JPH11332567A - Judgment of atopic predisposition - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for correctly judging risk of atopic allergosis from a specific gene sequence of an individual by using the technique of genetic engineering. SOLUTION: This method comprises the judgment of atopic predisposition wherein an individual having the α-chain of interleukin 4 receptor having isoleucine at 50th. site from its N-terminal is judged to be at risk of atopic allergosis by e.g. a process for amplifying, through PCR technique, the nucleic acid partial base sequence or a fragment having the whole length of the gene encoding the α-chain of interleukin 4 receptor.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention relates to a method for determining the risk of developing an atopic allergic disease. More specifically,
The present invention relates to a method for accurately determining the risk of developing an atopic allergic disease from a specific gene sequence of an individual using a genetic engineering technique.

[0002] Asthma is a disease that interferes with daily life, and its main cause in children and young adults is atopy. Helper T cell type 2 subtypes are involved in atopy, especially IgE against antigens present in environments such as mites and pollen that are rich in interleukin (IL-4).
Is an immunodeficiency that is produced (Shirakawa, T. et a
l., Science, 275, pp. 77-79, 1997). The reaction of the antigen with IgE bound to mast cells of the airways induces mucosal inflammation, which causes asthma symptoms. The possible involvement of genetic factors in the development of atopy has been empirically recognized in clinical settings. However, since atopy is a multifactorial disease that develops due to environmental factors in addition to genetic factors, it has been extremely difficult to identify the causative gene.

[0003] Linkage analysis on chromosomes, which is a genetic approach, has shown an association between serum IgE levels and chromosomes 5, 6, 7, 11, and 16. Various genes such as various cytokines such as IL-4, HLA, T cell receptor, high affinity IgE receptor, and IL-4 receptor are present on these chromosomes, and these genes are allergic. In particular, it is considered as a candidate for an atopic gene. An extensive series of studies has shown that more than one gene is genetically involved in atopy,
(Daniels, SE, et al., Nature, 383, pp.247-250, 1
996; NatureGenel., 15, pp.389-392, 1997), and there is no functional evidence such as how these genes are involved in the genetic constitution of atopy, Was not out of the list of candidates.

[0004] IL-4 and interleukin 13 (IL-1
3) is a cytokine essential for IgE production in B cells and differentiation of helper T cells into Th2 subtype, and is closely related to the pathogenesis of IgE-dependent allergic diseases. In particular, IL-4 is a multifunctional hematopoietic cytokine, which is essential for B cells to produce IgE antibodies and for helper T cells to mature to Th2 (helper T cell type subtype 2). Is also essential (Zuwarski, G. et al., Immunology Today, 15, pp.
19-26, 1994), and may play a critical role in IgE-dependent atopic disorders.

In order for IL-4 and IL-13 to induce IgE production and induction of differentiation of helper T cells into Th2 subtype,
Signal Transducer and Transcription factor-6 (STAT
6; hereinafter, abbreviated as “stat 6”) plays an important role in the intracellular signal transduction system. IL-4 is composed of IL-4 receptor α chain and interleukin 2 receptor γ chain (common γ chain: Russel, SM et
al., Science, 262, pp. 1880-1882, 1993). JAK1 which is a Janus kinase (Janus kinase) is associated with the IL-4 receptor α chain, and JAK3 is associated with the common γ chain, and these tyrosine phosphorylases activate stat6.

Recently, a variant of the IL-4 receptor α chain, Arg576Gln (where the amino acid number is the first AT
Indicating the number from the G codon, indicating that the natural amino acid indicated on the right side of the number has been mutated to the amino acid indicated on the left side of the number) is associated with other atopy-related disorders [hyper IgE syndrome and severe eczema] SHP is a negative regulatory molecule
-1 has been shown to prevent binding to the receptor (Khu
rana, GK, et al., New.Engl.JM, 337, pp.1720
-1725, 1997).

On the other hand, the human IL-4 receptor α chain Ile5
A 0 Val mutation has also been identified (50 is the number from the second ATG codon) (Idzerda, RL, J. Exp. Me
d., 171, pp. 861-873, 1990; Garizzi, J.-P. et al.,
Int. Immunol., 2, pp. 669-675, 1990). This is human I
The only extracellular mutation of the L-4 receptor alpha known to date (Deichmann, K. et al., Biochem. Bi.
ophys. Res. Comm., 231, pp. 696-697, 1997). However, there is no report on the relationship between the amino acid mutation of the human IL-4 receptor α chain and atopy.

[0008]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for accurately determining the risk of developing an atopic allergic disease. More specifically, it is an object of the present invention to provide a method for accurately determining the risk of developing an atopic allergic disease from a specific gene sequence of an individual using a genetic engineering technique.

[0009]

Means for Solving the Problems The present inventors have studied human IL-
To elucidate the correlation between the gene mutation of α4 receptor α chain and the onset of atopic allergic disease, large-scale gene linkage analysis was performed on atopic and non-atopic asthma, and the mutant IL-4 receptor Functional assays were performed after transfection of the somatic α chain gene into mouse and human B cell lines. As a result, Ile of the IL-4 receptor α chain
The 50 Val mutation was found to be strongly involved in the development of asthma. The present invention has been completed based on the above findings.

That is, the present invention is a method for determining the risk of developing an atopic allergic disease, comprising the steps of:
It is intended to provide a method for judging a human individual having an IL-4 receptor α chain in which the 50th amino acid is isoleucine is at risk of developing an atopic allergic disease. According to a preferred embodiment of the present invention, the above-mentioned method of determining by determining the nucleic acid sequence of the gene encoding the IL-4 receptor α chain; and the partial base of the gene encoding the IL-4 receptor α chain The above method is provided, comprising the step of amplifying a fragment containing the sequence or the full length by PCR.

According to another preferred embodiment, in the gene encoding the IL-4 receptor α chain, the nucleic acid sequence encoding the 50th amino acid from the N-terminus of the IL-4 receptor α chain is a nucleic acid sequence encoding isoleucine The above method of determining that the individual is at risk of developing an atopic allergic disease; N-type of IL-4 receptor α chain in at least one of both alleles of the interleukin 4 receptor gene When the nucleic acid sequence encoding the 50th amino acid from the terminal is a nucleic acid sequence encoding isoleucine, the above method of determining that the individual is at high risk of developing an atopic allergic disease; and an interleukin-4 receptor gene I in both alleles of
The above method of determining that an individual is at high risk of developing an atopic allergic disease when the nucleic acid sequence encoding the 50th amino acid from the N-terminus of the L-4 receptor α chain is a nucleic acid sequence encoding isoleucine Is provided.

In another aspect, there is provided a method for determining the risk of developing an atopic allergic disease, comprising the following steps:
(a) PCR using a biological sample isolated from a human individual to fragment a partial nucleotide sequence containing the nucleic acid numbers 150 to 152 of the gene encoding the IL-4 receptor α chain or a fragment containing the full length
Amplifying by a method; and (b) a step including, when a fragment containing the Ile50Val mutation is obtained, determining that the individual is at risk of developing an atopic allergic disease; the following primer set: A primer : 5'-CGGAATTCCGAGGCCCACAC
GTTTG and B primer: 5'-CGCTGGGG
The above method using CTTGAAGGAG; and the above method for making a determination using a monoclonal antibody that specifically recognizes the IL-4 receptor α chain in which the 50th amino acid from the N-terminus is isoleucine are provided.

From a further viewpoint, an interleukin receptor (preferably an IL-4 receptor or an IL-13 receptor, containing an IL-4 receptor α chain in which the 50th amino acid from the N-terminal is isoleucine, A therapeutic and / or prophylactic agent for an atopic allergic disease containing a ligand that binds to an IL-4 receptor as an antagonist; IL-4 in which the 50th amino acid from the N-terminus is isoleucine
Atopic allergy comprising the step of evaluating a ligand that binds as an antagonist to an interleukin receptor (preferably IL-4 receptor or IL-13 receptor, more preferably IL-4 receptor) containing a receptor α chain A method for evaluating a therapeutic and / or prophylactic agent for a disease is provided.

From another viewpoint, an interleukin receptor (preferably an IL-4 receptor or an IL-13 receptor, containing an IL-4 receptor α chain in which the 50th amino acid from the N-terminal is isoleucine, More preferably, there is provided a therapeutic and / or prophylactic agent for atopic allergic diseases, comprising a substance that inactivates or inhibits IL-4 receptor), preferably a monoclonal antibody, as an active ingredient.

Further, from another viewpoint, interleukin 4 in which the 50th amino acid from the N-terminus is isoleucine.
An inhibitor or inhibitor of increased IgE production caused by an interleukin receptor having an α-chain of a receptor; an interleukin receptor having an α-chain of an interleukin 4 receptor in which the 50th amino acid from the N-terminus is isoleucine Provided is an inhibitor or inhibitor of the phosphorylation of Stat 6 caused by In these inventions, preferable examples of the atopic allergic disease include atopic dermatitis, atopic asthma, and hay fever.

[0016]

BEST MODE FOR CARRYING OUT THE INVENTION In the method of the present invention, an individual having an IL-4 receptor α chain in which the 50th amino acid from the N-terminal is isoleucine is used to determine the risk of developing atopic allergic disease. It is characterized by determining that there is a risk of developing an allergic disease. Human IL
The amino acid sequence of the α-4 receptor α-chain and the Ile50Val mutation are described in known literature (Idzerda, R.
L., J. Exp.Med., 171, pp. 861-873, 1990; Garizzi,
J.-P. et al., Int. Immunol., 2, pp.669-675, 199
0).

In the method of the present invention, when making a determination,
Using a biological sample separated and collected from an individual, Ile is added to the IL-4 receptor α chain of the IL-4 receptor possessed by the individual.
Check whether the 50 Val mutation is included. The means for this confirmation is not particularly limited. In addition to a method for directly analyzing the amino acid sequence of the polypeptide chain constituting the IL-4 receptor α chain, the method for interleukin 4 receptor α chain A method for determining the nucleic acid sequence of the gene encoding Although the type of the biological sample is not particularly limited, it is preferable to use, for example, blood, tissue pieces, and the like.

As a method for determining the nucleic acid sequence of the gene encoding the α chain of the IL-4 receptor, it is preferable to employ a PCR (polymerase chain reaction) method. This method is well known and widely used in the field of genetic engineering, and a desired gene fragment can be easily amplified in a short time by using an appropriate primer sequence. The partial nucleotide sequence of the gene encoding the IL-4 receptor α-chain, which contains the nucleic acid numbers 150 to 152 (encoding the N-terminal amino acid of the IL-4 receptor α-chain, Nucleic acid numbers 1 to 3), or a fragment containing the full length of the gene encoding the IL-4 receptor α chain can be amplified.

The reaction conditions and reagents for the PCR method can be appropriately selected by those skilled in the art, and the primer sequence can be appropriately designed and used so that the desired fragment can be efficiently amplified. For example, the following primer set: A primer: 5'-CGGAATTCCGAGGCCCCAC
ACGTTTGT and B primer: 5'-CGCTG
Use of GGCTTGAAGGAG allows efficient preparation of a desired fragment. The method for determining the nucleic acid sequence of the amplified fragment is not particularly limited, and any of various methods available to those skilled in the art may be employed.

According to the determination method of the present invention, in the gene encoding the IL-4 receptor α chain, the nucleic acid sequence encoding the 50th amino acid from the N-terminal of the IL-4 receptor α chain is a nucleic acid encoding isoleucine. If it is a sequence, the human individual, preferably a human pediatric individual, is determined to be at risk of developing an atopic allergic disease. Such individuals include Ile50 homo and hetero. IL-4 in at least one of these alleles
When the nucleic acid sequence encoding the 50th amino acid from the N-terminus of the receptor α-chain is a nucleic acid sequence encoding isoleucine (Ile50 heterozygous), the individual is more susceptible to atopic allergic disease than an individual not including Ile50. It can be determined that the onset risk is high. When the nucleic acid sequence encoding the 50th amino acid from the N-terminus of the IL-4 receptor α chain in both alleles is a nucleic acid sequence encoding isoleucine (Ile50 homo), the individual is an Ile50 heterozygous. It is determined that the risk of developing an atopic allergic disease is higher than that of an individual.

[0021] The method of the present invention generally comprises the following two steps: (a) IL-
Nucleic acid numbers 150 to 15 of the gene encoding the 4 receptor α chain
The partial base sequence containing 2 or the fragment containing the full length
Amplifying by CR method; and (b) Ile50Val
When a fragment containing a mutation is obtained, the method is preferably performed by a method including a step of determining that the individual is at risk of developing an atopic allergic disease.

From another point of view, I-proteins containing an IL-4 receptor α chain in which the 50th amino acid from the N-terminal is isoleucine
There is provided a therapeutic and / or prophylactic agent for atopic allergic diseases, comprising as an active ingredient a ligand that binds to an L-4 receptor or an IL-13 receptor as an antagonist.
Whether or not a substance can bind to an IL-4 receptor containing an IL-4 receptor α chain as an antagonist can be determined by examining the binding constant (receptor affinity), the concentration of interleukin-4 that inhibits the expression of a physiological activity, and the like. It can be easily determined. The method for evaluating a therapeutic and / or prophylactic agent for an atopic allergic disease of the present invention is characterized in that a ligand having the above characteristics is selected from various compounds by evaluation. As an index for selecting candidate substances, for example,
The binding constants and IL-4 inhibitory concentrations described above can be used.

Also, a substance that inactivates an IL-4 receptor containing an IL-4 receptor α chain in which the 50th amino acid from the N-terminal is isoleucine, for example, an IL in which the 50th amino acid from the N-terminal is isoleucine. Pharmaceuticals containing as an active ingredient a monoclonal antibody that specifically recognizes the α-4 receptor α-chain are also useful as therapeutic and / or prophylactic agents for atopic allergic diseases. A method for producing a monoclonal antibody is well known and commonly used by those skilled in the art, and a monoclonal antibody having the above characteristics is produced by using an IL-4 receptor α chain in which the 50th amino acid from the N-terminus is isoleucine as an antigen. be able to. In addition, a monoclonal antibody that can specifically recognize the Ile50Val mutation of the IL-4 receptor α chain can be suitably used in the determination method of the present invention.

[0024]

EXAMPLES The present invention will be described more specifically with reference to the following examples, but the scope of the present invention is not limited to the following examples. Example 1 In a stochastic analysis of the population, testing for the Ile50Val mutation was performed using a PCR-based Ms11 restriction assay. The genotype frequencies for the IL-4 receptor α Ile50 and Val50 in control subjects are consistent with Hardy-Weinberg equilibrium and p
(Ile50) -0.4 and q (Val50) -0.6. Ile between control group and atopic patient group
The genotype frequencies of 50 and Val50 were significantly different (Table 1).

[0025]

[Table 1]

Ile50 was associated with atopic asthma but not intrinsic or non-atopic asthma. Ile50 increases total serum IgE levels (predicted ratio = 3.94, 95% CI 1.90-5.88, p <
0.01) and an increase in mite-specific IgE (predicted ratio = 3.1)
8, 95% CI 1.72-2.28, p <0.01)
Was also relevant. The association with atopic asthma was particularly strong in children (prediction ratio = 6.30, 95% CI
3.66-8.95, p <0.001); adult (prediction ratio = 3.67, 95% CI 1.57-6.69, p <
0.01). These results are consistent with younger identical twins having the highest association between asthmatic symptoms and total serum IgE levels, and relative genetic inputs or genetics for atopy and asthma. Consistent with the conclusion that sex is greatest in children (Shirakawa, T.,
et al., J. Clin. Epidemiol., 49, pp. 1059-1065, 199
6).

The high frequency [-60%] of Ile50 homozygotes in the pediatric asthma group was attributed to Ile5 for atopy.
0 indicates a predominantly recessive genetic effect, while
The effect of Arg576Gln appeared to be primarily dominant (Khurama, GK, New Engl. JM, 337, p.
p.1720-1725, 1997). This result illustrates the complexity of atopy's genetics, where heterogeneity is found not only in one locus but also in different loci.

Ile50 Mutation of IL-4 Receptor α and Va
To examine the function of the 150 mutations, a plasmid containing the promoter region of the human Iε gene linked to either the luciferase or the human growth hormone gene was constructed using cDNAs showing these mutations, and mouse B lymphocytes or Human B lymphocytes were transfected. The Iε-luciferase construct was transfected into the mouse pro-B cell line Ba / F3 [BF-GETP] and the Iε-human growth hormone construct was transfected into the human B cell line Jijoye [J-GETP]. did. The clones of these systems were then added to an expression vector (Ile50 or Val50 IL-4 receptor αc
DNA (carrying any of FIG. 1 (b)) was transfected.

When the mouse BF-GETP system was subjected to screening, four out of ten Ile50 and ten Vae
Two of the 150 transfected clones grew well under the stimulation of human IL-4. Ile50
BF-GETP showed almost three times as much growth as Val50 BF-GETP grown under the stimulation of human IL-4 (FIG. 2). Their luciferase activities are not different from each other upon stimulation of mouse IL-4,
Although it was not different from the parent BF-GETP clone,
This indicates that the intracellular mechanisms for transcription of germline epsilon transcripts are Ile50BF-GETP and Val5.
This indicates that both 0BF-GETP are normal. Ile50BF-GETP induced about 3-fold greater induction of Iε transcript in response to human IL-4 when compared to the Val50 clone (5.4-fold and 15.5-fold, respectively) (FIG. 3).

[0030] Il than the Val50 transfectants
A binding assay was performed to evaluate the possibility that the response of Ile50BF-GETP to stimulation of human IL-4 was enhanced due to high expression of e50. As a result, the average Kd ｛52 (39-63) pM vs. 56 (40,
71) pM—Ile50BF-GETP in FIG. 4｝
And there was no difference between Val50BF-GETP.
Average number of Ile50IL-4 receptor α on cells (230
(0 sites / cell) was the same as the average number of Val50IL-4 receptor α (2300 sites / cell). The result is
Ile50 up-regulates the function of human IL-4 receptor α, resulting in increased cell proliferation and germline epsilon transcripts (Iε
Territory governed by).

Transfected human J-GETP
The same result was obtained with the clone. Upon screening, 10 drug-resistant clones were obtained, which were Ile50IL-4 receptor α or Val50, respectively.
Had the IL-4 receptor α. From these three clones having high responsiveness were selected and used in the following tests.
Ile50 J-GETP responds to IL-4 by sending Va
It produced about three times more growth hormone than did 150J-GETP (FIG. 5). Average Kd ｛63-143
For 100-143 pM４３, Ile50J-G
There was no difference between ETP and Val50J-GETP (FIG. 6), and there was no difference in the number of IL-4 receptor α on J-GETP.
000 / cell vs. 3600-420 at Val50
0 / cell｝.

Since Stat6-deficient mice do not produce IgE (Takeda, K. et al., Nature, 380, pp.
627-630, 1996; Shimoda, K., et al., Nature, 380, p.
p.630-633, 1996), to clarify and further develop the above findings, the relative activation of the transcription factor Stat6 was examined. The dynamic patterns of Stat6 activation in Ile50 and Val50J-GETP were nearly identical, but in both mouse BF-GETP and human J-GETP clones, Ile50 compared to Val50.
The mutant enhanced Stat6 activation approximately 2-fold (FIG. 7: cells were incubated for 15 minutes at each human IL-4 concentration).

Data obtained from both mouse and human cell lines show that Ile50 of IL-4 receptor α significantly increases the receptor's response to IL-4, and consequently Stat
Strongly suggests the conclusion that increasing the activity of 6 results in growth and germline ε production. These findings are fully consistent with the strong association found between Ile50 and high serum levels of IgE (both total and allergen specific) and with atopic asthma in statistical analysis. ing. In addition, IL-4
Receptor α is a component common to both the IL-4 receptor and the IL-13 receptor (Callard, RE, Immuno
l. Today, 17, pp. 108-110, 1996), IL-13 is IL
-4 share some of the various functions. Therefore, IL
Mutations in the -4 receptor alpha chain may enhance the function of IL-13.

[Experimental method]Selection of subjects  As a control among patients in a medical testing company
120 subjects were selected. The gender of the selected subject
Age morbidity was matched to that in this region. Doctor
Allergies, endogenous pediatric allergic asthma
The 120 diagnosed cases were collected from two hospitals, respectively. Suffered
If the examiner exhibits two or more of the following respiratory symptoms
It was judged as asthma. (I) cough, (ii) sputum, (iii) call
Dyspnea, (iv) day or night wheezing, or
(V) Deficiency breathing accompanied by wheezing over 2 years
Work. Heavy smokers (cigarette 2
0 / day).

[0035]Serological test  Detect specific IgE using MAST (Hitachi, Ltd.)
In the same manner as described in the literature.
Cut-off values were used (Mao, X.-Q. et al., Lancet, 34
8, pp. 581-583, 1996). Normal values for children described in the literature
Larger or 400 kU / L for adults (mean +
/ -2SD), the higher total IgE value (CA
P, Uppsala, Sweden). atopic
Is defined as IgE responsiveness and is defined as the high concentration of total serum IgE.
Or 15 highly purified airborne allergens
Positive specific IgE titers for one or more
The diagnosis was made in two combinations.

[0036]DNA method  DNA samples are available from commercial kits (IsoQuick, Mi
Croprobe Corporation, Gar, USA
(Dengrove). Human IL-4 receptor
For α, only cDNA sequence, not genomic DNA
Only the mouse IL-4 receptor α
Based on the exon-intron structure of the gene,
(Wrighton, N. et al., Growth Factor,
6, pp. 103-118, 1992). Initially denatured at 94 ° C for 5 minutes
Then, using 100 ng of genomic DNA as a template
Perform a PCR reaction in a total of 30 μl of the reaction solution at 94 ° C.
30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds
The cycle was performed for 37 cycles. 5 'as primer
−CGGAATTCCGAGGCCCACACGTTG
For T and 5'-CGCTGGGCTTGAAGGAG
Was. The underlined sequence is the extension of the PCR product.
Added for long. 2 units of Msl1 (New E
ngland Biolab, UK)
Thereafter, DNA was separated on a 5% agarose gel (2: 3N
usieve GTG: agarose).

[0037]Functional assays  Perform site-directed mutagenesis according to literature methods
(Kunkel. T.A., Proc. Natl. Acad. Sci. U.S.A.,
82, pp. 488-492, 1985). 5'CTCAGGGATAC
Mutagenesis of oligonucleotide represented by ACCCG
Used for development. Human carrying valine or isoleucine
Plasmid DNA of IL-4 receptor α was converted to pcDNA3.
1 / Zeo vector (Invitrogen, Canada
Carlsbad) and insert them into Val5
0 and Ile50.

[0038]Construction of transfected B cell line  pGL3 enhancer vector (Promega, Wisco)
-187 to + of human Iε inserted into Madison, N.
And a plasmid containing the promoter region of pSV2neo
Mycin resistance gene and mouse pro-B cell line
Ba / F3 cotransfected and the resulting transformation
The cells were named BF-GETP. Val50IL-4
Either receptor α or Ile50IL-4 receptor α
To BF-GETP by electroporation
I did it.

PS72 into which the human growth hormone cDNA and the human Iε -583 to -3 promoter region were inserted
The human Burkitt lymphoma cell line, Jijoyc, was transfected with the vector plasmid. This transformed cell was obtained from JanE. Dr. deVries (DNAX
Research Institute, Palo Alto, CA) and is referred to as J-GETP. Either Val50 or Ile50 IL-4 receptor α was transfected into J-GETP by electroporation.

[0040]MTT assay using BT-GETP  Incubated with various concentrations of human IL-4 for 24 hours
The proliferative response of the cells was assayed by the MTT method described previously.
(Yokota, T. et al., Proc.Natl.Acad.Sci.U.S.A.,
81, pp. 1070-1074, 1984).Luciferase activity assay using BT-GETP  Presence of 2 ng / ml human IL-4 or mouse IL-4
1 × 10 in the presence or absence⁶Individual cells (BT-G
After culturing (ETP) for 24 hours, the cells were
Lyse with Fur (Promega) and clarify the cell lysate
Mix with luciferase assay reagent (Toyo Ink)
Was.

[0041]Growth hormone assay  1 × 10 with various concentrations of human IL-4⁴48 cells
After interculture, growth hormone was assayed by ELISA assay.
Production was examined.Binding assay ¹²⁵ I-labeled human IL-4 (NEN, Mass.
(Boston, UT) cell binding assay documented
(Izuhara, K. et al., Biochem.
Biophys. Res. Comm. 190, pp. 992-1000, 1993).

[0042]Electrophoretic mobility shift assay (EMS
A)  EMSA operation was performed according to the method described in the literature (Izu
hara, K. et al., J. Biol. Chem., 271, pp. 619-622, 1
996). Lysing cells stimulated by human IL-4;
The nuclear protein was extracted. The amount of nuclear extract used before mixing
Standardized. Nuclear extract is combined with binding buffer poly
(Dl-dC) and Iε³²P-labeled oligonucleotide
Probe (5'GTCAACTTCCCAAGAAC
AGAA) and then mix the mixture with polyacrylamide
Separated by gel electrophoresis. DNA-protein complex
The body was visualized by autoradiography.

[Brief description of the drawings]

FIG. 1 is a diagram showing the structure of an interleukin-4 receptor α chain. In the figure, (a) is a schematic diagram of the structure of the human IL-4 receptor α chain, where the hatched portion indicates the signal peptide and the black portion indicates the transmembrane domain. (B)
Indicates a cDNA sequence encoding Ile50 or Val50.

FIG. 2 shows the results of a Ba / F3 transfectant assay (MTT assay).

FIG. 3 shows the results of a Ba / F3 transfectant assay (luciferase activity assay). In the figure, the results are shown assuming that the luciferase activity of each clone was 1-fold when there was no stimulation of human IL-4.

FIG. 4 shows the results of a Ba / F3 transfectant assay (binding assay).

FIG. 5 is a diagram showing the results of a Jijoy transfectant assay (growth hormone activity assay).
Each vertical bar indicating an error indicates a deviation among three clones.

FIG. 6 shows the results of a Jijoy transfectant assay (binding assay).

FIG. 7: IL-4 receptor and BF-GETP or J-
FIG. 4 shows Stat6 activity induced by GETP. In the figure, the arrow indicates the position of the Stat6-containing DNA complex. In the figure, A shows the result of BF-GETP, and B shows the result of J-GETP.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI G01N 33/53 G01N 33/53 P A61K 37/02

Claims (21)

[Claims] 1. A method for determining atopic constitution, comprising:
A method for determining that an individual having an interleukin 4 receptor α-chain in which the 50th amino acid from the N-terminal is isoleucine is at risk of developing an atopic allergic disease. 2. The method according to claim 1, wherein the determination is performed by determining a nucleic acid sequence of a gene encoding an interleukin-4 receptor α chain. 3. The method according to claim 1, further comprising the step of amplifying a fragment containing the nucleic acid partial base sequence or the full length of the gene encoding the interleukin-4 receptor α chain by PCR. 4. The gene encoding the interleukin 4 receptor α chain,
4. The method according to claim 2, wherein when the nucleic acid sequence encoding the 50th amino acid from the terminal is a nucleic acid sequence encoding isoleucine, the individual is determined to be at risk of developing an atopic allergic disease. 5. When the nucleic acid sequence encoding the 50th amino acid from the N-terminal of the interleukin 4 receptor α chain in both alleles of the interleukin 4 receptor gene is a nucleic acid sequence encoding isoleucine, The method according to claim 4, wherein the individual is determined to be at high risk of developing an atopic allergic disease. 6. A method for determining the risk of developing an atopic allergic disease, comprising the following steps: (a) a nucleic acid of a gene encoding an interleukin-4 receptor α chain using a biological sample isolated from an individual; From number 150
Amplifying a fragment containing the partial nucleotide sequence containing 152 or the full length by PCR; (b) when a fragment containing the Ile50Val mutation is obtained, the individual is determined to be at risk of developing an atopic allergic disease A process. 7. The following primer set: A primer: 5′-CGGAATTCCGAGGCC
CACACGTTGT B primer: 5'-CGCTGGGCTTGAAGG
The method according to any one of claims 3 to 6, wherein AG is used. 8. A primer set used for determining the risk of developing an atopic allergic disease, comprising:
A set comprising the A primer and the B primer according to claim 7. 9. The determination is performed using a monoclonal antibody that specifically recognizes an interleukin 4 receptor α-chain in which the 50th amino acid from the N-terminal is isoleucine.
The described method. 10. A therapeutic and / or prophylactic agent for an atopic allergic disease comprising a ligand that binds as an antagonist to an interleukin receptor containing an interleukin 4 receptor α-chain in which the 50th amino acid from the N-terminal is isoleucine. 11. The therapeutic and / or prophylactic agent according to claim 10, wherein the interleukin receptor is an interleukin 4 receptor. 12. A method for treating atopic allergic disease, comprising the step of evaluating a ligand that binds as an antagonist to an interleukin receptor containing an interleukin 4 receptor α-chain in which the 50th amino acid from the N-terminal is isoleucine. Or a method for evaluating a prophylactic agent. 13. The method according to claim 12, wherein the interleukin receptor is an interleukin 4 receptor. 14. The treatment and / or treatment of atopic allergic diseases, which comprises, as an active ingredient, a substance which inactivates an interleukin receptor containing an interleukin 4 receptor α-chain in which the 50th amino acid from the N-terminal is isoleucine. Prophylactic agent. 15. The therapeutic and / or prophylactic agent according to claim 14, wherein the interleukin receptor is an interleukin 4 receptor. 16. The therapeutic and / or prophylactic agent according to claim 14, wherein the substance that inactivates or inhibits the interleukin receptor is a monoclonal antibody or a substance having an antigen recognition site of the monoclonal antibody. 17. An inhibitor or inhibitor of an increase in IgE production caused by an interleukin receptor containing an α-chain of an interleukin 4 receptor, wherein the 50th amino acid from the N-terminal is isoleucine. 18. An inhibitor or inhibitor of Stat6 phosphorylation caused by an interleukin receptor containing an α-chain of interleukin 4 receptor, wherein the 50th amino acid from the N-terminal is isoleucine. 19. The method according to any one of claims 1 to 6, wherein the atopic allergic disease is atopic dermatitis, atopic asthma or hay fever. 20. The method according to claim 10, wherein the atopic allergic disease is atopic dermatitis, atopic asthma or hay fever.
A method according to any one of claims 11, 14 to 16. 21. The method according to claim 12, wherein the atopic allergic disease is atopic dermatitis, atopic asthma or hay fever.