WO2000065049A1 - Gene 513 associe a la pollinose - Google Patents
Gene 513 associe a la pollinose Download PDFInfo
- Publication number
- WO2000065049A1 WO2000065049A1 PCT/JP2000/002733 JP0002733W WO0065049A1 WO 2000065049 A1 WO2000065049 A1 WO 2000065049A1 JP 0002733 W JP0002733 W JP 0002733W WO 0065049 A1 WO0065049 A1 WO 0065049A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- preparing
- rna
- rna sample
- test compound
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
Definitions
- the present invention relates to a gene associated with an allergic disease, in particular, hay fever, a method for testing an allergic disease using an expression of the gene as an index, and a method for screening a candidate therapeutic drug for an allergic disease.
- Allergic diseases including hay fever, are considered multifactorial diseases. These diseases are caused by the interaction of the expression of many different genes, and the expression of these individual genes is affected by multiple environmental factors. Therefore, it is very difficult to elucidate the specific genes that cause specific diseases.
- Allergic diseases are thought to be related to the expression of genes having mutations or defects, or to overexpression or reduced expression of specific genes. To understand the role of gene expression in disease, it is necessary to understand how genes are involved in pathogenesis and how external stimuli, such as drugs, alter gene expression.
- the differential display (DD) method is useful as such a method.
- the differential display method was first developed in 1992 by Liang and Pardee (Science, 1992, 257: 967-971). By using this method, dozens or more of samples can be screened at a time, and It is possible to detect a gene whose expression has changed. Using such a method to examine genes with mutations or genes whose expression changes with time or environment is expected to provide important information for elucidating pathogenic genes. These genes include those whose expression is affected by environmental factors.
- hay fever is one of the diseases seen in many people in recent years.
- the pathogenesis of hay fever may involve several genes whose expression is affected by pollen, one of the environmental factors. Under such circumstances, it has been desired to isolate a gene associated with hay fever. Disclosure of the invention
- An object of the present invention is to provide a gene associated with an allergic disease, particularly hay fever. Another object of the present invention is to provide a method for detecting an allergic disease and a method for screening a candidate compound for a therapeutic drug for allergic diseases, using the expression of the gene as an index.
- the present inventors have proposed a method for treating a plurality of humans based on the already established “Fluorescent DD (Fluorescent DD) method” (T. I to et al., 1994, FEBS Lett. 351: 231-236).
- Fluorescent DD Fluorescent DD
- the present inventors divided the subjects into a group with a high IgE value for cedar pollen (group predisposed to cedar pollinosis) and other groups (healthy subjects), and determined the expression level of the isolated “513” gene in both groups. As a result of comparative analysis, it was found that the gene showed significantly higher values in the cedar pollinosis-predisposing group than in healthy subjects. Therefore, the present inventors have determined that the expression level of the gene As an index, it has been found that it is possible to conduct an allergic disease test and to screen for a candidate drug for a therapeutic drug for allergic disease.
- the present invention relates to a gene that is highly expressed in a person having an allergic predisposition, a method for testing an allergic disease using the expression of the gene as an index, and a method for screening a candidate compound for a therapeutic drug for allergic disease. More specifically,
- nucleic acid molecule comprising the base sequence of SEQ ID NO: 1,
- nucleic acid molecule comprising the coding region of the nucleotide sequence of SEQ ID NO: 1,
- T cells are prepared from peripheral blood of the subject
- a method for screening a therapeutic candidate compound for an allergic disease comprising:
- step (f) selecting a compound that reduces the amount of RNA measured in step (e) as compared to a control (in the case where the test compound is not administered),
- step (f) Amplification in step (e) compared to control (without test compound) Selecting a compound that reduces the amount of DM to be obtained, (12) a method of screening a candidate drug for a therapeutic agent for allergic disease,
- step (h) selecting a compound that reduces the amount of RNA measured in step (g) as compared to a control (in the case where the test compound is not administered),
- step (h) selecting a compound that reduces the amount of DNA amplified in step (g) as compared to a control (in the case where no test compound is administered);
- a method for screening a candidate compound for a therapeutic drug for an allergic disease comprising: (a) preparing lymphocytes from a hay fever model animal or a human having hay fever; Process,
- step (g) selecting a compound that reduces the amount of RNA measured in step (f) as compared to a control (in the case where the test compound is not administered),
- step (g) selecting a compound that reduces the amount of DNA amplified in step (f) as compared to a control (in the case where no test compound is administered);
- step (e) selecting a compound that reduces the amount of RNA measured in step (d) as compared to a control (in the case where the test compound is not administered),
- step (e) selecting a compound that reduces the amount of DNA amplified in step (d) as compared to a control (in the case where the test compound is not administered),
- lymphocytes are prepared from peripheral blood
- allergic disease is a general term for diseases associated with allergic reactions. More specifically, it can be defined as identifying the allergen, demonstrating a deep link between exposure to the allergen and the development of the lesion, and demonstrating an immunological mechanism for the lesion.
- the immunological mechanism means that T cells show an immune response by allergen stimulation.
- Representative allergic diseases can include bronchial asthma, allergic rhinitis, atopic dermatitis, hay fever, or insect allergy.
- Allergic diathesis is a genetic factor transmitted from parents to children with allergic diseases. family sexually occurring allergic diseases are also called atopic diseases, and the genetic factors that cause them are atopic diathesis.
- the “nucleic acid molecule” in the present invention includes DNA and RNA.
- the “test for allergic disease” in the present invention includes not only a test for a patient who has an allergic disease, but also a test for determining whether or not a subject who does not have an allergic disease has an allergic predisposition. Inspection is also included.
- the present invention relates to a novel gene “513” correlated with an IgE production response to cedar pollen of an individual.
- SEQ ID NO: 1 shows the nucleotide sequence of “513” cDNA found by the present inventors.
- the base sequence of the “513” cDNA isolated by the present inventors is a partial distribution sequence of the “513” cDNA, and those skilled in the art will be able to obtain the sequence information of the “513” cDNA described in SEQ ID NO: 1.
- isolation of the full-length cDNA of "513” can be usually performed. That is, a method for screening a T cell cDNA library or the like by hybridization using a sequence derived from “513” as a probe, or a method for screening a DNA derived from a T cell cDNA library or the like using a sequence derived from “513” as a primer.
- nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1” in the present invention includes the full-length of “513” which can be isolated based on the sequence information of the “513” cDNA of SEQ ID NO: 1. cDNA is included.
- “513” showed significantly higher expression in the atopic predisposing group (IgE value for cedar pollen was 3.5 AU / ml or more) than in the non-atopic predisposing group. Therefore, using the expression of the “513” gene (including transcription into mRNA and translation into protein) as an index, It will be possible to conduct examinations of the disease and screening for candidate compounds for the treatment of allergic diseases.
- cedar pollinosis is particularly preferred as an allergic disease to be tested and treated.
- the detection of the expression of the “513” gene in the test for allergic disease according to the present invention can be performed by a hybridization technique using a nucleic acid that hybridizes to the “513” gene as a probe, or a DNA that hybridizes to the gene of the present invention as a primer. It is possible to use the gene amplification technology.
- a nucleic acid molecule that specifically hybridizes to the “513” gene and has a chain length of at least 15 nucleotides is used.
- the term “specifically hybridizes” as used herein refers to a DNA that encodes another gene and cross-hybridizes under normal hybridization conditions, preferably under stringent hybridization conditions, with Z or RM. Indicates that no significant dilution occurs.
- the probe and the transfer membrane are hybridized with 68 in Express Hybridization Solution (manufactured by CL0NTECH), and finally washed with 50 in 0.1X SSC, 0.05% SDS solution, and then washed with 50. It can be set to a gently condition.
- the probe DNA used for hybridization is usually labeled.
- Labels include, for example, labeling by nick translation using DNA polymerase 1, end labeling using polynucleotide kinase, fill-in end labeling using Klenow fragment (Berger SL, Kimmel AR. (1987) Guide to Molecular Cloning Techniques, Method in Enzymology, Academic Press; Hames BD, Higg ins SJ (1985) Genes Probes: A Practical Approach. IRL Press; Sambrook. J, Fritsch EF, Maniat is T. (1989) Molecular Cloning: a Laboratory Manual, 2nd Edn.
- Testing for allergic diseases using the hybridization technology can be performed using, for example, a Northern hybridization method, a dot blot method, a method using a DNA microarray, or the like.
- the RT-PCR method can be used as a method utilizing the gene amplification technique.
- the expression of the “513” gene can be more accurately quantified by using the PCR amplification monitor method as shown in Example 8 in the gene amplification process.
- probes that are labeled with different fluorescent dyes that cancel each other's fluorescence on both ends are used to hybridize to the detection target (DNA or reverse transcript of RNA).
- the detection target DNA or reverse transcript of RNA
- the two fluorescent dyes are separated and the fluorescence is detected. This fluorescence is detected in real time.
- the number of copies of the target to be detected in the target sample is determined by the number of linear cycles of PCR amplification by simultaneously measuring a standard sample with a clear copy number for the target (Holland, PM et al., 1991, Proc. Natl. Acad. Sci.
- test for an allergic disease of the present invention may be performed by detecting the protein encoded by “513”.
- a test method includes, for example, a West method using an antibody that binds to a protein encoded by “513”. Tumbrotting, immunoprecipitation, ELISA and the like can be used.
- the antibody of the protein encoded by "513" of the present invention can be obtained as a polyclonal antibody or a monoclonal antibody using techniques well known to those skilled in the art (Milstein C, et al., 1983, Nature 305). (5934): 537-40).
- a protein or a partial peptide thereof used as an antigen is prepared by incorporating the “513” gene or a part thereof into an expression vector, introducing the vector into an appropriate host cell, and preparing a transformant. Is cultured to express a recombinant protein, and the expressed recombinant protein is purified from a culture or a culture supernatant.
- the expression of the gene of the present invention if the expression of the gene of the present invention is significantly high, the subject can be determined to have a high IgE value against an allergen such as cedar pollen antigen and have an allergic predisposition.
- the measurement of the expression level of the gene of the present invention in combination with the allergen-specific antibody titer, symptoms, etc. can be used for testing for allergic diseases.
- the “513” gene expressed in T cells has high IgE specific to pollen antigen, and its expression is increased in a group of hay fever patients. Even in an allergic patient showing responsiveness to an antigen other than cedar pollen, the expression of the “513” gene may be increased in a state where T cell responsiveness to the antigen is enhanced. In such cases, increased expression of the “513” gene corresponds to increased T-cell responsiveness, and therefore, screening for therapeutic drugs for allergic diseases by monitoring the expression of the “513” gene is not possible. it can.
- the method for screening a candidate compound for treating an allergic disease of the present invention can be performed in vivo or in vitro.
- in vivo screening for example, after administering a candidate drug and stimulating with a pollen antigen to a model animal such as a mouse, T cells are separated from peripheral blood, and the transcript of “513” is obtained. Measure.
- lymphocytes are separated from peripheral blood, and the lymphocytes are stimulated in vitro with cedar pollen antigen or the like. Lymph after the stimulation Separate T cells from the sphere and measure the transcript of the “513” gene.
- a compound that reduces the transcription amount of the “513” gene is selected.
- the stimulation with the pollen antigen is performed for the purpose of inducing an antigen-specific allergic reaction in ⁇ cells and determining the therapeutic effect of the candidate compound on it.
- peripheral blood lymphocytes are collected from hay fever humans or mice, and the peripheral blood lymphocytes are stimulated in vitro with cedar pollen antigens.
- Candidate compounds are added during invitro stimulation.
- the T cells are then separated from the stimulated peripheral blood lymphocytes and the transcript of “513” is measured. As a result of this measurement, a compound that reduces the transcription amount of the “513” gene is selected.
- Screening of the candidate compound for treating an allergic disease of the present invention can also be performed using established T cells.
- established T cells such as Molt4 cells and Jurkat cells
- lymphocyte stimulating substances include calcium ionophore (A23187), PMA, and phytohemagglutinin (PHA).
- Add candidate drug during i n vitro stimulation Thereafter, the transcription amount of the “513” gene in the established T cells is measured. As a result of this measurement, a compound that reduces the transcription of the “513” gene is selected.
- Detection of the expression of the “513” gene in the screening of a candidate compound for treatment of an allergic disease can be performed by a hybridization technique using a nucleic acid that hybridizes to the “513” gene as a probe, as in the test for an allergic disease of the present invention, or It can be carried out using a gene amplification technique using DNA that hybridizes to the gene of the present invention as a primer.
- a method using the hybridization technology for example, a Northern hybridization method, a dot blot method, a method using a DNA microarray, and the like can be used.
- a method utilizing the gene amplification technique an RT-PCR method can be used. In the RT-PCR method, if a PCR amplification monitor method as shown in Example 8 is used in the gene amplification process, More accurate quantification can be performed.
- test compounds used in these screenings include compound samples synthesized by existing chemical methods such as steroid derivatives, compound samples synthesized by combinatorial chemistry, extracts of animal and plant tissues, and microorganisms. A mixture containing a plurality of compounds such as a culture, a sample purified from them, and the like can be mentioned.
- the compound isolated by the method for screening a candidate compound for a therapeutic drug for an allergic disease of the present invention is a candidate for a drug which improves allergic predisposition to an allergen such as a pollen antigen.
- the compound isolated by the screening method of the present invention when used as a pharmaceutical, it can be used as a pharmaceutical preparation by a known pharmaceutical production method.
- a pharmaceutically acceptable carrier or vehicle such as saline, vegetable oils, suspensions, surfactants, stabilizers, etc.
- Administration will be transdermal, intranasal, transbronchial, intramuscular, intravenous, or oral, depending on the nature of the compound.
- the dose varies depending on the patient's age, body weight, symptoms, administration method and the like, but those skilled in the art can appropriately select an appropriate dose.
- FIG. 1 is a diagram showing the antibody titers of cedar pollen-specific IgE antibodies in a total of 18 blood samples from 10 subjects who collected blood.
- the value of cedar pollen-specific IgE antibody in each blood sample of subjects A to (sample numbers 1 to 18) was expressed in AU / ml.
- the pair before pollen scattering is shown on the left (white column), and the one after scattering is shown on the right (black column).
- Subjects A and B collected only blood after pollen scattering.
- FIG. 2 is a diagram showing changes in the expression of “513” in a high IgE group and a normal IgE group when classified according to cedar pollen-specific IgE values. Error bars represent standard deviation.
- Serum with standard antibody titers from Pharmacia There are, to determine it based on their respective IgE antibody titer of the sample (unit displays Pharmacia RAST Unit, PRU or both AU (a rbitrary unit),).
- Fig. 1 shows the measured cedar pollen-specific IgE values before and after pollen scattering in each subject. As shown, most of the 10 subjects had increased serum levels of cedar pollen-specific IgE after pollen exposure. The presence of atopic predisposition was determined by whether the value of the CAP RAST test for cedar pollen-specific IgE was greater than 1. That is, subjects A to G and I were eight subjects as atopic predisposition group (hereinafter also referred to as “patient”), and subjects H and ⁇ were regarded as healthy subjects (hereinafter also referred to as “normal group”). Of the eight subjects with an atopic predisposition, seven exhibited symptoms of allergic rhinitis after pollen dispersal.
- patient atopic predisposition group
- normal group healthy subjects
- the procedure was as follows. First, treat the syringe wall uniformly with 1 ml of Heparin from Novo, etc. to obtain a final concentration of 50 unit / ml Heparin. Blood was collected in a 10 ml syringe containing At this time, two 22G needles were prepared for one blood sample. The injection needle was removed and transferred to a 50 ml centrifuge tube (made of polypropylene). After centrifugation at 1500 rpm for 5 minutes at room temperature, 1.1 ml was collected from as close to the surface as possible, and centrifuged at 15000 rpm for 5 minutes at 4 to collect 1 ml of the supernatant as plasma.
- the lymphocyte fraction obtained in Example 2 was centrifuged at 1200 ⁇ for 4: 5 minutes, and suspended in BSA / PBS at a concentration of 10 8 per 100 1. The capacity became about 201. This was transferred to an Eppendorf tube (1.5 ml), and the CD3 microbead solution was added. After that, it was left at 4-10 for 30 minutes (it was not placed on ice at this time). Magneto this sample The treatment was carried out using a tic cell sorter (MACS) (manufactured by Milteny Biotech Inc.) as follows. The MS + / RS + column was attached to the Mini MACS or Vario MACS separation unit (without needles). 500 1 of BSA / PBS was gently applied to the column and the buffer was drained.
- MCS tic cell sorter
- T cell fraction was centrifuged at 00 rpm for 5 minutes at 4.
- the precipitate was washed twice with BSA / PBS. After the second washing, the cells were suspended in 1 ml, and a part thereof was diluted 2-fold with trypan blue to count the number of cells. Total cell number was approximately 4 ⁇ 10 6 .
- RNA from T cells was prepared using RNeasy Mini (manufactured by Qiagen) according to the attached manual in principle. All operations were performed at room temperature, wearing gloves. Four volumes of ethanol were added to Posh Buffer RPE. To the lysis buffer RLT, 101 / ml of 2-mercaptoethanol was added. The cell suspension was centrifuged at 1000-1200 nm for 5 minutes, and the supernatant was removed by evaporation. A 350 ⁇ 1 lysis buffer RLT (containing 2-mercaptoethanol) solution was added to the precipitate. At this stage, lysates of cells in RLT buffer could be stored at -70.
- the cell lysate was stored frozen, it was incubated at 37 t: for 10-15 minutes, and if insoluble material was visible, it was centrifuged at maximum speed for 3 minutes, and only the supernatant was collected.
- the lysate was homogenized with a syringe with a 20G force teran needle and processed with Q IAshredder. (That is, usually, 350 1 cell lysates were applied to a Kyaschlets dunit using a Pittman. This was centrifuged at 1500 ⁇ m for 2 minutes to collect the effluent.) 1/70% ethanol was added and mixed well by pipetting.
- the column was placed in a new 1.5 ml tube, 30 / l of DEPC-treated water was applied, the lid was closed, and the column was allowed to stand for 10 minutes. Centrifugation was performed at 1500 ir »m for 10 minutes to obtain total RNA. Measure the concentration, and if the volume is low, re-attach the column to a new 1.5 ml tube, apply D EPC-treated water 30 1, cover it, cover it for 10 minutes, and set it up at 1 1500 ⁇ ⁇ ⁇ . Centrifuge for minutes.
- DNase treatment was performed to remove DNA from total RNA prepared from T cells. The reaction was performed with 2 units of DNase (Futtsubon Gene) and 50 units of RNase inhibitor
- DD Differential display
- F1 uorescent Differential Display Fluorescence differential display (F1 uorescent Differential Display, abbreviated as “DD”) using total RNA prepared from T cells is described in the literature (T. Ito et al., 1994, FEBS Lett. 351: 231-236). Performed according to the method. Total RNA prepared from T cells was reverse transcribed to obtain cDNA.
- cDNA was prepared using 0.2 g of total RNA for each of the three anchor primers.
- cDNA was prepared using RNAOAg for each of the three anchor primers.
- Each cDNA was diluted to a final concentration equivalent to 0.4 ng / jl RNA and used in the experiments.
- a DD-PCR reaction was performed using cDNA equivalent to 1 ng RNA per reaction. Table 1 shows the composition of the reaction solution.
- the PCR reaction conditions were as follows: ⁇ 95 minutes 3 minutes, 40 minutes 5 minutes, 72 minutes 5 minutes '' for one cycle, followed by 94 cycles of 15 seconds, 40 minutes 2 minutes, and 72 minutes 1 minute of 30 cycles. Afterwards, it was kept at 72 for 5 minutes and then continuously at 4.
- the primer pairs used were arbitrary primers AG 1 to 110 and AG 111 to AG 15A (SEQ ID NO: 2), GT 15C (SEQ ID NO: 3), and GT15G (SEQ ID NO: 4), which are anchor primers, respectively.
- a total of 287 reactions were performed by combining 199 and AG 200-287.
- an oligomer composed of 10 nucleotides having a GC content of 50% was designed, synthesized, and used.
- a 6% denaturing polyacrylamide gel was prepared, and samples were applied and electrophoresed at 40 W for 210 minutes. Thereafter, the gel plate was scanned using Hitachi Fluorescence Image Analyzer -FMBI0 I I, and electrophoresis images were obtained by fluorescence detection.
- Two DD analyzes were performed using a number of arbitrary primers. Bands that differed before and after pollen dispersal or between the patient and healthy groups were selected and reproducible bands were excised from the gel in two experiments.
- the band “513” was found by DD analysis using GT15C (SEQ ID NO: 3) as an anchor primer and AG136 (TCATGCAGAC / SEQ ID NO: 5) as an arbitrary primer.
- the gel containing the “513” band was cut out, stored in a TE solution, and heated at 60 for 10 minutes to elute DNA from the gel.
- a TE solution as type II
- PCR was performed under the same conditions as DD-PCR, and a DNA fragment of about 360 bp was amplified.
- GT15C was used as the primer and AG136 was used as the optional primer.
- the amplified DNA fragment was cloned into a plasmid vector pCR2.1 (Invitrogen) to obtain a plasmid P513-122 having a DNA fragment of about 360 bp.
- the nucleotide sequence of the DNA fragment was determined according to a conventional method.
- the expression amount of “513” was quantified by the TaqMan method using ABI-PRISM7700. This method quantitatively detects the PCR-amplified MA chain in real time using a fluorescent dye. System.
- RNA samples before and after cedar pollen scattering were collected from 22 volunteers in the spring of 1998, T cells were prepared, and total RNA was extracted. The expression level of the target gene was quantified using a total of 44 RNA samples.
- primers 513-TQ1 GCAGACAGTTCGATGCTTTTCC SEQ ID NO: 6
- 513-TQ2 TTTTCTTATGAGGTCCTGCCTT G / SEQ ID NO: 7
- TaqMan probe 513-TQM AGGGCAGTTTGCATCCTAAAGGTTGTTAA No .: 8
- TaqMan probe 5 13 -TQM was used with its 5 'end fluorescently labeled with FAM (6-carboxyfluorescein) and its 3' end fluorescently labeled with TAMRA (6-carboxy-tetramethyl-rhodamine).
- FAM 6-carboxyfluorescein
- TAMRA 6-carboxy-tetramethyl-rhodamine
- type I cDNA obtained by reverse transcription of 44 total RNAs using poly T (12 to 18 mer) as a primer was used.
- a serial dilution of the plasmid p513-122 obtained in Example 7 was used as a type II for the reaction.
- Table 3 shows the composition of the reaction mixture for monitoring PCR amplification.
- the same quantitative analysis was performed on the ⁇ -actin actin) gene, and the target gene (513) was calculated.
- Reaction composition of AB I-PRISM 7700 (reaction volume per 1 liter) Sterile distilled water 25.66 (ill)
- Table 4 shows the number (copy number) of “513” in each sample corrected for the 0-actin copy number. For the correction, the average copy of ⁇ -actin in all samples was obtained, and the copy number of "513" in each sample was divided by the relative value of / 3-actin in each sample when it was set to 1.
- “513” was cloned using Marathon cDNA Amplification Kit (CLONTECH).
- a cDNA for Marathon was prepared using the mRNA of the YY-1 cell line and used as type II.
- PCR was performed using the specific primer 513-154L (GCTTGTCCCTGGGGTTCACACTTZ SEQ ID NO: 9) prepared based on the nucleotide sequence of “513” isolated by DD and the adapter-primer attached to the kit.
- Amplification products of up to about 1. 1 kb were obtained. When the base sequence was determined, it was 1171 bp including the sequence determined so far. Was obtained. This sequence is shown in SEQ ID NO: 1.
- a novel gene having a correlation with a cedar pollen-specific IgE value was provided.
- the expression of the gene of the present invention as an index it has become possible to carry out a test for whether or not the subject has an allergic predisposition and a screening for candidate compounds for a therapeutic drug for allergic diseases.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/019,832 US6986990B1 (en) | 1999-04-27 | 2000-04-26 | Pollen allergy-related gene 513 |
EP00922883A EP1182256A4 (en) | 1999-04-27 | 2000-04-26 | WITH POLLINOSIS ASSOCIATED GEN 513 |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP11/120491 | 1999-04-27 | ||
JP12049199 | 1999-04-27 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000065049A1 true WO2000065049A1 (fr) | 2000-11-02 |
Family
ID=14787516
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/JP2000/002733 WO2000065049A1 (fr) | 1999-04-27 | 2000-04-26 | Gene 513 associe a la pollinose |
Country Status (3)
Country | Link |
---|---|
US (1) | US6986990B1 (ja) |
EP (1) | EP1182256A4 (ja) |
WO (1) | WO2000065049A1 (ja) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1284289A1 (en) * | 2000-12-21 | 2003-02-19 | Genox Research, Inc. | Method of examining allergic disease |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH11332567A (ja) * | 1998-05-22 | 1999-12-07 | Dai Ichi Seiyaku Co Ltd | アトピー体質の判定方法 |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997020948A1 (en) * | 1995-12-05 | 1997-06-12 | Koch Joern Erland | A cascade nucleic acid amplification reaction |
US5792850A (en) * | 1996-05-23 | 1998-08-11 | Zymogenetics, Inc. | Hematopoietic cytokine receptor |
-
2000
- 2000-04-26 WO PCT/JP2000/002733 patent/WO2000065049A1/ja not_active Application Discontinuation
- 2000-04-26 EP EP00922883A patent/EP1182256A4/en not_active Withdrawn
- 2000-04-26 US US10/019,832 patent/US6986990B1/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH11332567A (ja) * | 1998-05-22 | 1999-12-07 | Dai Ichi Seiyaku Co Ltd | アトピー体質の判定方法 |
Non-Patent Citations (5)
Title |
---|
HOLROYD KENNETH J. ET AL.: "Asthma and bronchial hyperresponsiveness linked to the XY long arm pseudoautosomal region", GENOMICS, vol. 52, no. 2, 1 September 1998 (1998-09-01), pages 233 - 235, XP002930133 * |
KAZUSHI HONDA: "Sugi kafun sho no meneki idengaku teki kaiseki HLA to rensa shita sugi kafun kogen ni taisuru meneki yokusei idenshi no shoumei to kaiseki", FUKUOKA IGAKU ZASSHI, vol. 80, no. 1, 25 January 1989 (1989-01-25), pages 28 - 37, XP002946664 * |
MITSURU MUNAKATA: "beta-Adrenalin juyotai idenshi", GENDAI IRYO, vol. 30, no. 3, 10 March 1998 (1998-03-10), pages 863 - 867, XP002946665 * |
See also references of EP1182256A4 * |
TAKABAYASHI AKIRA ET AL.: "Novel polymorphism in the 5'-untranslated region of the interleukin-4 gene", JOURNAL OF HUMAN GENETICS, vol. 44, no. 5, 1999, pages 352 - 353, XP002930134 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1284289A1 (en) * | 2000-12-21 | 2003-02-19 | Genox Research, Inc. | Method of examining allergic disease |
EP1284289A4 (en) * | 2000-12-21 | 2004-03-31 | Genox Research Inc | METHOD OF STUDYING ALLERGIC DISEASES |
Also Published As
Publication number | Publication date |
---|---|
EP1182256A1 (en) | 2002-02-27 |
US6986990B1 (en) | 2006-01-17 |
EP1182256A4 (en) | 2003-07-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Singh et al. | Gene expression changes in peripheral blood mononuclear cells from multiple sclerosis patients undergoing β-interferon therapy | |
JP6997709B2 (ja) | 全身性炎症反応症候群(sirs)患者における合併症リスクを評価する方法 | |
Pereira et al. | IL10A genotypic association with decreased IL-10 circulating levels in malaria infected individuals from endemic area of the Brazilian Amazon | |
CN109825571A (zh) | 抑郁症检测生物标记物及其试剂盒 | |
WO2001065259A1 (fr) | Methode d'examen de maladies allergiques | |
WO2000020575A1 (fr) | Gene associe a la pollinose | |
WO2000065049A1 (fr) | Gene 513 associe a la pollinose | |
WO2000065046A1 (en) | Pollinosis-associated gene 373 | |
US20220349888A1 (en) | Method for detecting brain tumor | |
JPWO2002050269A1 (ja) | アレルギー性疾患の検査方法 | |
WO2000073435A1 (fr) | Gene 441 associe a la pollinose | |
JP2002300883A (ja) | ステロイド応答性の検査方法 | |
KR101889072B1 (ko) | 디지털 PCR을 이용한 유전성 강직성 대마비(Hereditary spastic paraplegia, HSP) 관련 유전자 SPG4의 거대결손 검증법 | |
WO2000065051A1 (fr) | Gene 627 associe a la pollinose | |
WO2000073440A1 (fr) | Gene 787 associe a la pollinose | |
WO2000073439A1 (fr) | Gene 465 associe a la pollinose | |
JP2003125776A (ja) | 花粉症関連遺伝子、419 | |
JP2003125777A (ja) | 花粉症関連遺伝子、581 | |
WO2000065050A1 (en) | Pollinosis-associated gene 795 | |
JP7540730B2 (ja) | 関節リウマチを検査する方法 | |
WO2018129529A1 (en) | Compositions and methods targeting the th2 pathway for the treatment of asthma | |
CN108251519B (zh) | 轴前多指病的致病基因及其用途 | |
JP2002257827A (ja) | ステロイド応答性の検査方法 | |
JPWO2003054231A1 (ja) | アレルギー性疾患の検査方法 | |
JPWO2002033069A1 (ja) | アレルギー性疾患の検査方法 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA CN JP KR US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2000 614385 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000922883 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000922883 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10019832 Country of ref document: US |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000922883 Country of ref document: EP |