WO2000065050A1

WO2000065050A1 - Pollinosis-associated gene 795

Info

Publication number: WO2000065050A1
Application number: PCT/JP2000/002734
Authority: WO
Inventors: Takeshi Nagasu; Yuji Sugita; Tomoko Fujishima; Tadahiro Oshida; Masaya Obayashi; Shigemichi Gunji; Izumi Obayashi; Yukiho Imai; Nei Yoshida; Kaoru Ogawa; Keiko Matsui; Eiki Takahashi; Akira Yokoi
Original assignee: Genox Research, Inc.; Eisai Co., Ltd.
Priority date: 1999-04-27
Filing date: 2000-04-26
Publication date: 2000-11-02

Abstract

A novel gene undergoing significantly low expression in subjects showing high cedar pollen-specific IgE levels. This gene has been successfully isolated by preparing T cells from subjects showing different cedar pollen-specific Ig-E levels before and after the pollen-scattering season and searching the gene by the differential display method. It is found out that this gene is usable in examining allergic diseases and screening candidate compounds for remedies for allergic diseases.

Description

Description Pollen allergy-related gene, 795 Technical field

The present invention relates to a gene associated with an allergic disease, in particular, hay fever, a method for testing an allergic disease using an expression of the gene as an index, and a method for screening a candidate therapeutic drug for an allergic disease. Background art

Allergic diseases, including hay fever, are considered multifactorial diseases. These diseases are caused by the interaction of the expression of many different genes, and the expression of these individual genes is affected by multiple environmental factors. Therefore, it is very difficult to elucidate the specific genes that cause specific diseases.

Allergic diseases are thought to be related to the expression of genes having mutations or defects, or to overexpression or reduced expression of specific genes. To understand the role of gene expression in disease, it is necessary to understand how genes are involved in pathogenesis and how external stimuli, such as drugs, alter gene expression.

Recent developments in gene expression analysis technology have made it possible to analyze and compare gene expression in many clinical samples. The differential display (DD) method is useful as such a method. The differential display method was first developed in 1992 by Liang and Pardee (Science, 1992, 257: 967-971). By using this method, dozens or more of samples can be screened at a time, and It is possible to detect a gene whose expression has changed. Using such a method to examine genes with mutations or genes whose expression changes with time or environment is expected to provide important information for elucidating pathogenic genes. These genes include those whose expression is affected by environmental factors.

Among allergic diseases, hay fever is one of the diseases seen in many people in recent years. The pathogenesis of hay fever may involve several genes whose expression is affected by pollen, one of the environmental factors. Under such circumstances, it has been desired to isolate a gene associated with hay fever. Disclosure of the invention

An object of the present invention is to provide a gene associated with an allergic disease, particularly hay fever. Another object of the present invention is to provide a method for detecting an allergic disease and a method for screening a candidate compound for a therapeutic drug for allergic diseases, using the expression of the gene as an index.

The inventors of the present invention have proposed a method based on the already established “Fluorescent DD (Fluorescent DD) method” (T. I to et al., 1994, FEBS Lett. 351: 231-236). We developed a new DD system that can analyze T cell RNA samples prepared from. Using this system, the present inventors collected T cells from blood before and after pollen scattering in multiple subjects including pollinosis patients, and expressed T cells between subjects with different cedar pollen-specific IgE values and before and after pollen scattering. We screened for genes with varying amounts and isolated a novel gene (the “795” gene).

The present inventors divided the subjects into a group having a high IgE value for cedar pollen (a group predisposed to cedar pollinosis) and other groups (normal subjects), and determined the expression level of the isolated “795” gene in both groups. As a result of comparative analysis, it was found that the gene showed a significantly lower value in the cedar pollinosis-diseased group as compared with healthy subjects. Furthermore, the results of the analysis of the base sequence As a result, it is a non-splicing form of this viability S vimentin, and the expression pattern of vimentin is significantly lower in the cedar pollinosis predisposition group compared to healthy subjects as in `` 795 '' It revealed that. For this reason, the present inventors have found that it is possible to perform an allergic disease test and a screening of a candidate drug for a therapeutic agent for allergic disease using the expression levels of these genes as indices.

That is, the present invention relates to a gene exhibiting a decreased expression level in a person having an allergic predisposition, a method for testing an allergic disease using the expression level of the gene as an index, and a method for screening a candidate compound for a therapeutic drug for allergic disease. . More specifically, the present invention relates to the following nucleic acid molecule, and a test method or a screening method using the nucleic acid molecule as an index.

[1] a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 24;

[2] A nucleic acid molecule functionally equivalent to a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 24, which is hybridized with a DNA consisting of the nucleotide sequence of SEQ ID NO: 24 under stringent conditions.

[3] A vector into which the nucleic acid molecule according to [1] or [2] has been inserted.

[4] A transformant that retains the nucleic acid molecule of [1] or [2] in an expressible manner. [5] A polynucleotide that hybridizes to a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 24 or a complementary strand thereof, and has a chain length of at least 15 nucleotides.

[6] The primer for nucleic acid molecule synthesis according to [1], comprising the polynucleotide according to [5].

[7] The probe for detecting a nucleic acid molecule of [1], comprising the polynucleotide of [5].

[8] The method for detecting a nucleic acid molecule according to [1], comprising using the polynucleotide according to [5].

[9] SEQ ID NO: 24 or the nucleotide sequence of SEQ ID NO: 25 in a biological sample A method for testing an allergic disease, comprising the step of measuring the expression level of a gene comprising the gene and comparing it with a control (in the case of a healthy subject).

[10] The method according to [9], wherein the biological sample is a T cell, and the expression level of the gene in the T cell is measured by RT-PCR using mRNA as type III.

[11] The method according to [10], wherein RT-PCR is performed by a PCR amplification monitoring method.

[12] The method according to any one of [9] to [11], wherein T cells are prepared from peripheral blood of the subject.

[13] The biological sample is blood, and the expression level of the gene is measured by measuring a protein comprising the amino acid sequence shown in SEQ ID NO: 26 and Z or a fragment thereof in blood. the method of.

[14] The method according to any one of [9] to [13], wherein the allergic disease is cedar pollinosis.

(15) a method for screening a therapeutic compound candidate compound for an allergic disease,

(a) administering a test compound to a model animal of hay fever and stimulating it with a pollen antigen;

(b) measuring the expression level of a gene consisting of the nucleotide sequence of SEQ ID NO: 24 or SEQ ID NO: 25 in T cells of the model animal,

(c) selecting a compound that increases the expression level of the gene measured in step (b) as compared to a control (in the case where no test compound is administered).

(16) a method for screening a candidate drug for a therapeutic drug for an allergic disease,

(a) administering a test compound to a model animal of hay fever,

(b) preparing lymphocytes from the model animal,

(c) stimulating the lymphocytes with a pollen antigen, (d) separating T cells from the antigen-stimulated lymphocytes,

(e) measuring the expression level of the gene comprising the base sequence of SEQ ID NO: 24 or SEQ ID NO: 25 in the T cell,

(f) selecting a compound that increases the expression level of the gene measured in step (e) as compared to a control (in the case where no test compound is administered).

(17) a method for screening a candidate drug for a therapeutic drug for an allergic disease,

(a) preparing lymphocytes from a hay fever model animal or hay fever;

(b) stimulating the lymphocytes with a pollen antigen in the presence of a test compound; (c) separating T cells from the antigen-stimulated lymphocytes;

(d) measuring the expression level of the gene comprising the base sequence of SEQ ID NO: 24 or SEQ ID NO: 25 in the T cell,

(e) selecting a compound that increases the expression level of the gene measured in step (d) as compared to a control (in the case where no test compound is administered).

[18] a method for screening a candidate drug for a therapeutic agent for an allergic disease,

(a) stimulating established T cells with a lymphocyte stimulating substance in the presence of a test compound,

(b) measuring the expression level of the gene consisting of the nucleotide sequence of SEQ ID NO: 24 or SEQ ID NO: 25 in the established T cells,

(c) selecting a compound that increases the expression level of the gene measured in step (b) as compared to a control (in the case where no test compound is administered). [19] The method according to any one of [15] to [18], wherein the expression level of the gene is measured by RT-PCR using mRNA as type III.

[20] The method of [15], wherein the T cells are prepared from peripheral blood of a model animal of hay fever.

[21] the method of [16] or [17], wherein the lymphocytes are prepared from peripheral blood;

[22] The method according to any one of [15] to [21], wherein the allergic disease is cedar pollinosis.

In the present invention, an allergic disease is a general term for diseases associated with allergic reactions. More specifically, it can be defined as identifying the allergen, demonstrating a deep link between exposure to the allergen and the development of the lesion, and demonstrating an immunological mechanism for the lesion. Here, the immunological mechanism means that T cells show an immune response by allergen stimulation. Representative allergic diseases can include bronchial asthma, allergic rhinitis, atopic dermatitis, hay fever, or insect allergy. Allergic diathesis is a genetic factor transmitted from parents to children with allergic diseases. Allergic diseases that occur familially are also called atopic diseases, and the genetic factors that cause them are atopic predisposition.

In the present invention, the “nucleic acid molecule” includes DNA and RNA. Further, the “test for allergic disease” in the present invention includes not only a test for a patient who has developed an allergic disease, but also a determination of whether or not a subject who has not developed an allergic disease has an allergic predisposition. Inspections are also included. Further, the expression level of the gene in the present invention is used as a term including either the amount of transcribed mRNA or the amount of a protein that is a translation product based on this mRNA.

The present invention relates to a novel gene “795” that is correlated with an IgE production response to cedar pollen of an individual. The nucleotide sequence of the “795” cDNA found by the present inventors is shown in SEQ ID NO: See Figure 24.

“795” is based on the base sequence (SEQ ID NO: 1, 1384 bp) of the fragment isolated by the DD method, and is based on the RACE method (Frohman, MA et al .: Pro Natl. Acad. Sci. USA, 85 : 8992, 1988), and the nucleotide sequence at the 5 'side was determined, and finally the nucleotide sequence of 4467 bp (SEQ ID NO: 24) was determined. The nucleotide sequence of “795” (SEQ ID NO: 24) in the present invention was confirmed by a homology search to be a non-slicing form containing exon 1 and exon 2 of vimentin, a known protein. . Vimentin is a constituent protein of vimentin filament which belongs to the type III intermediate filament protein (Mo 1 · Cell. Biol. 6 / 11,3614-3620,1986). It is thought to form a network that spreads throughout the cytoplasm, dynamically integrating cells. Vimentin has also been confirmed to exist in undifferentiated cells and tumor cells. However, there is no report that vimentin is associated with an allergic disease, and the findings obtained by the present inventors are novel.

Furthermore, the present inventors also investigated the relationship between the copy number of vimentin mRNA and allergic diseases, and found that the expression pattern was similar to that of “795”. The nucleic acid molecule of the present invention can hybridize not only with the nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 24 but also under stringent conditions with the nucleic acid molecule, and a nucleic acid functionally equivalent to the nucleic acid molecule Including molecules. In the present invention, the stringent condition may be, for example, the following condition. Hybridization conditions can be adjusted according to the chain length of the nucleic acid molecule and the constituent bases.

Eight ridden conditions:

5 XSSC

7% SDS

50-60

Cleaning conditions:

0.1 XSSC 0.1% SDS

60-70

Further, in the present invention, functionally equivalent to “795” means that expression is significantly lower in the atopic predisposing group (powder value for cedar pollen is 3.5 AU / ml or more) than in the non-atopic predisposing group. means. Since nucleic acid molecules that can hybridize under stringent conditions are nucleic acid molecules that are structurally highly homologous, screening under such conditions allows the “795” in the present invention to be screened. A functionally equivalent nucleic acid molecule can be obtained.

The nucleic acid molecule of the present invention can be obtained by a known method based on the nucleotide sequence information shown in SEQ ID NO: 24. The vimentin gene can also be obtained by a known method based on the nucleotide sequence that has already been clarified. For example, the desired cDNA can be selected by screening a cDNA library of human T cells with a probe set based on the nucleotide sequence of SEQ ID NO: 24. Or. PCR can be performed using primers set based on the nucleotide sequence shown in SEQ ID NO: 24 to amplify the target gene. If a cDNA derived from a non-human animal lymphocyte is used as a screening library or template for PCR, homologues of other species of “795” can be obtained. Furthermore, the nucleotide sequence shown in SEQ ID NO: 24 can also be chemically synthesized. Such molecular genetic techniques include known methods (Sambrook), Fritsch, EF, and Maniatis T. Molecular cloning: A Laboratory Manual (2nd edition). Cold Spring Harbor Laboratory Press, Cold Spring Harbor. ) Can be used for ij.

The nucleic acid molecule or vimentin gene of the present invention thus obtained is useful as a diagnostic index for allergic disease or as an index for screening a therapeutic agent for allergic disease.

Alternatively, the present invention provides a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 24, Relates to a polynucleotide that hybridizes to its complementary strand, the polynucleotide having a chain length of at least 15 nucleotides. One skilled in the art can design a polynucleotide that can hybridize to a given base sequence. Further, not only those specifically hybridizing to the nucleotide sequence of SEQ ID NO: 24 but also methods for designing probes and primers capable of hybridizing to an unknown nucleotide sequence similar in structure are known. The polynucleotide having the designed base sequence can be chemically synthesized by a technique such as the dideoxy method. Alternatively, a polynucleotide comprising a required nucleotide sequence can be obtained by cleaving a cDNA clone with an appropriate restriction enzyme. These polynucleotides are useful as probes and primers for detecting and synthesizing the nucleic acid molecule of the present invention.

“795” and vimentin genes showed significantly lower expression in the atopic predisposing group (IgE value for cedar pollen was 3.5 AU / ml or more) than in the non-atopic predisposing group. Therefore, using the expression of the “795” gene (that is, including transcription into mRNA and translation into protein) as an index, it is possible to test for allergic diseases and to screen candidate compounds for therapeutic drugs for allergic diseases. Conceivable. In the present invention, cedar pollinosis is particularly preferred as an allergic disease to be a control for examination and treatment. The detection of the expression of the gene of “795” or vimentin in the test for allergic disease according to the present invention can be performed by using a hybridization technique using a nucleic acid that hybridizes to the gene of “795” or vimentin as a probe, or a method using these techniques. It can be carried out by using gene amplification technology using DNA that hybridizes to the gene as a primer.

As the probe or primer used in the test of the present invention, a nucleic acid molecule which specifically hybridizes to “795” or vimentin gene and has a chain length of at least 15 nucleotides is used. As used herein, “specifically hybridizes” means, under ordinary hybridization conditions, preferably stringent hybridization. Under hybridization conditions, refers to no significant cross-hybridization of DNA and / or RNA encoding other genes. For example, in an Express Hybridization Solution (manufactured by CLONTECH), the probe and transfer membrane are hybridized with 68, and finally washed with 50% in a solution of 0.IX SSC, 0.05% SDS, and then washed with 50%. Can be a gentle condition.

These nucleic acid molecules used in the test of the present invention may be synthetic or natural. The probe DNA used for hybridization is usually labeled. Labels include, for example, labeling by nick translation using DNA polymerase 1, terminal labeling using polynucleotide kinase, fill-in labeling using cleno-fragment (Berger SL, Kernel AR. (198 7) Guide to Molecular Cloning Techniques, Method in Enzymology, Academic

Press; Hames BD, Higgins SJ (1985) Genes Probes: A Practical Approach. IRL Press; Sambrook J, Fritsch EF, Maniatis T. (1989) Molecular Cloning: a Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press), RNA Labeling by transcription using polymerase (Melton DA, Krieg, PA, Rebagkiati MR, Maniatis T, Zinn K, Green MR. (1984) Nucleic Acid Res., 12, 7035-7056), Modification without radioisotope How to incorporate nucleotides into DNA (Kricka LJ.

(1992) Nonisotopic DNA Probing Techniques. Academic Press).

Testing for allergic diseases using the hybridization technology can be performed using, for example, a Northern hybridization method, a dot blot method, a method using a DNA microarray, and the like.

On the other hand, as a method utilizing the gene amplification technique, for example, an RT-PCR method can be used. In the RT-PCR method, the expression level of “795” or vimentin gene can be more accurately quantified by using the PCR amplification monitor method as shown in Example 8 in the gene amplification process. In the present invention, "795" or vimentin It is desirable to measure the expression level of each gene alone. By hybridizing a probe or a primer with a base sequence specifically found in any of the genes as a target, the expression level of each gene can be clarified individually. Alternatively, it is possible to separately measure the expression levels of both using the region found in both, such as exon 1 and exon 2 of the vimentin gene. In other words, since the base sequence corresponding to the intron does not exist in the transcript that has undergone splicing of the vimentin gene, even if the same region is used as the target base sequence of the primer, the length of the generated amplification product differs. coming out. Further, by setting a probe for the PCR amplification monitoring method in the intron region, the amplification of “795” can be specifically followed. If a common nucleotide sequence is used as a target, the expression level of both can be determined comprehensively.

In the PCR amplification monitoring method, probes that are labeled with different fluorochromes at both ends to cancel each other's fluorescence are used to hybridize to the detection target (DNA or RNA reverse transcript). When the PCR proceeds and the probe is degraded by the 5'-3 'exonuclease activity of Taq polymerase, the two fluorescent dyes separate and the fluorescence is detected. This fluorescence is detected in real time. The number of copies of the target in the target sample is determined by the number of linear cycles of PCR amplification by simultaneously measuring a standard sample whose copy number is known for the target (Holland, PM et al., 1991). Natl. Acad. Sci. USA 88: 7276-7280; Livak, KJ et al., 1995, PCR Methods and Applications 4 (6): 357-362; Heid, CA et a, Genome Research 6: 986-994; Gibson, EMU et al., 996, Genome Research 6: 995-1001). In the PCR amplification monitor method, for example, A-PRISM7700 (PerkinElmer) can be used.

In addition, the test for an allergic disease of the present invention may be performed by detecting a vimentin protein. The amino acid sequence of vimentin is known (SEQ ID NO: No .: 26). As such a test method, for example, a Western blotting method using an antibody that binds to a vimentin protein, an immunoprecipitation method, an ELISA method, or the like can be used. A lysate of T cells—a blood sample such as serum or plasma can be used as a sample for protein detection. Alternatively, a whole blood sample containing T cells can be lysed into a sample.

The antibody of the vimentin protein in the present invention can be obtained as a polyclonal antibody or a monoclonal antibody using techniques well known to those skilled in the art (Milstein C, eta, 1983, Nature 305 (5934): 537-40). ). For the protein or its partial peptide used as an antigen, for example, a vimentin gene (SEQ ID NO: 25) or a part thereof is inserted into an expression vector, and this is introduced into an appropriate host cell to prepare a transformant. It can be obtained by culturing the transformant to express a recombinant protein, and purifying the expressed recombinant protein from a culture or a culture supernatant.

As a result of the test for an allergic disease according to the present invention, if the expression of the gene of the present invention is significantly low, the subject can be determined to have a high IgE value against an allergen such as cedar pollen antigen and have an allergic predisposition. The measurement of the expression level of the gene of the present invention in combination with the allergen-specific antibody titer, symptoms, etc., can be used for testing for allergic diseases. That is, the present invention relates to a polynucleotide comprising a nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25, or a nucleotide sequence complementary to a complementary strand thereof, and having a chain length of at least 15 nucleotides. The use of nucleotides in testing for allergic diseases. The polynucleotide of the present invention is used as a probe or a primer for detecting a gene used as an index for a test.

The expression of “795” or vimentin gene expressed in T cells is decreased in the group of hay fever patients with high IgE specific to pollen antigen. Even in allergic patients who show responsiveness to an antigen other than cedar pollen, expression of `` 795 '' or vimentin gene is reduced while T cell responsiveness to the antigen is enhanced. May be In such cases, decreased expression of these genes corresponds to increased T-cell responsiveness, and thus monitoring of expression of the “795” or vimentin gene will increase the risk of allergic disease. Can be performed. That is, the present invention relates to the use of the polynucleotide in a method for screening a candidate compound for a therapeutic drug for an allergic disease.

The method for screening a candidate compound for treating an allergic disease of the present invention can be performed in vivo or in vitro. For in vivo screening, for example, after administering a candidate drug and stimulating with a pollen antigen to a model animal such as a mouse, T cells are separated from peripheral blood, and the `` 795 '' or vimentin gene The transcript of is measured. Alternatively, after administering a candidate drug to a model animal such as a mouse, lymphocytes are separated from peripheral blood, and the lymphocytes are stimulated in vitro with cedar pollen antigen or the like. T cells are separated from the lymphocytes after the stimulation, and their “795” or viment in gene transcript is measured. As a result of these measurements, “795” or a compound that increases the transcription amount of the vimentin gene is selected. Here, the stimulation with the pollen antigen is performed for the purpose of eliciting an antigen-specific allergic reaction in T cells and determining the therapeutic effect of the candidate compound on it.

In the in vitro screening, for example, peripheral blood lymphocytes are collected from hay fever humans or mice or the like, and the peripheral blood lymphocytes are stimulated in vitro with cedar pollen antigen or the like. Candidate compounds are added during in vitro stimulation. Then, T cells are separated from the stimulated peripheral blood lymphocytes, and the transcript of “795” or vimentin gene is measured. As a result of this measurement, “795” or a compound that increases the transcription amount of the vimentin gene is selected.

Screening of the candidate compound for treating an allergic disease of the present invention can also be performed using established T cells. For example, established T cells such as Mol t4 cells and Jurkat cells are stimulated in vitro with a lymphocyte stimulator. Examples of lymphocyte stimulators include calcium ionophore (A23187), PMA, and phytohemagglutinin (PHA). And so on. Candidate drugs are added during in vitro stimulation. Thereafter, the transcription amount of “795” or vimentin gene in the established T cells is measured. As a result of this measurement, “795” or a compound that increases the transcription of the vimentin gene is selected. Detection of the gene expression of "795" or vimentin in the screening of candidate compounds for the treatment of allergic diseases is carried out by hybridization using a nucleic acid that hybridizes to "795" or vimentin gene as in the test for allergic diseases of the present invention. It can be carried out by using a technique or a gene amplification technique using a DNA that hybridizes to the gene of the present invention as a primer.

As a method using the hybridization technology, for example, a Northern hybridization method, a dot blot method, a method using a DNA microarray, or the like can be used. On the other hand, as a method utilizing the gene amplification technique, an RT-PCR method can be used. In the RT-PCR method, the expression of the “795” gene can be more accurately quantified by using a PCR amplification monitoring method as shown in Example 8 in the gene amplification process. Operations such as separation of lymphocytes and T cells, extraction of RNA from T cells, and synthesis of cDNA can be performed according to known techniques as described in Examples.

The test compounds used in these screenings include compound preparations synthesized by existing chemical methods such as steroid derivatives, compound preparations synthesized by combinatorial chemistry, and extracts of animal and plant tissues or Examples thereof include a mixture containing a plurality of compounds such as a microorganism culture, and a sample purified therefrom. The compound isolated by the method for screening a candidate compound for a therapeutic drug for an allergic disease of the present invention is a candidate for a drug which improves allergic predisposition to an allergen such as a pollen antigen.

When the compound isolated by the screening method of the present invention is used as a pharmaceutical, it can be used as a pharmaceutical preparation by a known pharmaceutical production method. For example, pharmacologically acceptable carriers or vehicles (saline, vegetable oils, suspensions, (Activators, stabilizers, etc.). Administration will be transdermal, intranasal, transbronchial, intramuscular, intravenous, or oral, depending on the nature of the compound. The dose varies depending on the patient's age, body weight, symptoms, administration method and the like, but those skilled in the art can appropriately select an appropriate dose. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagram showing the antibody titers of cedar pollen-specific IgE antibodies in a total of 18 blood samples from 10 subjects who collected blood. The values of cedar pollen-specific IgE antibodies in each blood sample of subjects A to ί (sample numbers 1 to 18) were expressed in AU / ml. The pair before pollen scattering is shown on the left (white column), and the one after scattering is shown on the right (black column). Subjects A and B collected only blood after pollen scattering.

FIG. 2 is a graph showing changes in the expression of “795” in a high IgE group and a normal IgE group when classified according to cedar pollen-specific IgE values. Error bars represent standard deviation. FIG. 3 shows the results of measuring the expression level of “795” in hay fever patients. The vertical axis indicates the copy number (copy / ng RNA) of “795”, and the horizontal axis indicates the sample number.

FIG. 4 shows the results of measuring the expression level of vimentin in hay fever patients. The vertical axis shows the copy number (copy / ng RNA) of “795”, and the horizontal axis shows the sample number.

FIG. 5 is a diagram showing changes in the expression of vimentin in the high IgE group and the normal IgE group when grouped according to cedar pollen-specific IgE values. Error bars represent standard deviation. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described specifically with reference to Examples, but the present invention is not limited to these Examples.

[Example 1] Blood collection from 10 adult volunteers

To collect T cells before and after pollen scattering, 10 adult volunteers (A ~; 0 to 10) ml blood samples were taken before and after pollen dispersal. The first blood sample was collected before the Japanese cedar pollen season (January and February 1997), and the second after the Japanese cedar pollen season (March, April and May 1997). Collected. Eight of the volunteers obtained samples from two periods. For the remaining two volunteers, only samples after pollen dispersal were available. An aliquot of these blood samples was used to determine the amount of cedar pollen-specific IgE. The specific IgE is measured by the CAP RAST method (Pharmacia), which is a modified version of the RAST method (radio allergo sorbent test, Wide, L. et, al .: Lancet 2: 1105-1107, 1967) using a paper disk as a solid phase. I went. Using a serum containing a standard antibody titer manufactured by Pharmacia, and using that as a reference, the IgE antibody titer of each sample (the unit is also indicated as Pharmacia RAST Unit, PRU, or AU (arbitrary unit)) It was determined.

Fig. 1 shows the measured cedar pollen-specific IgE values before and after pollen scattering in each subject. As shown, most of the 10 subjects had increased serum levels of cedar pollen-specific IgE after pollen exposure. The presence of atopic predisposition was determined by whether the value of the CAP RAST test for cedar pollen-specific IgE was greater than 2. That is, eight subjects A to G and I were regarded as an atopic predisposition group (hereinafter also referred to as “patient”), and two subjects H and; ί were regarded as healthy subjects (hereinafter also referred to as “normal group”). Of the eight subjects with an atopic predisposition, seven exhibited symptoms of allergic rhinitis after pollen dispersal.

[Example 2] Preparation of lymphocyte fraction from blood sample

To prepare Τ cells from 10 ml of blood, proceed as follows. First, the wall of the syringe was treated with 1 ml of Heparin from Nopo, etc. without any restriction, and blood was collected in a 10 ml syringe containing a final concentration of 50 unit / ml heparin. At this time, two 22G needles were prepared for one blood sample. The injection needle was removed and transferred to a 50 ml centrifuge tube (made of polypropylene). After centrifugation at 1500 rpm for 5 minutes at room temperature, 1.1 ml was collected from the surface as close as possible, and centrifuged at 15000 rpm for 5 minutes and at 4 to collect 1 ml of the supernatant as plasma. Collect plasma An equal volume (9 ml) of 0.9% NaCl containing 3% dextran (manufactured by Nacalai) was added to the remaining residue, and the mixture was gently inverted several times to mix. Then, it was left still at room temperature for 30 minutes. PRP (Pla teletrich plasma, platelet-rich plasma) was transferred to another 15 ml centrifuge tube, and centrifuged at 1200 rpm (equivalent to 150 Xg in a Tommy centrifuge) for 5 minutes at room temperature. After centrifugation, platelets were in the supernatant. The precipitated cells were suspended in 5 ml of Ca- and Mg-free HBSS obtained from Gibco or the like. This was overlaid on one tube (Falcon tube: 2006 or 2059; made of polypropylene) containing 5 ml of Ficol Paque (Pharmacia) using a Pasteur pipette. After centrifugation at 1200 ι · ριη for 5 minutes, the mixture was centrifuged at 1500 rpm (equivalent to 400 Xg in a Tomy centrifuge) at room temperature for 30 minutes. As a result, granulocytes and erythrocytes precipitated, and lymphocytes (lymphocytes), monocytes (monocytes), and platelets (platelets) were contained in the middle layer with the ficoll layer interposed therebetween.

Collect the middle layer with a Pasteur pipette, add 2 to 3 volumes of BSA / PBS (0.5% BSA, 2 mM EDTA in PBS, pH 7.2; degas immediately before use), and add 1200 rpm, 4 rpm. And centrifuged at for 5 minutes. The precipitate was collected and washed twice with BSA / PBS. After the second washing, the cells were suspended in 5 ml, and a part thereof was diluted 2-fold with trypan blue, and the number of cells was counted. Total cell number was about IX 10 ^7. This was used as the lymphocyte fraction.

[Example 3] Separation of T cells from lymphocyte fraction

The lymphocyte fraction obtained in Example 2 was centrifuged at 1200 rpm for 4 and 5 minutes, and suspended in BSA / PBS at 10 ⁸ per 100 ^ 1. The volume was about 20 l. This was transferred to an Eppendorf tube (1.5 ml), and the CD3 microbead solution was added. After that, it was left at 4-10 for 30 minutes (it was not placed on ice at this time). This sample was treated by Magnetic Celso Ichiichi (MACS) (Miltenyi Biotech Inc.) as follows.

The MS + / RS + column was attached to a Mini MACS or Vario MACS separation unit (without needles). 500 / xl BSA / PBS was gently applied to the column and the buffer was poured. Next, apply the cells labeled with CD3 microbeads to the column. I did it. The column was washed three times with (cell fraction). The column was removed from the separation unit and placed on a tube for collecting the eluate. 1 ml of BSA / PBS was applied to the column, and positive cells were rapidly flushed out using a plunger attached to the column. This was used as the T cell fraction.

The obtained T cell fraction was centrifuged at 1200 rpm for 5 minutes at 4. The precipitate was washed twice with BSA / PBS. After the second washing, the cells were suspended in 1 ml, and a part thereof was diluted 2-fold with trypan blue to count the number of cells. Total cell number was approximately 4 × 10 ⁶ .

[Example 4] Preparation of total RNA from T cells

Preparation of total RNA from T cells was performed using RNeasy Mini (manufactured by Qiagen) according to the attached manual in principle. All operations were performed at room temperature, wearing gloves. Four volumes of ethanol were added to Posh Buffer RPE. Lysis buffer-RLT was supplemented with 101 / ml 2-mercaptoethanol. The cell suspension was centrifuged at 1000-1200 ι · ρπι for 5 minutes, and the supernatant was removed by aspiration. A lysis buffer RLT (containing 2-mercaptoethanol) solution was added to the precipitate. At this stage, lysates of cells in RLT buffer could be stored at -70. If the cell lysate had been stored frozen, incubate at 37 for 10-15 minutes, and if insolubles were visible, centrifuge for 3 minutes at maximum speed to collect only the supernatant. The lysate was homogenized with a syringe equipped with a 20 G force teran needle and then treated with Q IAshredder. (That is, usually, 350 1 cell lysate was applied to the Kyaschlets Danitto using a Pitman. This was centrifuged at 1500 rpm for 2 minutes, and the effluent was collected.) 350 il of 70% ethanol was added. Mix well by pipetting. An RNeasy spin column was attached to the attached 2 ml tube, a lysate mixture of cells was applied, centrifuged at 8000 Xg (11500 rpm) for 1 minute, and the effluent was discarded. Posh buffer RW1700 was applied to the column, and the tube was capped for 5 minutes. The mixture was centrifuged at 11,500 rpm for 15 seconds, and the effluent was discarded. Attach the column to a new 2 ml tube and wash with Pash Buffer RPE (containing ethanol) 500 1 Was applied to the column, and centrifuged at 11500 15m for 15 seconds, and the effluent was discarded. The wash buffer RPE5001 was applied to the column and centrifuged at maximum speed for 2 minutes. The column was mounted in a new 1.5 ml tube, DEPC-treated water 301 was applied, and the lid was capped and allowed to stand for 10 minutes. Centrifugation was performed at 11500 ι · ριη for 10 minutes to obtain total RNA. Measure the concentration, and if the volume is low, replace the column with a new one and place it in a 5 ml tube. Centrifuge.

[Example 5] DNase treatment of total RNA

DNase treatment was performed to remove DNA from total RNA prepared from T cells. The reaction was performed in an IOOI lXDNase buffer (Nitsubon Gene) containing 2 units of DNase (Nitsubon Gene) and 50 units of RNase inhibitor (Pharmacia). After incubating the mixture at 37 for 15 minutes, an equal amount of PCI (phenol: black form: isoamyl alcohol = 25: 24: 1) was added, and the mixture was portexed. The mixture was centrifuged at 12,000 rpm at room temperature for 10 minutes, and the upper layer (aqueous layer) was transferred to a new 1.5 ml tube.

One-tenth volume of 3M sodium acetate (pH 5.2) was added, and 2.5 volumes of 100% ethanol and eta-precipitated mate were added and mixed by inversion. After leaving at −20 for 15 minutes, the mixture was centrifuged at 12,000 rpm for 4:15 minutes, the supernatant was removed, and 70% ethanol was added. After tapping to the extent that the precipitate was detached, the supernatant was removed cleanly. Dried for 3 minutes and dissolved in 10-201 DDW (no DNase and RNase). The concentration was measured and stored at -80 until use.

[Example 6] Differential display (DD) analysis using total RNA prepared from T cells

Fluorescent differential display (F1 uorescent Diferential Display, abbreviated as “DD”) using total RNA prepared from T cells Analysis of the literature (T. I to et al., 1994, FEBS Let t. 351: 231-236). Total RNA prepared from T cells was reverse transcribed to obtain cDNA. Three anchors for the primary DD-PCR reaction CDNA was prepared using 0.2 g each of total RNA for each of the primers. For the secondary DD-PCR reaction, cDNA was prepared using 0.4 g of RNA for each of the three anchor primers. All cDNAs were diluted to a final concentration of 0.4 ng / ^ l RNA and used in the experiments. A DD-PCR reaction was performed using cDNA equivalent to 1 ng RNA per reaction. Table 1 shows the composition of the reaction solution.

Table 1 cDNA (equivalent to 0.4 ng / l RNA) 2.5 1

Optional primer (2 M) 2.5M1

lO AmpliTaq PCR buffer Ι.ΟβΙ

2.5mM dNTP 0.8U1

50 H anchor primer 0.1 1

(GT15A, GT15C, GT15G)

Gene Taq (5U / U1) 0.05 1

AmpliTaq (5U / il) 0.05M1

dH, 0 3.0M1 Total amount 10.0 1

The PCR reaction conditions were as follows: 3 cycles at 95, 5 minutes at 40, 5 minutes at 72, 1 cycle, followed by 30 cycles of 94Π5 seconds, 2 minutes at 40, 1 minute at 72. 5 min at 72, then continuously at 4

The primer pair used is an anchor primer: GT15A (SEQ ID NO: 2), GT15C (SEQ ID NO: 3), and GT15G (SEQ ID NO: 4). A total of 287 reactions were performed by combining 199 and AG 200-287. As an optional primer, use 10 nucleosides with a GC content of 50%. Oligomers composed of tides were designed, synthesized and used.

For gel electrophoresis, a 6% denaturing polyacrylamide gel was prepared, 2.5 / ^ 1 samples were applied, and electrophoresed at 40 W for 210 minutes. Thereafter, the gel plate was scanned using Hitachi Fluorescence Image Analyzer -FMBI0 I I, and electrophoresis images were obtained by fluorescence detection.

[Example 7] Amplification and sequencing of band cut out by DD analysis

Two DD analyzes were performed using a number of arbitrary primers. Bands that differed before and after pollen dispersal or between the patient and healthy groups were selected and reproducible bands were excised from the gel in two experiments.

Further analysis was performed on one of the excised bands (referred to as “795”). The band “795” was found by DD analysis using GT15A (SEQ ID NO: 2) as an anchor primer and AG109 (TGTCACGGTT SEQ ID NO: 5) as an arbitrary primer.

In order to determine the nucleotide sequence of “795”, the gel containing the “795” band was cut out, stored in a TE solution, and heated for 6 minutes (TC, 10 minutes) to elute the DNA from the gel. PCR was performed under the same conditions as DD-PCR for type I, and a DNA fragment of about 180 bp was amplified using GT15A as an anchor primer and AG109 as an optional primer. Invitrogen) was used to obtain a plasmid p795-50 carrying a DNA fragment of about 180 bp. An EST sequence (N62037) homologous to 795 was extracted from dbEST, and then extracted using ABI AutoAssembler. The two sequences were assembled to obtain a 0.7 kb sequence, from which a primer (1006-002: CTGGGCCAGATATTAGATMCGGA SEQ ID NO: 6) was prepared, and cDNA cloning by RACE was attempted. Uses Marathon cDNA Amplif icat i on Kit (CL0NTECH) Human Leukocyte Marathon-Ready cDNA (CL0NTECH) was used as the type I. As a result, a new 685 bp upstream sequence was obtained, resulting in a total of 1384 bp. : Shown in 1.

[Example 8] Quantification by ABI-7700 The expression amount of “795” was quantified by the TaqMan method using ABI-PRISM7700. This method uses a fluorescent dye to quantitatively detect the PCR-amplified DNA strand in real time.

For the purpose of quantification, blood samples before and after cedar pollen scattering were collected from 22 volunteers in the spring of 1998, T cells were prepared, and total RNA was extracted. The expression level of the target gene was quantified using a total of 44 RNA samples.

In the same manner as in Example 1, specific IgE values and total IgE values of cedar pollen, cypress pollen, Dermatophagoides farinae, and Dermatophagoides farinae were measured (Table 2).

Table 2 Specific IgE (UA / ml) Total IgE Subjects Blood collection timing (UA mt)

A Fly TT before 300 after flight 460

B Before scattering 770 After scattering J. 840

C scattering 15.2, 450 after tt 330

D Before flying J. 200 After flying 0.81 4 7 120

E Before scattering 0.8 <0.34 30 After K 34 38

F Before flying 0,39 <0.34 <0.34 26 After flying 27

G before flying "t <0.34 26 after flying u.ot. 30

H before flight QQ 3fi 220 after tt 7 -a q 1 50

1 flight tt before ci 130 flight tt 34, 39 q 100

J Before scattering • a cc 0 gg 96 After 77 78

K before flight, after 96 flight it no no before flight tt 13 after flight 18

M Fly Before J * t J * t 0 36 Fly at After 34 43

N Fei << t «$ 0 34 22

After 7i M 73

0 flying tt D 34? Q, 180 after flying <G 160

P Before scattering Q ^ 280 After tt 0.68 <0.34 4.49 3,02 240

Q fly Κλΰ 0.34 <0.34 <0.34 <0.34 <5.0 Fly tt 0.34 <0.34 0.34 <0.34 <5.0

R Before M <0.34 0.34 <0.34 <0.34 53 After scattering <0.34 <0.34 <0.34 <0.34 62

S scattering 0.34 <0.34 <0.34 <0.34 420 After flying <0.34 <0.34 <0.34 <0.34 370

, T before tt 0.34 <0.34 <0.34 <0.34 82 after <0.34 <0.34 <0.34 <0.34 62 u 0.34 <0.34 0.34 <0.34 18 after tt <0.34 <0.34 <0.34 0.34 16

V Fly ΜΚΐ 0.34 <0.34 0.79 0.81 180 Fly After It <0.34 0.34 0.78 0.9 160 Based on the nucleotide sequence of the DD band determined in Example 7, primers P795F (G ACACAAGTATTTGCTAACATCCGTTZ SEQ ID NO: 7), P795R (TGTGAGGTATGCTTGTAGCTTTA AMZ SEQ ID NO: 8), and TaqMan probe T795 (TAATATCTGGCCCAGACTTGAGAA GTAGGTAATGTAAAAATZ SEQ ID NO: 9) Were synthesized and used for the quantitative reaction. The TaqMan probe T795 was used with its 5 ′ end labeled with FAM (6-carboxyfluorescein) and its 3 ′ end with TARA (6-carboxy-tetramethytri rhodamine). For type III, cDNA obtained by reverse transcription of poly T (12 to 18 mer) as a primer from 44 kinds of total RNA was used. The reaction was carried out using a serial dilution of plasmid p795-50 obtained in Example 7 for the standard curve for calculating the copy number. Table 3 shows the composition of the reaction mixture for monitoring PCR amplification. In addition, in order to correct the difference in cDNA concentration in the sample, the same quantitative analysis was performed for the β-actin) gene, and the copy number of the target gene (795) was calculated based on the correction based on the copy number of those genes. did.

Table 3

Reaction composition of ABI-PRISM 7700 (reaction volume per 1 ゥ)

Sterile distilled water 25.66 (U)

10x TaqMan Coffer A 5

25mM MgCl ₂ 7

dATP (10mM) 1.2

dCTP (10mM) 1.2

dGTP (lOmM) 1.2

dUTP (lOmM) 1.2

Forward Primer (100 M) 0.15

Reverse Primer (100 H) 0.15

795 TaqMan probe (6.7 M) 1.49

AmpliTaq Gold (5U / L) 0.25 AmpErase UNG (1U / L) 0.5

Template solution 5

Total 50

Table 4 shows the number (copy number) of “795” in each sample corrected for the copy number of / 3-actin. For the correction, the average copy of -actin in all samples was obtained, and the copy number of "795" in each sample was divided by the relative value of 0-actin in each sample when it was set to 1.

Table 4

ABI7700 quantitative shirt (copy / ngRNA) beta—actin correction data

Using this value, two-way analysis of variance was performed. The grouping was performed before and after scattering of Japanese cedar pollen, or at least 3.5 AU / ml for each specific serum IgE in serum (high IgE group) and other (normal). (IgE group). For example, in the case of cedar pollen, the number of individuals in each group was 10 in the high IgE group and 12 in the normal IgE group. The test was performed separately for the group showing 200 AU / ml for total IgE and the other groups. Tests for two-way analysis of variance were performed using StatView software (Abacuus Concepts, Inc.).

The results showed that expression of “795” was significantly lower in high IgE groups than in normal IgE groups when grouped by IgE value for cedar pollen (Table 5, FIG. 2). The combined expression levels of 795 in the high IgE group and the normal IgE group when the data before and after the scattering were combined were 9948 ± 1 196.7 and 274.3 5 ± 2769.9 copies / ng RNA (mean standard deviation, respectively). )Met. No such difference was observed even when grouping by IgE value for non-cedar pollen.

Table 5

795

[Example 9] Analysis by 5 'RACE method 1

Marahon-Ready cDNA (CL0NTECH) Bone Marrow was used as type III for 5'RACE analysis. For the primary 5 'RACE-PCR reaction, use the attached API Primer (SEQ ID NO: 10: CCAT CCTAATACGACTCACTATAGGGC) t 795-R1 Primer (SEQ ID NO: 11: TGCCAGAATGTCTGTATCTACAT) specific to "795" PCR reaction was performed. For the second (nested) 5 'RACE-PCR reaction, the attached AP2 Primer (SEQ ID NO: 12: ACTCACTATAGGGCTCGA) A PCR reaction was performed using (GCGGC) and 795- 5R-8 Primer (SEQ ID NO: 13: GAGAGTCTACAAAC CTGTCTGA) specific within “795”. The PCR reaction conditions were as follows: primary: one cycle of “94 at 9 minutes” followed by 43 cycles of “94 at 30 seconds, 55 at 30 seconds, 72 at 3 minutes” After that, one cycle of “5 minutes at 72” was performed for one cycle, and then continuously at 4 minutes. The second is “94 for 3 minutes” for one cycle, followed by “94 for 30 seconds, 60 for 30 seconds, and 72 for 2 minutes” after 15 cycles, and then “72 for 5 minutes. For one cycle and then continuously for four. As the Taq enzyme, the first reaction uses AmpliTaq Gold (PERKIN ELMER) and the second reaction uses TaKaRa Ex Taq (TaKaRa), and the reaction solution is prepared from the attached reagent according to the attached manual. Was prepared.

For gel electrophoresis, a 1.5% agarose gel was prepared, 5 / ^ 1 samples were applied, and electrophoresis was performed at 100 V constant voltage for 30 minutes. Thereafter, electrophoretic images were obtained by UV transillumination.

[Example 10] Collection and sequencing of a band excised by 5 'RACE analysis 1

In order to determine the nucleotide sequence of the band obtained by 5 'RACE analysis, the amplified DNA fragment was excised from the gel, cloned into a plasmid vector pCR2.1 (Invitrogen), and a plasmid containing a DNA fragment of about 600 bp was cloned. Obtained. Using a plasmid DNA, the nucleotide sequence of the DNA fragment was determined according to a conventional method. As a result, a further upstream sequence of about 500 bp was obtained. The sequence is shown in SEQ ID NO: 14.

[Example 1 1] Analysis by 5 'RACE method 2

5, RACE analysis was performed using Cap Site cDNA (NIPPON GENE) Human HeLa Cell as type III. For the primary 5'RACE-PCR reaction, use the attached IRC Primer (SEQ ID NO: 15: CAA GGTACGCCACAGCGTATG) t 795-yRl Primer (SEQ ID NO: 16: CG GCAGGTTTCAGCGGGACTTC) specific to "795" Was used to perform a PCR reaction. For the second (nested) 5'RACE-PC R reaction, the attached 2RC Primer (SEQ ID NO: 17: GTACGCCACAGCGTATGATGC) t 795-yR2 Primer specific to “795” (SEQ ID NO: 18) : GAAAGTTTGGAGGACTGGCTCTCA). 795-yRl Primer and 795-yR2 Primer are `` 5 'RACE It is designed based on the base sequence obtained from “Recovering and Sequencing Bands Excised by Analysis 1”. The primary PCR reaction conditions were as follows: 1 cycle of 95 minutes for 1 cycle, followed by 35 cycles of 94 seconds for 30 seconds, 60 seconds for 30 seconds, and 72 for 1 minute. After that, “72 ° 5 minutes” was performed for one cycle, and then continuously reduced to 4. The second one is "95 at 5 minutes" for one cycle, followed by "94 at 30 seconds, 60 at 30 seconds, 72 at 1 minute" at 30 cycles, and then "72 at 5 minutes". Minutes ”for one cycle and then continuously for four. In both reactions, TaKaRa Taq (TaKaRa) was used as a Taq enzyme, and glycerol was added to the attached reaction reagent to a final concentration of 5% to prepare reaction solutions.

For gel electrophoresis, a 1.2% agarose gel was prepared, a 5 / ^ sample was applied, and electrophoresed at 100 V constant voltage for 30 minutes. Thereafter, electrophoretic images were obtained by UV transillumination overnight.

[Example 1 2] Collection and sequencing of band excised by 5 'RACE analysis 2

In order to determine the base sequence of the band obtained by 5 'RACE analysis, the amplified DNA fragment was excised from the gel, cloned with plasmid vector pCR2.1 (Invitrogen), and a plasmid containing a DNA fragment of about 1 kbp I got Using a plasmid DNA, the nucleotide sequence of the DNA fragment was determined according to a conventional method. As a result, about 800 bp of the upstream sequence could be obtained. The sequence is shown in SEQ ID NO: 19. From the NCBI BLAST Search, the nucleotide sequence from No. 1 to No. 705 of the sequence shown in SEQ ID NO: 19 is the same as the nucleotide sequence from No. 147 to No. 854 of Human viment in gene (Accession No. MU144). 9 9%-found to be This region corresponds to exon 1 of the human vimentin gene. In addition, the nucleotide sequence from No. 27 to 88 in “795” (SEQ ID NO: 1) is 100% identical to the nucleotide sequence from No. 85 to 91 in the Human vimentin gene. This region corresponds to exon 2 of the human vimentin gene. From the above, it was clarified that “795” is a human viment in gene (D ηοπ-splicing form).

[Example 13] Quantification of vimentin by ABI-7700

As a result of Example 12, it was determined that “795” was a non-splicing form of vimentin. Therefore, the expression amount of “vimentin” was quantified by the TaqMan method using ABI-PRISM7700. As a sample, a total of 44 kinds of total RNA samples as in Example 8 were used to quantify the expression amount of the vimentin gene.

That is, in order to measure the expression level of vimentin, a PCR amplification quantification method was performed based on the sequence of the vimemt in gene (GenBank accession number: M14144). For the standard curve for calculating the copy number, PCR was performed using peripheral blood Tcell-derived cDNA as type III primer-vimentin2F (GACATTGAGATTGCCACCTACAGZ SEQ ID NO: 20) t vimentinR (GGGTATCAA CCAGAGGGAGTGM / SEQ ID NO: 21). The obtained and amplified 130 bp DNA fragment (SEQ ID NO: 23) was cloned into a plasmid vector (pGEM, Promega). PCR amplification and quantification were performed using vimentinTQ (TCCCTGAACCTGAGGGAAACT MTCTGGA / SEQ ID NO: 22) as a TaqMan probe. Other conditions were the same as in Example 8.

3) Figures 7 and 4 show the numbers (copy numbers) of “795” and vimentin mRNA in each sample, corrected for the copy number of 3-actin. For the correction, the average copy of / 3-actin in all samples was determined, and the copy number of vimentin in each sample was divided by the relative value of -actin in each sample when it was set to 1. In addition, the vimentin mRNA copy numbers before and after pollen scattering were compared for each sample (Table 6).

Table 6 Subjects Dish 'ft? * ¾t time «Vimennn

A Before scattering 23490

After splash 21422

B Before scattering 28694

After scattering 17514

C before scattering

After dispersal 11738

D Before flying

After scattering 28204

E Before scattering 15786

After scattering 19915

F before scattering 12418

After scattering 13918

G before scattering 15541

After dispersal 24084

H before scattering 9929

After scattering 13705

1 Before scattering 11444 After scattering 15070

J before scattering 17209

After scattering 17115

K before scattering 18820

After the scattering 29933 and before the scattering 30045

After the flight 28765

M before scattering 8656

After the splash 18726

N Before scattering 28539

After flying 37083

0 Before flying 29275

After scattering 37180

P Before defeat 10025

After scattering 46528

Q Before defeat 9380

After dispersal 35837

R before scattering 20140

After scattering 37470

S before scattering 20684

After scattering 17540

T before scattering 31133

After scattering 16784 u Before scattering 22042 After scattering 17293

V Before scattering 24070

After dispersion 21408 Based on these results, a two-way analysis of variance was performed using these values, similar to “795”. The groups were divided into groups before and after scattering of Japanese cedar pollen, or a group showing 3.5 AU / ml or more for at least one of the two specific IgE measurements in serum (high IgE group) and others (Normal IgE group). Two-way analysis of variance was tested using StatView software (Abacuus Concepts, Inc.). As a result, when grouped by IgE value for cedar pollen, the expression of vimentin was higher in the high IgE group (mean soil standard deviation = 17328 ± 5067) than in the normal IgE group (24889 ± 9831), as in “795” It was shown to be significantly lower (p = 0.0059) (Table 7, and FIG. 5).

Table 7

Industrial applicability

According to the present invention, a novel gene having a correlation with a cedar pollen-specific IgE value was provided. Using the expression of the gene of the present invention as an index, it has become possible to carry out a test for whether or not it has an allergic predisposition and a screening for candidate compounds for the treatment of allergic diseases.

Claims

Claims A nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 24.

A nucleic acid molecule which hybridizes with a DNA consisting of the nucleotide sequence of SEQ ID NO: 24 under stringent conditions and is functionally equivalent to a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 24.

A vector into which the nucleic acid molecule according to claim 1 or 2 has been inserted.

A transformant that retains the nucleic acid molecule according to claim 1 or 2 in an expressible manner.

A polynucleotide that hybridizes with a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 24 or a complementary strand thereof, and has a chain length of at least 15 nucleotides.

A primer for nucleic acid molecule synthesis according to claim 1, comprising the polynucleotide according to claim 5.

A probe for detecting a nucleic acid molecule according to claim 1, comprising the polynucleotide according to claim 5.

The method for detecting a nucleic acid molecule according to claim 1, wherein the polynucleotide according to claim 5 is used.

A method for testing an allergic disease, comprising the step of measuring the expression level of a gene consisting of the nucleotide sequence of SEQ ID NO: 24 or SEQ ID NO: 25 in a biological sample and comparing it with a control (in the case of a healthy subject) .

10. The method according to claim 9, wherein the biological sample is a T cell, and the expression level of the gene in the T cell is measured by RT-PCR using mRNA as a type.

The method according to claim 10, wherein the RT-PCR is performed by a PCR amplification monitor method. The method according to any one of claims 9 to 11, wherein the T cells are prepared from peripheral blood of a subject.

3. The method according to claim 9, wherein the biological sample is blood, and the expression level of the gene is measured by measuring a protein comprising the amino acid sequence shown in SEQ ID NO: 26 and / or a fragment thereof in blood.

4. The method according to claim 9, wherein the allergic disease is cedar pollinosis.

5. A method for screening a candidate compound for a therapeutic drug for an allergic disease,

(a) administering a test compound to a model animal of hay fever and stimulating with a pollen antigen,

(c) selecting a compound that increases the expression level of the gene measured in step (b) as compared to a control (in the case where the test compound is not administered).

6. A method for screening a candidate drug for treating an allergic disease, comprising:

(a) administering a test compound to a model animal of hay fever,

(b) preparing lymphocytes from the model animal,

(c) stimulating the lymphocytes with a pollen antigen,

(d) separating T cells from the antigen-stimulated lymphocytes,

(f) selecting a compound that increases the expression level of the gene measured in step (e) as compared to a control (in the case where the test compound is not administered).

7. A method for screening a candidate compound for a therapeutic agent for an allergic disease, comprising: (a) preparing lymphocytes from a hay fever model animal or a human having hay fever; (b) stimulating the lymphocytes with a pollen antigen in the presence of a test compound,

(c) separating T cells from the antigen-stimulated lymphocytes,

18. A method for screening a candidate drug for treating an allergic disease, comprising:

19. The method according to any one of claims 15 to 18, wherein the expression level of the gene is measured by RT-PCR using mRNA as type II.

20. The method according to claim 15, wherein the T cells are prepared from peripheral blood of a model animal of hay fever.

21. The method of claim 16 or 17, wherein the lymphocytes are prepared from peripheral blood. 22. The method according to any one of claims 15 to 21, wherein the allergic disease is cedar pollinosis.