WO2001038511A2 - Resolvase-katalysierte, sequenz-spezifische dna-rekombination in eukaryotischen zellen - Google Patents
Resolvase-katalysierte, sequenz-spezifische dna-rekombination in eukaryotischen zellen Download PDFInfo
- Publication number
- WO2001038511A2 WO2001038511A2 PCT/EP2000/011718 EP0011718W WO0138511A2 WO 2001038511 A2 WO2001038511 A2 WO 2001038511A2 EP 0011718 W EP0011718 W EP 0011718W WO 0138511 A2 WO0138511 A2 WO 0138511A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- resolvase
- sequence
- seq
- dna
- recombination
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Definitions
- the present invention relates to a method for sequence-specific recombination of DNA in eukaryotic cells, comprising introducing into a cell a first DNA sequence comprising a res sequence, inserting a copy of the first DNA sequence and performing the sequence -specific recombination by the action of a resolvase or its derivative.
- the present invention further relates to a method for testing topoisomerase inhibitors in a eukaryotic cell, comprising introducing into a cell a first DNA sequence according to SEQ ID NO: 1, introducing into a cell a copy of the first DNA sequence according to SEQ ID NO : l in direct orientation, the introduction of a wild-type resolvase, and addition of the topoisomerase inhibitors to be tested.
- Controlled manipulation of eukaryotic genomes is an important method for researching the function (s) of certain genes in the living organism. In addition, it plays a role in gene therapy procedures in the medical field.
- the production of transgenic animal strains, the modification of genes or gene segments (so-called "gene targeting") and the targeted integration of foreign DNA into the genome of higher eukaryotes are of particular importance in this context.
- gene targeting the modification of genes or gene segments
- telomere sequences are divided into two families. Members of the first, the so-called "integrase" family, catalyze the separation and relinking of DNA strands between two defined nucleotide sequences, which are referred to below as recombination sequences. These can either lie on two different molecules or on one DNA molecule. Intermolecular or intramolecular recombination then occurs. In the latter case the result of the reaction depends on the the respective arrangement of the recombination sequences from one another. If the recombination sequences are in inverted, ie opposite, orientation to one another, the DNA segment in between is inversed.
- the recombination sequences are direct, ie rectified, repeats on a DNA substrate, deletion occurs.
- intermolecular recombination ie when the two recombination sequences are placed on two different DNA molecules, the two DNA molecules can fuse. While members of the integrase family usually catalyze both intra- and intermolecular recombination, recombinases of the second family, the so-called “invertases / resolvases", are only capable of intramolecular recombination.
- invertases / resolvases can only carry out intramolecular recombination if the recombination sequences exist either as inverted repeats (invertases) or as direct repeats (resolvases).
- invertases inverted repeats
- resolvases direct repeats
- loxP is a 34 bp nucleotide sequence consisting of two 13 bp inverted nucleotide sequences and an 8 bp spacer in between; see. Hoess, R. et al. (1985) J. Mol. Biol., 181, pp. 351.
- the binding sequences for Flp have a similar structure, but differ from loxP; see. Kilby, J. et al. (1993) Trends Genet., 9, pp. 413.
- the recombination sequences can therefore not be interchanged, i.e. Cre cannot recombine ER7 and FLP / o-xP sequences.
- Both recombination systems are active over long distances, i.e. the DNA segment to be inverted or deleted, flanked by two loxP or ERr sequences, can be several 10,000 base pairs (kb) long.
- invertase resolvase family Two members of the invertase resolvase family have been used to manipulate eukaryotic genomes.
- a mutant of invertin gin from bacteriophage Mu can catalyze the inversion of a DNA fragment in plant protoplasts without cofactors.
- this mutant was found to be hyper recombinant, i.e. also catalyzes DNA strand separations at other than their natural recombination sequences; see. Maeser, S. & Kahmann, R. (1991) Mol. Gen. Genet., 230, pp. 170. This leads to undesired, sometimes lethal recombination events in the genome of the plant protoplasts.
- the ⁇ resolvase is the prototype of the resolvase subfamily and is encoded by the bacterial transposon ⁇ (also known as transposon 1000).
- the ⁇ resolvase is phylogenetically closely related to the Tn3 resolvase.
- the ⁇ transposon occurs episomally as part of the F factor in the bacterium Escherichia coli.
- the biological function of a transposon-encoded resolvase is usually to catalyze the dissolution of the so-called co-integrate through a sequence-specific DNA recombination.
- the co-integrate consists of two directly repeated copies of the transposon and arises transiently through the process of transposition ("jumping" of the mobile genetic element into another genomic locus) within a bacterial cell.
- the resolvase catalyzes the recombination between two identical recombination sequences, commonly known as res be designated.
- Res comprises 145 nucleotides and, like the resolvase gene, is a natural part of the transposon.
- the class II transposons consist of a res, a tnpA gene which codes for the transposase, and a tnpR gene which codes for the resolvase.
- the transposon When the co-integrate is formed, the transposon is doubled, so that two copies of the transposon with the res sequence, the tnpA gene and the tnpR gene are present as a direct repeat; see. Review article by Grindley, NDF (1994) Nucl. Acids and Mol. Biol, 8, pp. 236.
- the resolvase has a total of six binding sites in one res, ie each binding site is bound by a single resolvase molecule. Since the wild-type resolvase is in solution (and thus also intracellularly) as a homodimer, a total of 3 dimers bind to a res.
- Res therefore consists of three dimer binding sites, called I, ⁇ and EI.
- Two of the three binding sites ( ⁇ and III) are called auxiliary sequences.
- the occupation of these sequences by two resolvase dimers is a necessary prerequisite for the activation of the actual recombination reaction, which ultimately leads to the DNA strand exchange. This takes place in the center of the imperfect palindromic binding site I in res, the so-called "crossover" region, and is catalyzed by the resolvase dimer bound to it.
- resolvase mutants for example the 7 ⁇ 3 resolvase and the ⁇ -resolvase ( ⁇ -resolvase E124Q ), which, regardless of the presence (-) supercoilings in the DNA-substrate molecule, can catalyze recombination between two complete res.
- the molecular one The basis for this phenotype has not yet been clearly clarified. Apparently the changed ones are playing
- mutant resolvase when a (-) supercoiling is present is that these mutant resolvases can carry out the recombination without the two auxiliary sequences II and m and only with the palindromic binding site I in res. It follows from this that the recombination can also take place between two DNA segments which only contain the binding sites I and are therefore considerably shorter than the complete res. The recombination occurs regardless of the location and orientation of the recombination sequences, i.e. the two partner sequences can lie on one or on two different DNA molecules and occur as direct or inverted repeats.
- intermolecular recombination can occur, which leads to a fusion of the two different DNA molecules, or, in the case of the intramolecular reaction, depending on the respective orientation of the binding sites I to one another, i.e. as direct or inverted repeats, for deletion or inversion of a DNA segment lying between the binding sites I
- Unmodified resolvase is strictly dependent on the non-relaxed state of the DNA substrate, which must also carry two complete res sequences as direct repeats. There is only intramolecular recombination and the resulting deletion of a DNA segment.
- the mutated variants e.g. ⁇ -resolvase E124Q or ⁇ -resolvase E102 E124Q, on the other hand, can also catalyze the recombination reaction on relaxed, e.g. linear, substrate molecules, although the complete res sequences (I, II and IH) are on the same DNA -Molecule must be in direct repetition. Even with the mutant resolvases, the complete res sequences only result in intramolecular recombination and the resulting deletion of a DNA segment.
- the mutant resolvase can also carry out the recombination if only the res- Sequences with the binding site I are present, regardless of the torsional tension of the DNA, ie with or without (-) supercoiling. The localization of the res sequences on a DNA molecule and the orientation is insignificant.
- the resolvase mutants can therefore perform both intra- and intermolecular recombinations.
- Intracellular genomic and episomal DNA in higher eukaryotes is in a topologically relaxed state except for a few areas, i.e. there are hardly any free (-) superhelical turns in the DNA, e.g. could use the wild-type resolvase to catalyze recombination. Therefore, the resolvase has not been used for recombination in eukaryotic cells.
- topological state of genomic DNA is regulated in the cell by a special class of enzymes called topoisomerases. If the enzymatic activity of these proteins fails, for example due to mutations or the action of inhibitors, topological tension accumulates in the genomic DNA as a result of other DNA transactions, such as transcription; see. Review article by Wang, J.C. (1996) Annu. Rev. Biochem., 65, pp. 635.
- topoisomerases There are a number of substances that can selectively inhibit intracellular topoisomerase activities.
- a special class of these substances is e.g. represented by camptothecin and its derivatives, which are already in therapeutic use as anti-cancer agents and selectively inhibit type I topoisomerases; Review article by Chen and Liu (1994), Annu. Rev.
- a major problem in the development of new and more effective topoisomerase inhibitors is the lack of a simple test system, either in cell culture or in the living organism, e.g. the mouse, for determining the level of inhibition and / or the tissue specificity of such a substance.
- Another object of the present invention is to provide a simple and controllable recombination system and the work equipment required. Another object of the present invention is to provide a simple and reliable test system for eukaryotic topoisomerase inhibitors.
- FIG. 1A shows a schematic illustration of the ⁇ -resolvase-catalyzed recombination reaction
- FIG. 1B shows a schematic illustration of the ⁇ -res sequence.
- A A circular, topologically relaxed DNA is shown, which carries two res as direct repetitions (black arrows). Binding the resolvase dimers to each res leads to the formation of the synaptic complex, the synaptosome, in which the DNA strand breaks are catalyzed (indicated by open arrowheads). Both synapse formation and DNA strand exchange require negative superhelical tension on the DNA substrate.
- FIG. 2A shows a schematic illustration of the ⁇ -resolvase expression vectors
- FIG. 2B shows a schematic illustration of the substrate vector and the product vector resulting from the recombination.
- A A schematic representation of the eukaryotic expression vectors for the wild-type ⁇ resolvase (pPGK ⁇ ) and their mutants ⁇ E102Y ' E124Q (pPGK ⁇ l02) and ⁇ EI24Q (pPGK ⁇ l24) is shown. The position and nature of the respective mutation in the resolvase gene is marked.
- the wild type and the two mutants, ⁇ E102Y ' E124Q and ⁇ E124Q each have a version with and without a nuclear localization sequence (NLS) at the C-terminal end of the gene.
- the genes are expressed by the phosphoglycerate kinase promoter (P-PGK). This promoter is active in all eukaryotic cells examined to date.
- P-PGK phosphoglycerate kinase promoter
- coli it contains the early SV40 promoter, which consists of res in front of the recombination cassette, the gene for neomycin (neo) resistance, res and the lacZ gene which codes for the ⁇ -galactosidase.
- the location and respective orientation of the two PCR primers P-SV40 ceremonies and P-Seqanti are indicated by small arrows above and below the vector.
- the recombination between the two res leads to the deletion of the intermediate neo gene, the simultaneous loss of a res copy and the expression of the lacZ gene.
- the vector resulting from the recombination is called pCH-RZ.
- the relevant interfaces in both vectors for the restriction enzyme BamHI are additionally marked.
- Figure 3 shows a schematic representation of a Western analysis.
- FIG. 4 shows a representation of the quantitative evaluation of transient co-transfection
- Lipofection introduced into CHO cells.
- the enzymatic activity of the ⁇ -galactosidase was determined photometrically after 72 hours in cell lysates, normalized to the protein content of the lysates and statistically evaluated.
- a bar chart is shown with the respective
- FIG. 5 shows a schematic representation of the detection of the deletion in reporter cell line H5 by PCR and subsequent Southern hybridization after separation of the DNA molecules in agarose gels (1.2% w / v).
- a Southern analysis of the PCR products achieved by the respective expression vectors is shown.
- the term unrec. or rec. indicate the position of the PCR products in the gel that result from the non-recombined (pCH-RNRZ) or recombined vector (pCH-RZ).
- FIG. 6 A shows a representation of the quantitative evaluation of the influence of the topoisomerase inhibitor camptothecin on the recombination with wild-type ⁇ resolvase.
- transposon denotes a mobile genetic element that comprises at least one recombination sequence, a transposase and a resolvase and is derived from bacteria.
- FIG. 7 shows a representation of the quantitative evaluation of transient co-transfection experiments in CHO cells with substrate vectors linearized in vitro.
- a bar chart is shown with the respective standard deviations from the mean.
- the expression vectors for Cre and ⁇ -resolvase E102 ⁇ ' EI24Q were introduced separately with the substrate vector pCH-RLNRLZ, a derivative of pCH-RNRZ, which additionally contains two loxP sequences for recombination by Cre as direct repeats, by lipofection in CHO cells. Before lipofection, pCH-RLNRLZ was linearized with the restriction enzyme XmnI, which cuts only once in the entire vector, and then checked in an agarose gel electrophoresis.
- the enzymatic activity of the ⁇ -galactosidase was determined photometrically after 72 hours in cell lysates, normalized to the protein content of the lysates and statistically evaluated.
- the substrate plasmid was co-transfected with an expression vector for the lambda integrase (pPGKssInth) (bars 3 and 6, from left).
- the pCH-RLNRLZ (pCH-RLZ) vector recombined in E. coli acted as a positive control, co-transfected with the respective expression vector for Cre (pPGKCre) or ⁇ -resolvase E102Y ' E124Q (pPGK ⁇ l02NLS) (bars 1 and 4).
- resolvase refers to an enzyme encoded by a transposon that catalyzes the resolution of the co-integrate structure of the transposon by sequence-specific recombination as well as its derivatives, e.g. mutant resolvases.
- derivatives used here denotes nucleic acid or amino acid sequences which have one or more deletions, substitutions, additions, insertions and / or inversions.
- the term “derivatives” denotes a 3'- and / or 5'-shortened form of the sequence shown in SEQ ID NO: 1 or 2, minor mutations (base exchange) of the res sequence according to SEQ ID NO: 1 or 2 and insertions, additions or deletions of SEQ ID NO: 1 or 2, all of these modifications having a comparable activity with the Have initial res sequences. Accordingly, the term “derivatives” also refers to the
- Nucleic acids that have one or more of the listed mutations and encode a polypeptide with resolvase activity also designates polypeptides with one or more of the modifications listed, the polypeptides having resolvase activity.
- basic amino acid used here denotes amino acid residues with a positively charged side chain, e.g. Lysine, arginine and histidine.
- acidic amino acid refers to amino acid residues with a negatively charged side chain, e.g. Aspartic acid and glutamic acid.
- transformation means any introduction of a nucleic acid sequence into a cell.
- the insertion can e.g. be a transfection or lipofection by the calcium phosphate method, electroshock method or an oocyte injection.
- One aspect of the present invention relates to a method for sequence-specific recombination of DNA in eukaryotic cells, comprising the simultaneous or sequential introduction into a cell of two copies of a first DNA sequence comprising a res sequence, and performing the sequence-specific recombination by the action of a resolvase.
- a method is preferred in which a copy of the first DNA sequence is introduced in a direct orientation on the same DNA molecule as the other copy.
- a method is particularly preferred, the first DNA sequence comprising a res sequence according to SEQ ID NO: 1 or SEQ ID NO: 2.
- the first DNA sequence can comprise, in addition to the recombination sequence, further DNA sequences which permit integration into a desired target location in the genome of the eukaryotic cell.
- This integration takes place via homologous recombination, which is mediated by internal recombination mechanisms.
- the other DNA sequences must be homologous to the target DNA and both 3 ' and 5 ' of the two res sequences present as direct repeats must be located.
- the person skilled in the art knows how high the degree of homology and how long the respective 3 'and 5' sequences must be in order for the homologous recombination to take place with a sufficient probability; see. Review article by Capecchi, M. (1989) Science, 244, pp. 1288th
- the method according to the invention can be used, for example, to delete the DNA segment lying between the directly oriented recombination sequences in eukaryotic cells during an intramolecular recombination.
- the recombination sequences are directly oriented if the sequences are inserted in the 5 '-3' direction.
- the recombination sequences for example res with the binding sites I, ⁇ and ⁇ i (SEQ FD NO: 1) or res with the binding site I (SEQ ID NO: 2), each via homologous recombination into an intron sequence 5 'and 3' of an exon the same DNA molecule and the recombination by the action of the resolvase, for example the ⁇ -resolvase EI24Q or ⁇ -resolvase E102Y ' E124Q ; the exon is deleted.
- the polypeptide encoded by the corresponding gene can lose its activity or function or the transcription can be stopped by the deletion, so that no (complete) transcript is produced.
- the resolvase or its derivative can carry a nuclear localization sequence at the C-terminal end, which ensures better intracellular transport of the recombinase into the cell nucleus.
- the method according to the invention can be used to invert the DNA segment lying between the non-directly oriented recombination sequences in eukaryotic cells during an intramolecular recombination.
- the recombination sequences res with the binding site I must be placed in the opposite orientation on the same DNA molecule.
- the method according to the invention can also be used to carry out intermolecular recombination in eukaryotic cells. To do this, the
- Recombination sequences res with the binding site I are placed on two different DNA molecules regardless of the orientation. The recombination then leads to a fusion of the two DNA molecules at the binding sites I.
- Recombination sequences act.
- the resolvase or the resolvase gene can already be present in the eukaryotic cell before the introduction of the first DNA sequence comprising a res sequence and / or the copy of the first DNA sequence or after the introduction of the first DNA sequence and / or of the copy of the first DNA sequence.
- the resolvase used for the sequence-specific recombination is preferably expressed in the cell in which it carries out the reaction.
- a second DNA sequence comprising a resolvase gene, is introduced into the cells.
- Nucleic acids which encode modified ⁇ resolvases are preferably used, the resolvases preferably being modified in such a way that they are in the segment of amino acids 80-140, preferably 90-110, based on the wild type presolvase numbering shown in SEQ ID NO: 4 have at least one, preferably at least two, of the following mutations: (i) an acidic amino acid residue is replaced by an aromatic, hydrophilic or basic amino acid residue, (ii) a neutral one Amino acid residue is replaced by a hydrophilic amino acid residue, and (iii) a hydrophilic amino acid residue is replaced by a neutral or acidic amino acid residue.
- nucleic acids encode modified ⁇ resolvases, in which Glu is replaced by Gin or Tyr, Asp by Ser, Ser by Asp, Gly by Ser, Asp by Ala and / or Glu by Arg.
- particularly preferred resolvase genes are listed in SEQ ID NO: 3, 5 and 7 and also include their derivatives.
- ⁇ resolvase genes whose encoded polypeptides have two mutations, in particular the resolvase gene according to SEQ ID NO: 5, are very particularly preferred because of their higher efficiency compared to the single mutants.
- a method is particularly preferred in which the second DNA sequence is integrated into the eukaryotic genome of the cell via homologous recombination or randomly. Also preferred is a method in which the second DNA sequence comprises regulatory DNA sequences which bring about a spatial and / or temporal expression of the resolvase gene.
- Spatial expression in this case means e.g. that the recombinase only in a certain cell type, e.g. Liver cells, kidney cells, nerve cells or cells of the immune system can be expressed through the use of cell type-specific promoters and only in these cells catalyzes the recombination.
- a temporal expression in the regulation of resolvase expression can be achieved by promoters which are active in the adult organism from or at a specific development stage or at a specific time.
- the spatial and / or temporal expression can be determined by using inducible promoters, e.g. can be achieved by interferon- or tetracycline-dependent promoters; see. Review article by Müller, U. (1999) Mech. Develop.
- the resolvase used in the method according to the invention can be both the wild-type resolvase and a modified resolvase.
- the use of a modified resolvase is preferred.
- the resolvases preferably used in the method according to the invention comprise the amino acid sequences listed in SEQ ED NO: 4, 6 and 8.
- the modified resolvase is modified such that it does the recombination reaction without (-) DNA supercoiling, ie on relaxed substrate molecules, preferably on relaxed linear substrate molecules.
- the preparation of modified polypeptides and the screening for the desired activity are state of the art and easy to carry out; see. Erlich, H. (1989) PCR Technology. Stockton Press.
- Modified resol vases are particularly preferred, the resol vases preferably being modified in such a way that they have at least one, preferably at least two, in the segment of amino acids 80-140, preferably 90-110, based on the wild type presolvase numbering shown in SEQ ID NO: 4.
- Modified ⁇ resol vases are particularly preferred, in which Glu by Gin or Tyr, Asp by Ser, Ser by Asp, Gly by Ser, Asp by Ala and or Glu by Arg in the segment.
- ⁇ -resolvase E124Q contains a glutamine residue instead of a glutamate residue at position 124.
- ⁇ -resolvase E102 ' E124Q contains, in addition to the exchange of mutant 124, a tyrosine residue instead of the glutamate residue at position 102 compared to wild-type ⁇ - resolvase.
- Both ⁇ resolvase mutants were produced via PCR mutagenesis of the ⁇ resolvase gene. These mutants can perform recombination between two directly repeated, complete res sequences without the cofactor (-) supercoiling.
- the method according to the invention can be carried out in all eukaryotic cells.
- the cells can be present, for example, in a cell culture and can include all types of plant or animal cells, for example vertebrates such as fish, frogs or mammals, or invertebrates such as worms or insects, for example flies.
- the cells can be oocytes, embryonic stem cells, hematopoietic stem cells or any type of differentiated cells.
- a method is preferred in which the eukaryotic cell is a non-mammalian cell, for example a zebrafish, Caenorhabditis elegans or Drosophila melanogaster cell.
- the eukaryotic cell is a mammalian cell, for example a human cell or a non-human cell, for example a monkey, mouse, rat, rabbit, hamster, goat, cow, sheep or pig cell .
- the method according to the invention thus relates likewise eukaryotic cells, comprising res according to SEQ ID NO: 1 or 2 in at least one and preferably two copies and / or the resol vas gene according to SEQ FD NO: 3, 5 or 7 or the polypeptides encoded by the genes or their respective derivatives.
- the invention relates to the use of a res sequence according to SEQ FD NO: 1 or SEQ ID NO: 2 in a sequence-specific recombination of DNA in eukaryotic cells.
- the eukaryotic cell can also be in the cell assembly of a plant or animal organism, for example of vertebrates such as fish, frogs or non-human mammals or (if it is permissible in the patenting requirements of the respective patent system) in the form of a human organism, or invertebrates such as worms or insects, eg flies, which do not contain a resolvase.
- the invention thus also relates to the use of a resolvase or a resolvase gene in a sequence-specific recombination in eukaryotic cells.
- the invention relates to the use of the resolvase gene according to SEQ ID NO: 3, the resolvase E102Y ' E124Q according to SEQ FD NO: 5 and the resolvase E124Q according to SEQ ID NO: 7.
- the invention also relates to transgenic organisms such as plants or animals, e.g. Vertebrates such as fish, frogs or mammals, or invertebrates such as worms or insects, e.g. To fly.
- the invention preferably relates to transgenic non-mammalian organisms such as zebrafish, Caenorhabditis elegans or Drosophila melanogaster and transgenic mammalian organisms such as transgenic monkeys, mice, rats, rabbits, hamsters, goats, cows, sheep or pigs, the res according to SEQ ED NO: 1 or SEQ ID NO: 2 in one or two copies and / or the resolvase gene according to SEQ ID NO: 3, 5 or 7 or their derivatives integrated in their cells.
- the method according to the invention can also be used for testing topoisomerase inhibitors in a eukaryotic cell, comprising a) introducing into a cell a first DNA sequence according to SEQ ED NO: 1, b) introducing into a cell a copy of the first DNA sequence according to SEQ ED NO: 1 in direct orientation, and c) the introduction of a wild-type resolvase, and d) addition of the topoisomerase inhibitors to be tested.
- the eukaryotic cells can be used in culture (ex vivo) or in the organism (in vivo) for the method according to the invention.
- the method in the organism is preferred here, since the cell- and tissue-specific physiological influences on the possible degradation or modification of the topoisomerase inhibitors and the resulting effects can be tested with regard to their effectiveness.
- the topoisomerase inhibitors can act on the cells before or after the expression of the resolvase, which leads to the activation of the recombination and is easy to detect, for example, via enzymes or marker proteins.
- the efficiency of the respective substances with regard to their inhibitory effect on topoisomerases correlates with the activation of the recombination.
- a spatial and or temporal activation of the recombination can be achieved by regulating the resolvase expression.
- a spatial and / or temporal activation can also be achieved by regulating the action of topoisomerase inhibitors with constitutive expression of the wild-type resolvase.
- a method is preferred, wherein a second DNA sequence comprising a wild-type resolvase gene is additionally introduced into the cell.
- a method in which the wild-type resolvase is a wild-type ⁇ -resolvase is particularly preferred.
- the invention further relates to a eukaryotic cell comprising two DNA sequences according to SEQ ID NO: 1.
- a eukaryotic cell is preferred which also contains a wild-type resolvase gene, in particular a wild-type ⁇ resolvase.
- the invention further relates to a transgenic organism such as plants or animals, for example vertebrates such as fish, frogs or mammals, or invertebrates such as worms or insects, for example flies.
- the invention preferably relates to transgenic non-mammalian organisms such as zebrafish, Caenorhabditis elegans or Drosophila melanogaster and transgenic mammalian organisms such as transgenic monkeys, mice, rats, rabbits, hamsters, goats, cows, sheep or pigs which have two copies of res according to SEQ ED NO: l in direct orientation and have a resol vas gene, in particular a ⁇ resol vas gene according to SEQ ED NO: 3, integrated in their cells.
- transgenic non-mammalian organisms such as zebrafish, Caenorhabditis elegans or Drosophila melanogaster
- transgenic mammalian organisms such as transgenic monkeys, mice, rats, rabbits, hamsters, goats, cows, sheep or pigs which have two copies of res according to SEQ ED NO: l in direct orientation and have a resol vas gene,
- the eukaryotic expression vectors for ⁇ -resolvase (pPGK ⁇ / pPGK ⁇ NLS ) and for the ⁇ ⁇ -resolvase mutants ⁇ E124Q (pPGK ⁇ l24 / pPGK ⁇ l24NLS) and ⁇ E102Y ' E124FDKKNK2 (pPGGKLD) GmbH (pPGGKLD) GmbH ).
- the vector contains the phosphoglycerate kinase promoter (P-PGK) and the polyadenylation signal sequences from the small Simian Virus 40 (SV40) tumor antigen.
- P-PGK phosphoglycerate kinase promoter
- SV40 small Simian Virus 40
- P- ⁇ A 5 'GATACTGCAGCATGCGACTTTTTGGTTACGCACGGGTATCA 3 '
- P- ⁇ B 5 ' GATATCTAGATT AGTTGCTTTC ATTTATT ACTTT AT A 3 '
- P- ⁇ l24Q 5 'CGACAGAGAATACTACAGCGTACCAATGAA 3'
- P- ⁇ l24Qanti 5 'TTCATTGGTACGCTGTAGTATTCTCTGTCG 3'
- P- ⁇ l02Y 5 'AGTACCGATGGGTATATGGGTAAAATGGTT 3'
- P- ⁇ l02Yanti 5 'AACCATTTTACCCATATACCCATCGGTACT 3'
- the wild-type resolvase gene without or with a nuclear localization sequence (NLS) was amplified with the primers P- ⁇ A and P- ⁇ B, or P2972 after a first denaturation step at 94 ° C. (5 min.) With 28 cycles of denaturation ( 95 ° C, 30sec), primer binding (56 ° C, 30sec.) And DNA synthesis (72 ° C, 45sec), followed by a final synthesis step (72 ° C, 4min.).
- the resulting PCR fragment, restricted with PstI and Xbal replaces the Cre gene excised with the same enzymes in pPGKcrebpa.
- the resolvase mutants were produced by assembly PCR.
- the two ⁇ resolvase gene fragments were amplified in two separate PCR batches with the primers P- ⁇ A and P- ⁇ 124Qanti or P- ⁇ l24Q and P- ⁇ B contain the desired mutation, which were then used in the second step of the assembly PCR in equimolar amounts as a template for the following third PCR with the primers P- ⁇ A and P- ⁇ B.
- the amplifications took place after a first denaturation step at 94 ° C (5 min.) With 30 cycles of denaturation (94 ° C; 45sec), Primer binding (60 ° C; 45sec.) And DNA synthesis (72 ° C; 45sec), as well as a final synthesis step (72 ° C; 6min).
- the second mutation E102Y was introduced into the gene with the oligonucleotides P- ⁇ A, P- ⁇ l02Y, P- ⁇ l02Yanti and P- ⁇ B. The mutants were then PCR-primed P- ⁇ A and P2972 under the same reaction conditions with an NLS at the C-terminus of the protein.
- the substrate vectors are derivatives of pCHHO (Pharmacia).
- the recombination cassettes are under the control of the SV40 promoter, which guarantees a strong constitutive expression.
- the plasmid also has the polyadenylation signal sequences of the SV40 tumor antigen.
- the ⁇ -galactosidase gene (lacZ) contained in the starting vector together with the prokaryotic promoter was first cut out with Hindin and BamHI in order to reinsert it after PCR amplification with the primers P-lacZl and P-lacZantil without a prokaryotic promoter.
- a first denaturation step (94 ° C; 5 min.) was carried out, followed by 30 cycles of denaturation (94 ° C; 1 min.), Primer binding (56 ° C; 1 min.) And DNA synthesis (72 ° C; 4 min.). ) and a final synthesis step (72 ° C; 10min.).
- neomycin resistance gene was then cut out of the vector pSV2Neo (Southern, PJ, Berg, P. (1982) J. Mol. Appl. Genet. 1, pp.327) with the restriction enzymes Smal and BglEt and with ⁇ - Resolvase recognition sequences flanked. These recombination sequences (res) are arranged in the construct in the same orientation.
- the res was amplified with the primers P-RES1 and P-RESantil or P-RESanti2. It started with a first denaturation step (94 ° C; 5min.) And 30 cycles of denaturation (94 ° C; 30sec), primer binding (56 ° C; 30sec.) And DNA synthesis (72 ° C; 30 sec). A final synthesis step followed (72 ° C; 4min.).
- the res located at the 5 ' terminus of the neomycing gene was ligated to the neomycin gene via Bgi ⁇ , the second res was connected to the 3' end of the gene by a blunt-end ligation.
- P-lacZanti 1 5 'GAT AGG ATCC AG AC ATGAT AAGAT A 3'
- P-RES 1 5 ' GATAAAGCTTGGGCCCAAAAAGTCGCATAAAAATGTATCC 3 '
- P-RESantil 5 'GATAAGATCTAACAATTTTGCAACCGTCCGA 3'
- P-RESanti2 5 'GATAAAGCTTAACAATTTTGCAACCGTCCGA 3'
- the plasmid pCH-RNRZ was recombined in vivo in E. coli strain DH5 ⁇ cells (Hanahan, D. (1983) J. Mol. Biol., 166, pp. 557). This bacterial strain is distinguished by the fact that it carries an F'-plasmid which codes for wild-type ⁇ resolvase. The resulting recombined plasmid pCH-RZ was used as a positive control in the further experiments.
- the plasmid pCH-RLNRLZ is a derivative of pCH-RNRZ and was generated via PCR with the following oligonucleotides:
- Plasmid pCH-RNRZ (100ng) was used as a template for the PCR with these two oligonucleotides.
- the PCR conditions correspond exactly to those under 1.2. (Substrate vectors) mentioned in the first paragraph.
- the PCR fragment was isolated by agaraose gel electrophoresis, restricted with the restriction enzymes Hind Eil and Bgl II and in the pCH-RNRZ vector residue cut with Hind III / Bgl II (pCH-RNRZ without the Neo gene and the second (3 ') res sequence). This gives the resloxneoreslox (RLNRL) recombination cassette between the SV40 promoter and the lacZ gene.
- the plasmid pCH-RLZ was generated by in vivo recombination as described for pCH-RZ.
- Expression plasmid DNAs and pCH-RZ were isolated from E. coli strain DH5 ⁇ by means of affinity chromatography (Qiagen, Germany).
- Substrate plasmid pCH-RNRZ was isolated from E. coli strain JC5547 (Willets, NS, Clark, AJ (1969) J. Bacteriol., 100, pp. 231).
- the sequence control of all expression and substrate vectors, as well as all PCR-generated products, was carried out using the fluorescence-based 373A DNA sequencing system (Applied Biosystems). PCR reactions were carried out using the "Master Mix Q - Kit" (Quiagen, Germany). All DNAs were analyzed by agarose gel electrophoresis (0.8% - 1.5% w / v) in TBE buffer.
- the transient expression and recombination analyzes were carried out with an ovary hamster cell line CHO (Puck, TT (1958) J. Exp. Med., 108, pp. 945) and a human epithelial cervical carcinoma cell line HeLa (Geye, GO, et al. ( 1952) Cancer Res., 12, pp. 264).
- HeLa cells were cultivated in ⁇ -MEM (Life Technologies, Inc.), which was enriched with 10% fetal calf semen and contains streptomycin (0.1 mg / ml), penicillin (100 units / ml) and sodium pyruvate (ImM) , CHO cells were cultured in DMEM with the same additives, without sodium pyruvate.
- HeLa reporter cell lines which stably integrated pCH-RNRZ into the genome were determined as follows: approx. 20 ⁇ g of the plasmid DNA were linearized with BamHI, purified by phenol / chloroform extractions, precipitated with ethanol and in approx. 5 ⁇ 10 6 cells of a lipofect (30 ⁇ l Fugene TM 6, Boehringer Mannheim) transfected. Stable cell lines were selected with 500 ⁇ g / ml G418 / Geneticin (Life Technologies) and then characterized by PCR, DNA sequencing and Southern analysis.
- the ⁇ -gal staining was carried out after fixation of the cells with 0.5% glutaraldehyde by adding the staining solution (5mM K 4 Fe (Cn 6 ) x3H 2 O, 5mM K 3 Fe (Cn 6 ), 2mM MgCl 2 , 4mg ml X-Gal in PBS) and subsequent incubation for 7-8h at 37 ° C Colored cells were determined microscopically.
- the ß-Gal assay was carried out using the "Galacto Light Kit” (Tropix, Perkin bucket) according to the manufacturer, carried out with quantities reduced to 33%. Relative light units (RLUs) were measured in the Lumat LB9501 luminometer (Berthold, Germany) and normalized to RLU / ⁇ g protein in the cell lysate.
- lxlO 5 cells were first sown in 3.5 cm plates, and transfected with 2 ⁇ g expression vector (pPGK ⁇ NLS).
- pPGK ⁇ NLS 2 ⁇ g expression vector
- the cells were cultivated for 72 hours before the addition of the topoisomerase inhibitor camptothecin (50 ⁇ g / ml).
- camptothecin 50 ⁇ g / ml.
- a co-transfection of pCH-RNRZ and expression vector in a ratio of 1: 1 was carried out.
- a further 72 hours later, a ⁇ -gal staining was carried out as described above.
- the recombination analysis in the stable HeLa cell lines (H5) was carried out directly at the DNA level.
- 5x10 6 cells were sown in 10 cm plates and, after 24 hours, transfected with 14 ⁇ g circular expression vector and 21 ⁇ l Fugene TM 6. After 72 hours, the cells were harvested to determine the genomic DNA via affinity chromatography (QIAamp Blood Kit; Qiagen,
- genomic DNA About 100-400ng of the genomic DNA were amplified by PCR in order to detect the deletion of the neomycin resistance gene and a complete res caused by resolution.
- P-SV40 tenu2 5 'ATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCAT 3 '
- the amplification was carried out after an initial denaturation at 94 ° C (5 min.) With 34 cycles of denaturation (94 ° C, 1 min.), Primer binding (63 ° C, 1 min.) And DNA synthesis (72 ° C, 2 min.) , followed by a final synthesis step for 4 min at 72 ° C.
- the amplified PCR products were separated by agarose gel electrophoresis, the recombination product was eluted (QIAquick Gel Extraction Kit, Qiagen, Germany) and then sequenced.
- the PCR products were transferred to a nylon membrane by means of Southern hybridization, and hybridized with the recombined PCR product as 32 P-dATP and 32 P-dCTP (Amersham) radiolabelled probe.
- Another PCR with the primers P-SV eol and P-SVNeo2 served as Evidence of a possible inversion product.
- Cell lysates from transiently transfected cells were prepared by boiling (15 min.) The cells in sample buffer (New England Biolabs). The proteins were separated by molecular weight in a 12.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (Immobilon P, Millipore) overnight. The membrane was treated with 1% blocking solution (BM Chemiluminescence Western Blotting Kit; Boehringer Mannheim, Germany) and incubated with polyclonal mouse antibodies against ⁇ -resolvase at a dilution of 1: 3000 (antibodies from N. Grindley, USA).
- sample buffer New England Biolabs
- the proteins were separated by molecular weight in a 12.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (Immobilon P, Millipore) overnight.
- the membrane was treated with 1% blocking solution (BM Chemiluminescence Western Blotting Kit; Boehringer Mannheim, Germany) and incubated with polyclonal mouse antibodies against ⁇ -
- the position of the resolvase on the membrane was made visible with the peroxidase-coupled secondary antibodies (BM Chemiluminescence Western Blotting Kit; Boehringer Mannnheim, Germany). Purified ⁇ resolvase acted as a control.
- the kD marker (Broad rank marker, New England Biolabs) was used to compare the sizes.
- ⁇ -resolvase or one of the mutants can catalyze recombination in eukaryotic cells.
- the eukaryotic expression vectors, pPGK ⁇ and their derivatives which contain the resolvase gene or the genes for the derivatives under the control of the PGK promoter, were used.
- cell lysates were prepared 72 hours later and examined by Western analysis.
- the recombinase was detected by means of mouse polyclonal antibodies directed against wild-type ⁇ resolvase.
- pPGKCre which expresses the Cre recombinase of the phage P1, was introduced into the cells.
- the Westem analysis shows that, based on the respective expression vectors, the resolvase protein or its respective derivatives are synthesized in CHO cells.
- the expression vectors were in each case transiently introduced together with the recombination substrate pCH-RNRZ.
- the recombination leads to the deletion of the DNA segment in front of the ⁇ -galactosidase gene, which can then be expressed by the SV40 promoter. Successful recombination events can therefore be detected by an enzyme activity determination.
- a human reporter cell line (H5) was determined. This cell line contains a copy of the substrate vector (pCH-RNRZ) randomly integrated into the genome by non-homologous recombination. This was demonstrated in advance using a Southern analysis. Approximately 72 hours after the introduction of the respective expression vectors into the cell line H5, genomic DNA was isolated and an attempt was made to detect the recombination via PCR with the primers P-SV40gar and P-CHSeqanti and subsequent Southern analysis.
- the PCR product that is obtained with unrecombined substrate is longer than that after the deletion of the neo gene Recombination occurred, and thus both products can be separated from each other in an agarose gel electrophoresis.
- the results show that recombination in the presence of the two
- Resolve mutants ⁇ E124Q and ⁇ E102Y * E124Q have taken place and that - presumably very low - activity can also be measured with wild-type ⁇ resolvase (without NLS).
- the expression vector pPGK ⁇ was first introduced alone in HeLa cells by lipofection. Approximately 72 hours later the cells were treated with CPT and after a further 3 hours the expression vector together with the substrate pCH-RNRZ was introduced into the cells pretreated in this way, again by lipofection. After a further 72 hours, the cells were stained by treatment with X-Gal. A blue staining of the cells shows that the enzyme ⁇ -galactosidase is expressed in the cells, which in turn suggests successful recombination events.
- CPT topoisomerase inhibitor camptothecin
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2001540261A JP2003533176A (ja) | 1999-11-24 | 2000-11-24 | リゾルバーゼが触媒する、真核細胞におけるdnaの配列特異的組換え |
EP00977566A EP1240316A2 (de) | 1999-11-24 | 2000-11-24 | Resolvase-katalysierte, sequenz-spezifische dna-rekombination in eukaryotischen zellen |
AU18239/01A AU1823901A (en) | 1999-11-24 | 2000-11-24 | Resolvase-catalysed, sequence-specific dna-recombination in eukaryotic cells |
CA002394827A CA2394827A1 (en) | 1999-11-24 | 2000-11-24 | Resolvase-catalysed, sequence-specific dna-recombination in eukaryotic cells |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19956513.9 | 1999-11-24 | ||
DE1999156513 DE19956513A1 (de) | 1999-11-24 | 1999-11-24 | Resolvase-katalysierte, Sequenz-spezifische DNA-Rekombination in eukaryotischen Zellen |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2001038511A2 true WO2001038511A2 (de) | 2001-05-31 |
WO2001038511A3 WO2001038511A3 (de) | 2002-05-10 |
WO2001038511A8 WO2001038511A8 (de) | 2002-05-30 |
Family
ID=7930159
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2000/011718 WO2001038511A2 (de) | 1999-11-24 | 2000-11-24 | Resolvase-katalysierte, sequenz-spezifische dna-rekombination in eukaryotischen zellen |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1240316A2 (de) |
JP (1) | JP2003533176A (de) |
AU (1) | AU1823901A (de) |
CA (1) | CA2394827A1 (de) |
DE (1) | DE19956513A1 (de) |
WO (1) | WO2001038511A2 (de) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2013018096A1 (en) | 2011-08-03 | 2013-02-07 | Ramot At Tel-Aviv University Ltd. | Use of integrase for targeted gene expression |
-
1999
- 1999-11-24 DE DE1999156513 patent/DE19956513A1/de not_active Ceased
-
2000
- 2000-11-24 AU AU18239/01A patent/AU1823901A/en not_active Abandoned
- 2000-11-24 JP JP2001540261A patent/JP2003533176A/ja active Pending
- 2000-11-24 EP EP00977566A patent/EP1240316A2/de not_active Withdrawn
- 2000-11-24 WO PCT/EP2000/011718 patent/WO2001038511A2/de not_active Application Discontinuation
- 2000-11-24 CA CA002394827A patent/CA2394827A1/en not_active Abandoned
Non-Patent Citations (11)
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2013018096A1 (en) | 2011-08-03 | 2013-02-07 | Ramot At Tel-Aviv University Ltd. | Use of integrase for targeted gene expression |
US9816077B2 (en) | 2011-08-03 | 2017-11-14 | Ramot At Tel-Aviv University Ltd. | Use of integrase for targeted gene expression |
Also Published As
Publication number | Publication date |
---|---|
WO2001038511A3 (de) | 2002-05-10 |
WO2001038511A8 (de) | 2002-05-30 |
CA2394827A1 (en) | 2001-05-31 |
JP2003533176A (ja) | 2003-11-11 |
AU1823901A (en) | 2001-06-04 |
EP1240316A2 (de) | 2002-09-18 |
DE19956513A1 (de) | 2001-06-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1681355B1 (de) | Sequenz-spezifische DNA-Rekombination in eukaryotischen Zellen | |
DE69034238T2 (de) | Verfahren zur Erreichung einer Expression, oder zur Verbesserung der Expression eines Gens | |
EP1276889B1 (de) | Sleeping beauty, ein transposonvektor mit breitem wirtsbereich für die genetische transformation bei wirbeltieren | |
DE60221801T3 (de) | Cpg-freie synthetische gene und bakterielle plasmide | |
DE69433034T2 (de) | Expression von heterologen genen nach einem ziel-expressionsprofil | |
US20020166138A1 (en) | FLP-mediated gene modification in mammalian cells, and compositions and cells useful therefor | |
MX2007014139A (es) | Piggybac como una herramienta para manipulacion genetica y analisis en vertebrados. | |
US20060205077A1 (en) | Targeted transgenesis using the rosa26 locus | |
DE60036297T2 (de) | Bedingtes 'gene trapping'-konstrukt zur unterbrechung von genen | |
EP0957165A2 (de) | Optimierung von Zellen für die endogene Genaktivierung | |
JP7418796B2 (ja) | 細胞株の開発のための相同組換えベクターの高速生成のためのdnaプラスミド | |
DE60113159T2 (de) | Modifizierte rekombinase | |
Zhang et al. | Establishment of a Cre-rat resource for creating conditional and physiological relevant models of human diseases | |
DE69836641T2 (de) | Verwendung einer prokaryotischen beta-Rekombinase in eukaryotischen Zellen für transgene Arbeit | |
DE69534022T2 (de) | Genomische DNS Fragmente der regulierenden Sequenz der Beta 2 Untereinheit des neuronalen Nikotin-Acetycholin Rezeptors; damit transformierte transgene Tiere. | |
DE69734143T2 (de) | Neue methoden zur charakterisierung von verbindungen, welche die stf-1 expression in inselzellen der bauchspeicheldrüse stimuliert | |
WO2001038511A2 (de) | Resolvase-katalysierte, sequenz-spezifische dna-rekombination in eukaryotischen zellen | |
EP0902092A2 (de) | Verfahren zur Identifizierung von Zielgenen von Transkriptionsfaktoren | |
AT500838B1 (de) | Multiple hse | |
WO2008155306A1 (de) | Nukleinsäurekonstrukte zur inaktivierung und konditionalen mutagenese von genen | |
EP0386766A1 (de) | Verfahren zur gezielten Veränderung eines Gens | |
DE60225046T2 (de) | Produktion eukaryontischer proteine und nukleinsäuremoleküle in c. elegans | |
KR20080041146A (ko) | 척추동물에서의 유전자 조작 및 분석을 위한 도구로서의피기백 | |
WO2003070931A2 (de) | Verfahren zur ortsspezifischen dna-rekombination | |
DE19831312A1 (de) | Nicht-menschliche transgene Säuger, die durch Rekombinase-aktivierte Expression eines Zelltod-induzierenden Gens eine kontrollierte Zellablation in vivo ermöglichen, sowie Verfahren zur Herstellung dieser Säuger |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU CA CN CZ HU ID IL IN JP KR NO PL RU SG SI SK US ZA |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2394827 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 540261 Kind code of ref document: A Format of ref document f/p: F |
|
AK | Designated states |
Kind code of ref document: C1 Designated state(s): AU CA CN CZ HU ID IL IN JP KR NO PL RU SG SI SK US ZA |
|
AL | Designated countries for regional patents |
Kind code of ref document: C1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
WR | Later publication of a revised version of an international search report | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2000977566 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000977566 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000977566 Country of ref document: EP |