 2018-09-11 Sangamo Therapeutics, Inc. Methods and compositions for modification of a HLA locus
WO2012047598A1 (en) 2010-09-27 2012-04-12 Sangamo Biosciences, Inc. Methods and compositions for inhibiting viral entry into cells
EP3511420A1 (en) 2010-09-27 2019-07-17 Sangamo Therapeutics, Inc. Methods and compositions for inhibiting viral entry into cells
US9566352B2 (en) 2010-09-27 2017-02-14 Sangamo Biosciences, Inc. Methods and compositions for inhibiting viral entry into cells
WO2012051343A1 (en) 2010-10-12 2012-04-19 The Children's Hospital Of Philadelphia Methods and compositions for treating hemophilia b
US9175280B2 (en) 2010-10-12 2015-11-03 Sangamo Biosciences, Inc. Methods and compositions for treating hemophilia B
US9629930B2 (en) 2010-10-12 2017-04-25 Sangamo Biosciences, Inc. Methods and compositions for treating hemophilia B
EP3311822A1 (en) 2010-11-17 2018-04-25 Sangamo Therapeutics, Inc. Methods and compositions for modulating pd1
US9631187B2 (en) 2011-01-05 2017-04-25 Sangamo Biosciences, Inc. Methods and compositions for gene correction
US9267123B2 (en) 2011-01-05 2016-02-23 Sangamo Biosciences, Inc. Methods and compositions for gene correction
WO2012139045A1 (en) 2011-04-08 2012-10-11 Gilead Biologics, Inc. Methods and compositions for normalization of tumor vasculature by inhibition of loxl2
US9161995B2 (en) 2011-07-25 2015-10-20 Sangamo Biosciences, Inc. Methods and compositions for alteration of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
US9777281B2 (en) 2011-09-21 2017-10-03 Sangamo Therapeutics, Inc. Methods and compositions for regulation of transgene expression
EP3498833A1 (en) 2011-09-21 2019-06-19 Sangamo Therapeutics, Inc. Methods and compositions for regulation of transgene expression
US10975375B2 (en) 2011-09-21 2021-04-13 Sangamo Therapeutics, Inc. Methods and compositions for regulation of transgene expression
WO2013044008A2 (en) 2011-09-21 2013-03-28 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
US11639504B2 (en) 2011-09-21 2023-05-02 Sangamo Therapeutics, Inc. Methods and compositions for regulation of transgene expression
US9150847B2 (en) 2011-09-21 2015-10-06 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
US9394545B2 (en) 2011-09-21 2016-07-19 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
US11859190B2 (en) 2011-09-21 2024-01-02 Sangamo Therapeutics, Inc. Methods and compositions for regulation of transgene expression
US8895264B2 (en) 2011-10-27 2014-11-25 Sangamo Biosciences, Inc. Methods and compositions for modification of the HPRT locus
US9222105B2 (en) 2011-10-27 2015-12-29 Sangamo Biosciences, Inc. Methods and compositions for modification of the HPRT locus
WO2013074999A1 (en) 2011-11-16 2013-05-23 Sangamo Biosciences, Inc. Modified dna-binding proteins and uses thereof
US9458205B2 (en) 2011-11-16 2016-10-04 Sangamo Biosciences, Inc. Modified DNA-binding proteins and uses thereof
WO2013112917A1 (en) 2012-01-27 2013-08-01 Sanbio, Inc. Methods and compositions for modulating angiogenesis and vasculogenesis
EP4218727A2 (en) 2012-01-27 2023-08-02 SanBio, Inc. Methods and compositions for modulating angiogenesis and vasculogenesis
US8841260B2 (en) 2012-02-29 2014-09-23 Sangamo Biosciences, Inc. Methods and compositions for treating Huntington's Disease
US11723952B2 (en) 2012-02-29 2023-08-15 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's Disease
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US9499597B2 (en) 2012-02-29 2016-11-22 Sangamo Biosciences, Inc. Methods and compositions for treating Huntington's disease
US10471123B2 (en) 2012-02-29 2019-11-12 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's disease
US10857203B2 (en) 2012-02-29 2020-12-08 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's disease
US10265377B2 (en) 2012-02-29 2019-04-23 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's Disease
US11085092B2 (en) 2012-05-02 2021-08-10 Corteva Agriscience Llc Targeted modification of malate dehydrogenase
WO2013166315A1 (en) 2012-05-02 2013-11-07 Dow Agrosciences Llc Targeted modification of malate dehydrogenase
US10358684B2 (en) 2012-05-02 2019-07-23 Dow Agrosciences Llc Targeted modification of malate dehydrogenase
US9523098B2 (en) 2012-05-02 2016-12-20 Dow Agrosciences Llc Targeted modification of malate dehydrogenase
WO2013169802A1 (en) 2012-05-07 2013-11-14 Sangamo Biosciences, Inc. Methods and compositions for nuclease-mediated targeted integration of transgenes
US10174331B2 (en) 2012-05-07 2019-01-08 Sangamo Therapeutics, Inc. Methods and compositions for nuclease-mediated targeted integration of transgenes
WO2014011901A2 (en) 2012-07-11 2014-01-16 Sangamo Biosciences, Inc. Methods and compositions for delivery of biologics
EP3444342A1 (en) 2012-07-11 2019-02-20 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of lysosomal storage diseases
US10293000B2 (en) 2012-07-11 2019-05-21 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of lysosomal storage diseases
US11898158B2 (en) 2012-07-11 2024-02-13 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of lysosomal storage diseases
EP3196301A1 (en) 2012-07-11 2017-07-26 Sangamo BioSciences, Inc. Methods and compositions for the treatment of monogenic diseases
US11040115B2 (en) 2012-07-11 2021-06-22 Sangamo Therapeutics, Inc. Method for the treatment of lysosomal storage diseases
WO2014011237A1 (en) 2012-07-11 2014-01-16 Sangamo Biosciences, Inc. Methods and compositions for the treatment of lysosomal storage diseases
US9956247B2 (en) 2012-07-11 2018-05-01 Sangamo Therapeutics, Inc. Method of treating lysosomal storage diseases
US9877988B2 (en) 2012-07-11 2018-01-30 Sangamo Therapeutics, Inc. Method of treating lysosomal storage diseases using nucleases and a transgene
US10648001B2 (en) 2012-07-11 2020-05-12 Sangamo Therapeutics, Inc. Method of treating mucopolysaccharidosis type I or II
US10883119B2 (en) 2012-07-11 2021-01-05 Sangamo Therapeutics, Inc. Methods and compositions for delivery of biologics
EP3816281A1 (en) 2012-07-11 2021-05-05 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of lysosomal storage diseases
US9650648B2 (en) 2012-08-29 2017-05-16 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
US9963715B2 (en) 2012-08-29 2018-05-08 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
WO2014036219A2 (en) 2012-08-29 2014-03-06 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
US11492643B2 (en) 2012-08-29 2022-11-08 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
US9914930B2 (en) 2012-09-07 2018-03-13 Dow Agrosciences Llc FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US9963711B2 (en) 2012-09-07 2018-05-08 Sangamo Therapeutics, Inc. FAD2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
WO2014039692A2 (en) 2012-09-07 2014-03-13 Dow Agrosciences Llc Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US10526610B2 (en) 2012-09-07 2020-01-07 Dow Agrosciences Llc FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US9493779B2 (en) 2012-09-07 2016-11-15 Dow Agrosciences Llc FAD2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US10961540B2 (en) 2012-09-07 2021-03-30 Dow Agrosciences Llc FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
WO2014039872A1 (en) 2012-09-07 2014-03-13 Dow Agrosciences Llc Engineered transgene integration platform (etip) for gene targeting and trait stacking
US10287595B2 (en) 2012-09-07 2019-05-14 Dow Agrosciences Llc Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
EP3431600A1 (en) 2012-09-07 2019-01-23 Dow AgroSciences LLC Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US10577616B2 (en) 2012-09-07 2020-03-03 Dow Agrosciences Llc FAD2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
WO2014039702A2 (en) 2012-09-07 2014-03-13 Dow Agrosciences Llc Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
EP3404099A1 (en) 2012-09-07 2018-11-21 Dow AgroSciences LLC Fad2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
EP3406715A1 (en) 2012-09-07 2018-11-28 Dow AgroSciences LLC Fad3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US10844389B2 (en) 2012-09-07 2020-11-24 Dow Agrosciences Llc FAD2 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US9597357B2 (en) 2012-10-10 2017-03-21 Sangamo Biosciences, Inc. T cell modifying compounds and uses thereof
EP3763810A2 (en) 2012-10-10 2021-01-13 Sangamo Therapeutics, Inc. T cell modifying compounds and uses thereof
US11236175B2 (en) 2012-10-10 2022-02-01 Sangamo Therapeutics, Inc. T cell modifying compounds and uses thereof
WO2014059173A2 (en) 2012-10-10 2014-04-17 Sangamo Biosciences, Inc. T cell modifying compounds and uses thereof
US9255250B2 (en) 2012-12-05 2016-02-09 Sangamo Bioscience, Inc. Isolated mouse or human cell having an exogenous transgene in an endogenous albumin gene
US10415046B2 (en) 2012-12-13 2019-09-17 Dow Agrosciences Llc Precision gene targeting to a particular locus in maize
WO2014130955A1 (en) 2013-02-25 2014-08-28 Sangamo Biosciences, Inc. Methods and compositions for enhancing nuclease-mediated gene disruption
US10227610B2 (en) 2013-02-25 2019-03-12 Sangamo Therapeutics, Inc. Methods and compositions for enhancing nuclease-mediated gene disruption
US9937207B2 (en) 2013-03-21 2018-04-10 Sangamo Therapeutics, Inc. Targeted disruption of T cell receptor genes using talens
US10918668B2 (en) 2013-03-21 2021-02-16 Sangamo Therapeutics, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
WO2014165612A2 (en) 2013-04-05 2014-10-09 Dow Agrosciences Llc Methods and compositions for integration of an exogenous sequence within the genome of plants
EP3679785A2 (en) 2013-04-05 2020-07-15 Dow AgroSciences LLC Methods and compositions for integration of an exogenous sequence within the genome of plants
US11198883B2 (en) 2013-04-05 2021-12-14 Dow Agrosciences Llc Methods and compositions for integration of an exogenous sequence within the genome of plants
US10501748B2 (en) 2013-04-05 2019-12-10 Dow Agrosciences Llc Methods and compositions for integration of an exogenous sequence within the genome of plants
US9902974B2 (en) 2013-05-15 2018-02-27 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
US10196651B2 (en) 2013-05-15 2019-02-05 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
US9873894B2 (en) 2013-05-15 2018-01-23 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
EP3730615A2 (en) 2013-05-15 2020-10-28 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
US10196652B2 (en) 2013-05-15 2019-02-05 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a genetic condition
US10538787B2 (en) 2013-08-28 2020-01-21 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
WO2015031619A1 (en) 2013-08-28 2015-03-05 Sangamo Biosciences, Inc. Compositions for linking dna-binding domains and cleavage domains
US9567609B2 (en) 2013-08-28 2017-02-14 Sangamo Biosciences, Inc. Compositions for linking DNA-binding domains and cleavage domains
US11041174B2 (en) 2013-08-28 2021-06-22 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
EP3591045A1 (en) 2013-08-28 2020-01-08 Sangamo Therapeutics, Inc. Compositions for linking dna-binding domains and cleavage domains
US10117899B2 (en) 2013-10-17 2018-11-06 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells
EP3441468A2 (en) 2013-10-17 2019-02-13 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
US10494648B2 (en) 2013-10-17 2019-12-03 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
WO2015057976A1 (en) 2013-10-17 2015-04-23 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells
US9957526B2 (en) 2013-10-17 2018-05-01 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
WO2015057980A1 (en) 2013-10-17 2015-04-23 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
US10106804B2 (en) 2013-11-04 2018-10-23 Dow Agrosciences Llc Optimal soybean loci
US10093940B2 (en) 2013-11-04 2018-10-09 Dow Agrosciences Llc Optimal maize loci
EP3862434A1 (en) 2013-11-04 2021-08-11 Dow AgroSciences LLC Optimal soybean loci
US10233465B2 (en) 2013-11-04 2019-03-19 Dow Agrosciences Llc Optimal soybean loci
US11149287B2 (en) 2013-11-04 2021-10-19 Corteva Agriscience Llc Optimal soybean loci
WO2015066643A1 (en) 2013-11-04 2015-05-07 Dow Agrosciences Llc Optimal soybean loci
US11198882B2 (en) 2013-11-04 2021-12-14 Corteva Agriscience Llc Optimal maize loci
US9909131B2 (en) 2013-11-04 2018-03-06 Dow Agrosciences Llc Optimal soybean loci
US10273493B2 (en) 2013-11-04 2019-04-30 Dow Agrosciences Llc Optimal maize loci
US11098316B2 (en) 2013-11-04 2021-08-24 Corteva Agriscience Llc Optimal soybean loci
WO2015066636A2 (en) 2013-11-04 2015-05-07 Dow Agrosciences Llc Optimal maize loci
WO2015066638A2 (en) 2013-11-04 2015-05-07 Dow Agrosciences Llc Optimal maize loci
US11098317B2 (en) 2013-11-04 2021-08-24 Corteva Agriscience Llc Optimal maize loci
WO2015070212A1 (en) 2013-11-11 2015-05-14 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US10369201B2 (en) 2013-11-11 2019-08-06 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's disease
US11021696B2 (en) 2013-11-13 2021-06-01 Children's Medical Center Corporation Nuclease-mediated regulation of gene expression
EP3492593A1 (en) 2013-11-13 2019-06-05 Children's Medical Center Corporation Nuclease-mediated regulation of gene expression
US10968261B2 (en) 2013-12-09 2021-04-06 Sangamo Therapeutics, Inc. Methods and compositions for genome engineering
US11634463B2 (en) 2013-12-09 2023-04-25 Sangamo Therapeutics, Inc. Methods and compositions for treating hemophilia
EP3757116A1 (en) 2013-12-09 2020-12-30 Sangamo Therapeutics, Inc. Methods and compositions for genome engineering
US9771403B2 (en) 2013-12-09 2017-09-26 Sangamo Therapeutics, Inc. Methods and compositions for treating hemophilia
US10407476B2 (en) 2013-12-09 2019-09-10 Sangamo Therapeutics, Inc. Methods and compositions for treating hemophilia
US10081661B2 (en) 2013-12-09 2018-09-25 Sangamo Therapeutics, Inc. Methods and compositions for genome engineering
US10370680B2 (en) 2014-02-24 2019-08-06 Sangamo Therapeutics, Inc. Method of treating factor IX deficiency using nuclease-mediated targeted integration
US11591622B2 (en) 2014-02-24 2023-02-28 Sangamo Therapeutics, Inc. Method of making and using mammalian liver cells for treating hemophilia or lysosomal storage disorder
EP3929279A1 (en) 2014-03-18 2021-12-29 Sangamo Therapeutics, Inc. Methods and compositions for regulation of zinc finger protein expression
US9624498B2 (en) 2014-03-18 2017-04-18 Sangamo Biosciences, Inc. Methods and compositions for regulation of zinc finger protein expression
WO2015143046A2 (en) 2014-03-18 2015-09-24 Sangamo Biosciences, Inc. Methods and compositions for regulation of zinc finger protein expression
US9522936B2 (en) 2014-04-24 2016-12-20 Sangamo Biosciences, Inc. Engineered transcription activator like effector (TALE) proteins
US11110154B2 (en) 2014-05-08 2021-09-07 Sangamo Therapeutics, Inc. Methods and compositions for treating Huntington's Disease
US9574211B2 (en) 2014-05-13 2017-02-21 Sangamo Biosciences, Inc. Methods and compositions for prevention or treatment of a disease
US9970001B2 (en) 2014-06-05 2018-05-15 Sangamo Therapeutics, Inc. Methods and compositions for nuclease design
WO2016005449A1 (en) 2014-07-08 2016-01-14 Vib Vzw Means and methods to increase plant yield
EP4335926A2 (en) 2014-07-14 2024-03-13 Washington State University Nanos knock-out that ablates germline cells
WO2016011029A2 (en) 2014-07-14 2016-01-21 Washington State University Nanos knock-out that ablates germline cells
WO2016011381A1 (en) 2014-07-18 2016-01-21 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Reducing cxcr4 expression and/or function to enhance engraftment of hematopoietic stem cells
US9816074B2 (en) 2014-07-25 2017-11-14 Sangamo Therapeutics, Inc. Methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells
US9757420B2 (en) 2014-07-25 2017-09-12 Sangamo Therapeutics, Inc. Gene editing for HIV gene therapy
US9833479B2 (en) 2014-07-30 2017-12-05 Sangamo Therapeutics, Inc. Gene correction of SCID-related genes in hematopoietic stem and progenitor cells
US9616090B2 (en) 2014-07-30 2017-04-11 Sangamo Biosciences, Inc. Gene correction of SCID-related genes in hematopoietic stem and progenitor cells
WO2016044416A1 (en) 2014-09-16 2016-03-24 Sangamo Biosciences, Inc. Methods and compositions for nuclease-mediated genome engineering and correction in hematopoietic stem cells
EP3878948A1 (en) 2014-09-16 2021-09-15 Sangamo Therapeutics, Inc. Methods and compositions for nuclease-mediated genome engineering and correction in hematopoietic stem cells
US10435677B2 (en) 2014-09-16 2019-10-08 Sangamo Therapeutics, Inc. Genetically modified human cell with a corrected mutant sickle cell mutation
US10889834B2 (en) 2014-12-15 2021-01-12 Sangamo Therapeutics, Inc. Methods and compositions for enhancing targeted transgene integration
WO2016118726A2 (en) 2015-01-21 2016-07-28 Sangamo Biosciences, Inc. Methods and compositions for identification of highly specific nucleases
EP4541900A2 (en) 2015-04-03 2025-04-23 Dana-Farber Cancer Institute, Inc. Composition and methods of genome editing of b- cells
WO2016161446A1 (en) 2015-04-03 2016-10-06 Dana-Farber Cancer Institute, Inc. Composition and methods of genome editing of b-cells
WO2017176806A1 (en) 2015-04-03 2017-10-12 Dana-Farber Cancer Institute, Inc. Composition and methods of genome editing of b cells
EP4335918A2 (en) 2015-04-03 2024-03-13 Dana-Farber Cancer Institute, Inc. Composition and methods of genome editing of b-cells
US10179918B2 (en) 2015-05-07 2019-01-15 Sangamo Therapeutics, Inc. Methods and compositions for increasing transgene activity
US10808020B2 (en) 2015-05-12 2020-10-20 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
US10619154B2 (en) 2015-06-18 2020-04-14 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
US9957501B2 (en) 2015-06-18 2018-05-01 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
US10450585B2 (en) 2015-07-13 2019-10-22 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
EP4361279A2 (en) 2015-08-06 2024-05-01 The Curators of the University of Missouri Pathogen-resistant animals having modified cd163 genes
WO2017023570A1 (en) 2015-08-06 2017-02-09 The Curators Of The University Of Missouri Pathogen-resistant animals having modified cd163 genes
US10435441B2 (en) 2015-09-23 2019-10-08 Sangamo Therapeutics, Inc. HTT repressors and uses thereof
US11123443B2 (en) 2015-09-23 2021-09-21 Sangamo Therapeutics, Inc. Htt repressors and uses thereof
US12551575B2 (en) 2015-09-23 2026-02-17 Sangamo Therapeutics, Inc. Htt repressors and uses thereof
US10639383B2 (en) 2015-11-23 2020-05-05 Sangamo Therapeutics, Inc. Methods and compositions for engineering immunity
US11793888B2 (en) 2015-11-23 2023-10-24 Sangamo Therapeutics, Inc. Methods and compositions for engineering immunity
US11352631B2 (en) 2015-12-18 2022-06-07 Sangamo Therapeutics, Inc. Targeted disruption of the T cell receptor
WO2017106528A2 (en) 2015-12-18 2017-06-22 Sangamo Biosciences, Inc. Targeted disruption of the t cell receptor
US10500229B2 (en) 2015-12-18 2019-12-10 Sangamo Therapeutics, Inc. Targeted disruption of the MHC cell receptor
WO2017106537A2 (en) 2015-12-18 2017-06-22 Sangamo Biosciences, Inc. Targeted disruption of the mhc cell receptor
US11285175B2 (en) 2015-12-18 2022-03-29 Sangamo Therapeutics, Inc. Targeted disruption of the MHC cell receptor
WO2017123757A1 (en) 2016-01-15 2017-07-20 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of neurologic disease
EP3769775A2 (en) 2016-02-02 2021-01-27 Sangamo Therapeutics, Inc. Compositions for linking dna-binding domains and cleavage domains
US10724020B2 (en) 2016-02-02 2020-07-28 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
US11920169B2 (en) 2016-02-02 2024-03-05 Sangamo Therapeutics, Inc. Compositions for linking DNA-binding domains and cleavage domains
US11421218B2 (en) 2016-03-23 2022-08-23 Dana-Farber Cancer Institute, Inc. Methods for enhancing the efficiency of gene editing
WO2017165655A1 (en) 2016-03-23 2017-09-28 Dana-Farber Cancer Institute, Inc. Methods for enhancing the efficiency of gene editing
US12031150B2 (en) 2016-07-13 2024-07-09 Vertex Pharmaceuticals Incorporated Methods, compositions and kits for increasing genome editing efficiency
WO2018013840A1 (en) 2016-07-13 2018-01-18 Vertex Pharmaceuticals Incorporated Methods, compositions and kits for increasing genome editing efficiency
EP4219462A1 (en) 2016-07-13 2023-08-02 Vertex Pharmaceuticals Incorporated Methods, compositions and kits for increasing genome editing efficiency
EP3838287A2 (en) 2016-07-27 2021-06-23 Case Western Reserve University Compounds and methods of promoting myelination
WO2018029034A1 (en) 2016-08-09 2018-02-15 Vib Vzw Cellulose synthase inhibitors and mutant plants
WO2018039440A1 (en) 2016-08-24 2018-03-01 Sangamo Therapeutics, Inc. Regulation of gene expression using engineered nucleases
US10975393B2 (en) 2016-08-24 2021-04-13 Sangamo Therapeutics, Inc. Engineered target specific nucleases
US10563184B2 (en) 2016-08-24 2020-02-18 Sangamo Therapeutics, Inc. Regulation of gene expression using engineered nucleases
EP3964573A1 (en) 2016-08-24 2022-03-09 Sangamo Therapeutics, Inc. Engineered target specific nucleases
US11845965B2 (en) 2016-08-24 2023-12-19 Sangamo Therapeutics, Inc. Regulation of gene expression using engineered nucleases
US11827900B2 (en) 2016-08-24 2023-11-28 Sangamo Therapeutics, Inc. Engineered target specific nucleases
WO2018039448A1 (en) 2016-08-24 2018-03-01 Sangamo Therapeutics, Inc. Engineered target specific nucleases
US10960085B2 (en) 2016-09-07 2021-03-30 Sangamo Therapeutics, Inc. Modulation of liver genes
US11072660B2 (en) 2016-10-03 2021-07-27 Juno Therapeutics, Inc. HPV-specific binding molecules
US10800833B2 (en) 2016-10-04 2020-10-13 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
EP4115951A1 (en) 2016-10-04 2023-01-11 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
WO2018067697A1 (en) 2016-10-04 2018-04-12 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
EP3757120A1 (en) 2016-10-04 2020-12-30 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
US11286291B2 (en) 2016-10-04 2022-03-29 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
US11219695B2 (en) 2016-10-20 2022-01-11 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of Fabry disease
WO2018081775A1 (en) 2016-10-31 2018-05-03 Sangamo Therapeutics, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
US11020492B2 (en) 2016-10-31 2021-06-01 Sangamo Therapeutics, Inc. Gene correction of SCID-related genes in hematopoietic stem and progenitor cells
US11504389B2 (en) 2016-12-01 2022-11-22 Sangamo Therapeutics, Inc. Tau modulators and methods and compositions for delivery thereof
WO2018106782A1 (en) 2016-12-08 2018-06-14 Case Western Reserve University Methods and compositions for enhancing functional myelin production
EP4276187A2 (en) 2016-12-08 2023-11-15 Case Western Reserve University Methods and compositions for enhancing functional myelin production
WO2018195418A1 (en) 2017-04-20 2018-10-25 Oregon Health & Science University Human gene correction
US11655275B2 (en) 2017-05-03 2023-05-23 Sangamo Therapeutics, Inc. Methods and compositions for modification of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
EP4029943A1 (en) 2017-05-08 2022-07-20 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
WO2018208837A1 (en) 2017-05-08 2018-11-15 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
US11512287B2 (en) 2017-06-16 2022-11-29 Sangamo Therapeutics, Inc. Targeted disruption of T cell and/or HLA receptors
WO2019005957A1 (en) 2017-06-30 2019-01-03 Precision Biosciences, Inc. GENETICALLY MODIFIED T CELLS COMPRISING A MODIFIED INTRON IN THE ALPHA T CELL RECEPTOR GENE
US12516098B2 (en) 2017-08-08 2026-01-06 Sangamo Therapeutics, Inc. Chimeric antigen receptor mediated cell targeting
EP4215543A2 (en) 2017-10-03 2023-07-26 Juno Therapeutics, Inc. Hpv-specific binding molecules
WO2019070856A1 (en) 2017-10-03 2019-04-11 Precision Biosciences, Inc. MODIFIED EPIDERMAL GROWTH FACTOR RECEPTOR PEPTIDES FOR USE IN GENETICALLY MODIFIED CELLS
US11952408B2 (en) 2017-10-03 2024-04-09 Juno Therapeutics, Inc. HPV-specific binding molecules
EP4269560A2 (en) 2017-10-03 2023-11-01 Precision Biosciences, Inc. Modified epidermal growth factor receptor peptides for use in genetically-modified cells
WO2019070541A1 (en) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. HPV-SPECIFIC BINDING MOLECULES
WO2019089913A1 (en) 2017-11-01 2019-05-09 Precision Biosciences, Inc. Engineered nucleases that target human and canine factor viii genes as a treatment for hemophilia a
US11661611B2 (en) 2017-11-09 2023-05-30 Sangamo Therapeutics, Inc. Genetic modification of cytokine inducible SH2-containing protein (CISH) gene
US12083188B2 (en) 2017-12-01 2024-09-10 Encoded Therapeutics, Inc. Engineered DNA binding proteins
EP4534678A2 (en) 2017-12-18 2025-04-09 Syngenta Crop Protection AG Targeted insertion sites in the maize genome
US12121524B2 (en) 2018-01-17 2024-10-22 Vertex Pharmaceuticals Incorporated DNA-PK inhibitors
WO2019143675A1 (en) 2018-01-17 2019-07-25 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
WO2019143677A1 (en) 2018-01-17 2019-07-25 Vertex Pharmaceuticals Incorporated Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency
US12269804B2 (en) 2018-01-17 2025-04-08 Vertex Pharmaceuticals Incorporated Quinoxalinone compounds, compositions, methods, and kits for increasing genome editing efficiency
WO2019143678A1 (en) 2018-01-17 2019-07-25 Vertex Pharmaceuticals Incorporated Dna-pk inhibitors
US12005127B2 (en) 2018-01-17 2024-06-11 Vertex Pharmaceuticals Incorporated DNA-PK inhibitors
US11401512B2 (en) 2018-02-08 2022-08-02 Sangamo Therapeutics, Inc. Engineered target specific nucleases
WO2019195492A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Methods of producing cells expressing a recombinant receptor and related compositions
WO2019195491A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cells expressing a recombinant receptor, related polynucleotides and methods
US11471489B2 (en) 2018-04-05 2022-10-18 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
US11421007B2 (en) 2018-04-18 2022-08-23 Sangamo Therapeutics, Inc. Zinc finger protein compositions for modulation of huntingtin (Htt)
US11690921B2 (en) 2018-05-18 2023-07-04 Sangamo Therapeutics, Inc. Delivery of target specific nucleases
US11834686B2 (en) 2018-08-23 2023-12-05 Sangamo Therapeutics, Inc. Engineered target specific base editors
EP4234570A2 (en) 2018-09-18 2023-08-30 Sangamo Therapeutics, Inc. Programmed cell death 1 (pd1) specific nucleases
US12329857B2 (en) 2018-09-21 2025-06-17 Acuitas Therapeutics, Inc. Systems and methods for manufacturing lipid nanoparticles and liposomes
EP4696310A2 (en) 2018-10-02 2026-02-18 Sangamo Therapeutics, Inc. Methods and compositions for modulation of tau proteins
WO2020072677A1 (en) 2018-10-02 2020-04-09 Sangamo Therapeutics, Inc. Methods and compositions for modulation of tau proteins
US12318427B2 (en) 2018-10-02 2025-06-03 Sangamo Therapeutics, Inc. Methods and compositions for modulation of tau proteins
US12583816B2 (en) 2018-10-18 2026-03-24 Acuitas Therapeutics, Inc. Lipids for lipid nanoparticle delivery of active agents
WO2020132659A1 (en) 2018-12-21 2020-06-25 Precision Biosciences, Inc. Genetic modification of the hydroxyacid oxidase 1 gene for treatment of primary hyperoxaluria
US11453639B2 (en) 2019-01-11 2022-09-27 Acuitas Therapeutics, Inc. Lipids for lipid nanoparticle delivery of active agents
US11857641B2 (en) 2019-02-06 2024-01-02 Sangamo Therapeutics, Inc. Method for the treatment of mucopolysaccharidosis type I
WO2020205838A1 (en) 2019-04-02 2020-10-08 Sangamo Therapeutics, Inc. Methods for the treatment of beta-thalassemia
EP4332115A2 (en) 2019-04-03 2024-03-06 Precision Biosciences, Inc. Genetically-modified immune cells comprising a microrna-adapted shrna (shrnamir)
WO2020206248A1 (en) 2019-04-03 2020-10-08 Precision Biosciences, Inc. Genetically-modified immune cells comprising a microrna-adapted shrna (shrnamir)
WO2020206231A1 (en) 2019-04-05 2020-10-08 Precision Biosciences, Inc. Methods of preparing populations of genetically-modified immune cells
US12139517B2 (en) 2019-04-23 2024-11-12 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
WO2020219726A1 (en) 2019-04-23 2020-10-29 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
US12435120B2 (en) 2019-05-01 2025-10-07 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified CD247 locus, related polynucleotides and methods
WO2020223571A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified cd247 locus, related polynucleotides and methods
WO2020223535A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a recombinant receptor from a modified tgfbr2 locus, related polynucleotides and methods
US12516350B2 (en) 2019-05-29 2026-01-06 Encoded Therapeutics, Inc. Compositions and methods for selective gene regulation
WO2021016608A1 (en) 2019-07-25 2021-01-28 Precision Biosciences, Inc. Compositions and methods for sequential stacking of nucleic acid sequences into a genomic locus
WO2021035054A1 (en) 2019-08-20 2021-02-25 Precision Biosciences, Inc. Lymphodepletion dosing regimens for cellular immunotherapies
WO2021035170A1 (en) 2019-08-21 2021-02-25 Precision Biosciences, Inc. Compositions and methods for tcr reprogramming using fusion proteins
WO2021067864A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for treatment of prion disease
WO2021067871A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing alpha-synuclein expression
WO2021087305A1 (en) 2019-10-30 2021-05-06 Precision Biosciences, Inc. Cd20 chimeric antigen receptors and methods of use for immunotherapy
WO2021087358A1 (en) 2019-11-01 2021-05-06 Sangamo Therapeutics, Inc. Gin recombinase variants
WO2021113543A1 (en) 2019-12-06 2021-06-10 Precision Biosciences, Inc. Methods for cancer immunotherapy, using lymphodepletion regimens and cd19, cd20 or bcma allogeneic car t cells
WO2021151012A1 (en) 2020-01-22 2021-07-29 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing tau expression
WO2021158915A1 (en) 2020-02-06 2021-08-12 Precision Biosciences, Inc. Recombinant adeno-associated virus compositions and methods for producing and using the same
WO2021202513A1 (en) 2020-03-31 2021-10-07 Elo Life Systems Modulation of endogenous mogroside pathway genes in watermelon and other cucurbits
WO2021224416A1 (en) 2020-05-06 2021-11-11 Cellectis S.A. Methods to genetically modify cells for delivery of therapeutic proteins
WO2021224395A1 (en) 2020-05-06 2021-11-11 Cellectis S.A. Methods for targeted insertion of exogenous sequences in cellular genomes
WO2021231259A1 (en) 2020-05-11 2021-11-18 Precision Biosciences, Inc. Self-limiting viral vectors encoding nucleases
WO2021231661A2 (en) 2020-05-13 2021-11-18 Juno Therapeutics, Inc. Process for producing donor-batched cells expressing a recombinant receptor
WO2021260186A1 (en) 2020-06-26 2021-12-30 Juno Therapeutics Gmbh Engineered t cells conditionally expressing a recombinant receptor, related polynucleotides and methods
US11976019B2 (en) 2020-07-16 2024-05-07 Acuitas Therapeutics, Inc. Cationic lipids for use in lipid nanoparticles
US12410121B2 (en) 2020-07-16 2025-09-09 Acuitas Therapeutics, Inc. Cationic lipids for use in lipid nanoparticles
WO2022035793A1 (en) 2020-08-10 2022-02-17 Precision Biosciences, Inc. Antibodies and fragments specific for b-cell maturation antigen and uses thereof
EP4501951A2 (en) 2020-08-25 2025-02-05 Kite Pharma, Inc. T cells with improved functionality
WO2022046760A2 (en) 2020-08-25 2022-03-03 Kite Pharma, Inc. T cells with improved functionality
WO2022067122A1 (en) 2020-09-25 2022-03-31 Sangamo Therapeutics, Inc. Zinc finger fusion proteins for nucleobase editing
WO2022076547A1 (en) 2020-10-07 2022-04-14 Precision Biosciences, Inc. Lipid nanoparticle compositions
WO2022087527A1 (en) 2020-10-23 2022-04-28 Elo Life Systems, Inc. Methods for producing vanilla plants with improved flavor and agronomic production
WO2022098787A1 (en) 2020-11-04 2022-05-12 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified invariant cd3 immunoglobulin superfamily chain locus and related polynucleotides and methods
WO2022101641A1 (en) 2020-11-16 2022-05-19 Pig Improvement Company Uk Limited Influenza a-resistant animals having edited anp32 genes
WO2022165111A1 (en) 2021-01-28 2022-08-04 Precision Biosciences, Inc. Modulation of tgf beta signaling in genetically-modified eukaryotic cells
WO2022226316A1 (en) 2021-04-22 2022-10-27 Precision Biosciences, Inc. Compositions and methods for generating male sterile plants
WO2023064872A1 (en) 2021-10-14 2023-04-20 Precision Biosciences, Inc. Combinations of anti-bcma car t cells and gamma secretase inhibitors
WO2023070003A1 (en) 2021-10-19 2023-04-27 Precision Biosciences, Inc. Gene editing methods for treating alpha-1 antitrypsin (aat) deficiency
WO2023081900A1 (en) 2021-11-08 2023-05-11 Juno Therapeutics, Inc. Engineered t cells expressing a recombinant t cell receptor (tcr) and related systems and methods
WO2023091910A1 (en) 2021-11-16 2023-05-25 Precision Biosciences, Inc. Methods for cancer immunotherapy
WO2023105244A1 (en) 2021-12-10 2023-06-15 Pig Improvement Company Uk Limited Editing tmprss2/4 for disease resistance in livestock
US12129223B2 (en) 2021-12-16 2024-10-29 Acuitas Therapeutics, Inc. Lipids for use in lipid nanoparticle formulations
WO2023122722A1 (en) 2021-12-22 2023-06-29 Sangamo Therapeutics, Inc. Novel zinc finger fusion proteins for nucleobase editing
WO2023131616A1 (en) 2022-01-05 2023-07-13 Vib Vzw Means and methods to increase abiotic stress tolerance in plants
WO2023131637A1 (en) 2022-01-06 2023-07-13 Vib Vzw Improved silage grasses
WO2023144199A1 (en) 2022-01-26 2023-08-03 Vib Vzw Plants having reduced levels of bitter taste metabolites
WO2024013514A2 (en) 2022-07-15 2024-01-18 Pig Improvement Company Uk Limited Gene edited livestock animals having coronavirus resistance
WO2024100604A1 (en) 2022-11-09 2024-05-16 Juno Therapeutics Gmbh Methods for manufacturing engineered immune cells
WO2024161021A1 (en) 2023-02-03 2024-08-08 Juno Therapeutics Gmbh Methods for non-viral manufacturing of engineered immune cells
WO2024216116A1 (en) 2023-04-14 2024-10-17 Precision Biosciences, Inc. Muscle-specific expression cassettes
WO2024216118A1 (en) 2023-04-14 2024-10-17 Precision Biosciences, Inc. Muscle-specific expression cassettes
WO2024238726A1 (en) 2023-05-16 2024-11-21 Omega Therapeutics, Inc. Methods and compositions for modulating methylation of a target gene
WO2024238723A1 (en) 2023-05-16 2024-11-21 Omega Therapeutics, Inc. Methods and compositions for modulating pcsk9 expression
WO2025004001A1 (en) 2023-06-30 2025-01-02 Takeda Pharmaceutical Company Limited Htt repressors and uses thereof
WO2025019742A1 (en) 2023-07-19 2025-01-23 Omega Therapeutics, Inc. Methods and compositions for modulating ctnnb1 expression
WO2025194124A1 (en) 2024-03-14 2025-09-18 Tessera Therapeutics, Inc. Modified st1cas9 guide nucleic acids
WO2025235563A1 (en) 2024-05-07 2025-11-13 Omega Therapeutics, Inc. Epigenetic modulation for upregulation of genes
WO2025235851A1 (en) 2024-05-10 2025-11-13 Juno Therapeutics, Inc. Genetically engineered t cells expressing a cd19 chimeric antigen receptor (car) and uses thereof for allogeneic cell therapy
WO2026083329A1 (en) 2024-10-18 2026-04-23 Precision Biosciences, Inc. Methods of nuclease-initiated homology directed repair and replacement and compositions and uses thereof
WO2026083328A1 (en) 2024-10-18 2026-04-23 Precision Biosciences, Inc. Base editing nucleotide sequences using homology directed repair

Also Published As

Publication number Publication date
EP1259597A2 (en) 2002-11-27
CN1416467B (zh) 2012-07-04
US20070087371A1 (en) 2007-04-19
WO2001060970A3 (en) 2002-02-07
DE60127819D1 (de) 2007-05-24
EP1259597A4 (en) 2003-08-27
JP4584840B2 (ja) 2010-11-24
DE60127819T2 (de) 2007-12-27
JP2003523195A (ja) 2003-08-05
US20020061512A1 (en) 2002-05-23
CN1416467A (zh) 2003-05-07
CA2400772A1 (en) 2001-08-23
EP1259597B1 (en) 2007-04-11
JP2006149395A (ja) 2006-06-15
AU3771901A (en) 2001-08-27
AU781103B2 (en) 2005-05-05
CA2400772C (en) 2008-05-13
NZ521293A (en) 2004-06-25
IL151149A0 (en) 2003-04-10
ATE359365T1 (de) 2007-05-15
JP4156840B2 (ja) 2008-09-24

Similar Documents

Publication Publication Date Title
EP1259597B1 (en) Zinc finger domains and methods of identifying same
US20090176653A1 (en) Zinc finger domain libraries
US5885779A (en) Repressed trans-activator system for characterization of protein-protein interactions
US6132963A (en) Interaction trap systems for analysis of protein networks
Guarente Strategies for the identification of interacting proteins.
White Gene transcription: mechanisms and control
AU2002324352A1 (en) Zinc finger domain libraries
EP1017802B1 (en) A potential effector for the grb7 family of signalling proteins
KR100436869B1 (ko) 징크 핑거 도메인 및 그 동정 방법
US20070042378A1 (en) Regulation of prokaryotic gene expression with zinc finger proteins
US20040259258A1 (en) Regulation of prokaryotic gene expression with zinc finger proteins
WO2004022575A2 (en) Bioinformatics analysis of cellular effects of artificial transcription factors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 151149

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2001910136

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2001 560342

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2400772

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 37719/01

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 018062520

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 521293

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: IN/PCT/2002/1445/CHE

Country of ref document: IN

WWP Wipo information: published in national office

Ref document number: 2001910136

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 521293

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 521293

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 37719/01

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 2001910136

Country of ref document: EP