WO2001012810A1 - Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation - Google Patents

Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation Download PDF

Info

Publication number
WO2001012810A1
WO2001012810A1 PCT/US2000/020432 US0020432W WO0112810A1 WO 2001012810 A1 WO2001012810 A1 WO 2001012810A1 US 0020432 W US0020432 W US 0020432W WO 0112810 A1 WO0112810 A1 WO 0112810A1
Authority
WO
WIPO (PCT)
Prior art keywords
cntf
rhcntf
mammal
mice
neurotrophic factor
Prior art date
Application number
PCT/US2000/020432
Other languages
English (en)
Inventor
Stanley J. Wiegand
Mark W. Sleeman
Philip D. Lambert
Original Assignee
Regeneron Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/454,380 external-priority patent/US6680291B1/en
Application filed by Regeneron Pharmaceuticals, Inc. filed Critical Regeneron Pharmaceuticals, Inc.
Priority to CA002379940A priority Critical patent/CA2379940A1/fr
Priority to JP2001517694A priority patent/JP2003507393A/ja
Priority to IL14803300A priority patent/IL148033A0/xx
Priority to HU0203057A priority patent/HUP0203057A3/hu
Priority to EP00950767A priority patent/EP1200589A1/fr
Priority to BR0013204-7A priority patent/BR0013204A/pt
Priority to AU63822/00A priority patent/AU6382200A/en
Publication of WO2001012810A1 publication Critical patent/WO2001012810A1/fr
Priority to HK02107484.6A priority patent/HK1046018A1/zh

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to therapeutic CNTF-related polypeptides useful for the treatment of neurological or other diseases or disorders.
  • Ciliary neurotrophic factor is a protein that is required for the survival of embryonic chick ciliary ganglion neurons in vitro (Manthorpe et al.,1980, J. Neurochem. 34:69-75).
  • the ciliary ganglion is anatomically located within the orbital cavity, lying between the lateral rectus and the sheath of the optic nerve; it receives parasympathetic nerve fibers from the oculomotor nerve which innervates the ciliary muscle and sphincter pupillae.
  • CNTF Ciliary neurotrophic factor
  • CNTF is believed to induce the differentiation of bipotential glial progenitor cells in the perinatal rat optic nerve and brain (Hughes et al., 1988, Nature 335:70-73). Furthermore, it has been observed to promote the survival of embryonic chick dorsal root ganglion sensory neurons (Skaper and Varon, 1986, Brain Res. 389:39-46). In addition, CNTF supports the survival and differentiation of motor neurons, hippocampal neurons and presympathetic spinal cord neurons [Sendtner, et al., 1990, Nature 345: 440-441 ; Ip, et al. 1991 , J. Neurosci. 11:3124-31 34; Blottner, et al. 1989, Neurosci. Lett. 1 05:316-3201.
  • CNTF prevents both the denervation-induced atrophy (decreased wet weight and myofiber cross sectional area) of skeletal muscle and the reduced twitch and tetanic tensions of denervated skeletal muscle. Helgren et al., 1994, Cell Z6:493-504. In this model, human CNTF also produces an adverse effect that is manifested as a retardation of weight gain. This adverse effect has also been observed in clinical trials with rHCNTF for the treatment of ALS.
  • T.I. therapeutic index
  • CNTF has been cloned and synthesized in bacterial expression systems, as described by Masiakowski, et al., 1991 , J. Neurosci. 57:1003-1012 and in International Publication No. WO 91/04316, published on April 4, 1991 , which are incorporated by reference in their entirety herein.
  • CNTFR ⁇ The receptor for CNTF (termed “CNTFR ⁇ ”) has been cloned, sequenced and expressed [see Davis, et al., 1991 Science 253:59-63].
  • CNTF and the hemopoietic factor known as leukemia inhibitory factor (LIF) act on neuronal cells via a shared signaling pathway that involves the IL-6 signal transducing component gp130 as well as a second, ⁇ -component (know as LIFR ⁇ ); accordingly, the CNTF/CNTF receptor complex can initiate signal transduction in LIF responsive cells, or other cells which carry the gp130 and LIFR ⁇ components [Ip, et al.,1992, Cell 69: 1 1 21 -1 1 32].
  • recombinant human and rat CNTF differ in several respects.
  • the biological activity of recombinant rat CNTF in supporting survival and neurite outgrowth from embryonic chick ciliary neurons in culture is four times better than that of recombinant human CNTF [Masiakowski et al., 1991 , J. Neurochem. 57:1003-1012].
  • rat CNTF has a higher affinity for the human CNTF receptor than does human CNTF.
  • Mutagenesis by genetic engineering has been used extensively in order to elucidate the structural organization of functional domains of recombinant proteins.
  • Several different approaches have been described in the literature for carrying out deletion or substitution mutagenesis. The most successful appear to be alanine scanning mutagenesis [Cunningham and Wells 1989, Science 244: 1081-1085] and homolog-scanning mutagenesis [Cunningham et al., 1989, Science 243:1330-13361. These approaches helped identify the receptor binding domains of growth hormone and create hybrid proteins with altered binding properties to their cognate receptors.
  • Huntington's disease is an hereditary degenerative disorder of the central nervous system.
  • the pathology underlying HD is progressive, relentless degeneration of the basal ganglia, structures deep inside the brain which are responsible for aspects of the integration of voluntary motor and cognitive activity.
  • the onset of symptoms in HD is generally in adulthood, between the ages of 20 and 40.
  • the characteristic manifestations of the disease are chorea and other involuntary movements, dementia, and psychiatric symptoms.
  • Choreic movements consist of brief, involuntary, fluid movements, predominantly affecting the distal extremities. Patients often tend to "cover up” these movements by blending them into voluntary acts. HD patients also, however, display a variety of other neurological abnormalities including dystonia (sustained, abnormal posturing), tics ("habit spasms"), ataxia (incoordination) and dysarthria (slurred speech).
  • the dementia of HD is characterized as the prototypical "subcortical" dementia. Manifestations of dementia in HD include slowness of mentation and difficulty in concentration and in sequencing tasks.
  • Behavioral disturbances in HD patients are varied, and can include personality changes such as apathy and withdrawal; agitation, impulsiveness, paranoia, depression, aggressive behavior, delusions, psychosis, etc.
  • personality changes such as apathy and withdrawal; agitation, impulsiveness, paranoia, depression, aggressive behavior, delusions, psychosis, etc.
  • the relentless motor, cognitive and behavioral decline results in social and functional incapacity and, ultimately death.
  • HD is inherited as an autosomal dominant trait. Its prevalence in the U.S. population is estimated to be 5 to 10 per 100,000 individuals, yielding a total prevalence of 25,000 in the US population. However, due to the late onset of symptoms, there are a number of "at-risk", asymptomatic individuals in the population as well. The prevalence of asymptomatic, at-risk patients carrying the HD gene is perhaps twice that of the symptomatic patients (W. Koroshetz and N. Wexler, personal communication). Thus, the total HD patient population eligible to receive a new therapy is about 75,000.
  • the gene currently believed to be responsible for the pathogenesis of HD is located at the telomeric end of the short arm of Chromosome 4. This gene codes for a structurally novel protein of unknown function, and the relationship of the gene product to the pathogenesis of HD remains uncertain at the present time.
  • the principal anatomical lesion in HD consists of loss of the so-called "medium spiny” neurons of the caudate nucleus and putamen (collectively known as the striatum in rodents). These neurons comprise the projection system whereby the caudate/putamen projects to its output nuclei elsewhere in the basal ganglia of the brain.
  • the principal neurotransmitter utilized by the medium spiny neurons is gamma-aminobutyric acid (GABA), although many also contain neuropeptides such as enkephalins and substance P.
  • GABA gamma-aminobutyric acid
  • the CNTF receptor complex contains 3 proteins: a specificity determining ⁇ component that directly binds to CNTF, as well as 2 signal transducing ⁇ components (LIFR ⁇ and gp130) that cannot bind CNTF on their own, but are required to initiate signaling in response to CNTF.
  • the ⁇ component of the CNTFR complex is more widely distributed throughout the body than the ⁇ component.
  • the 3 components of the CNTFR complex are normally unassociated on the cell surface; CNTF induces the stepwise assembly of a complete receptor complex by first binding to CNTFR ⁇ , then engaging gp130, and finally recruiting LIFR ⁇ .
  • JAK kinases non-receptor tyrosine kinases
  • STAT proteins dissociate from the receptor, dimerize, and translocate to the nucleus where they bind DNA and activate transcription
  • Axokine is a mutant CNTF molecule with improved physical and chemical properties, which retains the ability to interact with and activate the CNTF receptor. (Panayotatos, N., et al. (1993) J. Biol. Chem. 268: 19000- 19003).
  • Leptin the product of the ob gene, is secreted by adipocytes and functions as a peripheral signal to the brain to regulate food intake and energy metabolism (Zhang, Y., et al. (1994) Nature 372: 425-431 ).
  • leptin receptor a single membrane- spanning receptor has considerable sequence similarities to gp130 (Tartaglia, L, et al. (1995) Cell 83: 1263-1271 ), and like CNTF, leptin signals through the JAK/STAT pathway (Baumann, H., et al. (1996) Proc. Natl. Acad. Sci.
  • An object of the present invention is to provide novel CNTF- related neurotrophic factors for the treatment of diseases or disorders including, but not limited to, diabetes and obesity.
  • CNTF and related molecules are utilized for the treatment of non-insulin dependent diabetes mellitus.
  • a further object of the present invention is to provide a method for identifying CNTF-related factors, other than those specifically described herein, that have improved therapeutic properties.
  • amino acid substitutions in human CNTF protein enhance its therapeutic properties.
  • alterations in electrophoretic mobility are used to initially screen potentially useful modified CNTF proteins.
  • the amino acid glutamine in position 63 of human CNTF is replaced with arginine (referred to as 63Q ⁇ R) or another amino acid which results in a modified CNTF molecule with improved biological activity.
  • rHCNTF variants combine the 63Q ⁇ R mutation with three other novel features:
  • a molecule designated RG297 rHCNTF, 17CA63QR ⁇ C13
  • RG297 rHCNTF, 17CA63QR ⁇ C13
  • a 63Q ⁇ R substitution which confers greater biological potency
  • a deletion of the terminal 13 amino acid residues which confers greater solubility under physiological conditions
  • a 17CA substitution which confers stability, particularly under physiological conditions at 37°C
  • a molecule designated RG242 that carries the double substitution 63QR64WA which results in a different spectrum of biological potency and a 7-fold higher therapeutic index.
  • a molecule designated RG290 that carries the double substitution 63QR ⁇ C13 which confers greater solubility under physiological conditions.
  • Figure 1 Alignment of CNTF protein sequences.
  • A Human, rat, rabbit mouse and chicken (Leung, et al., 1992, Neuron 8:1045-1053) sequences. Dots indicate residues found in the human sequence.
  • Panel B Modified CNTF molecules showing human CNTF amino acid residues (dots) and rat CNTF (residues shown). The name of the purified recombinant protein corresponding to each sequence is shown on the left.
  • Figure 2 Mobility of human, rat and several modified CNTF molecules on reducing SDS-15% polyacrylamide gels. Purified recombinant proteins were loaded as indicated. Markers of the indicated MW were loaded on lane M.
  • Figure 3 Biological activity of two modified CNTF molecules.
  • Figure 4 Competitive ligand binding towards A.) SCG neurons and B.) MG87/huCNTFR fibroblasts. Standard deviation from the mean of three determinations is shown by vertical bars.
  • FIG. 5 Mobility of human and several modified CNTF molecules on SDS-15% polyacrylamide gels.
  • Supernatant (A) and pellet (B) preparations of recombinant human CNTF (designated HCNTF) and several modified CNTF proteins were loaded as indicated.
  • the modified proteins shown are ⁇ C13 (also known as RG160); 17CA, ⁇ C13 (RG162); ⁇ C13,63QR (RG290); and 17CA, ⁇ C13,63QR (RG 297). Markers of the indicated MW were loaded on lane M. Incubation in physiological buffer at 37°C for 0, 2, 7 and 14 days is indicated in lanes 1 -4, respectively.
  • Figure 6 Survival of primary dissociated E8 chick ciliary neurons in response to increasing concentrations of various CNTF variants.
  • Control concentration response curves for rat CNTF and rHCNTF obtained with standard, untreated stock solutions, as well as with four rHCNTF variants, RG297, RG290, RG160 and RG162.
  • FIG. 7 Survival of primary dissociated E8 chick ciliary neurons in response to increasing concentrations of various CNTF variants.
  • Control concentration response curves for rat CNTF and rHCNTF obtained with standard, untreated stock solutions, as well as with rHCNTF variant RG228 (also known as RPN228 and having the mutation 63QR).
  • Figure 8 Survival of primary dissociated E8 chick ciliary neurons in response to increasing concentrations of various CNTF variants. Control concentration response curves for rat CNTF and rHCNTF obtained with standard, untreated stock solutions, as well as with rHCNTF variant RG242 (which has the mutation 63QR.64WA).
  • Figure 9 Average plasma concentration time profiles in the rat after intravenous (IV) administration of rHCNTF, RG228 and RG242 normalized to 100 ⁇ g/kg dose for all three compounds.
  • Figure 10 Average plasma concentration time profiles in the rat after subcutaneous (SC) administration of rHCNTF, RG228 and RG242 normalized to 200 ⁇ g/kg dose for all three compounds.
  • Figure 1 Comparison of dose dependent rescue of rat muscle wet weight of (A) hCNTF vs. RG228; (B) hCNTF vs. RG297 and (C) hCNTF vs. RG242.
  • Figure 12 Comparison of in vivo toxicity for hCNTF, RG228, RG242 and RG297.
  • FIG. 13 Representative Nissl-stained sections (coronal plane) from brains treated with neurotrophins and injected with quinolinic acid.
  • Top left A view of an intact caudate-putamen (CPu).
  • Adjacent panels Comparable views of sections from brains treated with NGF, BDNF or NT-3 and injected with quinolinic acid.
  • a circumscribed area is virtually devoid of medium-sized neurons.
  • FIG 14 Representative Nissl-stained sections (coronal plane) from brains treated with CNTF or PBS and injected with quinolinic acid.
  • Top left A view of an untreated, intact caudate-putamen (CPu).
  • Top right A higher magnification view of the lateral CPu showing numerous medium-sized neurons, a few of which are indicated by arrows.
  • Middle and bottom left The left CPu in brains treated with PBS or CNTF and injected with quinolinic acid. The two tracks in the CPu were left by the PBS or CNTF infusion cannula (c) and the quinolinic acid injection needle (arrowhead); open arrows indicate the medial boundary of the lesion.
  • Middle and bottom right The left CPu in brains treated with PBS or CNTF infusion cannula (c) and the quinolinic acid injection needle (arrowhead); open arrows indicate the medial boundary of the lesion.
  • Middle and bottom right The left CPu in brains
  • Figure 15 Effect of treatment with neurotrophic factors on medium-sized striatal neuron loss induced by intrastriatal injection of quinolinic acid (QA).
  • A, B, C, D, E. Mean neuron loss scores ( ⁇ SEM) for groups treated with neurotrophic factor or PBS and injected with quinolinic acid.
  • Statistical comparisons were by unpaired t-test.
  • Figure 16 Effect of treatment with Ax1 on medium-sized striatal neuron loss induced by intrastriatal injection of quinolinic acid (QA). Above each graph, a time line indicates the experimental scheme.
  • ⁇ SEM Mean neuron loss score
  • ⁇ SEM Mean neuron loss score
  • FIG 17 Effects of Axokine-15 (Ax-15) in normal mice.
  • Normal C57BL/6J mice were injected subcutaneously daily for 6 days with either vehicle or Ax-15 at 0.1 mg/kg, 0.3 mg.kg, or 1.0 mg/kg. Percent change in body weight in Ax-15-treated versus vehicle- treated controls is shown.
  • FIG. 18 Effects of Ax-15 in ob/ob mice.
  • C57BL/6J ob/ob mice were injected subcutaneously daily for 7 days with either vehicle, leptin (1.0 mg/kg) or Ax-15 at 0.1 mg/kg, 0.3 mg.kg, or 1.0 mg/kg. Diet-restricted, pair-fed mice were injected with 0.3 mg/kg Ax-15 to investigate the effects of food intake reduction on weight loss. Percent change in body weight in Ax-15-treated and leptin-treated versus vehicle-treated controls is shown.
  • FIG 19 Effects of Ax-15 in diet-induced obesity in mice.
  • AKR/J mice were placed on a high fat diet for seven weeks prior to treatment with vehicle, leptin (1.0 mg/kg) or Ax-15 at 0.03 mg/kg, 0.1 mg/kg, 0.3 mg/kg, or 1.0 mg/kg. Diet-restricted, pair-fed AKR/J mice were injected with 0.3 mg/kg Ax-15 to investigate the effects of food-intake reduction on weight loss. Percent change in body weight in Ax-15-treated and leptin-treated versus vehicle-treated controls is shown.
  • Figures 20A and 20B Effects of Ax-15 and diet restriction on serum insulin and corticosterone levels in diet-induced obese AKR/J mice.
  • Figure 20A- Serum insulin levels were measured in ARK/J diet-induced obese mice following treatment with vehicle, diet restriction and Ax-15 (0.1 mg/kg) or Ax-15 only (0.1 mg/kg) to determine the effects of diet and/or Ax-15 treatment on obesity- associated hyperinsulinemia.
  • Figure 20B- Serum corticosterone levels were measured in ARK/J diet-induced obese mice following treatment with vehicle, diet restriction and Ax-15 (0.1 mg/kg) or Ax-15 only (0.1 mg/kg) to determine the effects of diet and/or Ax- 15 treatment on obesity-associated hyperinsulinemia.
  • Figure 21 - 1 -20-PEG Ax-15 (mono-20K-PEG-Ax-15) is 4-fold more effective than non-pegylated Ax-15 in causing weight loss in mice with diet induced obesity.
  • Figure 22 - 1 -20-PEG Ax-15 decreased food intake more effectively than non-Pegylated Ax-15 in mice with diet induced obesity.
  • FIG 23A-23D - Figure 23A - Treatment of db/db animals with daily Ax-15 causes a significantly greater weight loss than does caloric restriction, db/db mice or their heterozygous litter mates (db/?) were given daily injections (s.c.) of either Ax-15 (0.1 or 0.3 mg/kg) or vehicle for 10 days. Food intake was restricted for a cohort of vehicle treated animals (Pair-fed) to the same amount ingested by the highest Ax-15-treated group. The mean group bodyweight +/- SEM (n 12) is reported for each day.
  • Figure 23B The effect of 10 day Ax-15 treatment on glucose tolerance in db/db animals.
  • Figure 24 Time course of effects of Ax-15 treatment (0.3 mg/kg/day; filled triangle) compared to vehicle treated (open square), pairfed-vehicle treated (filled diamond) on non-fasting serum blood glucose from db/db male mice. Each point represents the mean of at least six animals ⁇ SEM 14 hour after the last injection .
  • Figure 25A-25C Physiological consequences of 10-day Ax-15 treatment in db/db animals.
  • Figure 25A Fasting blood glucose concentrations were determined with serum from db/db male mice treated for 10 days with Ax-15 (0.1 mg/kg/day and 0.3 mg/kg/day, hatched bars) as compared to control groups, vehicle treated (open bar), pairfed-vehicle treated (hatched bar) and age-matched heterozygous db/? mice (stipled). Each bar represents the mean of at least eight animals ⁇ SEM.
  • FIG. 25B Fasting insulin concentrations were determined on serum from db/db male mice treated for 10 days with Ax-15 (0.1 mg/kg/day and 0.3 mg/kg/day, hatched bars) as compared to control groups, vehicle treated (open bar), pairfed vehicle-treated (hatched bar) and age-matched heterozygous db/? mice (stipled). Each bar represents the mean of at least eight animals ⁇ SEM.
  • Figure 25C Fasting free fatty acid levels were determined on serum samples from db/db male mice treated for 10 days with Ax-15 (0.1 mg/kg/day and 0.3 mg/kg/day, hatched bars) in comparison to control groups, vehicle treated (open bar), pairfed-vehicle treated (hatched bar) and age-matched heterozygous db/? mice (stipled). Each bar represents the mean of at least eight animals ⁇ SEM. Insulin tolerance test data indicate an improved insulin sensitivity profile from the severely impaired vehicle treated control db/db animals.
  • FIG 26A-26H The effects of Ax-15 treatment on insulin- stimulated phosphotyrosine immunoreactivity in the arcuate nucleus of db/db mice. Immunostaining of heterozygous (db/?) mice showed an increase in phosphotyrosine immunoreactive staining neurons of the arcuate nucleus ( Figure 26B) following a 30 minute bolus of insulin (1 IU via the jugular vein) as compared to vehicle injected control level ( Figure 26A).
  • FIG. 27A-27B The effects of Ax-15 treatment on insulin- stimulated signaling in the liver of db/db mice.
  • Male db/db mice were treated for 10 days with either vehicle (lanes 7 & 8), pairfed to drug treatment levels (lanes 1 & 2) or treated with Ax-15 (0.1 mg/kg/day, lanes 5 & 6; 0.3 mg/kg/day, lanes 4 & 5).
  • On the 11th day animals were anaesthetized injected with either saline (-) or 1 IU of regular insulin (+) via the portal vein.
  • Non-immune control immunoprecipitation (Nl), no lysate control (NL), and 3T3-L1 lysate control for p85 (C) were run as immunprecipitation and blotting controls.
  • the present invention relates to a method of treating neurological or endocrine diseases and disorders in humans or animals. It is based, in part, on the initial finding that recombinant rat CNTF binds more efficiently to the human CNTF receptor than does recombinant human CNTF and the subsequent discovery that amino acid substitutions which cause human CNTF to more closely resemble rat CNTF result in enhanced binding of the modified CNTF to the human CNTF receptor and concomitant enhanced biological activity.
  • alteration of a single amino acid of the human CNTF protein results in a significant enhancement of the ability of the protein to promote the survival and outgrowth of ciliary ganglion, as well as other neurons.
  • CG chick ciliary ganglion
  • This method involved the exchange, by genetic engineering methods, of parts of the human CNTF sequence with the corresponding rat CNTF sequence and vice versa.
  • advantage was taken of restriction sites that are common to the two CNTF genes and unique in their corresponding expression vectors. When necessary, such sites were engineered in one or the other of the two genes in areas that encode the same protein sequence.
  • expression vectors were obtained for each of the modified proteins shown in Figure 1. After isolating the individual proteins to at least 60% purity, their properties, as compared to those of human and rat CNTF were determined.
  • electrophoretic mobility data indicated that all of the modified human CNTF molecules that migrated to the same position as rat CNTF had the single amino acid substitution Gln63 ⁇ Arg (Q63 ⁇ R).
  • CNTF Modified human CNTF proteins that demonstrated an electrophoretic mobility similar to that of the rat CNTF molecule were subsequently examined for biological activity and receptor binding.
  • CNTF is characterized by its capacity to support the survival of dissociated ciliary neurons of E8 chick embryos.
  • purified recombinant rat CNTF is as active as the native protein from rat, but four times more active than recombinant human CNTF [Masiakowski, et al., 1991 , J. Neurosci. 57:1003-1012 and in International Publication No. WO 91/04316, published on April 4, 1991].
  • the same assay was utilized to determine the biological activity of the altered molecules prepared as described above. As described herein, all of the modified CNTF molecules that had the
  • an indication of the potential biological activity of each of the molecules may also be obtained by determining the effect of each modification on the ability of the molecules to bind to the CNTF receptor.
  • the ability of the modified human CNTF proteins to compete with rat CNTF for binding to rat superior cervical ganglia neurons (SCGs) is measured.
  • human CNTF is about 90 times less potent in displacing 125 l-labelled rat CNTF binding from these cells than unlabelled rat CNTF.
  • Several of the modified human CNTF proteins described herein, however, are more potent than the human CNTF in displacing the rat protein. All of the molecules described herein that had such increased competitive binding ability were molecules that exhibited altered electrophoretic mobility, wherein the molecules migrated in a manner similar to rat CNTF.
  • cells such as MG87 fibroblasts, are engineered to express the human CNTF receptor ⁇ -component and such cells are used to assay the binding capability of the modified protein to the human receptor.
  • Human CNTF is about 12 times less potent than rat CNTF in competing with 125 l-labelled rat CNTF for binding to the human CNTF receptor.
  • modified human CNTF molecules described herein including all of those with electrophoretic mobility that resemble rat rather than human CNTF, were more potent than human CNTF in competing with binding of 125 l-rat CNTF to the cells expressing the human CNTF receptor.
  • an animal model with demonstrated utility in providing an indication of the ability of certain growth and other factors to prevent degeneration of retinal photoreceptors may be used to assess the therapeutic properties of the modified CNTF molecules according to the present invention.
  • hCNTF Gln63 ⁇ Arg
  • hCNTF has a ten-fold higher ability than recombinant human CNTF to prevent degeneration of photoreceptors in a light-induced damage model of retinal degeneration.
  • modified CNTF molecules useful for practicing the present invention may be prepared by cloning and expression in a prokaryotic or eukaryotic expression system as described, for example in Masiakowski, et al., 1991 , J. Neurosci. 57:1003-1012 and in
  • the recombinant neurotrophin gene may be expressed and purified utilizing any number of methods.
  • the gene encoding the factor may be subcloned into a bacterial expression vector, such as for example, but not by way of limitation, pCP1 10.
  • the recombinant factors may be purified by any technique which allows for the subsequent formation of a stable, biologically active protein.
  • the factors may be recovered from cells either as soluble proteins or as inclusion bodies, from which they may be extracted quantitatively by 8M guanidinium hydrochloride and dialysis.
  • conventional ion exchange chromatography, hydrophobic interaction chromatography, reverse phase chromatography or gel filtration may be used.
  • modified CNTF molecules produced as described herein, or a hybrid or mutant thereof may be used to promote differentiation, proliferation or survival in vitro or in vivo of cells that are responsive to CNTF, including cells that express receptors of the CNTF/IL-6/LIF receptor family, or any cells that express the appropriate signal transducing component, as described, for example, in Davis, et al.,1992, Cell 69:1 121 -1132. Mutants or hybrids may alternatively antagonize cell differentiation or survival.
  • the present invention may be used to treat disorders of any cell responsive to CNTF or the CNTF/CNTF receptor complex.
  • disorders of cells that express members of the CNTF/IL-6/LIF receptor family may be treated according to these methods.
  • disorders include but are not limited to those involving the following cells: leukemia cells, hematopoietic stem cells, megakaryocytes and their progenitors, DA1 cells, osteoclasts, osteoblasts, hepatocytes, adipocytes, kidney epithelial cells, embryonic stem cells, renal mesangial cells, T cells, B cells, etc.
  • the present invention provides for methods in which a patient suffering from a CNTF-related neurological or differentiation disorder or disease or nerve damage is treated with an effective amount of the modified CNTF, or a hybrid or mutant thereof.
  • the modified CNTF molecules may be utilized to treat disorders or diseases as described for CNTF in International Publication No. WO91/04316 published on April 4, 1991 by Masiakowski, et al. and for CNTF/CNTFR complex as described in
  • Such diseases or disorders include degenerative diseases, such as retinal degenerations, diseases or disorders involving the spinal cord, cholinergic neurons, hippocampal neurons or diseases or disorders involving motomeurons, such as amyotrophic lateral sclerosis or those of the facial nerve, such as Bell's palsy.
  • degenerative diseases such as retinal degenerations, diseases or disorders involving the spinal cord, cholinergic neurons, hippocampal neurons or diseases or disorders involving motomeurons, such as amyotrophic lateral sclerosis or those of the facial nerve, such as Bell's palsy.
  • CNTF or CNTF-related molecules described herein are used for the treatment of Huntington's disease.
  • Glutamate receptor mediated excitotoxicity has been hypothesized to play a role in numerous neurodegenerative diseases or insults, including Huntington's disease.
  • the predominant neuropathological feature of Huntington disease is a massive degeneration of the medium-sized, GABAergic, striatal output neurons, without substantial loss of striatal interneurons (Acheson, A. & R. Lindsay., 1994, Seminars Neurosci. 6:333-3410).
  • Applicants have conducted studies, using both CNTF and the variants described herein, in an animal model wherein the preferential loss of striatal output neurons observed in Huntington disease, and the resulting dyskinesia, are mimicked in rodent or primate models in which an NMDA glutamate receptor agonist, quinolinic acid, is injected into the striatum (DiFiglia, M. Trends
  • rHCNTF recombinant human CNTF
  • CNTF variants as described herein which have improved stability and solubility as compared to CNTF, provide preferred formulations for delivery of CNTF via, for example, osmotic pumps, into the CNS as described above. Because the instability of rHCNTF in solution at body temperature interferes with its ability to be chronically administered by intrathecal or intraventricular infusion, the variants of rHCNTF described herein are preferred for such uses in view of their improved stability, solubility, and decreased antigenicity.
  • the present invention contemplates variants of CNTF with improved solubility that may be used in therapeutic applications where infusion, via, for example, osmotic pump, is used to delivery the drug.
  • infusion via, for example, osmotic pump
  • rHCNTF is very limited in physiological buffer, e.g., Phosphate- Buffered-Saline, pH 7.4 (PBS). Furthermore, the solubility over at least the 4.5-8.0 pH range depends strongly on the temperature and on the time of incubation. At 5°C, the solubility of rHCNTF in PBS is 1 mg/ml and the solution is stable for a few hours, but at 37°C its solubility is only 0.1 mg/ml after 2 hr and 0.05 mg/ml after 48 hrs. This limited solubility and thermal stability preclude stable formulation of rHCNTF in physiological buffer. Such formulations are particularly desirable for continuous administration into the CNS.
  • physiological buffer e.g., Phosphate- Buffered-Saline, pH 7.4 (PBS).
  • PBS Phosphate- Buffered-Saline, pH 7.4
  • rHCNTF lacking the last 13 amino acid residues from the carboxyl end (rHCNTF, ⁇ C13 also designated RPN160 or RG160) retains full biological activity and is soluble at low temperatures (5-10°C) to at least 12 mg/ml. Yet, despite this far greater solubility, rHCNTF, ⁇ C13 still falls out of a PBS solution upon incubation at 37°C over a period of several hours, even at concentrations as low as 0.1 mg/ml. It was determined that the thermal instability of rHCNTF and rHCNTF, ⁇ C13 was the result of aggregation that was initiated by intermolecular disulfide bond formation and depended strongly on protein concentration and temperature.
  • rHCNTF, 63QR variants which have higher potency due to the substitution of the glutamine residue at position 63 by arginine.
  • rHCNTF, 17CA,63QR, ⁇ C13 also designated RG297 shows greater biological potency than rHCNTF because of the 63QR substitution, greater solubility because of the ⁇ C13 deletion and greater stability because of the 17CA substitution.
  • the present invention contemplates treatment of a patient having HD with a therapeutically effective amount of CNTF or the variants described herein.
  • Effective amounts of CNTF or its variants are amounts which result in the slowing of the progression of the disease, or of a reduction in the side-effects associated with the disease.
  • the efficacy of the treatment may be measured by comparing the effect of the treatment as compared to controls which receive no treatment.
  • the clinical course and natural history of HD have been extensively characterized both in field studies (Young et al.,1996, Ann Neurol.
  • HDFC scores can be roughly grouped into 5 clinical stages (Shoulson et al., 1989, Quantification of Neurologic Deficit, TL Munsat (ed) Butterworths 271 -284). Neuroimaging studies have focused on the gross pathological consequences of neuronal loss and consequent atrophy of basal ganglia structures. As HD progresses, the caudate nuclei shrink, giving a characteristic "box-car" appearance to the lateral ventricles. The degree of caudate atrophy can be quantified using a
  • Magnetic resonance imaging may be used to generate similar indices to those given by CT.
  • One preliminary study (Jenkins, et al., 1993, Neurology 43:2689-2695 has detected an increased amount of lactic acid, presumably reflecting either neuronal cell loss or a defect in intermediary metabolism, in the brains of HD patients.
  • Positron Emission tomographic (PET) permits functional imaging to be performed in living patients. Changes in metabolic state can be assessed using 2-deoxyglucose (which reflects synaptic activity), or selective radioligands which mark selected neuronal populations.
  • radioligands may be used to monitor striatal integrity in HD.
  • striatal integrity in HD since intrinsic striatal neurons which are lost in HD uniformly bear dopamine receptors, ligands for the dopamine receptor have been used to monitor the progression of HD.
  • These studies do indeed show a parallel reduction of both striatal D1 and D2 receptors in HD patients (Turjanski et al., 1995, Brain 1 18:689-696). Similar metabolic and neurochemical findings have been obtained in PET studies of primates treated with quinolinic acid in the striatum. Brownell et al., (1994, Exp.
  • Neurol.1_25:41 -51 reported that, following a quinolinate lesion of the striata of 3 non- human primates, symptoms similar to those of Huntington's disease could be induced by dopamine agonist treatment. All animals showed a long-term 40-50% decrease in glucose utilization in the caudate by [19F]fluoro-2-deoxy-D-glucose positron emission tomography (PET). Caudate-putamen uptake rate constants for D1 receptors reflected neuronal loss and decreased by an average 40 to 48%. Dopamine reuptake sites and fibers assessed by PET showed a temporary decrease in areas with mild neuronal loss and a long-term decrease in striatal regions with severe destruction.
  • rHCNTF,17CA63QR ⁇ C13 a modified CNTF molecule, known as Ax-13 or Ax-1 , (designated rHCNTF,17CA63QR ⁇ C13) which combines a 63Q ⁇ R substitution (which confers greater biological potency) with a deletion of the terminal 13 amino acid residues (which confers greater solubility under physiological conditions) and a 17CA substitution (which confers stability, particularly under physiological conditions at 37°C) and shows a 2-3 fold better therapeutic index than rHCNTF in an animal model.
  • rHCNTF,17CA63QR ⁇ C13 which combines a 63Q ⁇ R substitution (which confers greater biological potency) with a deletion of the terminal 13 amino acid residues (which confers greater solubility under physiological conditions) and a 17CA substitution (which confers stability, particularly under physiological conditions at 37°C) and shows a 2-3 fold better therapeutic index than rHCNTF in an animal model.
  • rHCNTF,17CA63QR ⁇ C13
  • Ax-15 therefore has the advantage of being more easily purified with a greater yield. Additionally, because there is greatly reduced bacterial amino acid tagging, Ax-15 does not raise the concern with regard to the immunogenicity or stability of the molecule that could be raised by Ax-13.
  • the object of the present invention is to provide an improved modified ciliary neurotrophic factor molecule.
  • one embodiment of the invention is a modified human ciliary neurotrophic factor having the modification Cys17 ⁇ Ala, Gln63 ⁇ Arg, and a deletion of the terminal15 amino acid residues.
  • the present invention also provides for an isolated nucleic acid molecule encoding the modified human ciliary neurotrophic factor of the invention.
  • a recombinant DNA molecule that encodes the modified human ciliary neurotrophic factor of the invention and which is operatively linked to an expression control sequence, as well as a host cell transformed with the recombinant DNA molecule.
  • the host cell may be prokaryotic or eukaryotic, and therefore may be, for example, a bacterium such as E . coli. a yeast cell such as Pichia pastoris, an insect cell such as Spodoptera frugiperda. or a mammalian cell such as a COS or CHO cell.
  • Said host cell may be used in a method for producing the modified ciliary neurotrophic factor molecule comprising: (a) growing the host cell transformed with the recombinant DNA molecule of the invention so that the DNA molecule is expressed by the host cell to produce the modified ciliary neurotrophic factor molecule of the invention and (b) isolating the expressed, modified ciliary neurotrophic factor molecule.
  • the subject invention further contemplates a composition comprising the modified ciliary neurotrophic factor molecule of the invention (Ax-15), and a carrier.
  • Another object of the present invention is to provide a method of treating a disease or disorder of the nervous system comprising administering the modified ciliary neurotrophic factor described herein as Ax-15.
  • the disease or disorder treated may be a degenerative disease and/or involve the spinal cord, motor neurons, cholinergic neurons or cells of the hippocampus.
  • the method of treatment may be for treating a disease or disorder of the nervous system which comprises damage to the nervous system caused by an event selected from the group consisting of trauma, surgery, infarction, infection, malignancy and exposure to a toxic agent.
  • Also contemplated by the present invention is a method of treating a disease or disorder involving muscle atrophy.
  • a further object of the present invention is to provide a method of protecting striatal neurons from degeneration comprising treating said striatal neurons with an effective amount of the modified ciliary neurotrophic factor described herein as Ax-15. Also contemplated by the present invention is a method of treating Huntington's disease comprising direct administration to the central nervous system of the modified ciliary neurotrophic factor described herein as Ax-15.
  • a further object of the present invention is to provide a method of inducing weight loss in a mammal comprising administration to the mammal of the modified ciliary neurotrophic factor described herein as Ax-15.
  • a specific embodiment of this invention involves inducing weight loss in a human.
  • the method of administering Ax-15 may be used in the treatment of morbid obesity or obesity of a genetically determined origin.
  • the Ax-15 described herein may also be used in a method of preventing and/or treating the occurrence of gestational or adult onset diabetes in a human.
  • Any of the above-described methods involving the administration of Ax-15 may be practiced by administering the Ax- 15 via a route of delivery selected from the group consisting of intravenous, intramuscular, subcutaneous, intrathecal, intracerebroventricular and intraparenchymal.
  • the Ax-15 may be administered via the implantation of cells that release the modified ciliary neurotrophic factor.
  • the present invention also contemplates diseases or disorders resulting from damage to the nervous system, wherein such damage may be caused by trauma, surgery, infarction, infection and malignancy or by exposure to a toxic agent.
  • the present invention also provides for pharmaceutical compositions comprising a modified CNTF molecule or hybrid or mutant thereof, as described herein, as the sole therapeutic agent or in a complex with the CNTF receptor, in a suitable pharmacologic carrier.
  • the active ingredient which may comprise CNTF or the modified CNTF molecules described herein should be formulated in a suitable pharmaceutical carrier for administration in vivo by any appropriate route including, but not limited to intraparenchymal, intraventricular or intracerebroventricular delivery, or by a sustained release implant, including a cellular or tissue implant such as is described, for example, in published application WO96/02646 published on February 1 , 1996, W095/28166 published on October 26, 1995, or WO95/505452 published February 23, 1995.
  • the active ingredient may be formulated in a liquid carrier such as saline, incorporated into liposomes, microcapsules, polymer or wax-based and controlled release preparations, In preferred embodiments, modified CNTF preparations which are stable, or formulated into tablet, pill or capsule forms.
  • concentration of the active ingredient used in the formulation will depend upon the effective dose required and the mode of administration used. The dose used should be sufficient to achieve circulating plasma concentrations of active ingredient that are efficacious. Effective doses may be extrapolated from dose- response curves derived from in vitro or animal model test systems. Effective doses are expected to be within the range of from about .001 to about 1 mg/day.
  • E. coli K-12 RFJ26 is a strain that overproduces the lactose operon repressor.
  • Plasmid pRPN219 was constructed by first digesting pRPN33 with the restriction enzymes Nhe1 plus Hind3 and gel purifying the 4,081 bp fragment. The second, much smaller fragment which codes for part of the human CNTF gene was subsequently replaced with an
  • Plasmid pRPN228 was constructed in the same manner as pRPN219, except that the 167 bp replacement fragment was amplified using the DNA primers Rat-lll-dniH-L-R : 5' AAG GTA CGA
  • Plasmids pRPN186, pRPN187, pRPN188, pRPN189, pRPN192, pRPN218, and pRPN222 were generated by similar means or by direct exchange of DNA fragments using the unique restriction sites shown in Figure 1.
  • Figure 2 also provides a measure of the purity of the different recombinant proteins. By visual inspection, purity varies from 60% for RPN189 to better than 90% for RPN228.
  • Recombinant rat CNTF (28 ⁇ g) in 37 ⁇ l 0.2 M sodium borate buffer, pH 8.5 was transferred to a vial containing 4 mCi, (2,000 Ci/mmole; NEN) of 125 l and reagent (Bolton and Hunter, 1973, Biochem J. 133: 529-539) which had been dried under a gentle stream of nitrogen. Reactions were incubated for 45 min at 0°C followed by 15 min at room temperature and terminated by the addition of 30 ml of
  • 125 I-CNTF was stored at 4°C and used up to one week after preparation. As a test of structural and conformational integrity, 125 I-CNTF (approximately 10,000 cpm) was mixed with a 5 ⁇ g unlabelled CNTF and analyzed by native gel electrophoresis. One major band was visible by either Coomassie staining or autoradiography. 125 I-CNTF also showed comparable activity to native CNTF in supporting survival of E8 chick ciliary neurons in culture.
  • Superior cervical ganglia from neonatal rats were treated with trypsin (0.1%), mechanically dissociated and plated on a poly-ornithine (30 ⁇ g/ml) substratum.
  • Growth medium consisted of Ham's nutrient mixture F12 with 10% heat-inactivated fetal bovine serum (Hyclone), nerve growth factor (NGF) (100 ng/ml), penicillin (50 U/ml) and streptomycin (50 ⁇ g/ml). Cultures were maintained at 37°C in a humidified 95% air/5% C0 2 atmosphere. Ganglion non- neuronal cells were eliminated by treatment with araC (10 ⁇ M) on days 1 and 3 of culture.
  • MG87/CNTFR is a fibroblast cell line transfected with the human CNTF ⁇ receptor gene (Squinto, et al.,1990, Neuron 5:757-766; Davis et al., 1991 , Science 253:59-63).
  • Figure 3 shows dose-response curves of dissociated, neuron- enriched cultures of E8 chick embryo ciliary ganglia for purified recombinant human, rat and the modified CNTF proteins RPN219 and RPN228.
  • the biological activity of the chimeric proteins is indistinguishable from that of purified recombinant rat CNTF and clearly higher than that of recombinant human CNTF.
  • Comparison of the dose-response curves in Figure 3 also shows that the maximal levels of surviving neurons obtained with RPN219, RPN228 or rat CNTF are higher than those obtained with human CNTF.
  • Example 4 Use of Modified CNTF To Prevent Light Induced Photoreceptor Injury
  • Albino rats of either the F344 or Sprague-Dawley strain were used at 2-5 months of age.
  • the rats were maintained in a cyclic light environment (12 hr on: 12 hr off at an in-cage illuminance of less than 25 ft-c) for 9 or more days before being exposed to constant light.
  • the rats were exposed to 1 or 2 weeks of constant light at an illuminance level of 1 15-200 ft-c (most rats received 125-170 ft-c) provided by two 40 watt General Electric "cool-white" fluorescent bulbs with a white reflector that was suspended 60cm above the floor of the cage.
  • rats were maintained in transparent polycarbonate cages with stainless steel wire-bar covers.
  • rats anesthetized with a ketamine-xylazine mixture were injected intravitreally with 1 ⁇ l of rat CNTF, human CNTF or modified CNTF [hCNTF (Q63 ⁇ R)] dissolved in phosphate buffered saline (PBS) at a concentration of
  • the injections were made with the insertion of a 32 gauge needle through the sclera, choroid and retina approximately midway between the ora serrata and equator of the eye. In all cases, the injections were made into the superior hemisphere of the eye.
  • the rats were sacrificed by overdose of carbon dioxide followed immediately by vascular perfusion of mixed aldehydes.
  • the eyes were embedded in epoxy resin for sectioning at 1 ⁇ m thickness to provide sections of the entire retina along the vertical meridian of the eye.
  • the degree of light-induced retinal degeneration was quantified by assessing the degree of photoreceptor rescue by a 0-4+ pathologist's scale of rescue, 4+ being maximal rescue and almost normal retinal integrity.
  • the degree of photoreceptor rescue in each section was scored by four individuals. This method has the advantage of considering not only the ONL thickness, but also more subtle degenerative changes to the photoreceptor inner and outer segments, as well as spatial degenerative gradients within the eye. Three eyes were examined for each time point to generate a dose response curve.
  • Recombinant human CNTF variants were genetically engineered, expressed in E. coli and recovered at greater than 90% purity, as described previously (Masiakowski, et al., 1991 , J. Neurosci.
  • RG162 (rHCNTF,17CA, ⁇ C13) 0.5 mg/ml
  • RG290 (rHCNTF,63QR, ⁇ C13) 1.2 mg/ml
  • Protein gel sample buffer (2X) consists of 12.5 ml TrisHCI, pH 6.8 - 20 ml glycerol - 40 ml 10% SDS and 5 mg Bromophenol Blue per 100 ml.
  • the solubility of rHCNTF is particularly limited in physiological buffer at neutral pH. Furthermore, the solubility over a broad pH range (4.5-8.0) depends strongly on the temperature and on the time of incubation. At 5°C, the solubility of rHCNTF in PBS is 1.4 mg/ml and the protein remains in solution for a few hours. In sharp contrast to the limited solubility of rHCNTF, the variant rHCNTF, ⁇ C13 can be concentrated to at least 12 mg/ml at 5°C.
  • Figure 6 shows control concentration response curves for rat CNTF and rHCNTF obtained with standard, untreated stock solutions, as well as with four rHCNTF variants incubated for 7 days at 37°C.
  • the proteins carrying the 17CA mutation, RG297 and RG162 were assayed at their nominal concentrations, whereas RG290 and RG160 were assayed after correcting their concentrations for the amount of protein remaining in solution.
  • Figure 6 shows that the concentration response curves displayed by these compounds are those expected from these proteins in their fully active form: RG160 and RG162 show the same potency as rHCNTF within experimental error, whereas RG290 and RG297 that carry the 63QR substitution show 4-5 fold higher potency than rHCNTF, as previously observed (Panayotatos, N., et al., 1993, J. Biol. Chem. 268:19000-19003) and as shown in Fig. 7. Therefore, incubation of rHCNTF and its derivatives at 37°C for 7 days does not cause loss of biological activity, only loss of protein through dimerization followed by precipitation.
  • RG228 (rHCNTF,63QR); RG297 (rHCNTF,17CA,63QR, ⁇ C13)
  • the plasma concentrations were evaluated using non compartment techniques. A standard curve for each compound was included on each assay plate and was used to calculate the amount of that compound present in the specimens analyzed on the plate. The sensitivity of the assay varied among compounds by less than twofold . Efficacy and Toxicitv Determinations In Vivo - Male Sprague- Dawley rats weighing -220 g were anesthetized before surgery. The right sciatic nerve was transected at the level of the knee and a 5 mm segment of nerve was removed. Sham surgeries were performed on the left side of each animal.
  • rats were weighed and administered vehicle (either PBS or lactate/phosphate/mannitol, pH 4.5) or the rHCNTF compound to be tested, dissolved in the same vehicle at doses ranging from 0.01 -1.0 mg/kg, s.c.
  • Rats were weighed and injected daily for 1 week, at which time they were sacrificed and the soleus muscles dissected and weighed.
  • the ratio of the right (denervated) to left (sham) soleus wet weights for each animal was calculated to assess the degree of atrophy caused by denervation and the prevention thereof by treatment with each compound.
  • the body weights were calculated as a percent of the weight gain of vehicle-treated rats. Both vehicle solutions produced similar results in atrophy and body weight gain.
  • RG242 After i.v. administration to rats, RG242 had a distribution phase ⁇ somewhat faster than that of rHCNTF and RG228. The disposition phase ⁇ for RG242 and RG228 was faster than that of rHCNTF. Thus, RG242 appeared to be distributed into the body and cleared from systemic circulation somewhat more rapidly than rHCNTF, whereas RG228 appeared to be distributed into the body as fast as rHCNTF and cleared from systemic circulation somewhat faster. The area under the concentration time curve (AUC) for RG242 was comparable to that of rHCNTF, indicating that the total body clearance (Cl ⁇ ) was about the same for the two compounds. A twice larger area was observed with RG228.
  • AUC concentration time curve
  • V area the apparent volume of distribution (V area ), which is a function of both ⁇ and AUC, was approximately twofold smaller for both RG228 and RG242 relative to rHCNTF, suggesting that these variants are distributed less widely.
  • the limited number of animals used in these evaluations did not allow the quantitative distinction of these values.
  • these results clearly indicate that the distribution and disposition kinetics of RG228 and RG242 after i.v. administration are not substantially different from those of rHCNTF.
  • RG228 and RG242 had a 2-3 fold longer absorption phase (Ka) relative to rHCNTF (Fig. 10 and Table 2).
  • the disposition phase of RG242 was also somewhat longer.
  • the longer apparent terminal disposition phase of RG242 after s.c dosing compared to i.v. administration may be attributed to the incomplete characterization of the terminal phase after the i.v. injection.
  • the relative therapeutic index (T.I.) for each of these compounds was calculated as the ratio of the TD 25 and ED 50 values, normalized to that of rHCNTF. While the T.I. of RG228 is equal to that of rHCNTF, the T.I. of RG297 and RG242 is 2.5 and 6.8 fold superior to that of rHCNTF, respectively.
  • RG297 and RG242 have superior pharmacological properties than rHCNTF. This is of great relevance to the clinical situation where decreased body weight is observed upon rHCNTF treatment in humans.
  • One skilled in the art will recognize that other alterations in the amino acid sequence of CNTF can result in a biologically active molecule which may have enhanced properties.
  • applicant has prepared a 17CS mutant which has a serine residue in place of the cysteine residue at position 17 and is biologically active.
  • Applicant has also prepared a biologically active quadruple mutant, 17CA, ⁇ C13,63QR,64WA.
  • Further CNTF mutants, all of which retain biological activity, are set forth in Table 4.
  • Table 1 Average Pharmacokinetic Parameters for rHCNTF, RG228 and RG242 after Intravenous Administration to Rats at 100 ⁇ g/kg.
  • Table 4 Biological activity of rHCNTF variants on E8 chick ciliary neurons. Potency units (1/EC 50 ) are shown relative to human CNTF which is assigned a value of 100. One potency unit is defined as the reciprocal ligand concentration showing the same biological activity as 1 ng/ml rHCNTF.
  • Glutamate receptor-mediated excitotoxicity has been hypothesized to play a role in numerous neurodegenerative diseases, including Huntington disease and motor neuron disease (DiFiglia, M. , 1990, Trends Neurosci. 13:286-289; Rothstein, et al., 1995, J. Neurochem. 65:643-651 ).
  • the predominant neuropathological feature of Huntington disease is a massive degeneration of the medium- sized, GABAergic, striatal output neurons, without substantial loss of striatal interneurons (Albin, et al., 1989, Trends Neurosci. 12:366-375; Harrington, et al., 1991 , J. Neuropathol. Exp. Neurol. 5_0.:309).
  • the classic animal model of HD involves production of an excitotoxic lesion of the rat striatum using a glutamate agonist of the NMDA-receptor class.
  • injection of the neurotoxin directly into the striatum results in loss of the medium sized intrinsic striatal neurons which utilize gamma-aminobutyric acid (GABA) as their neurotransmitter, with relative preservation of the two classes of striatal interneurons which utilize either acetylcholine or somatostatin and neuropeptide Y as their neurotransmitters.
  • GABA gamma-aminobutyric acid
  • Most recent studies have relied upon intrastriatal injection of quinolinic acid, which seems to most faithfully reproduce the appearance of the HD striatum.
  • 3-NP 3- nitropropionic acid
  • HD Huntington's disease
  • Excitotoxic injury to the striatum also mimics certain of the aspects of cell death seen in HD brain (Beal et al., 1986, Nature 321 :168-171 ).
  • patterns of distribution of TUNEL-positive neurons and glia were reminiscent of those seen in apoptotic cell death during normal development of the nervous system; in the same areas, nonrandom DNA fragmentation was detected occasionally.
  • internucleosomal DNA fragmentation (evidence of apoptosis) was seen at early time intervals and random DNA fragmentation (evidence of necrosis) at later time points.
  • TUNEL Tdt-mediated dUTP-biotin nick end labeling
  • Excitotoxic striatal lesions induced by quinolinic acid have been used to test for neuroprotective actions of nerve growth factor (NGF) on striatal cholinergic and GABAergic neurons in adult rats following quinolinic acid lesion (150 nmol).
  • NGF nerve growth factor
  • Daily intrastriatal NGF administration for one week increased the cellular expression of choline acetyltransferase messenger RNA three times above control levels and restored the levels of Trk A messenger RNA expression to control levels.
  • NGF treatment failed to attenuate the quinolinic acid-induced decrease in glutamate decarboxylase messenger RNA levels.
  • striatal glutamate decarboxylase messenger RNA-expressing GABAergic neurons which degenerate in Huntington's disease are not responsive to NGF.
  • Trophic Factors Recombinant human BDNF, nerve growth factor (NGF) and NT-3, and recombinant rat CNTF were prepared in E. coli and characterized as described (Maisonpierre, et al., 1990, Science 247:1446-1451 ; Masiakowski, et al., 1991 , J. Neurochem.
  • Axokinel is the designation for recombinant human CNTF with the following modifications: substitutions of alanine for cysteine at position 17 and arginine for glutamine at position 63, and deletion of the 13 C-terminal amino acids.
  • This CNTF analog has enhanced solubility, is stable for at least a week at 37°C in physiological buffer, and exhibits 4-5-fold greater potency in vitro relative to native human CNTF (Panayotatos et al., 1993, J. Biol. Chem. 268:19000-19003).
  • Trophic factor delivery bv osmotic pump A 30-gauge osmotic pump infusion cannula and a 22-gauge guide cannula (5.0 and 2.2 mm long, respectively) were chronically implanted side-by-side into the left hemisphere (stereotaxic coordinates AP 0.7, ML 3.2 relative to bregma; incisor bar 3.3 mm below the interaural line) in 250-300 g male, Sprague-Dawley rats under deep chloral hydrate (170 mg/kg) and pentobarbital (35 mg/kg) anesthesia.
  • the rats were again anesthetized and an Alzet osmotic minipump 2002 (two- week capacity at a delivery rate of 0.5 ⁇ l/hr), containing 0.1 M phosphate buffered saline (PBS) (pH 7.4), or PBS solutions of recombinant human NGF (0.9 mg/ml), human BDNF (1 mg/ml), human NT-3 (1 mg/ml), rat CNTF (0.78 mg/ml), or Ax1 (0.4 mg/ml) was connected by plastic tubing to the infusion cannula and implanted subcutaneously (Anderson, et al., 1995, J. Comp. Neurol. 357:296- 317).
  • PBS phosphate buffered saline
  • neurotrophic factor Due to the dead volume of the infusion cannula and tubing, the delivery of neurotrophic factor into the brain began about 1 day after pump implantation. Neurotrophins maintained in osmotic pumps at 37°C for 12 days were completely stable, as determined by bioassay, and effective intrastriatal delivery of the neurotrophins was verified by immunohistochemical staining of sections for the appropriate factor (Anderson, et al., 1995, J. Comp. Neurol. 357:296- 317).
  • anesthetized rats received an injection of quinolinic acid (50 nmol in 1 ⁇ l phosphate buffer, pH 7.2, over 10 minutes) through the guide cannula using a 10- ⁇ l Hamilton syringe with a 28-gauge blunt-tipped needle.
  • Trophic factor delivery by daily injection A 22-gauge guide cannula (2.2 mm long) was chronically implanted into the left hemisphere (stereotaxic coordinates AP 0.5, ML 3.0) of anesthetized rats, as described above. Beginning 1 week later, anesthetized rats received a daily intrastriatal injection of Ax1 (0.4 ⁇ g in 1 ⁇ l, over 10 minutes) or vehicle through the guide cannula using a Hamilton syringe. Ax1 was injected for 3 consecutive days before and 1 day after injection of quinolinic acid, which was injected as described above.
  • neuron loss also was evaluated by counting neurons in sections taken 0.5 mm rostral to the infusion cannula. For each section, neurons were counted that intersected every vertical line of a 10 x 10 sampling grid placed over seven fields, 0.4 x 0.4 mm, within the treated striatum.
  • the first field was located slightly lateral to the center of the striatum, at the center of a typical quinolinic acid-induced lesion (i.e. immediately rostral to the tip of the infusion cannula).
  • the six other fields were selected by moving diagonally from the first field, twice each in the dorsomedial and the ventromedial directions, and once each in the dorsolateral and the ventrolateral directions.
  • quinolinic acid 50 nmol was injected into the left striatum of adult rats 3 or 4 days after the start of intrastriatal infusion of neurotrophic factor by osmotic pump (nominal delivery rates: human NGF, 10.8 ⁇ g/day; human BDNF or NT-3, 12.0 ⁇ g/day; rat CNTF, 9.4 ⁇ g/day).
  • quinolinic acid is toxic to medium-sized striatal output neurons, which constitute over 90% of all striatal neurons, yet leaves the striatal populations of cholinergic interneurons and parvalbumin/GABAergic interneurons largely intact (Qin, et al., 1992, Experimental Neurology 1 15:200-21 1 : Figueredo-Cardenas, et al., 1994, Exp. Neurol. 129:37- 56).
  • Microscope analysis of Nissl-stained sections from brains collected 8-9 days after injection of quinolinic acid demonstrated no significant sparing of medium-sized striatal neurons in BDNF-, NGF-, or NT-3-treated brains (Fig. 13). In an additional set of experiments, no neuron sparing was apparent when quinolinic acid was injected 7 days after the start of BDNF or NGF infusion.
  • the neuroprotective effect of CNTF or Ax-1 was achieved without apparent adverse effects on behavior or health, as indicated, for example, by body weight.
  • Body weights measured at the end of the experiments were not significantly affected by CNTF or Ax-1 treatment (unpaired t-test).
  • CNTF is one of the first purified trophic factors demonstrated to protect striatal output neurons after pharmacological application in an adult animal model of Huntington disease.
  • NMDA N-methyl-D-aspartate
  • NGF is not the sole mediator of the neuroprotection provided by NGF-secreting fibroblasts.
  • BDNF and TrkC are expressed by numerous medium-sized striatal neurons (Altar, et al., 1994, Eur. J. Neurosci. 6:1389-1405).
  • BDNF and NT-3 unlike NGF
  • these neurotrophins can protect certain neuron populations from glutamate toxicity in vitro (Lindholm, et al., 1993, Eur. J. Neurosci.
  • CNTF receptor ligands may occur through direct action on medium-sized striatal neurons, since there is abundant expression of mRNA for components of the CNTF receptor (CNTFR ⁇ , LIFR ⁇ , gp130) in the striatum (Ip, et al.,
  • CNTF receptor ligands could potentially act indirectly, via other components of the striatum. For example, elimination of nigral or cortical input to the striatum prior to exposure to quinolinic acid results in a significant reduction in the loss of striatal neurons (DiFiglia, M., 1990, Trends Neurosci. 13:286- 289; Buisson, et al., 1991 , Neurosci.
  • astrocytes do not normally express detectable CNTFR ⁇ in vivo (Ip, et al., 1993, Neuron 10:89- 102), astrocytes do express all CNTF receptor components when activated by brain injury or when maintained in vitro (Rudge, et al.,
  • astrocytes might promote neuron survival through enhanced sequestration of excitatory amino acids or by release of substances that protect neurons.
  • the striatal neuron populations protected from excitotoxic damage by CNTF receptor-mediated events in the present study are the same types selectively lost in Huntington disease (Albin, et al., 1989, Trends Neurosci. 1_2: 366-375).
  • a potential link between excitotoxic stimulation and increased expression of the Huntington disease gene has recently been suggested (Carlock, et al., 1995,
  • Pegylation of proteins has been shown to increase their in vivo potency by enhancing stability and bioavailability while minimizing immunogenicity. It is known that the properties of certain proteins can be modulated by attachment of polyethylene glycol (PEG) polymers, which increases the hydrodynamic volume of the protein and thereby slows its clearance by kidney filtration. (See, e.g. Clark, R., et al., 1996, J. Biol. Chem. 271 : 21969-21977). We have generated PEGylated Axokine by covalently linking polyethylene glycol (PEG) to Ax-13. We have also developed a purification methodology to separate different PEGylated forms of Axokine from unmodified molecules.
  • PEG polyethylene glycol
  • PEGylated Ax-13 has better solubility and stability properties, at physiological pH, than unPEGylated Ax-13. PEGylation has been shown to greatly enhance pharmacokinetic properties of Ax-13 and would be expected to similarly enhance the properties of other Axokine molecules.
  • Purified Ax-13 derived from E. coli was used for these studies.
  • 20kD mPEG-SPA was obtained from Shearwater Polymers, Bicine from Sigma, and Tris-Glycine precast gels from Novex, CA.
  • a small scale reaction study was set up to determine reaction conditions.
  • 20kD mPEG SPA was reacted with purified Ax-13 at a final concentration of 0.6 mg/ml, at 4°C in an amine-free buffer at a pH of 8.1. Molar ratios of PEG to protein were varied and two reaction times were used. The reaction was stopped by the addition of a primary amine in large excess. Reaction products were analyzed by reducing SDS-PAGE. The predominant modified species ran at a molecular weight of approximately 60 kD. Higher order modified bands that ran at higher molecular weights were also seen. Based on this study, an overnight reaction at a PEG-to-protein ratio of 4 was chosen.
  • Ax-13 at 0.6 mg/mL was reacted with 20 kD mPEG SPA in a Bicine buffer overnight at 4°C at a pH of 8.1.
  • the reaction was stopped by the addition of a primary amine in large excess.
  • the reaction product was diluted with a low salt buffer and applied to an ion-exchange column. The column was washed with a low salt buffer and eluted with a NaCI gradient.
  • a good separation between higher order forms apparent MW >66kD on SDS-PAGE), a distinct modified species that ran at about 60kD and unmodified Ax-13 was obtained. Fractions corresponding to the 60kD band were tested in a Bioassay.
  • a very faint band of unmodified Ax-13 was noticed in the fractions corresponding to the 60kD band.
  • the 60kD band was further purified by Size exclusion chromatography (SEC) that resulted in baseline separation between unmodified Ax-13 and the 60kD band.
  • SEC Size exclusion chromatography
  • the expression plasmid pRG632 is a high copy plasmid that encodes ampicillin resistance and the gene for human CNTF- C17A,Q63R, ⁇ C13 (also referred to herein as either Ax1 or Ax-13) with a unique Eag I restriction enzyme recognition sequence 3' to the stop codon.
  • This plasmid was used to construct a human CNTF mutation C17A,Q63R, ⁇ C15 (designated Ax-15) by PCR amplification of a 187 bp BseR I-Eag1 DNA fragment that incorporates the ⁇ C 1 5 mutation.
  • the 5' primer ⁇ C15- 5' (5'- CCAGATAGAGGAGTTAATGATACTCCT-3') ⁇ encodes the BseR I site and the 3' primer ⁇ C15-3' ⁇ (5'-
  • GCGTCGGCCGCGGACCACGCTCATTACCCAGTCTGTGA GAAGAAATG-3' encodes the C-terminus of the Ax-15 gene ending at Gly185 followed by two stop codons and an Eag I restriction enzyme recognition sequence.
  • This DNA fragment was digested with BseR I and Eag I and ligated into the same sites in pRG632.
  • the resulting plasmid, pRG639 encodes the gene for Ax-15 (human CNTF C17A,Q63R, ⁇ C15).
  • the ⁇ C15 mutation was then transferred as a 339 bp Hind lll-Eag I DNA fragment into the corresponding sites within pRG421 , a high copy number expression plasmid encoding the gene for kanamycin resistance and human CNTF C17A,Q63R, ⁇ C13.
  • the resulting plasmid, pRG643, encodes the gene for Ax-15 under transcriptional control of the lacUV5 promoter, and confers kanamycin resistance.
  • the Ax-15 gene DNA sequence was confirmed by sequence analysis.
  • E. coli strain RFJ141 containing pRG639 was grown in LB medium and expression of Ax-15 protein was induced by the addition of lactose to 1% (w/v). Induced cells were harvested by centrifugation, resuspended in 20 mM Tris-HCI, pH 8.3, 5 mM EDTA, 1 mM DTT, and lysed by passage through a French pressure cell at 10,000 psi.
  • the cell lysate was centrifuged and the pellet was resuspended in 8 M guanidinium-HCI, 50 mM Tris-HCI, pH 8.3, 0.05 mM EDTA then diluted with 5 volumes of 50 mM Tris-HCI, pH 8.3, 0.05 mM EDTA (Buffer A) followed by dialysis against Buffer A.
  • the dialysate was loaded onto a Q-sepharose column equilibrated with Buffer A.
  • the Ax-15 protein was eluted by a linear gradient to 1 M NaCI in 10 column volumes of buffer. Fractions containing Ax-15 were pooled and brought to 1 M (NH 4 ) 2 S0 4 by the slow addition of solid (NH4) 2 S0 4 while maintaining the pH at 8.3 by the addition of
  • the pool was loaded onto a phenyl-sepharose column equilibrated with 1 M (NH 4 ) 2 S0 4 in Buffer A.
  • the column was washed with 0.5 M (NH 4 ) 2 S0 4 in Buffer A, and the Ax-15 protein was eluted by a linear gradient of decreasing (NH 4 ) 2 S0 4 concentration.
  • Fractions containing Ax-15 protein were pooled, dialyzed against 5 mM NaP0 4 , pH 8.3, then concentrated by ultrafiltration.
  • the concentrated pool was fractionated on an Sephacryl S-100 column equilibrated with 5 mM NaP0 4 , pH 8.3.
  • a recombinant, kanamycin resistant E. Coli strain RFJ141 expressing the Ax-15 protein under lac promoter control (pRG643) was grown to an intermediate density of 30-35 AU 550 (Absorbance @
  • Ax-15 protein was expressed as insoluble inclusion bodies following IPTG induction. Post- induction, cells were harvested, cell paste concentrated, and buffer exchanged to 20 mM Tris, 1.0 mM DTT, 5.0 mM EDTA, pH 8.5 via AGT 500,000 molecular weight cut off (mwco) hollow fiber diafiltration
  • Inclusion bodies were released from the harvested cells by disruption via repeated passage of cooled (0- 10°C) cell paste suspension through a continuous flow, high pressure (>8,000 psi) Niro Soavi homogenizer. The homogenate was subjected to two passages through a cooled (4-8°C) continuous flow, high speed (>17,000 x G) Sharpies centrifuge (source) to recover inclusion bodies. Recovered inclusion bodies were extracted in 8.0 M Guanidine HCL with 1.0 mM DTT. The Ax-15 protein/guanidine solution was diluted into 50 mM Tris-HCI, 1.0 mM DTT, 0.05 mM EDTA, pH 8.0-8.3, and diafiltered versus diluent buffer with AGT
  • the filtered Ax-15 solution described above was loaded onto a 16.4 L DEAE Sepharose (Pharmacia) column at 10.9 mg/ml resin and washed with 50 L of 50 mM Tris, pH 8.0-8.3, 1.0 mM DTT, and 0.05 mM EDTA buffer.
  • the Ax-15 protein was eluted from the column with a 120 mM NaCI step in the same Tris buffer. Eluate exceeding a previously established 280 nM absorbance criteria of 40% maximum A 28 o on tne ascending portion of the peak and 20% of maximum A 280 on the descending portion of the peak was pooled and either stored frozen (-30°C) or used in the next step of the purification procedure.
  • HIC hydrophobic interaction chromatography
  • the Ax-15 protein was eluted with a 77.0 L step of 5.0 mM sodium phosphate, 130 mM NaCI, pH 7.0-7.2. The eluate was simultaneously diluted 1 :5 into 10.0 mM sodium phosphate, pH 9.0-9.2 buffer without salt to reduce conductivity and increase pH. Peak material exceeding 20% maximum A 28 ⁇ on the ascending portion of the peak and 20% of the maximum A 280 on the descending portion of the peak was pooled. Pooled Ax-15 protein was stored frozen (-30°C) or used in the following step. Pooled SP FF sepharose Ax-15 protein was concentrated and diafiltered versus 5.0 mM sodium phosphate, pH 8.0-8.3 buffer with a 5,000 mwco AGT hollow fiber filter (ACG
  • the pool (24.66 g) was concentrated to ⁇ 5.0 L.
  • Concentrated, diafiltered Ax-15 protein was loaded onto a 50 L S- 100 Sephacryl (Pharmacia) sizing column and eluted with 250 L of the same 5.0 mM sodium phosphate buffer, pH 8.0-8.3. Peak material exceeding 40% maximum A 280 on the ascending portion of the peak and 40% of the maximum A 280 on the descending portion of the peak was pooled.
  • the pooled Ax-15 protein was filtered through Millipak 0.22 ⁇ m filters and stored at -80°C prior to dispensing or formulation.
  • the amino acid sequence of Ax-15 produced follows. Alternatively, one could produce a sequence which contains a
  • mice Normal ( ⁇ weeks) C57BL/6J mice were obtained from Taconic.
  • mice received daily subcutaneous injections of vehicle or Ax-15. The animals were weighed daily and food intake over 24-hours was determined between days 3 and 4. ob/ob mice As a result of a single gene mutation on chromosome 6, ob/ob mice produce a truncated, non-functional gene product (Leptin). These mice are hyperphagic, hyperinsulinemic, and markedly obese.
  • mice C57BL/6J ob/ob mice were obtained from Jackson Laboratory and used for experiments at 12-14 weeks of age. The mice received daily subcutaneous injection of vehicle, Ax-15, or leptin. Pair-fed group was given the average amount (g) of food consumed by animals treated with Ax-15 (0.3 mg/kg). Body weights were obtained daily and food intake over 24-hours was determined between days 3 and 4. On day 8, the animals were sacrificed and carcass analysis was performed.
  • AKR/J mice have been shown to be very susceptable to diet induced obesity by increasing body fat content. Although the gene- environment(diet) interaction is not completely known regarding this kind of dietary obesity, like in human obesity, the genotype is polygenic
  • AKR/J mice were obtained from Jackson Laboratory and put on a high fat diet (45% fat; Research Diets) at age 10-12 weeks old. All experiments commenced after 7 weeks on high fat diet.
  • the mice received daily subcutaneous injection of vehicle, Ax-15, or Leptin. Pair-fed group was given the average amount (g) of food consumed by animals treated with Ax-15 (0.1 mg/kg).
  • the animals were weighed daily and food intake over 24-hours was determined between days 3 and 4. On day 8, the animals were sacrificed and sera were obtained for insulin and corticosterone measurements.
  • Reagents Recombinant human Ax-15 was manufactured as set forth above and
  • Leptin was purchased from R & D Systems.
  • mice Ax-15 reduced body weight in normal mice in a dose dependent manner. In 6 days, the animals lost approximately 4%, 11%, and 16% of their body weight at 0.1 mg/kg, 0.3 mg/kg, and 1 mg/kg, respectively (Figure 17).
  • ob/ob mice There was a dose related (0.1 mg/kg - 3 mg/kg) decrease in body weight after Ax-15 treatment in ob/ob mice (figure 18). At a dose range of 0.1 mg/kg to 3 mg/kg, there was a 8%-25% reduction of body weight. Animals pair-fed to a specific dose of Ax-15 (0.3 mg/kg) showed equivalent loss of body weight as the mice given that dose of Ax-15, suggesting food intake is the primary cause of weight reduction.
  • Leptin was also effective in decreasing body weight in ob/ob mice. At 1 mg/kg, leptin decreased body weight 6% in 7 days, following a course almost identical to that of Ax-15 given at 0.1 mg/kg (figure 18).
  • Ax-15 reduced body weight in DIO mice dose dependently. Within one week, the animals lost approximately 14%, 26%, and 33% of their body weight when given Ax-15 at 0.1 mg/kg, 0.3 mg/kg, and
  • DIO mice when Ax-15 was administered in the same dose range (0.1 -1 mg/kg), DIO mice lost more than twice the body weight when compared to normal mice (see Figure 17). This higher sensitivity of diet-induced obese animals to Ax-15 suggests that adiposity may regulate the efficacy of Ax-15 such that Ax-15 will not cause continuous weight loss after adiposity is normalized. DIO mice are leptin resistant; no weight loss effect was observed in these animals with daily injection of leptin (1 mg/kg;
  • Ax-15 caused weight loss in normal mice in a dose dependent manner.
  • Ax-15 induced weight loss in ob/ob mice in a dose dependent manner.
  • Ax-15 (0.1 mg/kg) was as effective as Leptin (1 mg/kg) in causing weight loss in ob/ob mice.
  • Ax-15 caused weight loss in diet-induced obesity mice in a dose dependent manner, whereas Leptin was ineffective.
  • Ax-15 treatment attenuated obesity associated hyperinsulinemia in DIO mice; this effect was not observed in pair-fed control animals.
  • Ax-15 was more effective in inducing weight loss in DIO mice than normal or ob/ob mice.
  • our results suggest a specific useful application of Ax-15 in the treatment of leptin resistant obesity, such as type II diabetes associated obesity. 4.
  • the effectiveness of Ax-15 in reducing body weight in leptin resistant mouse model suggests that Ax-15 may also be effective in reducing body weight in obese humans who are resistant or unresponsive to Leptin.
  • Tables Results from carcass analysis of ob/ob mice
  • Applicants have generated several different pegylated Ax-15 molecules by covalently linking polyethylene glycol chains of different lengths and types to Ax-15 polypeptide molecules.
  • Ax-15 protein concentration ranging from 0.6 mg/ml to 6.0 mg/ml.
  • PEG/Ax-15 protein molar ratios up to 30:1.
  • reaction products were typically diluted with a low salt buffer and applied to an ion-exchange column.
  • the column was washed with a low salt buffer and eluted with a NaCI gradient ranging from 0 to 300mM NaCI in a 15mM Bicine buffer over a column packed with Q-HP anion exchange resin obtained from Pharmacia, Piscataway, NJ.
  • Q-HP anion exchange resin obtained from Pharmacia, Piscataway, NJ.
  • Different pools from the ion- exchange purification were concentrated and further purified by standard preparative size-exclusion chromatography.
  • PEG Ax-15 protein two close forms of PEG Ax-15 protein were pooled together and treated as one sample (e.g.: a sample marked PEG 5K (3,4)- 2°Amine- Ax 15 would consist predominantly of Ax-15 molecules attached with 3 or 4 chains of approximately 5KD PEG molecules using
  • EXAM P LE 15 In vivo experiments using P EG Ax-15 to treat obesity.
  • AKR/J mice have been shown to be susceptible to diet-induced obesity by increasing body fat content. Although the gene- environment (diet) interaction is not completely understood regarding this kind of dietary obesity, as in human obesity, the genotype is polygenic.
  • the following experiments were performed to test the effects of PEG Ax-15 on body weight and food intake in this experimental animal model of diet-induced obesity.
  • the particular molecule that is described in the experiments is called 1 -20-PEG Ax-15 and is just one of the many pegylated Ax-15 molecules produced by the procedures described above and tested in in. vivo experiments. This molecule is mono-pegylated with a 20 KD PEG chain via a 2° amine linkage.
  • Table 6 shows a Comparison of the In Vivo Activity of Various Pegylated Ax-15 Preparations.
  • mice Male AKR/J mice (The Jackson Laboratory, Bar Harbor, ME) were fed a high fat diet (with 45 kcal% from fat) starting at 10 weeks of age. By 17 weeks of age, the mice weighed about 30% more than lean littermates that were fed a normal chow diet and were termed diet-induced obesity (DIO) mice.
  • DIO mice diet-induced obesity mice.
  • PBS vehicle
  • non-pegylated Ax-15 0.7 mg/kg
  • 1 -20-PEG Ax-15 0.23 or 0.7 mg/kg
  • NIDDM Non Insulin Dependent Diabetes Mellitus
  • mice are insulin resistant and also exhibit a myriad of metabolic and hormonal abnormalities such as massive obesity, hyperphagia, and low energy expenditure (Kodama, H., et al., 1994 Diabetologia 37:739-744).
  • db/db as well as in human NIDDM, there is a diminished homeostatic control of glucose metabolism, highlighted by high plasma glucose levels as well as delayed glucose disappearance as evaluated by oral glucose tolerance testing (OGTT).
  • OGTT oral glucose tolerance testing
  • Systemic administration of ciliary neurotrophic factor (CNTF) is known to reduce the obesity in mice which lack either functional leptin (ob/ob mice) or the leptin receptor (db/db mice) (Gloaguen, I.
  • Ax-15 treatment results in an improvement in disposal of glucose and an increased sensitivity to insulin, which can not be attributed to decreased food intake and consequent weight loss.
  • insulin signaling involves a cascade of events initiated by insulin binding to its cell surface receptor, followed by autophosphorylation and activation of receptor tyrosine kinases, which result in tyrosine phosphorylation of insulin receptor substrates (IRSs) (Avruch, J., 1998, Molecular Cell Biochem 182:31-48).
  • PI 3-kinase phosphoinositide 3-kinase
  • the only PI3-kinases that are currently known to be stimulated by insulin are the class I heterodimeric p85/p1 10 catalytic PI3 kinases.
  • the p85 subunit acts as an adaptor which links the p110 catalytic subunit to the appropriate signalling complex.
  • the object of this study was to characterize the effects of Ax- 15, a modified CNTF, on the diabetic profile in the db/db mouse model of NIDDM.
  • mice Male db/db C57BL/KsJ mice (Jackson Laboratories, Bar Harbor, ME), aged 6-8 weeks, were housed in a room maintained at 69-75oC with lights on for 12 hours per day. All animal procedures were conducted in compliance with protocols approved by the Institutional Animal Care and Use Committee (IACUC). Starting at 10 weeks of age, mice were individually housed, received standard mouse chow (Purina Mills, Richmond, IN ) ad libitum and had free access to water. "Pair-fed" animals were provided with the same amount of food on a daily basis as the average amount ingested by the highest dose of Ax-15 in all studies reported. Ax-15 (0.1 and 0.3 mg/kg, s.c.) and vehicle (10 mM Sodium Phosphate, 0.05% Tween 80, 3% PEG 3350,
  • mice were studied to examine the effect of Ax-15 treatment on receptor signaling components. After the indicated times and doses of Ax-15 (see above), liver tissue was isolated and snap frozen for subsequent analysis. Tissue samples (100mg) were homogenized on ice in Buffer A (1% NP-40, 50 mM Hepes pH 7.4, 150mM NaCI, 1 mM EDTA, 30mM sodium pyrophosphate, 50mM Sodium Fluoride, 0.5mM sodium orthovanadate, 5 ⁇ g/ml aprotinin, 5 ⁇ g/ml leupeptin, 1 mM PMSF) and centrifuged for 10 minutes at 14,000g.
  • Buffer A 1% NP-40, 50 mM Hepes pH 7.4, 150mM NaCI, 1 mM EDTA, 30mM sodium pyrophosphate, 50mM Sodium Fluoride, 0.5mM sodium orthovanadate, 5 ⁇ g/ml aprotinin, 5 ⁇ g/ml leupeptin,
  • Lysate protein (2mg) was immunoprecipitated overnight at 4oC with either 5 ⁇ l of anti-p(tyr) antibody (4G10) or anti-IRS-1 antibody coupled to Protein A sepharose (Upstate Biotechnology, NY).
  • the immunoprecipitates were washed three times with Buffer A, resuspended in standard Laemmli sample buffer and heated for approximately 5 minutes at 65°C.
  • the protein samples were resolved by standard SDS-PAGE analysis on 6 or 8% precast gels and transferred to nitrocellulose membranes (Novex, CA) using a Trans Blot system (Hoeffer
  • the free floating sections were incubated overnight at 4oC with mouse anti-p(tyr) (4G10) at a 1 :1000 dilution to detect p(tyr) protein, washed, then incubated with biotinylated horse anti-mouse antibody diluted in buffer (KPBS/0.02% Triton X-100/1.0% BSA) at 1 :1500 dilution followed by avidin-biotin peroxidase (1 :500 in PBS; Vector Elite Kit, Vector Laboratories, Burlington, CA) both for 60 minutes and at room temperature. Between each step sections were washed thoroughly in PBS and the tissue-bound peroxidase was visualized by a diaminobenzidine (Sigma St Louis, MO) reaction mounted on gelatin- coated slides, dehydrated, and coverslipped.
  • a diaminobenzidine Sigma St Louis, MO
  • BW bodyweight
  • FIG. 25A-25C shows the results of an experiment that was designed to evaluate the physiological consequences of 10-day Ax-15 treatment on db/db mice.
  • Figure 25A Fasting blood glucose concentrations were determined with serum from db/db male mice treated for 10 days with Ax-15 (0.1 mg/kg/day and 0.3 mg/kg/day, hatched bars) as compared to control groups, vehicle treated (open bar), pairfed-vehicle treated (hatched bar) and age-matched heterozygous db/? mice (stippled). Each bar represents the mean of at least eight animals ⁇ SEM.
  • FIG. 25B Fasting insulin concentrations were determined on serum from db/db male mice treated for 10 days with Ax-15 (0.1 mg/kg/day and 0.3 mg/kg/day, hatched bars) as compared to control groups, vehicle treated (open bar), pairfed vehicle-treated (hatched bar) and age- matched heterozygous db/? mice (stippled). Each bar represents the mean of at least eight animals ⁇ SEM.
  • Figure 25C Fasting free fatty acid levels were determined on serum samples from db/db male mice treated for 10 days with Ax-15 (0.1 mg/kg/day and 0.3 mg/kg/day, hatched bars) in comparison to control groups, vehicle treated (open bar), pairfed-vehicle treated (hatched bar) and age-matched heterozygous db/? mice (stippled). Each bar represents the mean of at least eight animals ⁇ SEM.
  • IRS-1 insulin resistant/diabetic db/db mice
  • Analysis of the insulin resistant/diabetic db/db mice revealed a constitutively high p(tyr) immunoreactive staining pattern (Figure 26C) with no detectable change after insulin treatment ( Figure 26D).
  • Ten day Ax-15 treatment of db/db mice attenuated the high basal p(tyr) immunoreactivity ( Figure 26E and 26G) and restored insulin p(tyr) responsiveness (Figure 26F and 26H).
  • FIG. 27A-27B shows the results of an experiment designed to evaluate the effects of Ax- 15 treatment on insulin-stimulated signaling in the liver of db/db mice.
  • Male db/db mice were treated for 10 days with either vehicle (lanes 7 & 8), pairfed to drug treatment levels (lanes 1 & 2) or treated with Ax-15 (0.1 mg/kg/day, lanes 5 & 6; 0.3 mg/kg/day, lanes 4 & 5).
  • Non-immune control immunoprecipitation (Nl), no lysate control (NL), and 3T3-L1 lysate control for p85 (C) were run as immunoprecipitation and blotting controls.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Diabetes (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Endocrinology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Emergency Medicine (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)

Abstract

L'invention a trait à l'utilisation du facteur ciliaire neutrotrophique modifié Ax-15 dans la fabrication d'un médicament utilisé dans une méthode de traitement du diabète, en particulier du diabète sucré non insulino-dépendant ou du diabète gestationnel.
PCT/US2000/020432 1999-08-13 2000-07-27 Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation WO2001012810A1 (fr)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA002379940A CA2379940A1 (fr) 1999-08-13 2000-07-27 Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation
JP2001517694A JP2003507393A (ja) 1999-08-13 2000-07-27 改変された毛様体神経栄養因子、それらを作製する方法およびそれらの使用方法
IL14803300A IL148033A0 (en) 1999-08-13 2000-07-27 Modified ciliary neurotrophic factor, method of making and methods of use thereof
HU0203057A HUP0203057A3 (en) 1999-08-13 2000-07-27 Modified ciliary neurotrophic factor, method of making and methods of use thereof
EP00950767A EP1200589A1 (fr) 1999-08-13 2000-07-27 Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation
BR0013204-7A BR0013204A (pt) 1999-08-13 2000-07-27 Uso do fator neurotrófico ciliar modificado ax-15, métodos para tratar a diabetes, para reduzir a resistência à insulina, para aumentar a sensibilidade à insulina, para abaixar os nìveis de ácido graxo livre de soro, para tratar uma doença ou distúrbio do sistema endócrino, e para prevenir a ocorrência de diabetes gestacional ou diabetes mellitus não dependente de insulina, em um mamìfero, e, composição
AU63822/00A AU6382200A (en) 1999-08-13 2000-07-27 Modified ciliary neurotrophic factor, method of making and methods of use thereof
HK02107484.6A HK1046018A1 (zh) 1999-08-13 2002-10-16 修飾的睫狀神經營養因子，其製備方法及其使用方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US37383499A 1999-08-13 1999-08-13
US09/373,834 1999-08-13
US09/454,380 1999-12-03
US09/454,380 US6680291B1 (en) 1998-02-27 1999-12-03 Modified ciliary neurotrophic factor, method of making and methods of use thereof

Publications (1)

Publication Number Publication Date
WO2001012810A1 true WO2001012810A1 (fr) 2001-02-22

Family

ID=27006327

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/020432 WO2001012810A1 (fr) 1999-08-13 2000-07-27 Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation

Country Status (10)

Country Link
EP (1) EP1200589A1 (fr)
JP (1) JP2003507393A (fr)
CN (1) CN1387568A (fr)
AU (1) AU6382200A (fr)
BR (1) BR0013204A (fr)
CA (1) CA2379940A1 (fr)
HU (1) HUP0203057A3 (fr)
IL (1) IL148033A0 (fr)
PL (1) PL364931A1 (fr)
WO (1) WO2001012810A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002070698A2 (fr) * 2001-03-02 2002-09-12 Merck Patent Gmbh Facteur de croissance cntf à antigénicité réduite

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100439396C (zh) * 2004-04-02 2008-12-03 西南生物工程产业化中试基地有限公司 人睫状神经营养因子的衍生物多肽及其制备方法和应用
CN100457778C (zh) * 2005-09-02 2009-02-04 中国药品生物制品检定所 睫状神经营养因子(cntf)突变体及其生产方法和其用途
CN101144082B (zh) * 2007-06-12 2012-09-05 兰州生物制品研究所有限责任公司 重组人睫状神经营养因子、突变体及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998032458A1 (fr) * 1997-01-23 1998-07-30 Sumitomo Pharmaceuticals Company, Limited Remedes contre le diabete
US5846935A (en) * 1992-10-09 1998-12-08 Regeneron Pharmaceuticals, Inc. Modified ciliary neurotrophic factors
WO1999043813A1 (fr) * 1998-02-27 1999-09-02 Regeneron Pharmaceuticals, Inc. Facteur neurotrophique ciliaire modifie, procede de fabrication et procedes d'utilisation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5846935A (en) * 1992-10-09 1998-12-08 Regeneron Pharmaceuticals, Inc. Modified ciliary neurotrophic factors
WO1998032458A1 (fr) * 1997-01-23 1998-07-30 Sumitomo Pharmaceuticals Company, Limited Remedes contre le diabete
EP1010432A1 (fr) * 1997-01-23 2000-06-21 Sumitomo Pharmaceuticals Company, Limited Remedes contre le diabete
WO1999043813A1 (fr) * 1998-02-27 1999-09-02 Regeneron Pharmaceuticals, Inc. Facteur neurotrophique ciliaire modifie, procede de fabrication et procedes d'utilisation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ALS CNTF TREATMENT STUDY GROUP: "A double-blind placebo-controlled clinical trial of subcutaneous recombinant human ciliary neurotrophic factor (rHCNTF) in amyotrophic lateral sclerosis.", NEUROLOGY, vol. 46, no. 5, 1996, pages 1244 - 1249, XP000971863, ISSN: 0028-3878 *
GLOAGUEN I ET AL: "CILIARY NEUROTROPHIC FACTOR CORRECTS OBESITY AND DIABETES ASSOCIATED WITH LIPTIN DEFICIENCY AND RESISTANCE", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,US,NATIONAL ACADEMY OF SCIENCE. WASHINGTON, vol. 94, no. 12, 10 June 1997 (1997-06-10), pages 6456 - 6461, XP002058098, ISSN: 0027-8424 *
HE ET AL: "Preparation and a structure-function analysis of human ciliary neurotrophic factor", NEUROSCIENCE RESEARCH,IR,ELSEVIER, SHANNON, vol. 23, no. 4, November 1995 (1995-11-01), pages 327 - 333, XP002109251, ISSN: 0168-0102 *
NEGRO ET AL: "STRUCTURE-FUNCTION STUDIES OF HUMAN CILIARY NEUROTROPHIC FACTOR", NEUROCHEMICAL RESEARCH,US,PLENUM PRESS, NEW YORK, vol. 19, no. 2, February 1994 (1994-02-01), pages 223 - 227, XP002109252, ISSN: 0364-3190 *
PANAYOTATOS N ET AL: "EXCHANGE OF A SINGLE AMINO ACID INTERCONVERTS THE SPECIFIC ACTIVITY AND GEL MOBILITY OF HUMAN AND RAT CILIARY NEUROTROPHIC FACTORS", JOURNAL OF BIOLOGICAL CHEMISTRY,AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD,US, vol. 268, no. 25, 1993, pages 19000 - 19003, XP000941479, ISSN: 0021-9258 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002070698A2 (fr) * 2001-03-02 2002-09-12 Merck Patent Gmbh Facteur de croissance cntf à antigénicité réduite
WO2002070698A3 (fr) * 2001-03-02 2003-11-20 Merck Patent Gmbh Facteur de croissance cntf à antigénicité réduite

Also Published As

Publication number Publication date
EP1200589A1 (fr) 2002-05-02
BR0013204A (pt) 2004-02-17
PL364931A1 (en) 2004-12-27
CN1387568A (zh) 2002-12-25
CA2379940A1 (fr) 2001-02-22
HUP0203057A2 (hu) 2002-12-28
AU6382200A (en) 2001-03-13
JP2003507393A (ja) 2003-02-25
IL148033A0 (en) 2002-09-12
HUP0203057A3 (en) 2005-07-28

Similar Documents

Publication Publication Date Title
EP1056856B1 (fr) Facteur neurotrophique ciliaire modifie, procede de fabrication et procedes d'utilisation
US6440702B1 (en) Nucleic acids encoding modified ciliary neurotrophic factors
JP2004344175A (ja) 新規な神経栄養因子
JP2015057384A (ja) 薬学的使用のための新規のニュールツリン複合体
US9861682B2 (en) Treatment of hyperalgesia, spontaneous pain, and phantom pain
US6410510B1 (en) Administration modified ciliary neurotrophic factors
WO2001012810A1 (fr) Facteur cilaire neurotrophique modifie, son procede de production et ses procedes d'utilisation
US6680291B1 (en) Modified ciliary neurotrophic factor, method of making and methods of use thereof
WO1998039357A1 (fr) Procedes pour soulager les douleurs neuropathiques
WO1993009798A1 (fr) Methodes therapeutiques et diagnostiques basees sur l'expression de nt-3 specifique de tissus et sur la liaison de recepteurs
AU2002300005B2 (en) Method of alleviating neuropathic pain
CA2113815A1 (fr) Purification du facteur neurotrophique ciliaire recombinant, facteur neurotrophique ciliaire a extremite c-terminale tronquee et methodes de traitement des lesions neurales peripheriques
JP2001524944A (ja) 神経障害性疼痛の緩和方法
CA2221391A1 (fr) Systeme de regulation du developpement des neurones et des tumeurs neurales, anticorps diriges contre lui et utilisations du systeme

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000950767

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2379940

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 63822/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 148033

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 008142947

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2000950767

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000950767

Country of ref document: EP