WO2001040484A2 - Nouveau polypeptide, serine protease humaine 64 atp-dependante, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, serine protease humaine 64 atp-dependante, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001040484A2
WO2001040484A2 PCT/CN2000/000504 CN0000504W WO0140484A2 WO 2001040484 A2 WO2001040484 A2 WO 2001040484A2 CN 0000504 W CN0000504 W CN 0000504W WO 0140484 A2 WO0140484 A2 WO 0140484A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
dependent serine
human atp
sequence
Prior art date
Application number
PCT/CN2000/000504
Other languages
English (en)
Chinese (zh)
Other versions
WO2001040484A3 (fr
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU16885/01A priority Critical patent/AU1688501A/en
Publication of WO2001040484A2 publication Critical patent/WO2001040484A2/fr
Publication of WO2001040484A3 publication Critical patent/WO2001040484A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology.
  • the present invention describes a new polypeptide, a human ATP-dependent serine protease 64, and a polynucleotide sequence encoding the polypeptide.
  • the invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique
  • Lon-type proteolytic enzymes catalyzes the ATP-dependent degradation of mitochondrial matrix proteins.
  • People have cloned a variety of members of the Lon proteolytic enzyme family from bacteria, yeast, and humans, and found that human LON proteolytic enzymes are expressed in various tissues, and these proteins are encoded in the nucleus of the cell.
  • the N-terminus of the amino acid sequence contains a potential mitochondrial prelocalization sequence [Wang N., Got Tesman S. et al., 1993, Prog Na tl Acad Sci USA, 90: 11247-11251].
  • L0N1 protein In 1998, Baraka t S. and others cloned the L0N1 protein from maize, which is a new member of the Lon-type proteolytic enzyme family.
  • the L0N1 protein has high similarity in protein sequences with known bacterial and human Lon proteolytic enzymes, and both have a conserved substrate-binding domain and an ATP-binding domain; and the protein and the Lon protein family
  • the other members have similar biological functions and are closely related to the respiration process of the organism in vivo, which can maintain the integrity of mitochondrial DNA, but is not a component of the cytochrome complex [Baraka t S., Pearce DA.
  • the N-terminus of members of the enzyme family contains a conserved ATP-binding domain, which is responsible for binding to ATP in the body to hydrolyze ATP and provide the required energy for the enzyme to function; in addition, the enzyme family The members also contain the following conservative consensus sequence fragments:
  • DG- [PD] -SA- [GS]-[LIVMCA]-[TA]-[LIVM] (where S is the active serine site);
  • S is the active serine site;
  • the sequence fragment is the catalytic active center of the enzyme, and it plays a normal physiological function in the process of the enzyme Plays an important role. Mutations in this sequence will affect the catalytic activity of the enzyme in the organism.
  • novel human ATP-dependent serine proteolytic enzyme of the present invention and L0N1 proteolytic enzyme in Zea Mays have 55% identity and 73% similarity at the protein level, and both have an ATP binding Domain and enzyme catalytic center conserved sequence fragments; therefore, both are members of the Lon proteolytic enzyme family and have similar biological functions, and are associated with mitochondrial diseases, metabolic disorders related to energy and material metabolism in vivo , Growth and development disorders.
  • the human ATP-dependent serine protease 64 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
  • the human ATP-dependent serine protease 64 protein involved in these processes identifies the amino acid sequence of this protein.
  • the newcomer's ATP-dependent serine protein hydrolase 64 protein-coding gene isolation also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 64.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 64.
  • Another object of the present invention is to provide a method for producing human ATP-dependent serine proteolytic enzyme 64.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human ATP-dependent serine proteolytic enzyme 64.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human ATP-dependent serine protease 64 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human ATP-dependent serine protease 64.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide complementary to polynucleotide (a);
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 900-2645 in SEQ ID NO: 1; and (b) a sequence having positions 1-2840 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ATP-dependent serine protein hydrolase 64 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human ATP-dependent serine protease 64 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ATP-dependent serine proteolytic enzyme 64.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such " A "polypeptide” or “protein” is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as using color Glycine. "Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with human ATP-dependent serine proteolytic enzyme 64, causes the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human ATP-dependent serine proteolytic enzyme 64.
  • Antagonist refers to a molecule that blocks or regulates the biological or immunological activity of human ATP-dependent serine proteolytic enzyme 64 when combined with human ATP-dependent serine proteolytic enzyme 64.
  • Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ATP-dependent serine proteolytic enzyme 64.
  • Regular refers to a change in the function of human ATP-dependent serine protease 64, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human ATP-dependent serine protease 64 Or changes in immune properties.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human ATP-dependent serine proteolytic enzymes 64 using standard protein purification techniques.
  • the substantially pure human ATP-dependent serine protease 64 can generate a single main band on a non-reducing polyacrylamide gel.
  • the purity of human ATP-dependent serine protease 6 4 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization under conditions of reduced stringency (Southern blotting or Northern blotting, etc.). Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require the binding of two sequences to each other. Combined as specific or selective interactions.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of one or more amino acid or nucleic acid sequences.
  • the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
  • the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
  • the Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
  • the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human ATP-dependent serine protease 64.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural ring, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and peptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or peptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human ATP-dependent serine protease 64 means that human ATP-dependent serine protease 64 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human ATP-dependent serine proteolytic enzyme 64 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ATP-dependent serine protease 64 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a novel polypeptide human ATP-dependent serine proteolytic enzyme 64, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives, and analogs of human ATP-dependent serine proteolytic enzyme 64.
  • fragment refers to human ATP that substantially retains the invention
  • Dependent serine proteolytic enzymes 64 polypeptides with the same biological function or activity ..
  • a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) such a type in which one or more amino acid residues are conserved Or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such that one or more amino acid residues are A certain group is substituted by another group to include a substituent; or (III) a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV ) A polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or Secretory sequence or a sequence for purification of this polypeptide or a proprotein sequence) set forth by the herein Such fragments, derivatives and analogs are deemed to be within the knowledge of the skilled artisan.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2840 bases in length and its open reading frame (9 00-2645) encodes 581 amino acids. Sour. Based on the amino acid sequence homology comparison, it was found that this polypeptide has 55% homology with the L0N1 proteolytic enzyme in Zea Mays. It can be inferred that the human ATP-dependent serine proteolytic enzyme 64 is similar to the L0N1 proteolytic enzyme in Zea Mays. Structure and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DM forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ATP-dependent serine protease 64.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human ATP-dependent serine proteolytic enzyme 64 can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art.
  • These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human ATP-dependent serine protease 64 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of human ATP-dependent serine protease 64 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and use regular The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al.
  • Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human ATP-dependent serine proteolytic enzyme 64 coding sequence, and that recombinant technology is used to produce the present invention.
  • Polypeptide method Polypeptide method.
  • a polynucleotide sequence encoding human ATP-dependent serine proteolytic enzyme 64 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and Phenotypic traits of modified host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase, neomycin resistance for eukaryotic cell culture, and Phenotypic traits of modified host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human ATP-dependent serine protease 64 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase, and treated with the ( 12 method, the steps used are well known in the art.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Plastid packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human ATP-dependent serine protease 64 (Sc ience, 1 984; 224: 14 3 1). Generally, The following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of the amino acid sequence homology of the ATP-dependent serine proteolytic enzyme 64 of the present inventor and the LNN1 protein hydrolase in Zea Mays.
  • the upper sequence is human ATP-dependent serine protease 64, and the lower sequence is L0N1 protease in Zea Mays.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human ATP-dependent serine proteolytic enzyme 64.
  • 64kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0389H12 was new DNA.
  • the inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers.
  • the results showed that the 0389H12 clone contained a full-length cDNA of 2840bp (as shown in Seq ID NO: 1), and a 1746bp open reading frame (0RF) from 900bp to 2645bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone PBS-0389H12 and encoded the protein as human ATP-dependent serine protease 64.
  • Example 2 Homologous search of cDNA clones
  • the gene with the highest homology to the human ATP-dependent serine proteolytic enzyme 64 of the present invention is a known LON1 proteolytic enzyme in Zea Mays, which encodes a protein with accession number U85494 in Genbank.
  • the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 55% and a similarity of 73%.
  • Example 3 Cloning of a gene encoding human ATP-dependent serine protease 64 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
  • PCR amplification was performed with the following primers:
  • Primer2 5,-TTTTTATCAGTTTACTAAATCAAC -3, (SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Conditions for the amplification reaction 50 mmol / L KC1, 10 ramol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ raol / L dNTP, lOpmol primers in a reaction volume of 50 ⁇ 1 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain 0 ⁇ -act in was set as positive during RT-PCR Controls and template blanks are negative controls.
  • the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2840bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of human ATP-dependent serine protease 64 gene expression: Total RNA was extracted by a one-shot method [Anal. Biochera 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was prepared by random primers using cx- 32 P dATP.
  • the DNA probes used were PCR amplified human ATP-dependent serine protease 64 coding region sequences (900bp to 2645bp).
  • 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC- 5 ⁇ Denhardt's solution and 200 ⁇ g / ral salmon sperm DNA. Miscellaneous 3 ⁇ 4 After that, the filter was placed in 1 x SSC-0.1% S:) S at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human ATP-dependent serine protease 64
  • Primer3 5'- CCCCATATGATGCTAGAGAAAAAAATACGAACATC —3, (Seq ID No: 5)
  • Primer4 5'- CCCCATATGATGCTAGAGAAAAAAATACGAACATC —3, (Seq ID No: 6)
  • the 5 ′ ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
  • the coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
  • the pBS-0389H12 plasmid containing the full-length gene of interest was used as a template for the PCR reaction.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0389H12 plasmid, Primer-3 and Primer-4 were lOpniol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
  • the host strain BL21 (pET-0389H12) was cultured at 37 ′ to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation.
  • 6His-Tag A purified human ATP-dependent serine protease 64 of the protein of interest was shown.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human ATP-dependent serine protease 64-specific peptides:
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • the method please refer to: Avramea s, etal. Immunochemi str, 1969; 6:43. Immunize with 4mg of the above L cyanin polypeptide complex and complete Freund's adjuvant. After 15 days, use the hemocyanin polypeptide complex and incomplete Freund's adjuvant to boost the immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used for EL I SA to determine antibody titers in serum-free. Total I gG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepha ros e4B column, and the anti-peptide antibody was separated from the total I g () by affinity chromatography.
  • the immunoprecipitation method demonstrated that the purified antibody could specifically bind to human ATP-dependent serine Proteolytic enzyme 64 binds.
  • Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding sites of the sample on the filter with the carrier and synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe and sample hybridization has the strongest specificity and can be retained. 1. Selection of probes
  • the preferred range of probe size is 18-50 nucleotides
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when pollution must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature, for example, please refer to the literature
  • a total of 4,000 polynucleotide sequences of different full-length cI) NA were used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by (as described in the examples) PCR, and the amplified product was purified to adjust its concentration to about 500ng / ul, and spotted on the glass with a Cartesian 7500 spotting instrument (purchased by Cartesian, USA). The distance between the points on the medium is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips.
  • the specific method steps have been variously reported in the literature, and the specific method steps have been variously reported in the literature.
  • the sample post-processing steps of this embodiment are:
  • Total mRNA was extracted from normal liver and liver cancer by a single method, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
  • the fluorescent reagent Cy3dUTP (5-Amino-propargy 1-2 ⁇ -deoxyur id ine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled mRNA of liver tissue
  • Cy5dUTP (5-Amino-propargy 1-2 '-deoxyur id ine 5 ⁇ -tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company) labeled liver cancer tissue mRNA
  • a fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
  • Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeieChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The point where the ratio is less than 0.5 and greater than 2 is considered Genes with differential expression.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • the Lon protein family is closely related to the respiration process of organisms in the body. It can maintain the integrity of mitochondrial DNA, but it is not a component of the cytochrome complex. Abnormal expression can cause abnormal mitochondrial DNA structure and affect the function of the respiratory chain, leading to abnormal metabolism of matter and energy.
  • the abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will produce various diseases, especially mitochondrial diseases, metabolic disorders related to energy and material metabolism, and disorders of growth and development. These diseases include, but are not Limited to:
  • Organic acidemia isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency
  • the present invention also provides screening compounds to identify improvement (agonist) or repression (antagonist) Human ATP-dependent Serological Proteolytic Enzyme 64
  • Method Agonists enhance human ATP-dependent serine protease 64 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders associated with excessive cell proliferation, such as various cancers.
  • membrane preparations of mammalian cells or human ATP-dependent serine proteolytic enzymes 64 and labeled human ATP-dependent serine proteolytic enzymes 64 can be made in the presence of drugs — From cultivation. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human ATP-dependent serine protease 64 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human ATP-dependent serine protease 64 can bind to human ATP-dependent serine protease 64 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • human ATP-dependent serine protease 64 can be added to a bioanalytical assay by measuring the effect of the compound on the interaction between human ATP-dependent serine protease 64 and its receptor Determine if the compound is an antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human ATP-dependent serine proteolytic enzyme 64 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human ATP-dependent serine protein hydrolysate 64 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against human ATP-dependent serine protease 64 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human ATP-dependent serine protease 64 directly into immunized animals (such as home immunity, mice, rats, etc.).
  • immunized animals such as home immunity, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to human ATP-dependent serine proteolytic domain 64 include, but are not limited to, hybridoma technology (Kohler and Mil te in. Na tur e, 1975, 256: 495-497), triple tumor technology, Human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using existing techniques (Morris on e t al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human ATP-dependent serine proteolytic enzyme 64.
  • Antibodies against human ATP-dependent serine protease 64 can be used in immunohistochemistry to detect human ATP-dependent serine protease 64 in biopsy specimens.
  • Monoclonal antibodies that bind to human ATP-dependent serine proteolytic enzyme 64 can also be labeled with radioactive isotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human ATP-dependent serine protease 64 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria poison, ricin, ormosine, etc.).
  • a common method is to attack the antibody with a thiol crosslinker such as SPDP
  • SPDP thiol crosslinker
  • the amino group of the amino group binds the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill human ATP-dependent serine protease 64 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to human ATP-dependent serine protease 64. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human ATP-dependent serine proteolytic enzymes.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human ATP-dependent serine proteolytic enzyme 64 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human ATP-dependent serine protease 64 detected in the test can be used to explain the importance of human ATP-dependent serine protease 64 in various diseases and to diagnose human ATP-dependent serine protease 64 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis, for example, the polypeptide can be specifically cleaved by physical, chemical or enzyme, and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis, Polynucleotides encoding human ATP-dependent serine protease 64 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human ATP-dependent serine proteolytic enzyme 64.
  • Recombinant gene therapy vectors can be designed to express mutant human ATP-dependent serine protease 64 to inhibit endogenous human ATP-dependent serine protease 64 activity.
  • a variant human ATP-dependent serine protease 64 may be a shortened human ATP-dependent serine protease 64 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signal transduction. active. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human ATP-dependent serine proteolytic enzyme 64.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 64 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 64 can be found in existing literature (Sambrook, et al.).
  • a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 64 can be packaged into liposomes and transferred into cells.
  • the method for introducing the polynucleotide into tissues or cells includes: directly injecting the polynucleotide into tissues in vivo; Or, a polynucleotide (such as a virus, a phage, or a plasmid) is first introduced into a cell in vitro, and then the cell is transplanted into the body.
  • a polynucleotide such as a virus, a phage, or a plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human ATP-dependent serine protease 64 raRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be encoded by The DM sequence of the RNA is obtained by in vitro or in vivo transcription. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding human ATP-dependent serine protease 64 can be used for the diagnosis of diseases related to human ATP-dependent serine protease 64.
  • the polynucleotide encoding human ATP-dependent serine protease 64 can be used to detect the expression of human ATP-dependent serine protease 64 or the abnormal expression of human ATP-dependent serine protease 64 in a disease state.
  • the DM sequence encoding human ATP-dependent serine protease 64 can be used to hybridize biopsy specimens to determine the expression of human ATP-dependent serine protease 64.
  • Hybridization techniques include Sout hern blotting, Nor the rn blotting, and in situ hybridization.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Micr oa r ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • Human ATP-dependent serine proteolytic enzyme-specific 64 primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human ATP-dependent serine proteolytic enzyme 64 transcripts.
  • Human ATP-dependent serine proteolytic trans64 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human ATP-dependent serine proteolytic 64 DNA sequences. Mutations can be detected using existing techniques such as Sou thern blotting, I) NA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • the important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 15-35 b P ) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendel iaii Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human ATP-dependent serine proteolytic enzyme 64 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human ATP-dependent serine protease 64 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sérine protéase humaine 64 ATP-dépendante, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la sérine protéase humaine 64 ATP-dépendante.
PCT/CN2000/000504 1999-11-29 2000-11-27 Nouveau polypeptide, serine protease humaine 64 atp-dependante, et polynucleotide codant pour ce polypeptide WO2001040484A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU16885/01A AU1688501A (en) 1999-11-29 2000-11-27 A novel polypeptide, a human atp-dependent serine protease 64 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 99124137 CN1298013A (zh) 1999-11-29 1999-11-29 一种新的多肽——人atp依赖的丝氨酸蛋白水解酶64和编码这种多肽的多核苷酸

Publications (2)

Publication Number Publication Date
WO2001040484A2 true WO2001040484A2 (fr) 2001-06-07
WO2001040484A3 WO2001040484A3 (fr) 2007-11-22

Family

ID=5283229

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000504 WO2001040484A2 (fr) 1999-11-29 2000-11-27 Nouveau polypeptide, serine protease humaine 64 atp-dependante, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1298013A (fr)
AU (1) AU1688501A (fr)
WO (1) WO2001040484A2 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DATABASE PIR [Online] Database accession no. (A36894) & J. BACTERIOL. vol. 175, no. 14, July 1993, pages 4538 - 4544 *
DATABASE SWISS-PROT [Online] Database accession no. (O04979) *
DATABASE SWISS-PROT [Online] Database accession no. (P36774) & J. BACTERIOL vol. 175, no. 14, July 1993, pages 4545 - 4549 *
DATABASE SWISS-PROT [Online] Database accession no. (P93647) *
DATABASE SWISS-PROT [Online] Database accession no. (Q64948) *

Also Published As

Publication number Publication date
AU1688501A (en) 2001-06-12
CN1298013A (zh) 2001-06-06
WO2001040484A3 (fr) 2007-11-22

Similar Documents

Publication Publication Date Title
WO2001066707A1 (fr) Nouveau polypeptide, serine protease humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001040484A2 (fr) Nouveau polypeptide, serine protease humaine 64 atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001046431A1 (fr) Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide
WO2001075085A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001075125A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide
WO2001072983A1 (fr) Nouveau polypeptide, peroxydase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001053492A1 (fr) Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide
WO2001072986A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 10, et polynucleotide codant pour ce polypeptide
WO2001087943A1 (fr) Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant
WO2001072980A1 (fr) Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001064734A1 (fr) Nouveau polypeptide, cathepsine humaine 18, et polynucleotide codant pour ce polypeptide
WO2001072989A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 11, et polynucleotide codant pour ce polypeptide
WO2001072990A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 12, et polynucleotide codant pour ce polypeptide
WO2001072991A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.8, et polynucleotide codant pour ce polypeptide
WO2001040486A1 (fr) Nouveau polypeptide, serine protease humaine 48 atp-dependante, et polynucleotide codant pour ce polypeptide
WO2001038388A1 (fr) Nouveau polypeptide - transacylase 31 a chaine ramifiee de type humain - et polynucleotide codant ce polypeptide
WO2001081592A1 (fr) Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide
WO2001087974A1 (fr) Nouveau polypeptide, serine hydrolase humaine atp-dependante 35, et polynucleotide codant pour ce polypeptide
WO2001048176A1 (fr) Nouveau polypeptide, fumarase 9, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP