WO2001049724A1 - Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001049724A1 WO2001049724A1 PCT/CN2000/000656 CN0000656W WO0149724A1 WO 2001049724 A1 WO2001049724 A1 WO 2001049724A1 CN 0000656 W CN0000656 W CN 0000656W WO 0149724 A1 WO0149724 A1 WO 0149724A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide—human ankylosing protein 43, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
- G protein mediates the transmembrane transmission of signals. It consists of three subunits: ⁇ , ⁇ , and ⁇ .
- the ⁇ subunit can bind and hydrolyze GTP.
- the function of ⁇ and ⁇ subunits is not very clear, but they are found in the membrane. It plays a key role in the process of identification, anchoring and GTP replacing GDP.
- G- ⁇ the ⁇ subunit
- G- ⁇ is a small family of genes composed of a number of highly conserved proteins, which are approximately 340 amino acids in length. Structurally, G- ⁇ consists of eight 40-amino acid repeats arranged in tandem. Each repeat contains a Trp-Asp Mot if (also known as a WD-40 repeat).
- Trp-Asp Motif (WD-40 repeats) have different functions, are diverse, and have different cell localizations, such as in the nucleus, plasma membrane, and cytoskeleton. Therefore, the gene function inferred from this Mot i f is quite different from the actual situation.
- the polypeptide of the present invention is homologous to Mi 1 ler- Dieker cerebrum dysplasia type 1 protein (Mi 1 ler- Dieker li ssencepha ly protein, LIS1 Mi 1 ler- Dieker cerebella dysplasia type 1 protein was first cloned from human fetal brain Its full-length gene is 2750bp and encodes 288 amino acids. The chromosome is located at 17pl 3.3. There is already evidence that the loss of this protein or the deletion of chromosome 17pl 3.3 will lead to the occurrence of anencephaly. Mi ller- Dieker syndrome.
- the gene encoding the polypeptide of the present invention is homologous to the human ankylosing protein gene, it is speculated that the protein plays an important role in the development of the cerebral cortex. Combining its Mot if function, it is further speculated that this gene plays a role in signal transduction. Play an important role in the process, especially in the transmembrane signalling process. Based on the fact that its homologous protein is up-regulated by thyroid hormone in Xenopus laevis, it is speculated that this protein is regulated by hormones and mediates the function of thyroid hormones. If the protein is abnormal, it may be clinically manifested as thyroid hormone deficiency. Symptoms, such as staying sick. As mentioned above, this gene may be closely related to congenital or acquired brain development abnormalities, dementia, or mental retardation.
- the polypeptide of the present invention was presumed to be identified as a new human cerebella dysmorphic protein, and was named human cerebella dysmorphia 43.
- the human cephalic dysmorphic protein 43 protein plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more human cephalic dysplasia involved in these processes Protein 43 protein, especially the amino acid sequence of this protein. Isolation of the new brain-free dysmorphic protein 43 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code for DM.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing human cephalic dysmorphic protein 43.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human cephalic dysmorphia 43.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human ankylosing protein 43.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 20-1 to 198 in SEQ ID NO: 1; and (b) a sequence having 1- in SEQ ID NO: 1 1 558-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human acephalic dysmorphic protein 43 protein, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the human acephalic dysmorphic protein 43 protein, which comprises detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human acephalic dysmorphic protein 43.
- Figure 1 is a comparison diagram of the amino acid sequence homology of the 48-amino acid and domain WD-40 repeats of the inventor's cephalomorphic protein 43 at 180-228.
- the upper sequence is the human cephalic dysmorphic protein 43 and the lower sequence is the WD-40 repeat sequence domain.
- " And ":” and ".” Mean that the probability of the same amino acid decreasing between the two sequences decreases in order.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human cephalic deformity protein 43.
- FIG. 43 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that can cause changes in the protein and thereby regulate the activity of the protein when it binds to human acephalic dysmorphic protein 43.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human acephalic dysmorphic protein 43.
- Antagonist refers to a molecule that can block or modulate the biological or immunological activity of human ankylosing protein 43 when combined with human ankylosing protein 43.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human acephalic dysmorphic protein 43.
- Regular refers to a change in the function of human acephalic dysmorphic protein 43, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human acephalic dysmorphic protein 43. change.
- “Substantially pure '” means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify human acephalic dysmorphic protein 43 using standard protein purification techniques. Basic The pure human cephalic dysmorphic protein 43 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human cephalic dysplastic protein 43 can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern blotting or Nort hern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The C l uster method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence ⁇ and sequence ⁇ 100
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He i n J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense chain means “have "Sense strand” is a complementary nucleic acid strand.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and 1 ⁇ , which can specifically bind to the antigenic determinants of human ankylosing protein 43.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human cephalic dysmorphic protein 43 refers to human cephalic dysmorphic protein 43 which is essentially free of other proteins, lipids, sugars or other substances naturally associated with it. Those skilled in the art can purify human ankylosing protein 43 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human cephalic deformity protein 43 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human cephalic dysmorphic protein 43, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the present invention also includes fragments, derivatives, and analogs of human cephalic dysmorphic protein 43.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human acephalic dysmorphic protein 43 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may Is: (I) a type in which one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon Or (II) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (II I) a type in which a mature polypeptide and another compound (Such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol) or UV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or used to purify the polypeptide) Sequence or protease sequence).
- a mature polypeptide and another compound such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1 558 bases, and its open reading frame (20-1198) encodes 392 amino acids.
- This polypeptide has the characteristic sequence of the WD-40 repeat sequence, and it can be deduced that the human acephalic dysmorphic protein 43 has the structure and function represented by the WD-40 repeat sequence.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DNA forms include cDNA, genomic DNA or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between 50%, preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50 ° /.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ankylosing protein 43.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence of the present invention encoding human acephalic dysmorphic protein 43 can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of transcripts of human brain dysmorphic protein 43; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- probes are typically 2000 nucleotides in length Within 1,000 nucleotides is preferred.
- the probe used here is usually a chemically synthesized DNA sequence based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by human acephalic dysmorphic protein 43 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE- rapid cDNA end amplification method
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the coding sequence of human acephalic dysmorphic protein 43, and a recombinant technology for producing the polypeptide of the present invention. method.
- a polynucleotide sequence encoding the human cephalic dysmorphic protein 43 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: a ⁇ promoter-based expression vector (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- an expression vector containing a DNA sequence encoding human acephalic dysmorphic protein 43 and appropriate transcription / translation regulatory elements can be used to construct an expression vector containing a DNA sequence encoding human acephalic dysmorphic protein 43 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human acephalic dysmorphic protein 4 3 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human ankylosing protein 43 (Scence, 1 984; 224: 1431). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
- G protein mediates the transmembrane transmission of signals. It consists of three subunits: ⁇ , ⁇ , and ⁇ .
- the ⁇ subunit (G- ⁇ for short) is a small gene family composed of multiple highly conserved proteins. G - ⁇ has a specific Trp-Asp Mot if (also known as WD-40 repeat) is necessary for its activity. Proteins containing Trp-Asp Motif (WD-40 repeats) have different functions, are diverse, and have different cell localizations, such as in the nucleus, plasma membrane, and cytoskeleton.
- Trp-Asp Motif-containing polypeptide of the present invention is homologous to Mi 1 ler-Di eker angiocephalic type 1 protein. It may be regulated by thyroid hormones and mediate the function of thyroid hormones. If the protein is abnormal, it may be clinically manifested as symptoms of thyroid hormone deficiency, such as staying sick.
- the function of the polypeptide containing the mot if of the present invention is abnormal, which leads to the abnormality of the transmembrane transmission function of G protein-mediated signals, and may cause abnormalities during the embryonic development stage, or cause the body to be abnormally regulated by thyroid hormones. And produce related diseases such as embryonic developmental disorders, disorders related to abnormal thyroid hormone regulation, tumors, and growth and development disorders.
- the abnormal expression of the human cerebella dysmorphic protein 4 3 of the present invention will produce various diseases, especially embryonic developmental disorders, diseases related to abnormal regulation of thyroid hormones, tumors, and growth and development disorders. These diseases include but are not limited to:
- Embryonic developmental disorders congenital abortion, cleft palate, limb absentness, limb differentiation disorders, hyaline membrane disease, Pulmonary insufficiency, polycystic kidney disease, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube Defects, congenital hydrocephalus, iris defects, congenital cataracts, congenital glaucoma or cataracts, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma
- the abnormal expression of the human cephalic dysmorphic protein 43 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, diseases related to abnormal regulation of thyroid hormones, tumors, and growth and development disorders. Some hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human acephalic dysmorphic protein 43.
- Agonists enhance biological functions such as human acephalic dysmorphic protein 43 to stimulate cell proliferation, and antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human acephalic dysmorphic protein 43 can be cultured in the presence of drugs with labeled human acephalic dysmorphic protein 43. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human cephalic dysmorphic protein 43 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human cephalic dysmorphic protein 43 can bind to human cephalic dysplastic protein 43 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human anaplastic dysmorphic protein 43 can be added to the bioanalytical assay. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human ankylosing protein 43 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, the molecule of human cephalic dysmorphic protein 43 should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the present invention also provides antibodies directed against the human de novo gyrus 43 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- polyclonal antibodies can be obtained by direct injection of human anebrain deformity protein 43 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for the preparation of monoclonal antibodies against human cephalic dysmorphic protein 43 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single-chain antibodies (U. S. Pat No. 4946778) can also be used to produce single-chain antibodies against human ankylosing protein 43.
- Antibodies against human cephalic dysmorphic protein 43 can be used in immunohistochemical techniques to detect human cephalic dysmorphic protein 43 in biopsy specimens.
- Monoclonal antibodies that bind to human cephalic dysmorphic protein 43 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human acephalic dysmorphic protein 43 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human ankylosing protein 43 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human ankylosing protein 43.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ankylosing protein 43.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human cephalic dysmorphic protein 43.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the levels of human cephalic dysmorphic protein 43 detected in the test can be used to explain human cephalic dysmorphic protein 43 in various diseases. The importance of the disease and for the diagnosis of diseases in which the human dyscephalic protein 43 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human acephalic dysmorphic protein 43 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human acephalic dysmorphic protein 43.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutations in human acephalic dysmorphic protein 43 to inhibit endogenous human anaplastic dysmorphic protein 4 3 activity.
- a mutated human acephalic dysmorphic protein 43 may be a shortened human acephalic dysmorphic protein 43 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used for the treatment of diseases caused by abnormal expression or activity of human ankylosing protein 43.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer a polynucleotide encoding human acephalic dysmorphic protein 43 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human acephalic dysmorphic protein 43 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human acephalic dysmorphic protein 43 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human acephalic dysmorphic protein 43 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human cephalic dysmorphic protein 43 can be used for the diagnosis of diseases related to human cephalic dysmorphic protein 4 3.
- Polynucleotides encoding human cephalic dysmorphic protein 43 can be used to detect the expression of human cephalic dysmorphic protein 43 or abnormal expression of human cephalic dysmorphic protein 43 in disease states.
- the DNA sequence encoding human cephalic dysmorphic protein 43 can be used to hybridize biopsy specimens to determine human cephalic Expression of dysmorphic protein 43.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- RNA-polymerase chain reaction (RT-PCR) amplification using human-specific cephalic dysmorphic protein 43 specific primers can also be used to detect the transcription products of human cephalic dysmorphic protein 43.
- Detection of mutations in the human cephalic dysmorphic protein 43 gene can also be used to diagnose human cephalic dysmorphic protein 43-related diseases.
- Human ankylosing protein 43 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ankylosing protein 43 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human ankylosing protein 43 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human cerebella malformation protein 43 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Po ly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qi egene). 2ug po ly (A) mRNA was reverse transcribed to form cDNA.
- a Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
- the terminate cycle react ion sequencing kit (Perkin-Elmer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones.
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0328B04 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the human acephalic dysmorphic protein 43 and its encoded protein sequence of the present invention were profiled using the GCG profile scan program (Basic local alignment search tool) [Al tschul, SF et al. J. ol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as prosite.
- the human cephalic dysmorphic protein 43 of the present invention is homologous with the domain WD-40 repeat sequence at 180-228, and the homology result is shown in FIG. 1.
- the homology rate is 0.10, and the score is 4.92; the threshold value is 4.70.
- Example 3 Cloning of a gene encoding human ankylosing protein 43 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GGGTGGAGGCGGGGTCGAGATGGCG -3 '(SEQ ID NO: 3)
- Primer2 5'- AACATATTTTCTTTATTTCCTCCAG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mraol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DNA in a 50 ⁇ 1 reaction volume Polymerase (C 1 on t ech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-E 1 mer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min 0
- RT was set to P- Act in is a positive control and template blank is a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1558bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of the expression of human acephalin dysmorphin 43 gene Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159] 0 This method involves acid guanidinium thiocyanate-chloroform extraction.
- the tissue was homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- ⁇ - 32 ⁇ dATP Preparation 32 ⁇ - DNA probe labeled by the random primer method.
- the DNA probe used was the PCR-encoded human angiocephalic protein 43 coding region sequence (20bp to 1198bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in x SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, Analysis and quantification was performed using Phosphor Imager.
- Example 5 In vitro expression, isolation and purification of recombinant human ankylosing protein 43
- Primer3 5'- CCCGCTAGCATGGCGGCGCCTTTGAGGATTCAGA -3 '(Seq ID No: 5)
- Primer4 5'- CCCAAGCTTGATAGAACTGGTGCTCCTGATCTGA -3' (Seq ID No: 6)
- These two primers contain Ndel and Hindlll restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
- the Ndel and Hindi II restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ plasmid pBS- 0328 ⁇ 04 containing 10pg, primer Pr imer- 3 and Pr imer- 4 are lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and Hindlll were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into colibacillus DH5cc by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Correct positive clone (pET-0328B04)
- the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- the target protein is human cerebrum dysmorphic protein 43.
- Polypeptide synthesizer (product of PE company) was used to synthesize the following peptides specific for human cephalic dysmorphia 43: NH2- Met-Al a-Ala-Pro-Leu-Arg-I le-Gln-Ser-Asp-Trp- Al a-Gln-Ala-Leu-C00H (SEQ ID NO: 7).
- the peptide was coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Imraunochemi stry, 1969; 6:43.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps Off.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- GC content is 30% -70%, if it exceeds, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. Its specific method steps
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21427/01A AU2142701A (en) | 1999-12-29 | 2000-12-25 | A novel polypeptide-human lissencephaly protein 43 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99127209 CN1301762A (zh) | 1999-12-29 | 1999-12-29 | 一种新的多肽——人无脑回畸形蛋白43和编码这种多肽的多核苷酸 |
CN99127209.9 | 1999-12-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001049724A1 true WO2001049724A1 (fr) | 2001-07-12 |
Family
ID=5284797
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000656 WO2001049724A1 (fr) | 1999-12-29 | 2000-12-25 | Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1301762A (zh) |
AU (1) | AU2142701A (zh) |
WO (1) | WO2001049724A1 (zh) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103525934B (zh) * | 2013-10-12 | 2015-11-25 | 海门中科基因生物科技有限公司 | Miller-Dieker综合征检测芯片 |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998040495A1 (en) * | 1997-03-13 | 1998-09-17 | Beth Israel Deaconess Medical Center Inc. | Doublin, a gene involved in neuronal development and uses therefor |
WO1999027089A1 (en) * | 1997-11-21 | 1999-06-03 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | A gene called xlis and the xlis gene product, called doublecortin and their preparations |
-
1999
- 1999-12-29 CN CN 99127209 patent/CN1301762A/zh active Pending
-
2000
- 2000-12-25 WO PCT/CN2000/000656 patent/WO2001049724A1/zh active Application Filing
- 2000-12-25 AU AU21427/01A patent/AU2142701A/en not_active Abandoned
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998040495A1 (en) * | 1997-03-13 | 1998-09-17 | Beth Israel Deaconess Medical Center Inc. | Doublin, a gene involved in neuronal development and uses therefor |
WO1999027089A1 (en) * | 1997-11-21 | 1999-06-03 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | A gene called xlis and the xlis gene product, called doublecortin and their preparations |
Also Published As
Publication number | Publication date |
---|---|
CN1301762A (zh) | 2001-07-04 |
AU2142701A (en) | 2001-07-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001049724A1 (fr) | Nouveau polypeptide, proteine lissencephale humaine 43, et polynucleotide codant pour ce polypeptide | |
WO2001072796A1 (fr) | Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 11, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001046409A1 (fr) | Nouveau polypeptide, proteine ribosomale s7 9, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001070800A1 (fr) | Nouveau polypeptide, proteine humaine 11 helicase atp-dependante, et polynucleotide codant pour ce polypeptide | |
WO2001079429A2 (en) | A novel polypeptide - human guanine nucleotide exchange factor 10and the polynucleotide encoding said polypeptide | |
WO2001079434A2 (fr) | Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001048195A1 (fr) | Nouveau polypeptide, proteine rcc1 10, et polynucleotide codant pour ce polypeptide | |
WO2001066770A1 (fr) | Nouveau polypeptide, signal peptidase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001046437A1 (fr) | Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide | |
WO2001074893A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 11.8, et polynucleotide codant pour ce polypeptide | |
WO2001081386A1 (fr) | Nouveau polypeptide, proteine pax humaine 12.5, et polynucleotide codant pour ce polypeptide | |
WO2001070803A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 9.7, et polynucleotide codant pour ce polypeptide | |
WO2001081399A1 (fr) | Nouveau polypeptide, proteine pax humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001083544A1 (fr) | Nouveau polypeptide, proteine pax humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001087962A1 (fr) | Nouveau polypeptide, proteine pax humaine 11, et polynucleotide codant ce polypeptide | |
WO2001079437A2 (en) | Novel polypeptide a human cell differential transcriptional factor 14 and polynucleotide encoding it | |
WO2001048199A1 (fr) | Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide | |
WO2001053341A1 (fr) | Nouveau polypeptide, proteine humaine 13 a doigt de zinc, et polynucleotide codant pour ce polypeptide | |
WO2001047982A1 (fr) | Nouveau polypeptide, support mitochondrial 30, et polynucleotide codant pour ce polypeptide | |
WO2001083678A2 (en) | A novel polypeptide, homo uridylic acid kinase 13 and polynucleotide encoding said polypeptide | |
WO2001079436A2 (en) | A novel polypeptide - human cell differentiation transcription factor 10 and the polynucleotide encoding said polypeptide | |
WO2001053483A1 (fr) | Nouveau polypeptide, proteine humaine 30 a doigt de zinc, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |