WO2001006004A2 - Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede - Google Patents

Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede Download PDF

Info

Publication number
WO2001006004A2
WO2001006004A2 PCT/EP2000/006887 EP0006887W WO0106004A2 WO 2001006004 A2 WO2001006004 A2 WO 2001006004A2 EP 0006887 W EP0006887 W EP 0006887W WO 0106004 A2 WO0106004 A2 WO 0106004A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
primer
heeled
population
heeled primer
Prior art date
Application number
PCT/EP2000/006887
Other languages
English (en)
Other versions
WO2001006004A3 (fr
Inventor
Peter Richardson
Peter Cox
Original Assignee
Cambridge University Technical Services Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cambridge University Technical Services Ltd. filed Critical Cambridge University Technical Services Ltd.
Priority to EP00954533A priority Critical patent/EP1196639A2/fr
Priority to KR1020027000769A priority patent/KR20020034161A/ko
Priority to JP2001511213A priority patent/JP2003505034A/ja
Priority to CA002378070A priority patent/CA2378070A1/fr
Priority to AU66956/00A priority patent/AU6695600A/en
Publication of WO2001006004A2 publication Critical patent/WO2001006004A2/fr
Publication of WO2001006004A3 publication Critical patent/WO2001006004A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/131—Modifications characterised by incorporating a restriction site
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • a method for amplifying low abundance nucleic acid sequences and means for performing said method is provided.
  • the present invention relates to methods as well as to nucleic acid primers and kits containing the same for performing efficiently an amplification of nucleic acid sequences from a sample, particularly of nucleic acid sequences that are initially poorly represented in said sample.
  • DNA sequence information resulting from genome and expressed sequence tag (EST) sequencing projects is expected to provide the basis for further understanding of the control and mode of action of individual, and groups of gene products.
  • tissue cellular systems such as the immune and nervous systems, are composed of highly heterogeneous cell populations.
  • a key factor lies in understanding their physiology, and the role of specific gene products expressed with the ability to examine gene usage in the context of this cellular diversity.
  • PCR polymerase chain reaction
  • the former is technically difficult, whilst the latter may be biased against long transcripts and often requires subsequent cloning of the amplified products.
  • a method for expression profiling in single cells using 3' end amplification PCR has been developed by Dixon et al. (1998, Nucleic acids research, vol. 26 (n°19): 4426-4431). This method comprises a first step wherein mRNA species present in a cell are reversed transcribed using a first heeled primer, thereby providing a population of first strand cDNA species and a second step wherein partial 3' end second cDNA strand populations are synthesized using a second heeled primer population.
  • the inventors have developed sensitive methods for amplifying mRNA species present in a sample that allows the detection and cloning of one or several mRNA species of interest, particularly mRNA species which are initially present at a low copy number in a sample to be assayed. For instance, when applying the new method of the invention to mRNA samples obtained from cholinergic neurones, the inventors have succeeded in detecting the expression of low abundance A1 receptor mRNA at levels 50 fold lower than those possible using previous methods. In addition, when applying the method of the invention to 2.5 ng of total RNA (equivalent to that contained in approximately 250 cells), specific gene sequences could be detected using one millionth of the final product.
  • the present invention also relates to methods for increasing the number of nucleotide sequences corresponding to the mRNA species present initially at a low copy number in a sample to be assayed.
  • this technology allows high throughput analysis systems, e.g. arrays or gene chips to be used to analyse gene expression on extremely small samples, including analysing the expression of genes in a single cell.
  • the invention also pertains to various technical means that are necessary to perform these methods, and particularly to oligonucleotide primers that are required to perform the methods of the invention.
  • kits that are specially designed to perform the disclosed methods, particularly kits containing the oligonucleotide primers mentioned above.
  • Figure 1 Detection of gene specific sequences after amplification of cDNA derived from 100 pg of total RNA using the first embodiment of the method of the present invention.
  • Figure 2 Detection of gene specific sequences after amplification of cDNA derived from total RNA using the second (l)and third (II) embodiments of the method of the present invention.
  • Figure 3 Diagram to illustrate product priming/product repair after amplification of small amounts of cDNA using the first and second embodiment of the method of the present invention.
  • Figure 4 Detection of gene specific sequences after high stringency amplification of cDNA derived from 1000pg of total RNA using the third embodiment of the method of the present invention.
  • Figure 5 Detection of gene specific sequences after in vitro transcription of RNA from amplified cDNA derived from liver total RNA using the third embodiment of the method of the present invention.
  • Figure 6 Size distribution of the RNA produced after incubating the amplification products obtained according to the third embodiment of the present invention in the presence of T7 polymerase (complementary RNA, left) or T3 polymerase (sense RNA right).
  • Figure 7A Visualisation of the amplification products obtained according to the third embodiment to step d) after gene specific amplification with primers specific for tubulin, RL3, Synaptotagmin 1 and A2A receptor.
  • Figure 7B Visualisation of the amplification products obtained according to the third embodiment of the method that have been transcribed in vitro into the corresponding sense RNA using T3 RNA polymerase, and then reverse transcribed prior to gene specific PCR.
  • Low amounts of mRNA is intended to designate the amount of mRNA present in a maximum of 1000 cells, 1 to 100 cells being preferred, considering that in general, there are between 1 and 100 copies of any given mRNA present in a given cell.
  • Increase the number of nucleotide sequences corresponding to the mRNA species present in a sample is intended to designate an increase in nucleotide sequence to obtain a number of copies which is sufficient to allow at least one of the following methods: (i) detection of the sequence of interest with specific oligonucleotide probes;
  • Sample is intended to designate material which contains the mRNA which is to be analyzed. For example a cellular extract obtained from 1 to 1000 cells.
  • High molecular weight DNA is intended to designate any nucleic acid species which is outside the expected range of molecular weight observed for natural mRNA species. Preferably any nucleic acid sequence with a size above 5kb.
  • the first embodiment of the amplification method takes advantage of the generation high molecular weight DNA molecules are formed following amplification of the cDNA species obtained through reverse transcription of the initial mRNA species present in the sample.
  • the inventors have found that these high molecular weight DNA molecules or bridged products may result from the formation of partially duplexed DNA molecules during the annealing step.
  • These partially duplexed DNA molecules would contain partially complementary sequences that hybridize with one another in the low stringency hybridization conditions used, thus forming bridges between two structurally related or unrelated amplified cDNA molecules contained in the amplification mixture. Repetitive amplification cycles result in large nucleic acid molecules.
  • the first embodiment makes use of the high molecular weight DNA produced by this process to analyze amplified species of interest.
  • the first embodiment makes use of these findings by providing a process which by favoring an increase in the production of these high molecular weight DNA molecules in particular, allows to amplify mRNA species present in a low quantity in a sample to be analyzed.
  • a method to increase the number of nucleotide sequences corresponding to the mRNA species present in a low quantity in a sample comprising: a) reverse transcribing said mRNA species using a first heeled primer population to provide first strand cDNA sequences;
  • step b) amplifying said first and second cDNA strands resulting from step b) over a number of amplification cycles with the aid of a thermoresistant DNA polymerase(s) with: (i) a first primer comprising at least a portion of the heel sequence of the first heeled primer; and
  • said method is characterized in that it comprises the steps of: d') increasing the proportion of high molecular weight DNA molecules, e') using or analyzing specific nucleic acid sequences present in the high molecular weight DNA molecules,
  • heeled primer will be readily understood in the art to be a primer comprising a hybridizing region and a non-hybridizing region, wherein the non-hybridizing region represents the " heel " of the primer.
  • the first heeled primer is actually a population of individual primer species.
  • the first heeled primer population consists of a population of nucleic acid sequences each comprising, from 5' end to 3' end:
  • the components described in iii and iv being capable of hybridizing to a mRNA molecule at the 5' end of the poly-A tail thereof, wherein substantially every possible variable sequence combination is found in said first heeled primer population .
  • variable sequence of 2 to 4 nucleotides is selected among the following variable nucleotides sequence:
  • N is a nucleotide selected from A, T, C or G.
  • the first heeled primer may also comprise an RNA polymerase binding site, such as the T7, T3 or SP6 promoter, located between the oligo dT sequence and the heel.
  • an RNA polymerase binding site such as the T7, T3 or SP6 promoter
  • the second heeled primer is also a population of individual primer species.
  • each cDNA species will hybridize with at least one second heeled primer, (partly because of the selection of nucleotide sequences amongst the second heeled primers), second cDNA strand synthesis then proceeds in a 5' to 3' direction from the hybridized second primer.
  • the second heeled primer population may comprise primers differing by up to five nucleotide bases (differing in the hybridizing region), the second heeled primer population preferably comprising a number of primers in the range 1000 to 100,000 primers, more preferably in the range 1024 to 65536 primers.
  • the primers of the second heeled primer population preferably each comprise a first variable sequence of nucleotides in the range of 4 to 7 nucleotides 3' to the heel and a second variable sequence of at least 5 nucleotides contiguous 3' therewith. As will be appreciated, where there are 5 random nucleotides (which is preferred) there will be 4 5 (i.e. 1024) possible pentamer sequences.
  • the second variable sequence of this primer may be selected by sequence analysis of known sequences so as to promote the ability of the second heeled primer as a whole to hybridize to the transcribed cDNA species. Sequence analysis can be carried out through databases of DNA or RNA sequences. In particular, known sequences of the organism of interest are preferably consulted.
  • the second variable sequence of nucleotides preferably comprises a number of nucleotides in the range 2 to 10 nucleotides. In a particularly preferred embodiment, the second variable sequence of nucleotides may comprise a number of nucleotides equivalent to the number of nucleotides in the first variable sequence of this primer.
  • the second variable nucleotide sequence of the second heeled primers may be constant throughout the population of these primers and it is selected so as to stabilize the primers and to ensure optimal efficiency of hybridization to the target first strand cDNA species.
  • the second heeled primer from the population of second primers preferably hybridizes on average once in every 1 kb portion of first strand cDNA species. This has been found to produce optimal amplification of mRNA in a sample.
  • Particularly preferred second variable sequences of nucleotides in the second primers are: 5'-CGAGA-3 ⁇ 5'-CGACA-3 ⁇ 5'-CGTAC-3' and 5'-ATGCG-3'
  • the non hybridizing heel regions of the first and second heeled primers are preferably selected so that they lack the ability to hybridize to mRNA or first strand cDNA.
  • the heel regions like the hybridizing or variable sequence regions of the second primers, are selected by analysis of known nucleotide sequences.
  • the heel regions preferably comprise sequences absent from the mRNA species in the sample.
  • the heel regions may simply comprise sequences absent from the genome of the organism from which the sample is taken.
  • the heel regions preferably comprise a number of nucleotides in the range 15 to 22, more preferably 18 to 20 nucleotides.
  • the heel sequences are chosen among nucleic acid sequences having a GC content of about 50%, or for example from about 43% to about 55% of the heel sequence.
  • a particularly preferred heel sequence of the second heeled primer population is the following nucleic acid sequence of SEQ ID N°1 :
  • the particular temperatures, enzymes and reagents (other than the first heeled primer) used in the process of reverse transcription in step a) may be those already known in the art.
  • step a) is performed at 37°C in the presence of a reverse transcriptase.
  • the frequency with which an individual second heeled primer population species hybridizes along a given length of nucleic acid may be adjusted by employing suitable hybridizing conditions.
  • the hybridization conditions are of limited stringency so enabling efficient hybridization of the first variable sequence to target cDNA.
  • the degree of stringency and the number of contiguous random bases in the second heeled primers may be varied according to routine trial and error in order to achieve the desired frequency of hybridization of second heeled primer species along a given length of nucleic acid material.
  • the conditions for the hybridization between the second heeled primer and the first cDNA strands obtained at step a) are of low stringency.
  • step b) synthesis of the second cDNA strands is performed in the presence of DNA polymerase, preferably a Taq polymerase, in a suitable elongation buffer solution.
  • DNA polymerase preferably a Taq polymerase
  • the amount of second heeled primers added to the buffer solution vary from 0.01 ng to 10 ng in the elongation reaction buffer solution.
  • the annealing buffer may comprise a concentration of magnesium, generally up to 6 mM magnesium, preferably between 1.5 mM and 6 mM magnesium and most preferably about 4.5 mM magnesium.
  • the temperature of annealing between the second heeled primer and the first cDNA strands is of about 50°C and the elongation temperature in the presence of the suitable DNA polymerase is of about 72°C.
  • the cDNA molecules that are generated at the end of step b) are highly representative of the spectrum of mRNA molecules in a sample, as mRNA species of low abundance are reverse-transcribed to the same level of efficiency as more abundant mRNA species.
  • step c) The amplification reaction of step c) is performed with a pair of oligonucleotide primers that respectively comprise at least a portion of the heel sequence of the first and second heeled primers that are defined above.
  • the first primer of step c) is preferably the heel of the first heeled primer.
  • the second primer of step c) is preferably the heel of the second heeled primer.
  • the second primer of step c) may be the same as the second heeled primer and this can be advantageous in reducing the number of reagents needed to perform the first embodiment
  • a further alternative is to use the second heeled primer as the sole primer.
  • the amplification reaction of step c) is performed using low stringency hybridization conditions.
  • amplification reactions are performed in the presence of a concentration of magnesium generally up to 5 mM, preferably between 4 mM and 5 mM magnesium and most preferably of about 4.5 mM magnesium.
  • each amplification cycle comprises a denaturing step at 92°C, an annealing step at 60°C and an elongation step at 72°C.
  • the amplification reaction of step c) comprises from 30 to 50 amplification cycles, and most preferably comprises about
  • the cDNA may be submitted to in vitro transcription either immediately after step c) if the appropriate concentration of cDNA is present in the sample or after further amplification, such as through step d'), steps d) and e) which is/are discussed in more detail below.
  • at least one of the primers used in step a), b) and/or c) comprises a RNA polymerase binding site such as the T7 RNA polymerase promoter.
  • the RNA generated can then be subjected to further process steps, for instance by being labeled during reverse transcription and hybridized to DNA arrays.
  • cDNA generated in the presence or absence of a labeled substrate can be used in gene-specific PCR experiments.
  • Step d') In the preferred embodiment of step d'), step d') is a combination of the following steps d) and e).
  • the reaction mixture containing the population of amplified DNA molecules which include the "bridged products” can be diluted to obtain a diluted cDNA solution containing a cDNA concentration which is between 2 and 100 x inferior to the cDNA concentration of the product of step c).
  • the diluted cDNA concentration ranges between about 2 and 100 times less, and most preferably between 40 and 80 times less, than the initial cDNA concentration found in the reaction mixture obtained at the end of step c).
  • This dilution step is essential for performing the further steps of the method as it results in the almost complete elimination of the primers initially added to the amplification mixture.
  • step e consists of adding a thermoresistant DNA polymerase to the diluted cDNA solution of step d) and performing a further set of amplification reaction cycles without adding further primers.
  • the amplification of step e) is performed without adding any primers to the diluted cDNA solution obtained at step d). Because no exogenous primers are added, the annealing step results in the hybridization between different amplified DNA molecules initially present in the diluted cDNA solution, which are then elongated before the resulting duplex elongated cDNA molecules are denatured at the end of each amplification cycle.
  • step e also results in an increase of the number of bridged DNA molecules having a high molecular weight and therefore in an increase in the number of bridged but appropriately amplified genes from the sample.
  • the amplification reaction of step e) is performed for a number of amplification cycles ranging from 20 to 40 amplification cycles, more preferably from 25 to 35 amplification cycles and is most preferably of about 30 amplification cycles.
  • a number of amplification cycles ranging from 20 to 40 amplification cycles, more preferably from 25 to 35 amplification cycles and is most preferably of about 30 amplification cycles.
  • other cycle numbers could be envisaged.
  • One parameter of the optimum number of cycles required is determined by the polymerase used.
  • the amplification reaction of step e) is performed at hybridization conditions of low stringency, but with a greater stringency than the hybridization conditions used in the amplification reaction of step c).
  • the magnesium concentration generally used is up to 4,5mM, preferably between 1.5 mM and 4.5 mM magnesium and most preferably about 3.5 mM.
  • each amplification cycle comprises the following steps of: (i) obtaining single stranded DNA molecules by incubating the sample at a temperature comprised between 85°C and 95°C;
  • the amplification reaction of step e) comprises a denaturation step at 92°C, an annealing step at a temperature comprised between 55°C and 72°C, for example 55°C, 60°C, 65°C or 72°C, and an elongation step at 72°C in the presence of a suitable DNA polymerase.
  • step e') comprise a combination of the following steps f) and g).
  • the amplification mixture which contains a population of amplified heterogeneous cDNA molecules is then submitted to a further step (step f) wherein the high molecular weight cDNA species, preferably those having a length of at least 4.5 kb, are separated.
  • step g) consists of confirming the presence of at least one nucleic acid sequence species contained in the high molecular weight cDNA separated at step f)
  • the high molecular weight cDNA species previously separated at step f) can readily be used, typically for detecting the presence of at least one nucleic acid sequence of interest.
  • the amplification method may comprise an additional amplification step following step f), which consists of submitting at least a part of the high molecular weight DNA molecules separated at step f) to a further amplification reaction using a pair of primers, wherein a first primer comprises a portion of the first heel sequence and the second primer comprises a portion of the second heel sequence.
  • Step g) of the amplification method comprises anyone of the following methods:
  • the resulting cDNA may also be submitted to in vitro transcription.
  • one of the primers comprises a RNA polymerase binding site such as the T7 RNA polymerase promoter.
  • the RNA generated can then be subjected to further process steps, for instance either by being labeled and attached to DNA arrays for hybridization experiments or by being reverse transcribed, optionally using a fluorescent, radioactive or otherwise labeled substrate, to generate labeled cDNA strands.
  • the resulting labeled cDNA can then be hybridized to a DNA array or used in gene- specific PCR experiments.
  • any of the reactants used in any one of the 3 embodiments of the invention can be very useful in that it allows the skilled person to directly hybridize to a DNA array the products of the process of the present invention.
  • the inventors came to the conclusion that even though the "bridged sequences" refered to previously contain useful and exploitable information on the genes present in the sample to be analyzed, it would be useful to reduce bridge formation in order to obtain individual gene sequences in better yields and which could then be analyzed more specifically.
  • a key element of embodiments II and III described below resides in preventing or at least reducing the formation of "bridge sequences" to the largest extent possible. Therefore, the methods of embodiments II and III are characterized in that they comprise a process step which allows either to prevent or to reduce the formation of "bridged sequences” following reverse transcription and amplification of the nucleic acid sequences present in the sample to be analyzed.
  • the generation of a large number of high molecular weight DNA molecules is prevented or reduced by inserting a nucleic acid sequence encoding a cleavage site, in particular a restriction endonuclease site, at least in the heel sequence of the second heeled primer
  • another object of this invention consists of a method to increase the number of nucleic acid sequences corresponding to the mRNA species present in a low quantity in a sample, wherein said method comprises the steps of: a) reverse transcribing said mRNA species using a first heeled primer population to provide first strand cDNA sequences; b) synthesizing second cDNA strands from said first strand cDNA sequences using a second heeled primer population, wherein each of the primers of said first, and/or second heeled primer population optionally contains a rare cleavage site in particular a rare restriction site located at the 3' end of its heel sequence; c) amplifying the first and second cDNA strands resulting from step b) over a number of amplification cycles with: (i) a first primer comprising at least a portion of the heel sequence of the first heeled primer; and
  • a second primer comprising at least a portion of the heel sequence of the second heeled primer; d') cutting any large DNA molecules and preventing bridge formation in subsequent steps by suppressing the heel portions of at least one said first or second heeled primer e') increasing the amount of long double strand products with sequences more 5' from the original mRNA.
  • the first amplification reaction of step c) of this second method is performed under low stringency hybridization conditions.
  • the low stringency hybridization conditions used at step c) increase the chances to elongate any sequence present initially in the sample containing the first and second cDNA strands population.
  • the amplification reaction of step c) includes the following steps of:
  • the amplification reaction of step c) includes a denaturation step at 92°C, an annealing step at 60°C and an elongation step at 72°C.
  • the amplification reaction step of the first and second cDNA strands comprises between 30 and 50 amplification cycles, more preferably between 35 and 45 amplification cycles, most preferably about 40 amplification cycles.
  • cycle numbers could be envisaged.
  • One parameter of the optimum number of cycles required is determined by the polymerase used.
  • step d') consists of incubating the product obtained at step c with at least one restriction enzyme that specifically recognise the cleavage site in particular a rare restriction sites included in the primers.
  • the DNA molecules amplified in step c) are incubated in step d) with two restriction enzymes recognizing the rare cleavage site in particular a rare restriction sites of the first and the second heeled primers.
  • the rare cleavage site in particular a rare restriction site sequence present at the 3' end of the heel of at least the second heeled primer is a sequence recognized by the Mlul restriction enzyme.
  • Restriction cleavage in step d) is performed using the conventional restriction cleavage techniques well known to those skilled in the art such as described for example in Sambrook, J., Fritsch, E.F. , and T. Maniatis, (1989, Molecular cloning: A laboratory Manual . 2nd ed.; Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). Step e'):
  • step e') is a combination of the following steps e) and f).
  • the cleavage step can be followed by step e) wherein the product of step d) is diluted by an order of magnitude of 2 to 100 times in order to almost completely eliminate the primers used for the first amplification of step d). This favours the phenomenon of self priming ( as shown in figure 3) in the further set of amplification reaction cycles of step f).
  • the product of step d) is diluted 10 to 80 times and is most preferably diluted about 40 times.
  • step f) consists of adding a thermoresistant DNA polymerase to the diluted sample of step e) and performing a further set of amplification cycles without adding further nucleic acid primer. Subsequently to the dilutions of step e), a further set of amplification cycles without adding further nucleic acid primers can advantageously be performed in a step f).
  • each amplification cycle of step f) comprises the following steps of: (i) obtaining single stranded DNA molecules by incubating the sample at a temperature comprised between 85°C and 95°C;
  • step (ii) annealing the single stranded DNA molecules obtained at step (i) at a temperature comprised between 55°C and 75°C;
  • thermoresistant DNA polymerase elongating the annealed DNA molecules using a thermoresistant DNA polymerase at a temperature comprised between 65°C and 75°C;
  • the denaturation step is performed at 92°C
  • the annealing step is performed at 55°C, 60°C, 65°C or 72°C
  • the elongation step is performed at 72°C.
  • the amplification cycles carried out in step f) compris between 10 and 40 cycles, more preferably between
  • the set of amplification cycles carried out in step f) is preferably performed under low stringency hybridization conditions, the presence of about 3.5 mM magnesium.
  • the method comprises a further step wherein the DNA molecules obtained at step f) having a length of less than 50 base pairs are discarded from the reaction mixture.
  • step g) can comprises one or several of the following methods:
  • the amplified cDNA obtained from the reverse transcription and amplification of the nucleic acid sequences of the sample may be submitted to in vitro transcription either immediately after step d) if the appropriate concentration of cDNA is present in the sample or after further amplification such as through steps e), f) and g).
  • at least one of the primers comprises a RNA polymerase binding site such as the T7 RNA polymerase promoter.
  • the RNA generated can then be subjected to further process steps, for instance either by being labeled and hybridized to DNA arrays or by being reverse transcribed, optionally using a fluorescent, radioactive or otherwise labeled substrate, to generate labeled cDNA strands.
  • the resulting labeled cDNA can then be hybridized to a DNA array or used in gene-specific PCR experiments.
  • this cleavage site can be located either on the first heeled primer, on the second heeled primer, on both primers or on primers used in step c). However, it is necessary that at least one primer comprise a cleavage site.
  • the first heeled primer population consists of a population of nucleic acids comprising, from 5' end to 3' end:
  • a heel sequence of 15 to 22 nucleotides in length which is not complementary to the mRNA molecules present in the sample or with the first strand cDNA molecules synthesized at step a) and wherein the heel sequence optionally includes the nucleotide sequence of a rare cleavage site in particular a rare restriction site located at its 3' end;
  • variable sequence of 2-4 nucleotides in length. This sequence is able to hybridize to a mRNA molecule at the 5' end of the poly-A tail thereof, wherein substantially every possible variable sequence combination is found in said first heeled primer population.
  • the variable sequence of 2-4 nucleotides in length of the first heeled primer is selected among the following variable nucleotide sequence: 5'-(A or G or C)-N ⁇ - 3 -3', wherein N is a nucleotide selected from A, T, C or G.
  • the first heeled primer may therefore also include the sequence of a rare cleavagecleavage site in particular a rare restriction site, cleavage site in particular a rare restriction sitecleavage site in particular a rare restriction sitecleavage site in particular a rare restriction sitecleavage site in particular a rare restriction site.
  • the sequence of a rare cleavage site in particular a rare restriction site is usually located within or close to the 3' end of its heel sequence.
  • cleavage site in particular a rare restriction site is to be positioned so as to leave as few bases as possible from the heel after restriction enzyme cutting so as to avoid subsequent aberrant hybridization between the remaining and generated sequences.
  • the cleavage site in particular a rare restriction site is selected from the so-called 'rare cutter' the group which comprises, for example, Not1 Bsshll, Narl, Mlul, Nrul and Nael.
  • the cleavage site in particular a rare restriction site of the first heeled primer is identical to the cleavage site in particular a rare restriction site of the second heeled primer.
  • the cleavage site in particular a rare restriction site of said first heeled primer may be different from the cleavage site in particular a rare restriction site of the second heeled primer.
  • the second heeled primer population consists of a population of nucleic acid sequences each comprising, from 5' end to 3' end:
  • RNA polymerase promoter sequence (ii) An optional but preferably present RNA polymerase promoter sequence, (iii) a first variable sequence of 4 to 7 nucleotides in length selected such that substantially every possible sequence combination of 4 to 7 nucleotides is found in said second heeled primer population; and (iv) a second variable nucleotide sequence that was calculated to hybridize on average once in every 1 kb portion of said first strand cDNA molecules under low stringency hybridization conditions.
  • the cleavage site is located within the heel sequence. More preferably, the cleavage site in particular a rare restriction site is located at the 3' end of the heel sequence of the second heeled primer population, and is a rarely occurring cleavage site in particular a rare restriction site in the genome from which the initial mRNAs are expressed.
  • the cleavage site in particular a rare restriction site is selected among the cleavage site in particular a rare restriction sites that are found less than once every 20 kb in the genome of the organism from which the cDNA amplification is sought.
  • such rare cleavage site in particular a rare restriction site is selected from the so- called 'rare cutter' group of cleavage site in particular a rare restriction sites which comprises, for example, Not1 , Bsshll, Narl, Mlul, Nrul and Nael.
  • the heel sequence of the second heeled primer consists of the nucleotide sequence of SEQ ID N°2, CTGCATCTATCTAGTACGCGT.
  • said second variable sequence is chosen from the group of sequences consisting of 5'-CGAGA-3', 5'-CGACA-3 ⁇ 5'-CGTAC-3' and 5'-ATGCG- 3', such that each of said second variable sequence is found in said second heeled primer population.
  • the invention further relates to a kits for the amplification of the mRNA species present in a sample, wherein said kit compris: (i) a first heeled primer population; and (ii) a second heeled primer population, as defined above for either embodiments I or II.
  • the invention also pertains to a kit for the amplification of the mRNA species presenting a sample wherein said kit further comprises: (iii) a first primer consisting of the heel sequence of the first heeled primer;
  • the mRNA amplification kit may further comprise one or more restriction enzymes that recognize the rare cleavage site in particular a rare restriction site sequence that may be present in the heel sequence of the heeled primers.
  • said mRNA amplification kit may further comprise a restriction enzyme that recognize the rare cleavage site in particular a rare restriction site sequence that may be present in the heel sequence of the first heeled primer.
  • the kit may also include a suitable RNA polymerase.
  • bridges were cleaved by using a primers containing a rare cleavage site in its heel sequence. This allowed cleavage by a cleaving agent, preferably a restriction endonuclease, of the long cDNA molecules formed during the first set of amplification cycles.
  • a cleaving agent preferably a restriction endonuclease
  • the conditions for performing the third embodiment have been chosen to further reduce bridge formation.
  • Such conditions include for example, (apart from the optional presence of a restriction site on the primer) increasing the stringency of hybridization with respect to the stringency used in embodiment 1 or 2, for example by optimizing buffer conditions which will in turn decrease mis-hybridizations and/or increasing the GC content of the primers which allows elevated annealing temperatures, which also reduces mis-hybridization and increases the distance between hybridized paired oligonucleotides.
  • the method of embodiment III is a method to increase the number of nucleotide sequences corresponding to an mRNA species present in a sample in a low quantity comprising the steps of: a) reverse transcribing the mRNA species using first heeled primer population to provide first strand cDNA species; b) synthesizing second cDNA strands using a second heeled primer population; c) amplifying said second cDNA strands resulting from step b) over a number of amplification cycles in order to generate second cDNA strands comprising heels at both ends and increasing the number of second cDNA strands corresponding to long mRNA species present initially in the sample to be assayed; d) amplifying the DNA molecules resulting from step c) under hybridization conditions which are of a higher stringency than those of step c) and which enable reduction of the synthesis of high molecular weight cDNA molecules; and e) recovering the population of DNA molecules obtained at step ).
  • step a) is the same as for the first and the second embodiments, except that the first heeled primer population comprises a heel sequence that must have a GC content ranging from 60% to 80% and which is most preferably of about 75%, in order to permit an increase in the stringency of the hybridization conditions used in the first set of amplification cycles of step c), thereby reducing the formation of nucleic acid bridges inside the amplified cDNA molecule.
  • Step b) of synthesis of the second cDNA strands is also performed at hybridization conditions of a higher stringency than the hybridization conditions used in step b) as described for the first and the second embodimentsof the invention.
  • Step b) is preferably performed at high stringency conditions.
  • a preferred example of high stringency conditions is as follows: synthesizing second cDNA strands using a second heeled primer population preferably at a concentration ranging between 0.02 to 200 ng per reaction in the following conditions;
  • Hgh stringency hybridization conditions are notably obtained according to the specific structural features of the second heeled primer used.
  • step b) is performed in the presence of a magnesium concentration generally up to 5 mM magnesium, preferably between 3 and 5mM magnesium, most preferably of 3.5 mM.
  • the thermoresistant DNA polymerase is preferably added at step (b) in an amount that rangesfrom 3U to 5U, most preferably 4.5U DNA polymerase in a volume of 1 ⁇ l.
  • step (b) is performed in the presence of both a thermoresistant DNA polymerase and a proof reading enzyme. This enzyme being added at the same time as the DNA polymerase and in an amount which preferably ranges from 0.1 U to 0.5U, most preferably 0.25 U and is admixed with the DNA polymerase in a volume of 1 ⁇ L
  • step (b) (iv) it is performed for a period of time preferably from 1 min to 3 min, most preferably during 2 min.
  • step (b) (v) it is preferably performed at a temperature of 50°C for a period of time generally up to10 min, preferably between 4 min and 10 min, more preferably 6 min and 8 min and most preferably 7.5 min.
  • step (b) (vi) it is preferably performed at a temperature of 72°C for a period of time comprised between 1 min and 5 min, preferably between 2 min and 4 min and most preferably during 2.5 min.
  • High amounts of second heeled primer population used in steps b) and c) increases the probability of annealing of at least one primer to every sequence contained in the first cDNA strands previously synthesized at step a).
  • Step c) Although the inventors do not wish to be bound to any particular theory, it appears that through the successive cycles of the amplification reaction of step c), the sequences that contain at their 5'-end the heel sequence of the second heeled primer will anneal to the first strand cDNA in order to generate second cDNA strands comprising heels at both ends. These repetitive cycles of step c) increase the chances of detecting every first strand present in the reaction mixture of step b).
  • step c no denaturation is performed during the successive cycles.
  • This situation permits an increased efficiency in long sequence elongation by allowing the polymerase to work through several cycles without removing the primers or short DNA sequences hybridized to the first strand.
  • the inventors believe that the polymerase may actually displace small sequences hybridized to the first strand during the elongation to favor the extension of longer sequences already hybridized to this first strand.
  • step c denaturation is performed under mild temperature conditions, preferably in the range of 80 to 85°C.
  • small mismatched sequences generally of less than 50 bp in length and preferably at least the second heel primers, are removed from their hybridization site on the first strand and are thus available for further priming in subsequent reactions. The further increases the yield in the amplification of the second strand cDNA.
  • denaturation is performed under usual temperature conditions, preferably in the range of 85 to 95°C.
  • the first and second cDNA strands previously synthesized are preferably amplified over a number of amplification cycles with the second heeled primer at a concentration ranging between 0.02 to 200 ng per reaction, preferably 0.02 to 100 ng, more preferably between 1 and 50 ng and most preferably between 1 and 10 ng.
  • the preferred amount of second heeled primer population used in step c) increases the probability of annealing of at least one primer to every sequence contained in the first and second cDNA strands previously synthesized at steps a) and b).
  • a population of approximately 4 17 primers is used during the amplification reaction of step c). This increases the chances of each gene sequence annealing to at least one primer.
  • step (c) is performed in the presence of 4.5 mM magnesium between 30 and 50 amplification cycles, more preferably between 35 and 45 amplification cycles and most preferably about 40 amplification cycles.
  • the amplification reaction of step c) is performed in the presence of both a thermoresistant DNA polymerase and a thermoresistant proof reading enzyme.
  • thermoresistant proof reading enzyme in the amplification buffer allows a significant increase in the quality of the sequences that are synthesized during the elongation step of each amplification reaction cycle.
  • step c) comprises a step wherein the heeled primers are elongated in the presence of the DNA polymerase and optionally the proof reading enzyme at a temperature ranging between 40 and 72°C.
  • an annealing step may be performed between the denaturation step and the elongation step, at 40°C, a temperature wherein the DNA polymerase is almost prevented to synthesize DNA.
  • step c) comprises an elongation step wherein the annealed DNA molecules are elongated at a temperature comprised between 65 and 75°C in the presence of a thermoresistant DNA polymerase.
  • step c) can comprise the step of amplifying second cDNA strands resulting from step b) over a number of amplification cycles with said second heeled primer preferably at a concentration ranging between 0.02 to 200 ng per reaction in the following conditions;
  • steps (iv) and (iii) repeating steps (ii) and (iii) (with (i) as an option) for the desired number of cycles.
  • steps (c) (ii) to (iv) are repeated for 10 to 60 cycles, preferably from 20 to 50 cycles and most preferably about 20 or about 40 cycles.
  • step (c) a population of second heeled primers is added at step (b).
  • step c) is performed in the presence of a magnesium concentration up to 5 mM and most preferably of 3.5 mM.
  • step (c) is performed in the presence of both a thermoresistant DNA polymerase and a proof reading enzyme.
  • the proof reading enzyme is added at the same time as the DNA polymerase and in an amount which ranges from 0.1 U to 0.5U, most preferably 0.25 U and is admixed with the DNA polymerase in the volume of 1 ⁇ l.
  • the third embodiment further comprises a second set of amplification cycles which are performed at step d) (referred to above) under more stringent hybridization conditions. This serves to amplify all the cDNAs bearing heel sequences with minimum bridge formation and, due to the high stringency conditions used, at high efficiency, thus increasing the yield of sequences initially present in the sample (when compared to embodiments 1 and 2 above).
  • each amplification reaction cycle of step d) comprises the following steps of:
  • thermoresistant DNA polymerase elongating the annealed DNA molecules using a thermoresistant DNA polymerase at a temperature comprised between 65°C and 75°C;
  • the amplification reaction of step d) is performed in the presence of 2.5mM magnesium, between 30 and 50 amplification cycles, more preferably between 35 and 45 amplification cycles and most preferably about 40 amplification cycles.
  • 2.5mM magnesium between 30 and 50 amplification cycles, more preferably between 35 and 45 amplification cycles and most preferably about 40 amplification cycles.
  • other magnesium concentrations could be used, depending on the choice of polymerase.
  • the denaturation temperature is preferably 95°C and the elongation temperature is preferably 72°C.
  • the annealing and elongation step is performed during a period of time which is sufficient for maximizing the annealing of the primers to the single stranded cDNA molecules.
  • such annealing and elongation step ranges from 2.5 to 3.5 minutes and is most preferably about 3 minutes.
  • step d) can be performed as follows: amplifying said first and second cDNA strands resulting from step c) over a number of amplification cycles with primers selected from the group consisting of (1) a primer comprising a portion of the heel sequence of the first heeled primer which portion is of a nucleotide length sufficient to hybridize with its complementary sequence under the hybridization conditions specified, (2) a primer comprising a portion of the heel sequence of the second heeled primer which portion is of a nucleotide length sufficient to hybridize with its complementary sequence under the hybridization conditions specified, and (3) a mixture of the primers (1) and (2), wherein the total concentration of primers preferably ranges between 0.02 and 500 ng per reaction in the following conditions:
  • thermoresistant DNA polymerase adding a thermoresistant DNA polymerase
  • step d) (iv) is performed at a temperature of 94°C.
  • the reaction mixture contains essentially the single stranded cDNA products obtained at step c), the amplification primers as well as the thermoresistant DNA polymerase which is not active at this high temperature.
  • the temperature is maintained in the range from 80°C to 95°C, most preferably 94°C, for a period of time up to 3 minutes, most preferably 2 minutes.
  • the temperature ranges from 80°C to 95°C, most preferably 94°C, and is maintained up to 60 sec, most preferably 20 sec.
  • step d) (v) the primers are annealed to the single stranded DNA molecules at a temperature wherein the thermoresistant DNA polymerase is able to elongate the primers using the cDNA molecules as templates.
  • step d) (v) is performed at a temperature comprised between 68°C and 74°C, most preferably 72°C.
  • step d) (v) is performed during a period of time comprised between 1 min and 10 min, most preferably 5 min.
  • step d) (v), is performed during a period of time comprised between 10 and 60 min, preferably between 25 and 40 min, most preferably during 35 min.
  • Step d), (vi) preferably comprises between 10 and 50 amplification cycles
  • the amplification reaction of step d) is performed in the presence of both a thermoresistant DNA polymerase and a thermoresistant proof reading enzyme, also step d) is preferably performed in the presence of a concentration of magnesium comprised between 2 and 5 mM.
  • the respective concentration of primers at step (d) ranges from 0.02 to 500 ng.
  • Step d) which includes steps (i) to (vi) as described above, is preferably performed when the initial sample contains a large amount of mRNA, such as for example an amount of mRNA corresponding to the whole mRNA that can be found after extraction from about 100 cells (e.g. 100 mammalian cells).
  • step d) is preferably performed in the presence of a concentration of magnesium up to 3 mM, most preferably 2 mM.
  • step d) above will preferably comprise further steps of amplifying the products obtained at step d) (vi) of the second alternative.
  • step d) further comprises the steps of amplifying the DNA molecules obtained at step d) (vi) over a number of amplification cycles with primers selected from the group consisting of (1) a primer comprising a portion of the heel sequence of the first heeled primer which portion is of a nucleotide length sufficient to hybridize with its complementary sequence under the hybridization conditions specified, (2) a primer comprising a portion of the heel sequence of the second heeled primer which portion is of a nucleotide length sufficient to hybridize with its complementary sequence under the hybridization conditions specified, and (3) a mixture of the primers (1) and (2), wherein the total concentration of primers preferably ranges between 0.02 and 200 ng per reaction in the following conditions:
  • thermoresistant DNA polymerase adding a thermoresistant DNA polymerase to the single stranded DNA molecules obtained at step (vii);
  • magnesium concentration used at step (d) are preferably of (a) 2.5 mM magnesium at steps (d) (i) to (vi) and (b) 2mM magnesium at steps (d) (vii) to (x).
  • amplification reaction steps (d) (i) to (vi) these are performed with a respective concentration of primers which ranges from 0.02 to 90 ng, preferably from 10 to 50 ng, most preferably about 30 ng
  • step (d) (vii) to (x) is performed with a respective concentration of primers that ranges from 50 ng to 300 ng, preferably from 65 ng to 200 ng and most preferably about 100 ng.
  • step (d) (i) to (x) are preferably performed, using a total amount of primers ranging from 0.02 to 500 ng, preferably from 60 to 300 ng and most preferably about 130 ng.
  • step (d) (x) of the second alternative of the third amplification method described above comprises between 20 and 60 amplification cycles, preferably between 30 and 50 amplification cycles and most preferably about 40 amplification cycles.
  • step (d) when step (d) is performed by carrying out steps (i) to (x), the first set of amplification reactions of steps (i) to (vi) is performed with a smaller amount of primers than when step (d) is performed by carrying out solely steps (i) to (vi).
  • This lower amount of primers added at step (i) in this specific situation will permit a reduction in the level of mis-hybridizations in the first set of amplification reactions.
  • the products obtained at step d) (vi) are fully representative of the mRNA species initially contained in the sample.
  • the second set of amplification reactions namely steps (d) (vii) to (x) will increase the amount of material initially amplified at steps (d) (i) to (vi).
  • the amplification reaction steps namely steps (d) (vii) to (x) will increase the amount of material initially amplified at steps (d) (i) to (vi).
  • the amplification reactions steps (d) (viii) to (x) are performed in the presence of a concentration of magnesium up to 4 mM, preferably between 1.6 and 2.5 mM and most preferably at a magnesium concentration of 2.0 mM.
  • the respective concentration of primers used at steps (d) (vii) to (x) ranges from 10 to 500 ng, and most preferably from 30 to 300 ng.
  • the method may comprise a further step wherein the DNA molecules obtained at step e) having a length of less than 50 bp are discarded from the reaction mixture.
  • step d) is followed by the following steps : i) incubating the DNA molecules obtained at step e) with at least one restriction enzyme that specifically recognizes a restriction site included in the heeled sequence of the first and/or second heeled primer; and/or ii) diluting the product of step i) to obtain a diluted cDNA solution containing a cDNA concentration which is between about 2 and 100 times inferior to the cDNA concentration of the product of step i); and adding a thermoresistant DNA polymerase to the diluted sample and performing a further set of amplification reaction cycles without adding any nucleic acid primer; and/or iii) confirming the presence of at least one nucleic acid sequence contained in the population of DNA molecules obtained at step i) and/or ii).
  • the primers preferably each comprise at least one rare restriction site.
  • variants may also comprise a further step wherein the DNA molecules obtained at step i) having a length of less than 50 bp are discarded from the reaction mixture.
  • the number of amplification reaction cycles performed in step ii) is comprised between 20 and 40, more preferably between 25 and 40 and most preferably between 30 and 40.
  • it can comprise anyone of the following methods:
  • step i) to iii) of this preferred variant are the same as those described for performing steps d) to g) of the first and second embodiments.
  • Step f) comprises any one of the following methods:
  • the resulting cDNA may be submitted to in vitro transcription, either immediately after step c) if the appropriate concentration of cDNA is present in the sample or after further amplification such as through step d) or through optional steps of e') described above.
  • one of the primers comprises a RNA polymerase binding site such as the T7 RNA polymerase promoter.
  • the RNA generated can then be subjected to further process steps, for instance either by being labeled and hybridized to DNA arrays or by being reverse transcribed, optionally using a fluorescent, radioactive or otherwise labeled substrate, to generate labeled cDNA strands.
  • the resulting product can then be hybridized to a DNA array or used in gene-specific PCR experiments. If unlabelled the products can be attached to a microarray base and be hybridized to labeled oligonucleotides.
  • step e) or e' RNA transcription can be carried out by first optionally removing low molecular weight DNA, including heel primers, to provide a 'cleaner' environment for subsequent RNA polymerase reactions to take place. This 'cleaning up' also allows the skilled person to change the buffer solution to a buffer that would be more appropriate for subsequent RNA polymerase reactions.
  • RNA polymerase promoter in the primer allows synthesis of complementary RNA, suitable for hybridising to Gene Chips or arrays bearing sense gene specific oligonucleotides, or for subsequent reverse transcription and hybridising of the resultant cDNA to antisense gene specific oligonucleotides.
  • inclusion of the RNA polymerase promoter in the second heeled primer allows synthesis of sense RNA, suitable for hybridising to arrays bearing antisense oligonucleotides, or for subsequent reverse transcription and hybridization of the resultant cDNA to GeneChips or arrays bearing sense gene specfic oligonucleotides.
  • one of the primers comprises a RNA polymerase binding site such as the T7 RNA polymerase promoter.
  • the RNA generated can then be subjected to further process steps, for instance either by being labeled and hybrdized to DNA on arrays or by being reverse transcribed, optionally using a fluorescent, radioactive or otherwise labeled substrate, to generate labeled cDNA strands.
  • the resulting product can then be hybridised to a DNA array, or attached to a support (e.g. glass, nylon, silcon etc) for subsequent hybridisation with other nucleic acids, or used in gene-specific PCR experiments.
  • first and second heeled primers, primers used in step c include an increase in GC content as compared to primers of embodiments I and II.
  • the primers used in this embodiment comprise a heel sequence having a GC content ranging from 60% to 80%, most preferably of about 75%.
  • This increase in the GC content permits an increase in the stringency of the hybridization conditions used in the first set of amplification cycles of step c), thereby preventing the generation of nucleic acid bridges inside the amplified cDNA molecules and thus preventing the synthesis of the high molecular weight cDNA species observed during step c) of the first and second embodiments.
  • the above primers comprise at least one cleavage site in their heel sequences or at the 3' end of their heel sequence.
  • the first heeled primer population consists of a population of nucleic acids comprising, from 5' end to 3' end:
  • RNA polymerase promoter site an option but preferably present RNA polymerase promoter site; (iii) an oligo dT sequence of 15 to 35 nucleotides in length; and (iv) a variable sequence of 2-4 nucleotides in length that can hybridize to a mRNA molecule at the 5'end of the poly-A tail thereof, wherein substantially every possible variable sequence combination is found in said first heeled primer population.
  • variable sequence of 2 to 4 nucleotides is selected among the following variable nucleotide sequence : 5'-(A or G or C)-N- ⁇ - 3 , wherein N is a nucleotide selected from A, T, C or G.
  • the first heeled primer includes the sequence of a rare restriction site which may be located at any position within the heel sequence and preferably at the 5' end or at the 3'end of the heel sequence of said first heeled primer.
  • the oligo dT sequence has a length comprised between 20 and 35, more preferably between 25 and 35 and is most preferably of about 30 nucleotides in length.
  • the variable sequence of 2 to 4 nucleotides of the first heeled primer is selected among the following variable nucleotide sequences: 5'-(A or G or C)-N ⁇ _. 3 -3', wherein N is a nucleotide selected from A, T, C or G.
  • the GC content of the heel sequence of the first heeled primer is comprised between 50 and 80%, more preferably between 60 and 80% and is most preferably of about 75% .
  • the high GC content of the heel sequence of the first heeled primer allows a good annealing of said primer to the corresponding complementary sequence, even at the medium stringency hybridization conditions that are used notably at step d) of the present third cDNA amplification.
  • the second heeled primer population consists of a population of nucleic acid sequences each comprising, from 5'end to 3' end:
  • the heel sequence of said second heeled primer comprises the sequence of a rare restriction site, which may be located at any location within the heel sequence, but is preferably located at the
  • the heel sequence of the second heeled primer ranges from 25 to 35 nucleotides in length.
  • the heel sequence of the second heeled primer ranges from 45 to 75 nucleotides in length and comprises a RNA polymerase binding site.
  • the heel sequence of the second heeled primer ranges from 45 and 75 nucleotides in length and comprises a RNA polymerase binding site located at the 3' end of the heel sequence.
  • the first variable sequence of the second heeled primer population has preferably 15 to 20 nucleotides in length and is most preferably of about 17 nucleotides in length.
  • the first variable sequence of the second heeled primer population is longer the first variable sequence of the second heeled primer used to perform the first and second embodiments described above and are thus suitable to stabilize every second heeled primer of the population to its corresponding complementary DNA sequence during the annealing and the elongation step of the first and second set of amplifications cycles of steps c) and d).
  • a longer first variable sequence for stabilizing the primers belonging to the second heeled primer population was required, particularly due to the greater length of the heel sequence, which is preferably comprised between 25 and 30 nucleotides in length and is most preferably of about 27 nucleotides in length.
  • each nucleic acid sequence also comprises a second variable nucleotide sequence preferably selected according to the criteria set forth in the first embodiment.
  • the second variable sequence of the second heeled primer is chosen from the group of sequences consisting of 5'-CGAGA-3 ⁇ 5'-CGACA-3', 5'-CGTAC-3' and 5'-ATGCG-3', such that each of second said variable sequence is found in said second heeled primer population.
  • the heel sequence has 28 nucleotides in length.
  • said second heeled primer population comprises a heel sequence of 25 to 30 nucleotides in length, more preferably about 28 nucleotides in length and having a GC content comprised between 50 and 70%, more preferably between 60 and 70% and is most preferably of about 68%.
  • the heel sequences of the first heeled primer and the second heeled primer are identical.
  • the heel sequences of the first heeled primer and the second heeled primer share a sequence of at least 15 consecutive nucleotides, preferably at least 20 or 25 consecutive nucleotides.
  • the cDNA strands present in the mixture obtained at the end of step (c) of the present method comprise a sequence in their 5' end of at least 15 nucleotides which are complementary to a sequence comprised in their 3' end.
  • second cDNA strands of a short nucleic acid length that are regenerated during step c) have a high tendency to self-anneal and thus be no longer available for the set(s) of amplification reactions of step (d).
  • the first and second cDNA strands that are amplified when carrying out step (d) of the present method are mainly large cDNA molecules, including cDNA molecules comprising a sequence which is identical or which is complementary to the full length mRNA species initially present in the sample.
  • the heel sequences of the first and second heeled primers preferably comprised the sequence of a rare restriction site located at the 3'-end or at the 5'end of their respective heel sequence, as well as a RNA polymerase binding site, preferably located downstream from the restriction site.
  • the restriction site sequence of the first heeled primer is identical to the restriction site sequence present in the heel of the second heeled primer.
  • the restriction site sequence of the first heeled primer is different from the restriction site sequence present in the heel of the second heeled primer.
  • the restriction site sequence included in the heel sequence of the first heeled primer or the second heeled primer is selected from the group of so-called 'rare cutters' which comprises for example Not1 , Bsshll, Narl, Mlul, Nrul and Nael.
  • KITS 'rare cutters' which comprises for example Not1 , Bsshll, Narl, Mlul, Nrul and Nael.
  • the present invention further relates to kits for the amplification of the mRNA species present in a sample, said kit being specifically designed for performing the third cDNA amplification method described above.
  • kits for the amplification of the mRNA species present in a sample wherein said kit comprises:
  • Said amplification kits may further comprises: (iii) a first primer consisting of at least a portion of the heel sequence of the first heeled primer; and (iv) a second primer consisting of at least a portion of the heel sequence of the second heeled primer.
  • the heel sequences of the first heeled primer and of the second heeled primers are identical or alternatively share a common sequence of at least 15, preferably at least 20, most preferably at least 25 consecutive nucleotides in length.
  • said amplification kit may further comprises a restriction enzyme that recognizes the rare restriction site sequence present in the heeled sequence of the second heeled primer.
  • said amplification kit may further comprises a restriction enzyme that recognizes the rare restriction site sequence present in the heeled sequence of the first heeled primer.
  • the kit further comprises a suitable RNA polymerase.
  • the three mRNA amplification methods of the invention make it possible to amplify large numbers of samples easily and with high sensitivity.
  • mRNA containing samples may be used as starting materials for performing the cDNA amplification methods of the invention, such as the whole content of a cell cytoplasm or even a portion of the cell cytoplasm such a portion of cytoplasm of neuronal cells and also mRNA molecules extracted from a desired tissue.
  • cDNA molecules obtained at the end of any one of the three cDNA amplification methods described above can be used for many purposes including: a) cloning and production of cDNA libraries from small amounts of tissue; b) sequencing analysis of gene expression in small tissue samples; c) subtracting the amplified product from two different samples and analysing genes differentially expressed between them such as described by Diatchenko et al. (1996, Proc. Natl. Acad. Sci. USA, vol. 93: 6025-6030), and then by cloning and sequencing the sequences expressed only in one or several tissues; d) transcribing mRNA using labelled precursors for use on hybridisation arrays, such as described by Duggan , D. J.
  • tissue samples can be taken from living organisms without any disadvantages since only very small samples are needed; i) analysis of gene expression in single cells using anyone of the cDNA amplification methods described above. j) amplification of full length RNA samples from single cells and small samples, for subsequent library making or expression in suitable expression systems.
  • RNA isolated from whole rat brain was reverse transcribed.
  • cDNA derived from 100 pg total RNA (equivalent to the RNA content of between 5 and 10 cells) was amplified according to the first embodiment.
  • gene specific PCR assays were positive when cDNA derived from more than 10 pg of total RNA was used in each assay, as shown in figure 1A.
  • the majority of the genes were detected using 2.5% of the amplified product in each gene specific assay (i.e. each sample contained material derived from 2.5 pg of the original RNA), with some gene sequences detectable at lower levels, as shown in figure 1 B.
  • step (f) a further increase in sensitivity was observed with all the genes assayed being positive using as little as 0.1 % of the amplified product (i.e. amplified cDNA derived from 0.1 pg of the initial total mRNA sample), as shown in figure 1C. Therefore, using this approach, the expression of up to a 1000 genes could be assayed using 0.1 % of the final product in each gene specific PCR reaction.
  • amplified product i.e. amplified cDNA derived from 0.1 pg of the initial total mRNA sample
  • Total mRNA was prepared from rat whole brain using the total mRNA isolation system from Promega according to the manufacturer's instructions. Reverse transcription was performed using thermoscript reverse transcriptase or MMLV reverse transcriptase according to the manufacturer's (GIBCO-BRL.Paisley, Scotland) instructions.
  • the reverse transcription primers used were composed of an anchored oligo- dT primer with a specific 5' heel sequence absent from the mammalian data bases. In some instances a RNA polymerase (T7) promoter site was incorporated at the 3' end of the heel sequence.
  • the primers used were as shown in SEQ ID N°3:
  • Second strand cDNA synthesis was initiated by incubating cDNA derived from 100 pg of total RNA with 25 pg of a mixed primer population consisting of (5'-3'): a 5' heel sequence absent from the mammalian data bases (CTGCATCTATCTAATGCTCC), a stretch of 5 random nucleotides (NNNNN, where N represents A, C, G or T) and a variable pentameric sequence chosen from CGAGA, CGACA, CGTAC and ATGCG, as shown in SEQ ID N°4, 5, 6 and 7.
  • a mixed primer population consisting of (5'-3'): a 5' heel sequence absent from the mammalian data bases (CTGCATCTATCTAATGCTCC), a stretch of 5 random nucleotides (NNNNN, where N represents A, C, G or T) and a variable pentameric sequence chosen from CGAGA, CGACA, CGTAC and ATGCG, as shown in SEQ ID N°4, 5, 6 and 7.
  • primer extension was performed for 8 mins at 72°C using ampliTaq DNA polymerase (0.35 units, Applied Biosystems, Warrington, UK) in PCR-1 buffer containing 67 mM TrisHCI (pH 8.3) 4.5 mM MgCI 2 , 6 mM beta- mercaptoethanol, 0.16% bovine serum albumin and 0.5 mM dNTPs.
  • the final product was then diluted to 100 ⁇ l with water and samples (2.5 or 5 ⁇ l) used for subsequent gene specific PCR assays, or subjected to a further 40 cycles (of 92oC for 0.5 min, 60°C for 1.5 min and 72°C for 1 min, followed by a final 10 min extension) in the absence of added primers.
  • This was performed in a PCR-2 buffer containing 3.5 mM MgCfe, 45 mM Tris HCI pH 8.8 and, 12.5% sucrose, 0.1 mM cresol red, 12 mM beta- mercaptoethanol, 0.5 mM dNTPs (Pharmacia), with 0.6 U AmpliTaq DNA polymerase (Applied Biosystems).
  • This product was electrophoresed in a 2% agarose gel (E-gel, Invitrogen) and the high molecular weight products isolated from the gel using the Qiagen Gel extraction kit according to the manufacturer's instructions.
  • Gene specific PCR was performed on samples (2.5 to 10 ⁇ l) of amplified cDNA in PCR-2 buffer with gene specific primers at 100 ng/reaction. Following an initial 2 min denaturing step (92°C), each PCR cycle consisted of 0.5 min denaturing (92°C), 1.5 min annealing (55°C), and 1 min elongation (72°C). with a final extension for 10 min at 72°C.
  • the PCR products were then separated by electrophoresis in a 2.5% agarose gel, stained with ethidium bromide and the image recorded.
  • the gene-specific primers used were as follows: ⁇ Tubulin, (accession number, V01226, SEQ ID N°8 and 9), ⁇ -actin, (accession number, V01217, SEQ ID N°10 and 11), Cyclophilin, (accession number, M25637, SEQ ID N°12 and 13), Adenosine A1 receptor, (accession number, Y12519, SEQ ID N°14 and 15), Adenosine A2A receptor, (accession number, L08102, SEQ ID N°16 and 17), Adenosine A2B receptor (accession number, M91466, SEQ ID N°18 and 19), Adenosine A3 receptor, (accession number, M94152, SEQ ID N°20 and 21), NK1 receptor (accession number, J05097,
  • step (e) the inventors believe that the increased sensitivity seen after step (e) is due to the removal of products formed during step (c) which compete in the gene specific PCR amplification. These products contain repetitive primer sequences which arecapable of priming on the amplified cDNA molecules and thus reduce theefficiency of the gene specific reaction. These products are removed during step (f), while the amplified gene sequences which have been incorporated into the high molecular weight products during step (e) are retained.
  • amplification of cDNA derived from 100 pg of total RNA permits the detection of specific gene sequences by PCR at levels lower than those of unamplified cDNA.
  • A dilutions of unamplified cDNA; B) dilutions of the amplified cDNA (step c); C) dilutions of the amplified cDNA (step e).
  • the scale in (A) indicates the amount of total RNA from which the cDNA used in each gene specific assay was synthesised.
  • the scale indicates the amount of total RNA from which the gene specific assay sample was amplified (i.e.
  • 0.1 pg represents one thousandth of the final product obtained after amplification of cDNA derived from 100 pg of total RNA).
  • Gene sequences were detected after amplification (as described in steps (a) to ( c ) of the first embodiment of the invention when using amplified product containing as little 1 pg of the initial RNA.
  • step (e) a further increase in sensitivity can be seen with detection at levels as low as 0.05 pg-
  • EXAMPLE II The effect of restriction digestion on the detection of specific seguences after rat brain mRNA amplification using the second and third embodiments.
  • mRNA isolated from whole rat brain was reverse transcribed, and the cDNA derived from 25 pg total mRNA (equivalent to the mRNA content of between 2 and 5 cells) amplified according to Example 1 , with (A) or without (B) cutting with Mlul as described in step d), followed by steps e) to g), figure 2.
  • Each gene specific assay contained amplified product derived from 0.6 pg of total RNA. Note the detection of the adenosine A1 and A3 receptor after cutting (A) which were not detected without cutting (B).
  • mRNA isolated from whole rat brain was reverse transcribed, and the cDNA derived from 25 pg total mRNA (equivalent to the mRNA content of between 2 and 5 cells) amplified according to Example III, with (A) or without (B) cutting with Mlul as described in step g), followed by steps h) to j), figure 2.
  • Each gene specific assay contained amplified product derived from 0.6 pg of total RNA.
  • cDNA (derived from 25 pg total RNA from rat brain) was prepared and subjected to second strand synthesis as described in Example 1 , except the heel of the second strand primers as with SEQ ID N°2,which contains the Mlul cleavage site in particular a rare restriction site (ACGCGT) at the 3' end.
  • SEQ ID N°2 which contains the Mlul cleavage site in particular a rare restriction site (ACGCGT) at the 3' end.
  • 10 ⁇ l of the diluted product was incubated in a total of 20 ⁇ l at 37°C for 60 min with 2 units of Mlul in 6.0 mM Mg 2+ , according to the manufacturer's instructions (Promega).
  • removal of the heel sequence of the second strand primer was designed to increase the sensitivity of the gene specific PCR by cutting of the competitor products described in Example I (so that they no longer compete in any of the subsequent PCR reactions), and also to promote the detection of gene sequences upstream from the reverse transcription primer site.
  • the increased sensitivity due to removal of the primer sequences is apparent in the increased sensitivity of detection of the gene sequences indicated. It is believed (but the applicants do not wish to be bound by any theory) that short amplified products of gene sequence generated during step (c) can, after strand separation at 92°C, be extended after annealing to longer complementary products. Removal of the second strand primer heel, and amplification with the proof reading DNA polymerase pfu can assist this process. In this way the amount of amplified material containing sequence upstream from the reverse transcription primer site can be increased.
  • part (I), gene specific PCR after step (f), without (B) and with (A ) cutting with the rare cutter restriction enzyme Mlul shows that cutting increases the detection of low abundance gene sequences such as the adenosine A1 and A3 receptors.
  • two heel primers were designed for use at high stringency which were able to amplify single copies of lambda bacteriophage DNA in the presence of a 1000-fold excess of rat genomic DNA i.e. they were highly specific for the complementary sequences and able to amplify single copies (data not shown).
  • amplified product derived from as little as 0.01 pg of the initial RNA were positive in the gene specific PCR assays. This amount of RNA represents approximately 0.1% of that contained in a single cell.
  • Reverse transcription Total mRNA prepared from rat whole brain using the total mRNA isolation system from Promega according to the manufacturer's instructions. Reverse transcription was performed using MMLV reverse transcriptase again according to the manufacturer's (GIBCO-BRL, Paisley, Scotland) instructions.
  • the reverse transcription primers used were composed of an anchored oligo-dT primer with a specific 5' heel sequence absent from the mammalian data bases.
  • the primer used SEQ ID N°42 is indicated below: ACTGCCAGACCGCGCGCCTGAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
  • Second strand synthesis was initiated by incubating cDNA derived from 1000 pg of total RNA with 20 ng of second strand primers which were composed of (5' to 3'): a heel sequence absent from the mammalian data bases (TGTCCGTTTGCCGGTCGTGGGC) an Mlul site (ACGCGT), 17 random nucleotides (NNNNNNNNNNNNNNN) and three arbitrary bases (G, T) (A, G, T) (A, C, G), as shown in SEQ ID N°43.
  • primers were added to give a final volume of 20 ⁇ l of PCR-1 buffer containing 4.5 mM Mg 2+ , 1 unit of AmpliTaq DNA polymerase and 0.05 units of pfu DNA polymerase (Stratagene) and annealed and extended over 40 cycles under the following conditions: 92°C for 0.5 min, 40°C for 0.5 min (optional) and 72°C for 5 min, followed by a final 30 min extension.
  • the repetitive annealing of these primers serves to increase the probability that all the gene sequences present in the initial cDNA population are copied into double stranded products.
  • the amplification products were then subjected to restriction digestion with Mlul as described in Example 2, the low molecular weight products (including the heel of the second strand primers) removed through a Nanosep 10K column (double stranded DNA less than 100bp in length pass through the filter of these Nanosep columns) and the larger products either subjected to gene specific PCR, or subjected to a further 40 cycles of 92°C for 1.0 min, 95°C for 0.33 min, 72°C for 3 min, followed by a final 15 min extension. Removal of the second strand heel sequences was designed to both reduce the influence of any competing products and primers in the gene specific PCR and to permit product priming/repair as described in Embodiment 2.
  • high stringency amplification cDNA derived from 1000 pg of total RNA as described in embodiment 3 permits increased detection of gene sequences.
  • the scale indicates the amount of total RNA from which the cDNA used in each gene specific assay was synthesised (A), or the amount of RNA from which the gene specific assay sample was amplified (B).
  • step g) of Figure 2 including steps g) to i) in embodiment 3 (A) increases the detection of low abundance messages such as those encoding the adenosine A2B receptor and the mammalian degenerin MDEG, when compared to an amplification which omitted step g) (B).
  • detection of abundant mRNA species such as that encoding synaptotagmin 1 was also increased.
  • EXAMPLE IV In vitro transcription of RNA from cDNA amplified according to embodiments 1 and 3
  • RNA incorporation of the T7 promoter into the reverse transcription primer heel was performed so that RNA could be produced for subsequent analysis by hybridisation methods, for instance on oligo arrays.
  • the yield of RNA from the amplified cDNA was estimated by running two parallel transcriptions, one for RNA synthesis and the other containing 35S-UTP as a substrate, so that the incorporation of the radioactivity into RNA could be used used as an index of RNA synthesis.
  • amplification of rat liver cDNA derived from 500 pg of total RNA by Amplification Procedure 1 to step (c) in vitro transcription resulted in a yield of 12.5 micrograms of RNA.
  • RNA from liver cDNA (derived from 500 pg of total RNA) was 34 micrograms (mean of 5 experiments). Similarly the yield from cDNA derived from 2500 pg was 90 micrograms (mean of 5 experiments)..
  • step g) of Embodiment 3 prior to in vitro transcription increased the yield of RNA 1.7-fold (mean of two experiments).
  • the RNA was reverse transcribed using the heel of the second strand heeled primer.
  • Figure 5 illustrates that the cDNA derived from the transcribed RNA contained abundant gene sequence with actin tubulin and cyclophilin sequences being detected in aliquots representing 0.0001% of the RNA so produced. Therefore it appears that the expression of up to 1 ,000,000 genes may be assessed in amplified samples derived from 2500 pg of total RNA i.e. RNA derived from approximately 250 cells.
  • Reverse transcription of liver RNA was performed essentially as described in Examples 1 and 3, using primers containing a T7 RNA polymerase promoter site.
  • the primers used were, SEQ ID N°44,:
  • step (c) of each Embodiment the amplified cDNA was isolated using a Qiaquick PCR purification kit (Qiagen) according to the manufacturer's instructions to remove primers and other low molecular weight products, and 5 ⁇ l aliquots subjected to in vitro RNA transcription using the T7 Megascript kit (Ambion) according to the manufacturer's instructions.
  • DNase treatment to remove cDNA DNase 1 , 30 min, 37°C
  • the RNA was isolated using the Rneasy kit (Qiagen). One of the aliquots was transcribed in the presence of 35S-UTP to determine the yield of RNA.
  • RNA was subsequently ethanol precipitated (75% ethanol, 5% sodium acetate at -20°C for 30 mins), before reverse transcription with MMLV reverse transcriptase according to the manufacturer's instructions.
  • the reverse transcription primers used were part or the whole of the heel sequences of the second strand primers, SEQ ID N°1 and 44
  • RNA from amplified cDNA contains large amounts of bona fide gene sequence.
  • cDNA derived from 125, 500 and 2500 pg of liver total RNA was amplified using Amplification Method 3 as far step e) and RNA transcribed. Cutting with the restriction enzyme (step g) was omitted so that the RNA so produced would contain the heel sequence of the second strand primer. This heel primer was then used to prime reverse transcription of the RNA, and the resulting cDNA analysed for the presence of 3 gene sequences. Note that all 3 gene sequences were detected even after 10 6 fold dilution of the product.
  • Example V Amplification of rat spinal cord cDNA derived from 1 ng total RNA (equivalent to approximately 100 cells) using the third embodiment.
  • antisense RNA could be in vitro transcribed from cDNA amplified by embodiment 3, this RNA could be applied to gene chips bearing sense probes, or reverse transcribed and applied to microarrays bearing antisense probes. However many microarrays bear sense probes (i.e. they recognise antisense DNA), but are not suitable for the hybridization of labelled RNA samples. In order to maximise the utility of embodiment 3, sense RNA was also transcribed from the amplified cDNA in vitro, reverse transcribed and the gene sequence content assessed by gene specific PCR.
  • RT Reverse transcription
  • 10 ⁇ l containing; 1x first-strand buffer, 200 Units MMLV reverse transcriptase (BRL), and 0.5 ng first strand primer for 60 min at 37°C.
  • the first strand primer (SEQ ID N°46),ACTGCCAGACCGCGCGCCTGAACGCG
  • Second strand synthesis was performed by adding an excess of second strand primer (1 ng) (to increase chances of annealing to every first strand sequence) in 4 microlitres of buffer giving a final Mg 2+ concentration of 3.5mM.
  • Taq Applied Biosystems, Warrington, UK
  • pfu the proofreading enzyme
  • Primer annealing occurred at 50°C (7.5 mins decreasing by 10 sees per cycle) and extension at 72°C for 2.5mins. The temperature was cycled between 50°C and 72°C 40 times. Although not wishing to be bound by theory, is the inventors believe that under these conditions each first strand cDNA will be annealed in multiple positions by the second strand primer. Each cycle permits further annealing by the primer. However, unlike normal PCR, the second strands are not dissociated from the first strand by melting in each cycle, consequently each primer has an equal chance of being extended to the 5' end of the first strand (which bears one of the heels), thus increasing the efficiency of subsequent PCR.
  • the second strand primer contained (from 5' to 3'): a sequence absent from the mammalian data bases which is capable of hybridising to its complement and 72oC in the presence of 2mM Mg 2+ and standard PCR buffers, an Mlul site (ACGCG), the T3 RNA polymerase promoter and a random sequence of 15 bases, SEQ ID N°47: AAAACTGCCAGACCGCGCGCCTGAACGCGTCGTATTAACCCTCACT AAAGGGN15
  • PCR was performed by adding 4 microliters in AmpliTaq buffer (Applied Biosystems, Warrington, UK) containing 1.25 mM dNTPs and 33ng of primers (the sequence absent from the mammalian data bases which is capable of hybridising to its complement and 72°C in the presence of 2mM Mg 2+ with an Mlul site) to give a final Mg 2+ concentration of 2.6 mM.
  • this primer was common to both the first and second strand primers).
  • 5 units of Taq (Applied Biosystems, Warrington, UK) was added with 0.25 unit of the proofreading enzyme pfu (Startagene).
  • the reaction was then subjected to 20 cycles of denaturation (94°C, 20 sees), and annealing with extension (72°C, 5mins).
  • 19 microlitres of AmpliTaq buffer were then added (at 80°C) containing and 0.2 mM dNTPS, 100 ng of primers and giving a final Mg 2+ concentration of 2.1 mM.
  • 5 units of Taq (Applied Biosystems, Warrington, UK) was then added with 0.25 units of the proofreading enzyme pfu (Stratagene).
  • the reaction was then cycled 40 times as described above, with a final extension at 72°C for 30 min.
  • FIG. 6 shows the size distribution of the RNA produced from both the T3 and T7 RNA polymerase promoters (i.e. most between 200 and 600 bp with detectable higher molecular weight material). 10% of the product obtained after amplification of cDNA derived from 1 ng of total RNA was in vitro transcribed with T7 polymerase or T3 polymerase and 30% of each RNA applied to a gel. The estimated yields from the two RNA polymerases were 0.5 and 1.5 micrograms respectively.
  • Figure 7A shows that the amplified cDNA contained both rare (A2A receptor) and abundant (e.g.
  • tubulin gene sequences detectable by gene specific PCR.
  • I amplification with a second strand primer lacking the T3 promoter
  • II amplification with a second strand primer bearing the T3 promoter.
  • Samples were diluted up to 1/3,000 prior to gene specific PCR.
  • Figure 7B shows that the in vitro transcribed sense RNA generated using the T3 RNA polymerase (after reverse transcription to cDNA) also contains abundant gene sequence.
  • Example VI Single cell expression analysis using microarrays after cDNA amplification of striatal cholinergic neuron al mRNA using embodiment 3.
  • mRNA was amplified by the third embodiment using the primers and conditions described in Example V.
  • T3 RNA polymerase was used to generate sense RNA which was then reverse transcribed using fluorescently labelled dCTP (Cy3 or Cy5) for application to glass microarrays bearing sense DNA probes
  • Striatal cholinergic neurons were identified on the basis of their size and electrophysiological characteristics in 300 ⁇ m coronal slices from 14-28 day-old male Sprague Dawley rats containing the striatum were viewed with a Zeiss Axioskop microscope (Carl Zeiss Ltd., Welwyn Garden City, U.K.) fitted with a x64 water-immersion objective lens.
  • the physiological saline bathing the slices contained (mM) 125 NaCl, 25 NaHC03, 10 glucose, 2.5 KCI, 1.25 NaH2P04, 2 CaCI2, 1 MgCI 2 and was bubbled with 95%/5% 0 2 /C0 2 .
  • the electrode buffer contained 120 K gluconate, 10 NaCl, 2 MgCI 2 , 0.5 EGTA, 10 HEPES, 1- 4 mM Na2ATP, 0.3 Na 2 GTP, pH adjusted to 7.2 with KOH.
  • 0.5 ⁇ g/ml glycogen (Boehringer) and RNase inhibitor (Pharmacia, 0.1 units/ ⁇ l) were included to facilitate harvesting of RNA from the cells.
  • This buffer also contained 10 fg each of bacterial sequences derived from the trp, thr and lys codons of E. eoli. These mRNAs had polyA sequences attached to the 3' end so that they could be amplified by XTPEA. All solutions were made up in diethylpyrocarbonate (DEPC) treated water. Borosilicate recording electrodes were baked (2h, 250°C) before being pulled to a resistance of between 3 and 5 Mt- Electrophysiological signals were detected using an Axopatch-1 D patch-clamp amplifier (Axon Instruments, CA, USA) and were recorded onto digital audiotape.
  • DEPC diethylpyrocarbonate
  • cytoplasm from large cells was aspirated under visual control into a patch-clamp recording electrode until approximately 40% of the somatic cytoplasm had been collected.
  • nucleus was sucked onto the end of the electrode until an electrical seal (>0.5G ⁇ ) was formed prior to withdrawal of the electrode to prevent contamination from the slice. Since withdrawal of the nucleus from the cells caused structural damage, outside-out patches were used to seal the electrodes if the cells were to be subsequently examined immunohistochemically.
  • the contents of the electrode were forced into a microtube and reverse transcribed, amplified, low molecular weight components removed and all of the product in vitro transcribed as described for Example V. After Dnase treatment the RNA was reverse transcribed using Cy3 or Cy5 labelled dCTP prior to application to the microarrays.
  • Custom synthesised amine-modified oligonucleotide probes were purified in desalting columns to remove amine contaminants.
  • the probes were prepared to a final concentration of 10- 25 nmole/ml in 1X Surmodics Printing Buffer, containing 150 mM sodium phosphate, pH 8.5 (SurModics Inc, USA).
  • the probe solution was printed on 3D-Link Activated Slides (SurModics Inc, USA), and stored overnight in a saturated NaCl chamber. Printed slides were stored at room temperature.
  • the microarrays contained probes capabale of recognising the bacterial sequences which were included in the patch electrode buffer. These served to ensure that successful amplification had occurred.
  • 3 probes from the Dengue virus genome were included as negative controls.
  • the arrays contained a total of 510 oligonucleotide probes, recognising 141 different transcripts, each transcript being recognised by 3 or more separate probes.
  • Slides were removed from the incubation chamber and successively washed with 4X SSC for 30 seconds, 2X SSC / 0.1 % SDS for 5 minutes, 0.2X SSC for 1 minute and 0.1X SSC for 1 minute. Slides were spun to dry and scanned.
  • cDNA amplification by embodiment 3 was used to assess the expression of a large number of genes in 4 striatal cholinergic neurons, the aim being the detection of both low and high abundance transcripts.
  • problems are encountered with low abundance transcripts and with the non detection of some mRNAs in subpopulations of cells. This has been discussed in Surmeier et al (1996) J. Neurosci. 16, 6579-6591 and Richardson et al. (2000) J. Neurochem 74, 839-846.
  • the number of cells in which a transcript is detected is related to the abundance of the transcript i.e.
  • transcripts may be detected in only a subpopulafion of cells.
  • GABAA receptor subunit mRNAs were detected in less than 100% of the cholinergic neurons tested by Yan and Surmeier (1997), suggesting that these transcripts were expressed either at low abundance in all the cells, or only in a specific subpopulafion of cells.
  • more sensitive techniques will reveal a higher proportion of cells as positive for given transcripts, whereas in the latter there will be little change in the % of cells positive for a given transcript.
  • Table 1 shows some of the genes detected i.e. those whose expression in these cells had been previously characterised, and that the bacterial positive controls were detected but not the viral negative controls. All the housekeeping mRNAs are expected to be expressed in all cholinergic neurons.
  • the neuronal markers dynorphin, enkephalin and PPTA are markers for non cholinergic neurons in the striatum, and lipoprotein lipase for endothelial cells.
  • Table 1 also shows that the use of embodiment 3 increased the number of cells (compared to previous estimates) in which the Voltage sensitive Na channel ⁇ 6, trkC and NK3R mRNAs were detected, showing the ability of this method to detect low abundance transcripts in single cells.
  • Table 1 List of mRNAs detected in 4 single cholinergic neurons using embodiment 3 followed by hybridization to microarrays. The percentage of cells expected (e.g. housekeeping mRNAs are expected to be expressed in all cells) or previously shown by other methods, is shown in the third column (% positive cells) with the appropriate reference in the second column. The percentage of cholinergic cells in which the corresponding mRNAs were detected after embodiment 3 and microarray analysis is shown in column 4 (% positive cells by embodiment III).
  • Neurofil 68 Expected 100 100 ⁇ actin Expected 100 75
  • GABA ⁇ 1 Yan& Surmeier (1997) Present 50 GABA ⁇ 2 Yan& Surmeier (1997) Present 25 GABA ⁇ 3 Yan& Surmeier (1997) 73 100 GABA ct4 Yan& Surmeier (1997) 92 75 GABA ⁇ l Yan& Surmeier (1997) 100 50 GABA ⁇ 2 Yan& Surmeier (1997) 39 25 GABA ⁇ 3 Yan& Surmeier (1997) 77 50 GABA ⁇ l Yan& Surmeier (1997) 62 0 GABA ⁇ 2 Yan& Surmeier (1997) 100 75 GABA ⁇ 3 Yan& Surmeier (1997) 77 50
  • Dopamine D2R Yan et al (1997) 100 75 Dopamine D3R Yan et al (1997) 0 50 Dopamine D4R Yan et al (1997) 0 50 Dopamine D5R Yan et al (1997) 100 50 NK1 R Richardson et al (2000) 80 100 NK2R Richardson et al (2000) 0 50 NK3R Richardson et al (2000) 5 75

Abstract

La présente invention concerne des procédé ainsi que des amorces d'acide nucléique et des kits les renfermant qui permettent de réaliser une amplification efficace de séquences d'acides nucléiques prises dans un échantillon, plus particulièrement de séquences d'acide nucléiques dont la représentation au sein dudit échantillon est relativement faible au départ.
PCT/EP2000/006887 1999-07-19 2000-07-19 Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede WO2001006004A2 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP00954533A EP1196639A2 (fr) 1999-07-19 2000-07-19 Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede
KR1020027000769A KR20020034161A (ko) 1999-07-19 2000-07-19 불충분한 핵산 서열의 증폭방법 및 그 방법의 수행장치
JP2001511213A JP2003505034A (ja) 1999-07-19 2000-07-19 存在量の少ない核酸配列を増幅する方法および該方法を行うための手段
CA002378070A CA2378070A1 (fr) 1999-07-19 2000-07-19 Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede
AU66956/00A AU6695600A (en) 1999-07-19 2000-07-19 A method for amplifying low abundance nucleic acid sequences and means for performing said method

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14466699P 1999-07-19 1999-07-19
US60/144,666 1999-07-19

Publications (2)

Publication Number Publication Date
WO2001006004A2 true WO2001006004A2 (fr) 2001-01-25
WO2001006004A3 WO2001006004A3 (fr) 2001-08-09

Family

ID=22509592

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/006887 WO2001006004A2 (fr) 1999-07-19 2000-07-19 Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede

Country Status (6)

Country Link
EP (1) EP1196639A2 (fr)
JP (1) JP2003505034A (fr)
KR (1) KR20020034161A (fr)
AU (1) AU6695600A (fr)
CA (1) CA2378070A1 (fr)
WO (1) WO2001006004A2 (fr)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1275738A1 (fr) * 2001-07-11 2003-01-15 Roche Diagnostics GmbH Procédé pour la synthèse aléatoire et l'amplification d'ADNc
WO2004007766A1 (fr) * 2002-07-10 2004-01-22 Cambridge Biotechnology Ltd. Methode d'amplification d'acide nucleique
EP1436404A2 (fr) * 2001-09-19 2004-07-14 Alexion Pharmaceuticals, Inc. Matrices transgeniques et leurs utilisations dans l'amplification d'amorce unique
WO2005098029A3 (fr) * 2004-04-07 2005-12-15 Exiqon As Nouvelles methodes permettant de quantifier des micro arn et petits arn interferants
CN100390300C (zh) * 2004-09-27 2008-05-28 株式会社日立高新技术 核酸扩增分析法及装置
US7414111B2 (en) 2001-09-19 2008-08-19 Alexion Pharmaceuticals, Inc. Engineered templates and their use in single primer amplification
EP2142926A2 (fr) * 2007-04-05 2010-01-13 Genera Biosystems Limited Compositions et procédés de détection
US8192937B2 (en) 2004-04-07 2012-06-05 Exiqon A/S Methods for quantification of microRNAs and small interfering RNAs
CN102685048A (zh) * 2012-05-28 2012-09-19 上海师范大学 一种突发信号盲均衡算法
US9464106B2 (en) 2002-10-21 2016-10-11 Exiqon A/S Oligonucleotides useful for detecting and analyzing nucleic acids of interest

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100590621B1 (ko) * 2004-09-21 2006-06-19 (주)지노믹트리 하이힐 프라이머를 이용한 ｒｎａ의 선형 증폭방법
CN107075732B (zh) * 2014-11-25 2020-08-04 深圳华大智造科技有限公司 游离dna测序文库的构建方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991015601A1 (fr) * 1990-04-05 1991-10-17 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce Reaction en chaine de polymerase specifique de reproduction d'a.r.n. modifiee
WO1998008973A1 (fr) * 1996-08-29 1998-03-05 Cancer Research Campaign Technology Limited Amplification globale d'acides nucleiques
WO2000008208A2 (fr) * 1998-08-05 2000-02-17 Medical Research Council Transcription inverse, amplification, et leurs amorces

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991015601A1 (fr) * 1990-04-05 1991-10-17 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce Reaction en chaine de polymerase specifique de reproduction d'a.r.n. modifiee
WO1998008973A1 (fr) * 1996-08-29 1998-03-05 Cancer Research Campaign Technology Limited Amplification globale d'acides nucleiques
WO2000008208A2 (fr) * 1998-08-05 2000-02-17 Medical Research Council Transcription inverse, amplification, et leurs amorces

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHEUNG AND NELSON: "WHOLE GENOME AMPLIFICATION USING A DEGENERATE OLIGONUCLEOTIDE PRIMER ALLOWS HUNDREDS OF GENOTYPES TO BE PERFORMED ON LESS THAN ONE NANOGRAM OF GENOMIC DNA" PNAS, vol. 93, 1996, pages 14676-14679, XP002128316 *
DIXON ET AL.: "EXPRESSION PROFILING OF SINGLE CELLS USING 3 PRIME END AMPLIFICATION (TPEA) PCR" NUCLEIC ACIDS RESEARCH, vol. 26, no. 19, October 1998 (1998-10), pages 4426-4431, XP002128317 *
EBERWINE J ET AL: "ANALYSIS OF GENE EXPRESSION IN SINGLE LIVE NEURONS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,US,NATIONAL ACADEMY OF SCIENCE. WASHINGTON, vol. 89, 1 April 1992 (1992-04-01), pages 3010-3014, XP002912945 ISSN: 0027-8424 *
FROUSSARD: "A RANDOM-PCR METHOD (rPCR) TO CONSTRUCT WHOLE cDNA LIBRARY FROM LOW AMOUNTS OF RNA" NUCLEIC ACIDS RESEARCH, vol. 20, no. 11, 1992, page 2900 XP002128315 *
RICHARDSON ET AL.: "RELATING GENE EXPRESSION TO CELL FUNCTION USING A NOVEL SINGLE CELL PCR METHOD" EUROPEAN JOURNAL OF NEUROSCIENCE, vol. 10, no. supp. [10], August 1998 (1998-08), page 10307 XP000982404 *
TELENIUS H ET AL: "DEGENERATE OLIGONUCLEOTIDE-PRIMED PCR: GENERAL AMPLIFICATION OF TARGET DNA BY A SINGLE DEGENERATE PRIMER" GENOMICS,US,ACADEMIC PRESS, SAN DIEGO, vol. 13, 1992, page 718-725 XP000199116 ISSN: 0888-7543 *
ZHAO ET AL.: "3'-END cDNA POOL SUITABLE FOR DIFFERENTIAL DISPLAY FROM A SMALL NUMBER OF CELLS" BIOTECHNIQUES, vol. 24, May 1998 (1998-05), pages 842-852, XP002128314 *
ZHAO ET AL.: "NEW PRIMER STRATEGY IMPROVES PRECISION OF DIFFERENTIAL DISPLAY" BIOTECHNIQUES, vol. 18, no. 5, 1995, pages 842-850, XP002128267 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1275738A1 (fr) * 2001-07-11 2003-01-15 Roche Diagnostics GmbH Procédé pour la synthèse aléatoire et l'amplification d'ADNc
US7414111B2 (en) 2001-09-19 2008-08-19 Alexion Pharmaceuticals, Inc. Engineered templates and their use in single primer amplification
EP1436404A2 (fr) * 2001-09-19 2004-07-14 Alexion Pharmaceuticals, Inc. Matrices transgeniques et leurs utilisations dans l'amplification d'amorce unique
EP1436404A4 (fr) * 2001-09-19 2006-07-05 Alexion Pharma Inc Matrices transgeniques et leurs utilisations dans l'amplification d'amorce unique
US7306906B2 (en) 2001-09-19 2007-12-11 Alexion Pharmaceuticals, Inc. Engineered templates and their use in single primer amplification
WO2004007766A1 (fr) * 2002-07-10 2004-01-22 Cambridge Biotechnology Ltd. Methode d'amplification d'acide nucleique
AU2003254445B2 (en) * 2002-07-10 2006-06-15 Cambridge Biotechnology Ltd. Nucleic acid amplification method
US9464106B2 (en) 2002-10-21 2016-10-11 Exiqon A/S Oligonucleotides useful for detecting and analyzing nucleic acids of interest
WO2005098029A3 (fr) * 2004-04-07 2005-12-15 Exiqon As Nouvelles methodes permettant de quantifier des micro arn et petits arn interferants
US8192937B2 (en) 2004-04-07 2012-06-05 Exiqon A/S Methods for quantification of microRNAs and small interfering RNAs
US8383344B2 (en) 2004-04-07 2013-02-26 Exiqon A/S Methods for quantification of microRNAs and small interfering RNAs
CN100390300C (zh) * 2004-09-27 2008-05-28 株式会社日立高新技术 核酸扩增分析法及装置
EP2142926A2 (fr) * 2007-04-05 2010-01-13 Genera Biosystems Limited Compositions et procédés de détection
EP2142926A4 (fr) * 2007-04-05 2010-08-04 Genera Biosystems Ltd Compositions et procédés de détection
CN102685048A (zh) * 2012-05-28 2012-09-19 上海师范大学 一种突发信号盲均衡算法

Also Published As

Publication number Publication date
JP2003505034A (ja) 2003-02-12
WO2001006004A3 (fr) 2001-08-09
KR20020034161A (ko) 2002-05-08
AU6695600A (en) 2001-02-05
CA2378070A1 (fr) 2001-01-25
EP1196639A2 (fr) 2002-04-17

Similar Documents

Publication Publication Date Title
US7214490B2 (en) Method of target enrichment and amplification
US20050123987A1 (en) Method for depleting specific nucleic acids from a mixture
US6200747B1 (en) Method and kits for detection of fragile X specific, GC-rich DNA sequences
JP2011500092A (ja) 非ランダムプライマーを用いたｃＤＮＡ合成の方法
EP1966394A2 (fr) Strategies ameliorees pour etablir des profils de produits de transcription au moyen de technologies de sequençage a rendement eleve
WO2001006004A2 (fr) Procede d'amplification de sequences d'acide nucleique peu abondantes et moyens mis en oeuvre pour ce procede
US20110294701A1 (en) Nucleic acid amplification using non-random primers
US10947592B2 (en) Method for detecting cystic fibrosis
WO2000008208A2 (fr) Transcription inverse, amplification, et leurs amorces
JP2002519011A (ja) 弁別的に発現されたｍＲＮＡの同時同定および相対濃度測定のための改良方法
US20020164634A1 (en) Methods for reducing complexity of nucleic acid samples
JP7206424B2 (ja) ｍＲＮＡを増幅する方法及び完全長ｍＲＮＡライブラリを調製する方法
JP2002529050A (ja) 弁別的に発現されたｍＲＮＡの同時同定および相対濃度測定のための方法
Nonneman et al. Isolation and enrichment of abundant microsatellites from a channel catfish (Ictalurus punctatus) brain cDNA library
US10036053B2 (en) Determination of variants produced upon replication or transcription of nucleic acid sequences
AU2008232747B2 (en) Identification of the causative mutation for Hereditary Equine Regional Dermal Asthenia and a method for testing same
WO2004063390A2 (fr) Compositions et procedes pour determiner le sexe de chiens
WO2009079733A1 (fr) Détermination de variants produits par réplication ou transcription de séquences d'acide nucléique
CN113166742A (zh) 用于消耗和富集核酸序列的方法和试剂盒

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2378070

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1020027000769

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 66956/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2000954533

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000954533

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020027000769

Country of ref document: KR

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10019906

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 2000954533

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1020027000769

Country of ref document: KR