JP2002095500A - Method for examining allergic disease - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a gene associated with allergic diseases, and further to provide a method for examining the allergic diseases by using the expression of the gene as an index, and a method for screening candidate compounds for a therapeutic agent for the allergic diseases. SOLUTION: The gene exhibiting difference in expressions in eosinophils collected in an exacerbation stage and a remission stage is detected by a differential display method. As a result, the gene (2217-09) having significantly increased expression in the eosinophils of a patient in the remission stage accompanying the decrease of the eosinophils is isolated. It is discovered that the gene can be used for examining the allergic diseases and the screening of the candidate compounds for the therapeutic agent.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a gene associated with an allergic disease, a method for testing an allergic disease using the expression of the gene as an index, and a method for screening a candidate compound for a therapeutic drug for an allergic disease.

[0002]

2. Description of the Related Art Allergic diseases such as atopic dermatitis are considered as multifactorial diseases. These diseases are caused by the interaction of the expression of many different genes, and the expression of these individual genes is affected by multiple environmental factors. For this reason,
It is very difficult to elucidate the specific gene that causes a specific disease.

[0003] Further, it is considered that allergic diseases involve the expression of genes having mutations or defects, and the overexpression or reduction of the expression level of specific genes. To understand the role gene expression plays in disease,
It is necessary to understand how genes are involved in the pathogenesis and how external stimuli such as drugs alter gene expression.

[0004] Recent developments in gene expression analysis techniques have made it possible to analyze and compare gene expression in many clinical samples. As such a method, a differential display (DD) method is useful. The differential display method was first developed by Ryan and Pardee in 1992 (Science, 1992, 257: 967-971). By using this method, several tens or more types of samples can be screened at one time, and it is possible to detect a gene whose expression has changed in those samples. By using such a method to examine a gene in which a mutation has occurred or a gene whose expression changes with time or environment, it is expected that important information for elucidation of a pathogenic gene will be provided. These genes also include those whose expression is affected by environmental factors.

[0005] In the diagnosis of allergic diseases, questionnaires, family histories, and confirmation of the patient's past illness are currently important factors. In addition, in order to diagnose allergy based on more objective information, a test method using blood as a sample and a method for observing a patient's immunological response to an allergen have been implemented. Examples of the former include allergen-specific IgE measurement, leukocyte histamine release test,
Alternatively, a lymphocyte blastogenesis test and the like can be mentioned. The presence of allergen-specific IgE is evidence of an allergic reaction to the allergen. However, some patients may not always be able to detect allergen-specific IgE. In addition, due to its measurement principle, tests must be performed on all allergens required for diagnosis.
The leukocyte histamine release test and lymphocyte blastogenesis test are methods for observing the response of the immune system to allergens in vitro. These methods are complicated in operation.
On the other hand, a method of using an immune response observed when a patient is actually brought into contact with an allergen for diagnosis of allergy (the latter) is also known. Such tests include brick tests, scratch tests, patch tests, intradermal reactions, or provocation tests. Although these tests can directly diagnose a patient's allergic reaction, they can be said to be highly invasive tests that actually expose the subject to an allergen.

[0006] In addition, test methods have been attempted to prove the involvement of allergic reactions regardless of the allergen. For example, if the serum IgE level is high, it can be estimated that the patient has an allergic reaction. The serum IgE value is information corresponding to the total amount of allergen-specific IgE. Although it is easy to determine the total amount of IgE regardless of the type of allergen, IgE may be low in patients with diseases such as non-atopic bronchitis.
Eosinophil counts and ECP values are diagnostic items related to delayed-type reactions following type I allergy and allergic inflammatory reactions. The number of eosinophils is said to reflect the development of allergic symptoms. ECP (eosinophil cationic protein), which is a protein contained in eosinophil granules, is also strongly activated with asthma attack. These diagnostic items certainly reflect allergic symptoms.
However, the range that can be actually used as a diagnostic index is limited. Therefore, regardless of the allergen, there has been a demand for a diagnostic index that can be used for understanding the condition of an allergic patient and determining a treatment policy. In addition, it would be useful to provide a marker for an allergic disease, which can reduce the risk to the patient and can easily obtain information necessary for diagnosis.

[0007]

An object of the present invention is to provide a gene associated with an allergic disease.
Another object of the present invention is to provide a method for testing an allergic disease and a method for screening a candidate compound for a therapeutic drug for an allergic disease, using the expression of the gene as an index.

[0008]

Means for Solving the Problems The present inventors have established the "Fluorescent DD (Fluorescent DD) method" (T. Ito et al., 1994,
Based on the procedure of FEBS Lett. 351: 231-236), we have developed a DD system that can analyze white blood cell RNA samples prepared from multiple human blood (Japanese Patent Application No. 11-120489). Using this system, the present invention was applied to the isolation of genes having different expression levels specifically for allergic diseases. That is, first, the present inventors compared some parameters related to allergic symptoms between the exacerbation period and the remission period of skin inflammatory symptoms in patients with atopic dermatitis. As a result, a decrease in eosinophils during remission was observed in some patients. In general, eosinophils are regarded as a representative clinical indicator of atopic dermatitis, and the present inventors have paid attention to this finding. And if it is possible to isolate a gene whose expression level changes in eosinophils between the exacerbation period and remission period of the same patient, it will be possible to isolate genes directly involved in atopic dermatitis I thought it might be.

Therefore, eosinophils are collected from a plurality of subjects during the exacerbation period and remission period of atopic dermatitis, and the above system is used to screen for a gene whose expression level changes in eosinophils. went. As a result, the gene "2217-09" showing a significantly higher expression level was successfully isolated in patients in whom eosinophil reduction was observed during the remission period. This gene could not find the same nucleotide sequence in a known gene database, and was considered to be a novel gene. Furthermore, the present inventors have found that it is possible to perform an allergic disease test and a screening of a candidate compound for a therapeutic drug for an allergic disease using the expression level of this gene as an index, and completed the present invention.

[0010] That is, the present invention relates to a gene showing high expression in atopic dermatitis, particularly in a remission period accompanied by a decrease in eosinophils, and an application thereof. More specifically, a method for testing an allergic disease using the expression of the gene as an index, a method for detecting the effect of the candidate compound on the expression of the gene, and a candidate compound for a therapeutic agent for an allergic disease based on the detection method A screening method. [1] A method for testing an allergic disease, comprising the following steps: a) a step of measuring the expression level of a gene containing the nucleotide sequence of SEQ ID NO: 1 in eosinophil cells of a subject; b) a step of comparing the expression level of the gene in eosinophil cells of a healthy subject [2] the allergic disease is atopic dermatitis,
The inspection method according to [1]. [3] The test method according to [1], wherein the expression level of the gene is measured by cDNA PCR. [4] A reagent for testing an allergic disease, comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or an oligonucleotide having a nucleotide sequence complementary to a complementary strand thereof and having a length of at least 15 bases. [5] A method for detecting the effect of a candidate compound on the expression level of a polynucleotide described in the following (a) or (b), comprising the following steps: (1) A step of contacting a candidate compound with a cell expressing the polynucleotide described in (a) or (b) below: (a) A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1. (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. (2) a step of measuring the expression level of the polynucleotide according to (a) or (b); [6] the method according to [5], wherein the cells are established leukocytes; [7] A method for detecting the effect of a candidate compound on the expression level of a polynucleotide described in the following (a) or (b), comprising the following steps: (A) a polynucleotide sequence that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence of SEQ ID NO: 1; and A polynucleotide encoding a protein whose expression increases in eosinophils as eosinophils decrease. (1) a step of administering a candidate compound to a test animal, and (2) a step of measuring the expression intensity of the polynucleotide according to (a) or (b) in eosinophil cells of the test animal, [8] [ 5) or the method according to [7], comprising detecting the effect on the expression level and selecting a compound that increases the expression level as compared to a control. 2. A method for screening a compound that increases the expression level of the polynucleotide according to item 1.

[9] A method for detecting the effect of a candidate compound on the activity of a transcription regulatory region of a gene containing the nucleotide sequence of SEQ ID NO: 1, comprising the following steps: (1) contacting a candidate substance with a cell into which a vector containing a transcription regulatory region of a gene containing the nucleotide sequence of SEQ ID NO: 1 and a reporter gene expressed under the control of the transcription regulatory region has been introduced; and (2) measuring the activity of the reporter gene, [10]

Detecting the effect of the candidate compound on the activity by the method according to [9], and selecting a compound that increases the activity as compared to a control.
A method for screening a compound that increases the activity of a transcription regulatory region of a gene containing the nucleotide sequence according to 1. [11] A vector comprising a transcription regulatory region of a gene containing the nucleotide sequence of SEQ ID NO: 1, and a reporter gene expressed under the control of the transcription regulatory region. [12] A cell into which the vector of [11] has been introduced. [13] A therapeutic drug for allergic diseases, comprising as an active ingredient a compound obtainable by the screening method according to [8] or [10]. [14] A therapeutic agent for an allergic disease, comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or a part thereof as an antisense DNA as a main component. [15] a polynucleotide according to the following (a) or (b): (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. [16] a protein encoded by the polynucleotide of [15]; [17] A vector that holds the polynucleotide of [15] in an expressible manner. [18] a transformed cell that carries the polynucleotide of [15] or the vector of [17]; [19] The method for producing a protein according to [16], comprising a step of culturing the transformed cell according to [18] and collecting an expression product thereof. [20] an antibody against the protein of [16]; [21] a step of observing an immunological reaction of the antibody of [20] and the protein of [16],
2. The method for immunologically measuring a protein according to item 1. [22] a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, or an oligonucleotide having a nucleotide sequence complementary to a complementary strand thereof, the oligonucleotide having a length of at least 15 bases; [23] the oligonucleotide of [22];
[15] The method for measuring a polynucleotide according to [15], comprising a step of observing hybridization with the polynucleotide according to [5]. [24] An allergic disease model animal comprising a transgenic non-human vertebrate in which the expression intensity of the polynucleotide described in the following (a) or (b) is reduced in eosinophil cells. (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. [25] the model animal of [24], wherein the transgenic animal is a knockout animal;

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention provides a novel gene "2217-0
And a method for testing an allergic disease using the expression level of "2217-09" in eosinophil cells as an index.
“2217-09” is a gene whose expression level increases with a decrease in eosinophils during remission of atopic dermatitis patients. The gene "2217-09" of the present invention could not find a gene having a particularly high structural identity, and was considered to be a novel gene. "2217-09" includes the nucleotide sequence of SEQ ID NO: 1. The base sequence shown in SEQ ID NO: 1 is a partial sequence of the full-length cDNA. Full length cDNA containing this partial sequence
Can be obtained by screening a cDNA library of leukocyte cells with a probe consisting of a base sequence selected from the base sequence shown in SEQ ID NO: 1. “2217-09” is expressed not only in eosinophils but also in neutrophils. Therefore, any of these cells and a cDNA library derived from a cell population containing these cells can be used for obtaining the gene “2217-09” of the present invention. The RACE method (Frohman, MA et.
al .: Proc. Natl. Acad. Sci. USA, 85: 8992, 1988)
The sequence of "2217-09" can also be extended.
That is, using a sequence derived from `` 2217-09 '' as a primer, convert mRNA such as white blood cells into single-stranded cDNA,
An extended cDNA can be obtained by performing PCR after adding the oligomer to the end. "Polynucleotide containing base sequence described in SEQ ID NO: 1" in the present invention
Thus, the "2217-09" cDN of SEQ ID NO: 1
Full-length cDNA of "2217-09" that can be isolated based on the sequence information of A
Is included. Further, the amino acid sequence encoded by the cDNA can be estimated based on the nucleotide sequence of the cDNA thus obtained.

The present invention relates to a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 1. The present invention also relates to a polynucleotide that hybridizes to the polynucleotide under stringent conditions and encodes a protein functionally equivalent to the protein encoded by the polynucleotide. In the present invention, the term “polynucleotide” includes not only natural nucleic acid molecules such as DNA and RNA, but also labeled molecules and artificial molecules composed of various nucleotide derivatives. Artificial polynucleotides include polynucleotides having phosphorothioate bonds or peptide bonds as a backbone. These polynucleotides of the present invention can be chemically synthesized or isolated from natural nucleic acids such as mRNA, cDNA library, or genomic library. The polynucleotide molecule of the present invention is useful as an antisense nucleic acid for inhibiting the production of the protein encoded thereby, the expression of "2217-09", or a probe for detecting the presence thereof by hybridization, or the like. .

In the present invention, when the expression of a certain protein increases in eosinophils in association with the reduction of eosinophils during the remission of atopic dermatitis, it is said to be functionally equivalent to the protein of the present invention. Increased expression of a protein in eosinophils with eosinophil depletion during the remission phase of atopic dermatitis can be measured by observing changes in the number of eosinophils during the exacerbation and remission phases. This can be confirmed by comparing the expression level of the gene encoding the protein in the eosinophils collected in Step 1. A polynucleotide that hybridizes with this polynucleotide under stringent conditions and encodes a functionally equivalent protein can be obtained by a known method such as hybridization or PCR based on the nucleotide sequence of SEQ ID NO: 1. Can be obtained. For example, by using an oligonucleotide consisting of a base sequence selected from the base sequence described in SEQ ID NO: 1 as a probe and screening a cDNA library of leukocyte cells under stringent conditions,
A cDNA consisting of a nucleotide sequence having a high identity to the nucleotide sequence described in SEQ ID NO: 1 can be obtained. When a polynucleotide hybridizes under stringent conditions with a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, it is likely that the protein encoded by this polynucleotide often has an activity similar to the protein of the present invention. Conceivable. Stringent conditions generally include the following conditions. That is, 4 × SSC,
Hybridize at 65 ° C. and wash with 0.1 × SSC at 65 ° C. for 1 hour. Hybridization and washing temperature conditions that greatly affect stringency can be adjusted according to the melting temperature (Tm). Tm
Is the proportion of constituent bases in the base pairs that hybridize,
It varies depending on the hybridization solution composition (salt concentration, formamide and sodium dodecyl sulfate concentration).
Therefore, those skilled in the art can empirically set conditions that give equivalent stringency in consideration of these conditions. A protein encoded by a cDNA consisting of a highly identical base sequence is likely to be a functionally equivalent protein in the present invention. In the present invention, a base sequence having high identity generally means 70% or more, usually 80% or more, preferably 90% or more, more preferably 9% or more.
It refers to a nucleotide sequence showing 5% or more, more preferably 98% or more, particularly preferably 99% or more identity. The nucleotide sequence identity can be calculated by a known algorithm such as BLASTN.

Alternatively, an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is used as a primer,
Again, PCR using white blood cell cDNA library as template
By performing the above, a cDNA with high identity can also be obtained. If human cells are used as the source of cDNA, human cDNA can be obtained. If a vertebrate cell other than a human is used, a counterpart in a heterologous animal can be obtained. Examples of such non-human animals include many experimental animals such as mice, rats, dogs, pigs, and goats. The counterpart of “2217-09” in experimental animals is useful as a marker in the creation of allergy model animals in each animal species and in the development of therapeutic drugs for allergy.

[0015] The present invention also relates to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or an oligonucleotide having a nucleotide sequence complementary to a complementary strand thereof, wherein the oligonucleotide has a length of at least 15 bases. About. Here, “complementary strand” refers to A: T (in RNA, T is replaced by U
To the other strand of a double-stranded polynucleotide consisting of G: C base pairs. Also,
`` Complementary '' is not limited to completely complementary sequences in at least 15 contiguous nucleotide regions, but is at least 70%, preferably at least 80%, more preferably
It is sufficient that they have a homology of 90%, more preferably 95% or more on the base sequence. Nucleotide sequence homology can be determined by the algorithm described herein.

The oligonucleotide of the present invention is useful for detecting or synthesizing the polynucleotide of the present invention. Techniques for detecting or synthesizing a target polynucleotide using an oligonucleotide as a probe or primer are known. For example, Northern blotting using mRNA as a target polynucleotide is a typical method for detecting RNA. mRN
By performing RT-PCR using A as a template, the polynucleotide of the present invention can be synthesized. In addition, the presence or absence of mRNA and its expression level can be known using the presence or absence and amount of the synthetic product as an index. Alternatively, the polynucleotide of the present invention expressed in eosinophils can be detected by in situ hybridization.

Further, the polynucleotide encoded by the polynucleotide of the present invention can be produced as a recombinant. More specifically, a transformant is obtained by incorporating the coding region of the polynucleotide containing the nucleotide sequence of SEQ ID NO: 1 into a known expression vector and transforming it into an appropriate host. Alternatively, a transformant can be obtained by integrating a polynucleotide containing the coding region into the genome of an appropriate host. The protein of the present invention can be obtained by culturing the obtained transformant under conditions under which the introduced polynucleotide of the present invention can be expressed, and collecting the expression product. The expression product can be converted into a purified protein by a known method.

In addition, the present invention relates to a protein encoded by the polynucleotide of the present invention. The protein of the present invention is useful as an index for diagnosing allergic diseases such as atopic dermatitis. Alternatively, since the polynucleotide of the present invention increases expression in eosinophils in remission, the protein itself encoded by the polynucleotide can be expected to have a therapeutic effect on allergy. Alternatively, the protein of the present invention or a fragment thereof is useful as an immunogen for preparing an antibody against the protein of the present invention. Techniques for obtaining antibodies using a given immunogen are known. That is, the protein or a fragment thereof is mixed with an appropriate adjuvant to prepare an immunogen, and the immunized animal is inoculated. The immunized animal is not limited. Representative immunized animals include animals such as mice, rats, rabbits, and goats. Blood is collected after confirming an increase in the antibody titer, and serum is collected to obtain an antiserum. Alternatively, a purified antibody can be obtained by further purifying the IgG fraction. For purification of the antibody, techniques such as ammonium sulfate precipitation, ion exchange chromatography, protein A-bound Sepharose, and immunoaffinity chromatography using the protein of the present invention as a ligand can be used.

Furthermore, a monoclonal antibody can be obtained by transforming the antibody-producing cell by cell fusion or the like and cloning the antibody-producing cell. Alternatively, a method of obtaining a gene of an antibody-producing cell and constructing a humanized antibody or a chimeric antibody is also known. The antibody thus obtained is useful as a tool for immunologically measuring the protein of the present invention. The protein of the present invention can be measured immunologically by bringing the protein of the present invention into contact with the antibody and observing the immunological reaction between the two. Many known assay formats can be applied to the immunological measurement of the present invention. For example, a protein contained in serum or the like can be measured by a technique such as ELISA. Alternatively, in order to detect a protein expressed in eosinophils using an antibody, an immunohistological technique, FACS using a fluorescent-labeled antibody, or the like can be used.

In the present invention, allergic diseases (aller
gic disease) is a general term for diseases associated with allergic reactions. More specifically, it can be defined that an allergen is identified, a deep link is established between exposure to the allergen and the development of a lesion, and the lesion has an immunological mechanism. Here, the immunological mechanism means that leukocyte cells show an immune response by allergen stimulation. Examples of the allergen include a mite antigen and a pollen antigen. Representative allergic diseases include bronchial asthma, allergic rhinitis, atopic dermatitis, hay fever, and insect allergy. Allergic diathesis is a genetic factor transmitted from a parent with an allergic disease to a child. An allergic disease that develops familially is also called an atopic disease, and a genetically transmitted factor that causes it is atopic predisposition. Atopic dermatitis is a generic term given to atopic diseases, particularly those accompanied by skin inflammatory conditions.

In the present invention, the expression level of the gene "2217-09" is expressed in eosinophils of a patient in remission with a decrease in eosinophils in comparison with the exacerbation and remission of atopic dermatitis. Showed an increase. Therefore, allergic diseases can be tested using the expression level of the “2217-09” gene as an index. The test for allergic disease in the present invention includes, for example, the following tests. For example, the invention allows testing to determine whether allergic symptoms are improving. The gene “2217-09” of the present invention showed an increased expression level particularly in eosinophils of atopic dermatitis patients in remission with a decrease in eosinophils. Since eosinophils are a representative clinical marker of atopic dermatitis, a clinical marker associated with its reduction is useful for determining the therapeutic effect. More specifically, an increase in the expression of the gene “2217-09” of the present invention indicates that improvement of allergic diseases is progressing with a decrease in eosinophils. The severity of atopic dermatitis correlates with eosinophil counts, and aggressive reduction of eosinophil counts may lead to treatment. Measure this gene, which is specifically induced in eosinophils as the number decreases,
Finding methods and substances that actively induce cells from outside may lead to new treatments for atopic dermatitis and diagnostics to evaluate them.

In the present invention, the expression level of the “2217-09” gene includes transcription of these genes into mRNA and translation into proteins. Therefore, the method for testing an allergic disease according to the present invention is performed based on the comparison of the expression intensity of mRNA corresponding to the gene or the expression level of the protein encoded by the gene.

The measurement of the expression level of the "2217-09" gene in the test for allergic disease in the present invention can be carried out according to a known gene analysis method.
Specifically, for example, a hybridization technique using a nucleic acid that hybridizes to the gene as a probe or a gene amplification technique using a DNA that hybridizes to the gene of the present invention as a primer can be used.
The probe or primer used for the test of the present invention includes a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or at least one complementary to a complementary strand thereof.
Polynucleotides containing 5 nucleotides can be utilized. Here, “complementary strand” refers to A: T (for RNA,
U) refers to one strand of the double-stranded DNA consisting of G: C base pairs with respect to the other strand. Further, “complementary” means at least
It is not limited to a completely complementary sequence in 15 consecutive nucleotide regions, and is at least 70%, preferably at least 80%, more preferably 90%, and still more preferably 95%.
It is only necessary to have the above homology on the base sequence. The homology of the nucleotide sequences can be determined by an algorithm such as BLASTN.

Such a polynucleotide can be used as a probe for detecting and isolating the polynucleotide encoding the protein of the present invention, and as a primer for amplifying the polynucleotide of the present invention. is there. When used as a primer, usually 15
It has a chain length of bp to 100 bp, preferably 15 bp to 35 bp. When used as a probe, it has at least a part or the entire sequence of the polynucleotide of the present invention,
DNA with a chain length of at least 15 bp is used. When used as a primer, the 3′-side region needs to be complementary, but a restriction enzyme recognition sequence, a tag, or the like can be added to the 5′-side.

The "polynucleotide" in the present invention can be DNA or RNA. These polynucleotides may be synthetic or natural. Probes used for hybridization
Usually, labeled DNA is used. As the labeling method, for example, the following method can be shown. The term oligonucleotide means a polynucleotide having a relatively low degree of polymerization among polynucleotides. Oligonucleotides are included in polynucleotides. Labeling by nick translation using DNA polymerase I Terminal labeling using polynucleotide kinase Fill-in labeling using Klenow fragment (Be
rger SL, Kimmel AR. (1987) Guide to Molecular Clon
ing Techniques, Method in Enzymology, Academic Pre
ss; Hames BD, Higgins SJ (1985) Genes Probes: A Pr
actical Approach. IRL Press; Sambrook J, Fritsch E
F, Maniatis T. (1989) Molecular Cloning: a Laborat
ory Manual, 2nd Edn. Cold Spring Harbor Laboratory
Press) Labeling by transcription using RNA polymerase (Melton D
A, Krieg, PA, RebagkiatiMR, Maniatis T, Zinn K, Gre
en MR. (1984) Nucleic Acid Res., 12,7035-7056) ・ Incorporation of modified nucleotides without radioisotopes into DNA (KrickaLJ. (1992) Nonisotopic DNA P
robing Techniques. Academic Press)

The test for allergic diseases using the hybridization technique can be carried out using, for example, Northern hybridization, dot blotting, a method using a DNA microarray, or the like. Furthermore, gene amplification techniques such as the RT-PCR method can be used. In the RT-PCR method, the gene amplification process
By using the PCR amplification monitoring method, it is possible to perform more quantitative analysis on the expression of the gene of the present invention.

In the PCR gene amplification monitoring method, a probe labeled on each end with a different fluorescent dye that cancels each other's fluorescence is used to hybridize to a detection target (a reverse transcript of DNA or RNA). PCR reaction proceeds and Taq
5'-3 'exonuclease of polymerase (exonuclea
se) When the same probe is decomposed due to the activity, the two fluorescent dyes are separated and the fluorescence is detected. This fluorescence is detected in real time. Simultaneous measurement of a standard sample with a clear copy number for the detection target enables
Determine the number of copies to be detected in the target sample by the number of linear cycles of PCR amplification (Holland, PM et al., 19
91, Proc. Natl. Acad. Sci. USA 88: 7276-7280; Liva
k, KJ et al., 1995, PCR Methods and Application
s 4 (6): 357-362; Heid, CA et al., Genome Researc
h 6: 986-994; Gibson, EMU et al., 1996, Genome
Research 6: 995-1001). In the PCR amplification monitoring method, for example, ABI PRISM7700 (PE Biosystems)
Can be used.

The method of the present invention for detecting an allergic disease can also be carried out by detecting the protein encoded by the above-mentioned gene "2217-09". As such a test method, for example, a Western blotting method, an immunoprecipitation method, an ELISA method, or the like using an antibody that binds to a protein encoded by these genes can be used.

An antibody that binds to the "2217-09" protein used for this detection can be obtained using techniques well known to those skilled in the art. Antibodies used in the present invention are polyclonal antibodies,
Alternatively, a monoclonal antibody (Milstein C, et al., 198
3, Nature 305 (5934): 537-40).
For example, a polyclonal antibody against the protein of the present invention is obtained by extracting blood of a mammal sensitized with an antigen and separating serum from the blood by a known method. As the polyclonal antibody, serum containing the polyclonal antibody can be used. Alternatively, if necessary, a fraction containing a polyclonal antibody can be further isolated from the serum. In order to obtain a monoclonal antibody, immune cells are removed from a mammal sensitized with the above antigen, and are fused with myeloma cells or the like. The hybridoma thus obtained is cloned, and the antibody is recovered from the culture to obtain a monoclonal antibody.

For detection of the "2217-09" protein, these antibodies may be appropriately labeled and used. Further, without labeling the antibody, a substance that specifically binds to the antibody, for example, protein A or protein G can be labeled and detected indirectly. As a specific detection method, for example, EL
The ISA method can be mentioned. A protein or a partial peptide thereof used as an antigen can be prepared, for example, by incorporating the gene or a part thereof into an expression vector, introducing this into an appropriate host cell, preparing a transformant, and culturing the transformant to obtain a recombinant. The protein can be obtained by expressing the protein and purifying the expressed recombinant protein from a culture or a culture supernatant. Alternatively, an oligopeptide consisting of an amino acid sequence encoded by these genes or a partial amino acid sequence of the amino acid sequence encoded by full-length cDNA obtained based on SEQ ID NO: 1 is chemically synthesized and used as an immunogen. Can also.

In the present invention, eosinophil cells of a subject are used as a sample. Eosinophil cells can be prepared from peripheral blood by a known method. That is, for example, heparin-collected blood is fractionated by centrifugation to separate white blood cells. Next, granulocyte cells are separated from the leukocyte cells by centrifugation using Ficoll or the like, and further, eosinophil cells can be separated by depletion of neutrophils using the CD16 antibody. If the separated eosinophils are destroyed to form a lysate, it can be used as a sample for immunological measurement of the protein. Alternatively, if mRNA is extracted from this lysate, it can be used as a sample for measuring mRNA corresponding to the gene. For extraction of eosinophil lysate and mRNA, it is convenient to use a commercially available kit. Alternatively, the expression level of the gene to be used as an index in the present invention may be measured for whole blood or peripheral blood leukocyte populations without separating eosinophils. In this case, the change in the expression level of the gene in the cell can be obtained by correcting the measured value. For example, based on a measured value of the expression level of a gene (housekeeping gene) which is specifically expressed in eosinophils and whose expression level does not largely vary irrespective of the state of the cell, the expression of a gene to be used as an index in the present invention Level measurements can be corrected. When the protein to be detected is a secretory protein, the expression level of the gene encoding the protein is determined by measuring the amount of the target protein contained in a body fluid sample such as blood or serum of the subject. Can be compared.

As a result of the examination of the allergic disease according to the present invention, particularly when the expression level of the gene of the present invention is increased in a patient with an allergic disease such as atopic dermatitis, eosinophils are decreased. It is estimated that allergic symptoms are improving.

Further, the present invention provides the following (a) or (b)
Allergic disease model animals comprising a transgenic non-human animal having a reduced expression level of the polynucleotide of (1) in eosinophil cells. (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above.

In the present invention, the expression level is reduced by
A knockout state in which the function of a gene is substantially lost is included. In the present invention, a state in which the function of a gene is substantially lost refers to a state in which the expression of a gene or the activity of a protein encoded by the gene cannot be found. The expression level of the gene can be confirmed, for example, by quantitative PCR as described in Examples.
Further, the fact that the activity of the protein as a translation product cannot be substantially found can be confirmed by comparing with the normal state. Such transgenic animals include, for example, animals in which a mutation has been introduced into the coding region of a gene and an amino acid sequence has been mutated or a stop codon has been artificially generated to render the original protein activity incapable of being expressed. be able to. Mutations in the amino acid sequence can indicate substitutions, deletions, insertions, or additions. In addition, by mutating the transcriptional regulatory region of the gene,
The expression itself of the gene of the present invention can also be regulated.

Methods for obtaining a transgenic animal using a specific gene are known. That is, a method in which a gene and an egg are mixed and treated with calcium phosphate, a method in which a gene is directly introduced into a nucleus of a pronuclear stage egg with a micropipette under a phase-contrast microscope (microinjection method, US Pat. No. 4,873,191), A transgenic animal can be obtained by a method using embryonic stem cells (ES cells) or the like. In addition, a method of inserting a gene into a retroviral vector and infecting an egg, a method of introducing a gene into an egg via sperm, and a sperm vector method have also been developed.
The sperm vector method is a genetic recombination method in which a foreign gene is introduced into sperm cells by attaching a foreign gene to sperm or by a method such as electroporation, and then fertilizing the egg to introduce the foreign gene (M. Lavitranoet et Cel
l, 57, 717, 1989).

The transgenic animal of the present invention can be prepared using any vertebrate other than human. Specifically, mice, rats, rabbits, miniature pigs,
In vertebrates such as goats, sheep, and cattle, transgenic animals have been produced in which various genes have been introduced or their expression levels have been modified. The transgenic animal of the present invention includes a knockout animal in which the expression of a homolog of a human gene containing the nucleotide sequence shown in SEQ ID NO: 1 in the animal species is suppressed. By observing the phenotype of the knockout animal, the function of the knocked out gene can be specifically known. The expression of the gene containing the nucleotide sequence shown in SEQ ID NO: 1 was increased in eosinophils during remission with reduction of eosinophils in atopic dermatitis in humans. Therefore, an animal in which the homolog is knocked out is useful as a model animal for an allergic disease. For example, if the knockout animal according to the present invention develops dermatitis or shows a change in a measured value associated with any allergic disease, a screening system for searching for a compound having an action to restore it can be constructed. In this case, the action point of the drug is a gene product that is different from the 2217-09 gene and is involved in the allergic disease.

[0037] Methods for producing knockout animals are known. For example, a method is known in which homologous recombination is performed using embryonic stem cells in mice, and embryonic stem cells in which one allele has been modified or disrupted are selected to produce a knockout animal. For example, a chimeric animal in which cells derived from embryonic stem cells and cells derived from embryos are mixed is obtained by injecting embryonic stem cells whose genes have been manipulated into a fertilized egg. When this chimeric animal (a chimera is a single individual formed from somatic cells based on two or more fertilized eggs) is bred to a normal mouse, a heterozygote in which all of one allele has been altered or destroyed The body can be made. Furthermore, homozygotes can be produced by crossing heterozygotes. The transgenic animals according to the present invention include both these heterozygotes and homozygotes.

[0038] Homologous recombination refers to recombination occurring between two genes having the same or very similar nucleotide sequences in the gene recombination mechanism. PCR can be used to select cells that have undergone homologous recombination. A PCR reaction was performed using a part of the inserted gene and a part of the region expected to be inserted as primers, and it was found that homologous recombination had occurred in the cells in which the amplification product was formed. When homologous recombination is caused to a gene expressed in embryonic stem cells, a neomycin resistance gene can be linked to the introduced gene, and the cells can be selected by making the cells neomycin resistant after introduction. And their variations can be readily selected. Transgenic animals according to the present invention, in addition to screening for drugs for treating or preventing allergic diseases described below, elucidation of the mechanism of allergic disease,
Further, it is useful for testing the safety of the screened compound.

According to the present invention, the aforementioned gene "2217-09"
Was found to be elevated in eosinophils of patients with atopic dermatitis in remission with eosinophil depletion. Therefore, animals in which the expression levels of these genes or genes functionally equivalent to these genes in eosinophil cells are artificially reduced can be used as model animals for allergic diseases. The decrease in the expression level in eosinophils includes a decrease in the expression level of the gene in the whole leukocyte population. That is,
The expression level of the gene is reduced not only by eosinophils but also by the expression level of the gene in the whole leukocyte population. In the present invention, a functionally equivalent gene means any of the genes described in the above (a) or (b). As the model animal in the present invention, for example, the above-mentioned transgenic animal or the like can be used.

The present invention further relates to a method for detecting the effect of a candidate compound on the expression level of the polynucleotide of the present invention. In the present invention, the expression level of the “2217-09” gene is significantly increased in eosinophils of atopic dermatitis patients in remission with a decrease in eosinophils. Therefore, a therapeutic drug for allergic diseases can be obtained by selecting a compound capable of increasing the expression level based on a method for detecting the effect on the expression level of these genes. In the present invention, the compound that increases the expression level of a gene is a compound that has an action of inducing any of the steps of gene transcription, translation, and protein activity expression. The method for detecting the effect of the candidate compound on the expression level of the polynucleotide of the present invention can be performed in vivo or in vitro. To detect effects in vivo, appropriate test animals are used. As the test animal, for example, an allergic disease model animal or an allergic disease model animal consisting of a transgenic non-human animal in which the expression of the gene described in (a) or (b) in eosinophil cells is suppressed is used. be able to. The detection of the effect on the expression level in vivo according to the present invention can be performed, for example, according to the following steps. (1) a step of administering a candidate compound to a test animal, (2) a step of measuring the expression level of the polynucleotide according to (a) or (b) in eosinophil cells of the test animal,

As a test animal in the detection method of the present invention, for example, a transgenic animal in which the expression of 2217-09 is reduced by expressing the antisense of 2217-09 can be used. Such a transgenic animal can be created, for example, as follows. That is, first, a full-length sequence or a partial sequence of the sequence of 2217-09 is incorporated in a reverse direction downstream of an appropriate promoter sequence to construct an antisense RNA expression vector. When this expression vector is introduced into the nucleus, a transgenic animal expressing the 2217-09 antisense and having reduced expression of the 2217-09 gene can be obtained. When a promoter whose transcription is regulated by a substance such as an appropriate drug is used as the promoter used in the expression vector, the expression level of the 2217-09 gene in the transgenic animal can be adjusted by administering the substance.

By administering a drug candidate compound to the model animal in which the expression of the 2217-09 gene has been reduced in this way, and monitoring the effect of the compound on the expression of the 2217-09 gene in eosinophils of the model animal, The effect of the drug candidate compound on the expression level of the 2217-09 gene can be detected. Further, based on the result of this detection, 2217-0
If a drug candidate compound that increases the expression level of 9 genes is selected, the drug candidate compound can be screened. By such a screening, drugs involved in various forms in the expression of the 2217-09 gene can be selected. Specifically, for example, drug candidate compounds having the following action points can be found. Activation of signaling pathways leading to expression of the 2217-09 gene, 2217-09
Increased transcriptional activity of the gene, stabilization or inhibition of degradation of the transcript of the 2217-09 gene,

In vitro, for example, a method of contacting a candidate compound with cells expressing the genes described in (a) or (b) above and detecting the expression levels of these genes can be used. . Specifically, for example, it can be carried out according to the following steps. (1) a step of bringing a candidate compound into contact with cells expressing the polynucleotide described in (a) or (b); (2) a step of measuring the expression level of the polynucleotide described in (a) or (b) ,

In the present invention, cells for use in step (1) can be obtained by inserting these polynucleotides into an appropriate expression vector and introducing the vector into an appropriate host cell. Usable vectors and host cells may be any as long as they can express the gene of the present invention. As host cells in the host-vector system,
Escherichia coli, yeast, insect cells, animal cells and the like can be exemplified, and the available vectors can be appropriately selected.

As a method for introducing a vector into a host, a biological method, a physical method, a chemical method and the like can be mentioned. Examples of the biological method include a method using a viral vector, a method using a specific receptor, a cell fusion method (HVJ (Sendai virus), polyethylene glycol (PEG), an electric cell fusion method, micronucleus fusion). Method (chromosome transfer)). Examples of the physical method include a microinjection method, an electroporation method, and a method using a gene particle gun. Examples of the chemical method include a calcium phosphate precipitation method, a liposome method, a DEAE dextran method, a protoplast method, an erythrocyte ghost method, an erythrocyte membrane ghost method, and a microcapsule method.

In the detection method of the present invention, the above (a)
Alternatively, as a cell that expresses the polynucleotide described in (b), established leukocyte cells can also be used. Eol, YY-1, HL-60, TF-1, and
A leukocyte-derived cell line such as AML14.3D10 can be exemplified.
Among leukocyte cell lines, cell lines derived from eosinophils are suitable for the detection method of the present invention. Cell lines derived from eosinophils are as follows. Eol YY-1 AML14.3D10

Eol (Eol-1: Saito H et al, Establishmen
t and characterization of a newhuman eosinophilic
leukemia cell line.Blood 66, 1233-1240, 1985)
It can be obtained from Hayashibara Research Institute. Similarly, YY-1 (Oga
ta N et al, The activation od the JAK2 / STAT5 pathw
ay is commonly involved in signaling through the h
uman IL-5 receptor. Int.Arch. Allergy Immunol., Su
ppl 1, 24-27, 1997) is provided by Site Signal Laboratory. AML14.3D10 (Baumann MA et al, The AML
14 and AML14.3D10 cell lines: a long-overdue model
for the study of eosinophils and more.Stem Cell
s, 16, 16-24, 1998) is a Research Ser.
vice, VA Commercial Center Available from Paul CC at Dayton.

In addition, the undifferentiated leukocyte cell line HL-60
Clone 15 (ATCC CRL-1964) can be differentiated into eosinophils and used as an eosinophil cell line if cultured for about one week in the presence of butyric acid. Eosinophils can be distinguished morphologically by the presence of eosinophil granules in polymorphonuclear nuclei. Morphological observation is performed by Giemsa staining or Diff Quick staining. In general, human leukocyte cell lines containing eosinophils can be established by cloning immortalized cells from a leukemia patient sample. Therefore, those skilled in the art can also obtain an eosinophil cell line by a known method, if necessary.

In the screening method, first, a candidate compound is added to the established leukocyte cells. Thereafter, the expression level of the polynucleotide described in the above (a) or (b) in the established leukocyte cells is measured, and a compound that increases the expression level of the gene is selected.

As cells for the in vitro detection method, transformed cells in which the expression of the polynucleotide described in the above (a) or (b) is regulated can be used. Such transformed cells include, for example, cells transformed with an antisense expression vector for the polynucleotide. Transformed cells with the antisense expression vector can be obtained by the same principle as in the preparation of the transgenic animal. Using the obtained transformed cells, the effect of a candidate compound on the expression level of the gene can also be detected.

In the method of the present invention, the expression level of the polynucleotide described in the above (a) or (b) is
Not only the expression levels of the proteins encoded by these genes but also the corresponding mRNAs can be detected and compared. To compare expression levels by mRNA,
Instead of the protein sample preparation step, mRNA as described above
Perform the sample preparation process. Detection of mRNA or protein can be carried out by a known method as described above.

Further, based on the disclosure of the present invention, a transcription regulatory region of the gene of the present invention can be obtained, and a reporter assay system can be constructed. The reporter assay system refers to an assay system that screens for a transcription regulatory factor acting on the transcription regulatory region, using the expression level of a reporter gene expressed under the control of the transcription regulatory region as an index downstream of the transcription regulatory region. As a transcription control region, a promoter,
Examples include enhancers, and CAAT boxes and TATA boxes that are usually found in the promoter region. In addition, CAT (chloramphe
nicol acetyltransferase) gene, luciferase (luc
iferase) gene, growth hormone gene and the like can be used. The transcription regulatory region of the gene of the present invention can be obtained as follows. That is, first, based on the nucleotide sequence of the cDNA disclosed in the present invention, BAC library, screening from a human genomic DNA library such as YAC library by a method using PCR or hybridization, a genomic sequence containing the cDNA sequence
Obtain a DNA clone. Based on the obtained genomic DNA sequence,
The transcription control region of the cDNA disclosed in the present invention is estimated, and the transcription control region is obtained. The obtained transcription regulatory region is cloned so as to be located upstream of the reporter gene to construct a reporter construct. The resulting reporter construct is introduced into a cultured cell line to obtain a transformant for screening. By contacting the candidate compound with the transformant and detecting the expression of the reporter gene, the action of the candidate compound on the transcription regulatory region can be evaluated.

Based on the method of the present invention for detecting an effect on the expression level of the polynucleotide, a compound that changes the expression level of the polynucleotide can be screened. The present invention relates to a method for screening a compound that changes the expression level of the polynucleotide according to the above (a) or (b), comprising the following steps. That is, the present invention provides in vivo and / or in vi
tro, detecting the effect of the candidate compound on the expression level of the polynucleotide, and selecting a compound that increases the expression level as compared to a control, the method comprising: The present invention relates to a method for screening a compound that increases the expression level of a nucleotide. Alternatively, the present invention relates to a method for screening a compound that acts on a transcription regulatory region by a reporter assay using a transcription regulatory region of a gene containing the nucleotide sequence shown in SEQ ID NO: 1. Based on the results of the reporter assay according to the present invention, by selecting a compound that increases the expression of the reporter gene as compared with the subject, a compound that induces the expression of the gene containing the nucleotide sequence shown in SEQ ID NO: 1 is obtained. be able to.

A cell used in the method for detecting the effect of a candidate compound on the expression level of the 2090-05 gene according to the present invention, and a polynucleotide or an antibody for examining the expression level of the polynucleotide are used in combination with this method. For detection. Kits can also be combined with candidate compounds and instructions used as positive and negative controls. The kit for detecting the effect of the candidate compound on the expression level of the 2090-05 gene according to the present invention can be used as a kit for screening a compound that modifies the expression level of the 2090-05 gene.

The test candidate compounds used in these methods include compound preparations synthesized by existing chemical methods such as steroid derivatives, compound preparations synthesized by combinatorial chemistry, and extracts of animal and plant tissues or A mixture comprising a plurality of compounds, such as a microbial culture,
In addition, there may be mentioned a sample purified therefrom.

The compounds selected by the screening method of the present invention are useful as remedies for allergic diseases. The expression of the 2217-09 gene is increased in eosinophils with eosinophil depletion during the remission of atopic dermatitis. Therefore, a compound capable of enhancing the expression of this gene can be expected to have the effect of suppressing the symptoms of atopic dermatitis. The therapeutic agent for an allergic disease of the present invention,
It can be produced by mixing the compound selected by the screening method as an active ingredient with a physiologically acceptable carrier, excipient, diluent, or the like. The therapeutic agent for an allergic disease of the present invention,
It can be administered orally or parenterally for the purpose of improving allergic symptoms. As oral preparations, dosage forms such as granules, powders, tablets, capsules, solvents, emulsions, and suspensions can be selected. Injections include subcutaneous injections, intramuscular injections, intraperitoneal injections, and the like.

The dosage varies depending on the age, sex, weight and condition of the patient, the therapeutic effect, the administration method, the treatment time, and the type of active ingredient contained in the pharmaceutical composition. 0.1 mg to 500 mg per serving
, Preferably in the range of 0.5 mg to 20 mg. However, since the dose varies depending on various conditions, a dose smaller than the above dose may be sufficient, or a dose exceeding the above range may be required. Hereinafter, the present invention will be described specifically with reference to Examples.
The present invention is not limited to these embodiments.

[0058]

[Example 1] Differential display analysis Comparison of blood cells isolated from peripheral blood during the exacerbation period in the same patient with atopic dermatitis and the remission period due to drug treatment or the like, and a new expression with variable expression Screening was performed with the aim of finding therapeutic-related genes or genes useful for diagnosis. (1) Subjects The profiles of seven patients with atopic dermatitis from which blood was collected are shown in Table 1. Allergen non-specific (Total Ig
E), tick and cedar-specific IgE were measured by the EIA method. That is, the test serum is reacted with the cap to which the anti-human IgE antibody is bound, and the allergen non-specific IgE in the serum is reacted.
Antibodies or ticks and cedar-specific IgE antibodies were bound.
Next, a β-D-galactosidase-labeled anti-human IgE antibody and a substrate solution (4-methylumbelliferyl-β-D-galactopyranoside) were added and reacted to generate a fluorescent substance. The reaction was stopped by adding a reaction stop solution, and the antibody concentration was determined from the fluorescence intensity of the standard IgE measured at the same time. LDH is measured by the UV method (W
According to the roblewski-La Due method), the decrease rate of NADH due to the reaction between pyruvate and NADH was calculated from the decrease in absorbance. LD
For measurement of H value, L type Wako LDH (Wako Pure Chemical) and 7170
An automatic mold analyzer (Hitachi) was used. The number of eosinophils was determined by microscopy and an automatic blood cell analyzer SE-
It was measured by 9000 (RF / DC impedance method, manufactured by Sysmex).

[0059]

[Table 1]

(2) Differential display analysis A 3% dextran solution was added to whole blood collected from a patient.
It was left at room temperature for 30 minutes to sediment erythrocytes. The upper leukocyte fraction is collected and placed on Ficoll-Paque PLUS (Amersham Pharmacia Biotech) at 1500 rp.
and centrifuged at room temperature for 30 minutes. The granulocyte fraction collected in the lower layer was reacted with CD16 antibody magnetic beads at 4 ° C. for 30 minutes, and cells eluted without being trapped by separation using MACS were used as eosinophils in the experiment. Eosinophils prepared as above
n (Nippon Gene; Wako Pure Chemical Industries, Ltd.)
RNA was isolated according to the protocol attached to sogen. Chloroform was added, and the mixture was centrifuged with stirring to collect an aqueous layer. Next, isopropanol was added, and the mixture was centrifuged with stirring to collect the total RNA in the precipitate. The recovered total RNA was added to DNase (Nippon Gene; Wako Pure Chemical Industries) and reacted at 37 ° C for 15 minutes to give phenol.
-The RNA was recovered by chloroform extraction and ethanol precipitation. Using the total RNA prepared in this manner, a fluorescent differential display (Fluorescent Differential Dis
play, abbreviated as “DD”). DD analysis was performed according to the method described in the literature (T. Ito et al., 1994, FEBS Lett. 351: 231-236). First, total RNA was reverse transcribed to obtain cDNA. For the primary DD-PCR reaction, cDNA was prepared using 0.2 μg of total RNA for each of the three anchor primers. For the second DD-PCR reaction, cDNA was prepared using 0.4 μg of RNA for each of the three anchor primers.
Each cDNA was diluted to a final concentration equivalent to 0.4 ng / μl RNA and used for the experiments. A DD-PCR reaction was performed using cDNA equivalent to 1 ng RNA per reaction. Table 2 shows the composition of the reaction solution.

[0061]

[Table 2] ━━━━━━━━━━━━━━━━━━━━━━━ cDNA (equivalent to 0.4 ng / μl RNA) 2.5 μl Optional primer (2 μM) 2.5 μl 10 × AmpliTaq PCR buffer 1.0 μl 2.5 mM dNTP 0.8 μl 50 μM anchor primer 0.1 μl (GT15A, GT15C, GT15G) Gene Taq (5U / μl) 0.05 μl AmpliTaq (5U / μl) 0.05 μl dH ₂ O 3.0 μl ─────────総 Total volume 10.0μl ━━━━━━━━━━━━━━━━━━━━━━━

The PCR reaction conditions were as follows: “95 ° C. for 3 minutes, 40 ° C. for 5 minutes,
1 cycle of 2 ° C for 5 minutes, followed by 94 ° C for 15 seconds, 40 ° C for 2 minutes,
72 ° C for 1 minute after 30 cycles, 72 ° C for 5 minutes, and then continuously
4 ° C. The primer pairs used were GT15A (SEQ ID NO: 2) and GT15C (SEQ ID NO:
3), and arbitrary primers for GT15G (SEQ ID NO: 4), AG 1-110, AG 111-199, and AG 2 respectively.
By combining 00 to 287, a total of 287 sets of reactions were performed. As an arbitrary primer, an oligomer consisting of 10 nucleotides having a GC content of 50% was designed, synthesized, and used.

For gel electrophoresis, a 6% denaturing polyacrylamide gel was prepared, 2.5 μl of the sample was applied, and 2
Run for 10 minutes. Thereafter, the gel plate was scanned using a fluorescence image analyzer FMBIO II manufactured by Hitachi, and a migration image was obtained by fluorescence detection. Both exacerbation and remission samples were run side-by-side, and gene bands with variable expression in the same direction in most patients were visually determined and excised for TA cloning and sequencing. As a result, the eosinophil gene whose expression is significantly increased in the remission period compared with the exacerbation period (DD analysis band ID 2217-09; hereafter, this gene was referred to as “2217-0
9 "). The primer set used for amplification of band ID 2217-09 is shown below. Also, 2217-09 D
The base sequence of the D band is shown in SEQ ID NO: 14.

Band ID: 2217-09 Fragment length: 156 bp (excluding primer sequence) Anchor primer: GT15C Optional primer name: AG00146 Optional primer sequence: ATCGAACTGC (SEQ ID NO: 5)

(3) Expression analysis In order to quantitatively confirm the expression level of the 2217-09 gene, a quantitative PC
R performed. The primer and TaqMan probe used for the measurement with ABI 7700 were obtained from Primer Express (PE) based on the sequence information obtained by the differential display method.
Biosystems). TaqMan probe
The 5 'end is FAM (6-carboxy-fluorescein) and the 3' end is
Labeled with TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine). 2217-09 forward primer (SEQ ID NO: 6) GGAACTGCACCCATACAGACTT 2217-09 reverse primer (SEQ ID NO: 7) TTACAGGCATGAGCCACCA 2217-09 TaqMan probe (SEQ ID NO: 8) TTCACTTCAAGAAATACAGGGTACGGGCTG

As a template, a cDNA reverse transcribed from total RNA using poly T (12 to 18 mer) as a primer was used. For a standard curve for calculating the copy number, a plasmid clone containing a nucleotide sequence region amplified by both primers was prepared for each gene, and the reaction was performed using the serial dilution as a template.
The composition of the reaction solution for monitoring the PCR amplification is shown in Table 3.

[0067]

[Table 3] Reaction composition of ABI-PRISM 7700 (reaction volume per well) ━━━━━━━━━━━━━━━━━━━━━ Sterile distilled water 25.66 (μL) 10x TaqMan buffer A 5 25 mM MgCl ₂ 7 dATP (10 mM) 1.2 dCTP (10 mM) 1.2 dGTP (10 mM) 1.2 dUTP (10 mM) 1.2 Forward Primer (100 μM) 0.15 Reverse Primer (100 μM) 0.15 TaqMan probe (6.7 μM) 1.49 AmpliTaq Gold (5U / μL) 0.25 AmpErase UNG (1U / μL) 0.5 Template solution 5 ───────────────────── Total volume 50 ━━━━━━━━━━━━━ ━━━━━━━━

In order to correct the difference in the cDNA concentration in the sample, the same quantitative analysis was performed on the β-actin gene as an internal standard for correction, and the correction was performed based on the copy number of those genes. And the copy number of the target gene was calculated. For the quantification of β-actin gene, human cDN
A was used as a template. Primers and probes for β-actin measurement were obtained from TaqMan β-actin Control Reagents (PE
Biosystems) was used. The base sequence is as follows. The expression level (copy / ng RNA) of “2217-09” gene corrected by β-actin is shown in Table 4 and FIG. β actin forward primer (SEQ ID NO: 9) TCA CCC ACA CTG TGC CCA TCT ACG A β actin reverse primer (SEQ ID NO: 10) CAG CGG AAC CGC TCA TTG CCA ATG G β actin TaqMan probe (SEQ ID NO: 11) 5 '-(FAM) ATGCCC-T (TAMRA) -CCCCCATGCCATCCTGCGTp-3' FAM: 6-carboxy-fluorescein TAMRA: 6-carboxy-N, N, N ', N'-tetramethylrhodamine

[0069]

[Table 4] 2217-09 gene expression level (copy / ng RNA) 患者 Patient number Exacerbation period Remission period ─────────── ───── 1 2735.26 11420.37 2 1487.03 9441.52 3 1436.17 5390.62 4 3965.53 2712.69 5 3696.06 8332.24 6 11111.59 3878.92 7 7440.18 5715.02 ━━━━━━━━━━━━━━━━━

(4) Statistical Analysis Using the above data, a parametric multiple comparison test and a nonparametric multiple comparison test were performed.
Four of the seven patients with atopic dermatitis (patient number 1,
For 2, 3, 5), the number of eosinophils decreases markedly with the transition to remission due to treatment. Blood eosinophil count is a useful clinical indicator for atopic dermatitis. Therefore,
Statistical analysis was also performed on only four patient samples (n = 4) in which the number of eosinophils was significantly reduced along with the transition to remission (n = 4). Statistical analysis, SA of the SAS SYSTEM
S Preclinical Package Version 4.0 (SAS Institute Inc.)
This was performed using

As a result, the atopic dermatitis patient 7
In 4 of the patients (patient numbers 1, 2, 3, 5), 2217-
A significant increase in 09 gene expression was observed. In these four patients, the number of eosinophils is significantly reduced with the transition to remission by treatment (see Table 1). Blood eosinophil count
It is a useful clinical indicator of atopic dermatitis. Therefore, these four patient samples (patient Nos. 1, 2, 3, 5) whose eosinophil counts decrease significantly with the transition to remission (n = 4)
Of the 2217-09 gene was statistically analyzed.
Statistical analysis, The SAS SYSTEM SAS preclinical package Ver
sion 4.0 (SAS Institute Inc.). As a result, it was confirmed that the expression significantly increased in the remission period compared with the exacerbation period (p = 0.0128). These findings indicate that the expression of this gene increases with eosinophil depletion during the remission of atopic dermatitis. This indicates that measuring the expression of this gene has diagnostic value in atopic dermatitis. This eosinophil-derived gene is medically useful as a therapeutic target or a diagnostic marker for atopic dermatitis.

Example 2 Expression of the 2217-09 Gene in Various Blood Cells The expression of the 2217-09 gene in cells isolated from peripheral blood of five healthy individuals was examined. Eosinophil (E) separation was performed as described above. Neutrophils (N) were prepared by eluting eosinophils and then eluting and recovering the cells trapped by the CD16 antibody magnetic beads out of the magnetic field. On the other hand, the monocyte fraction recovered in the intermediate layer by Ficoll centrifugation is separated into a fraction eluted by MACS CD3 antibody magnetic beads (a mixture of M: monocyte and B cell) and a fraction trapped (T cell fraction). separated. Next, the eluted fraction was purified using MACS CD14 antibody magnetic beads.
(cell fraction) and a trapped fraction (moocyte fraction), which were referred to as purified T cells, purified B cells, and purified monocytes, respectively. Eosinophils are solubilized using Isogen, neutrophils, T cells, B cells, and monocytes using RNeasy (Qiagen), and subjected to gene expression analysis after extraction of total RNA and DNase treatment (as described above). did. The used primers and probes are the same as above. Average expression level in these blood cells (AVERAGE: c
opy / ng (correction value)) was as follows. Eosinophils (E): 15134 Neutrophils (N): 7842 Basophils (B): 3423 T cells (T): 905 Monocytes (M): 613 This result shows that the 2217-09 gene is eosinophil This indicates that it is specifically expressed. This suggests that the 2217-09 gene can also be used for eosinophil markers, and for eosinophil testing and control.

[Example 3] Base sequence extension Based on the base sequence determined in Example 1, the base sequence of the gene of the present invention was analyzed by the 5 'RACE method. SMART cDNA
Cloning was performed by plaque hybridization using a phage cDNA library prepared from peripheral blood eosinophil RNA using Library Construction kit (CLONTECH). Primers designed within the sequence of c2217-09
After amplification using a plasmid containing the sequence of c2217-09 as a template using 2217-09F and 2217-09R, a purified 73 bp PCR product was used as a probe. As a result, the sequence containing the sequence of c2217-09
A clone having a 0.8 kb sequence was obtained. Next, Human L
Marathon cDNA using eukocyte Marathon Ready cDNA as template
Using the Amplification Kit (CLONTECH), the AP included in the kit
PCR with one primer and B2217-specific primer 2217-09F
Was done. When the amplified fragment was subcloned and sequenced, a sequence of about 0.1 kb including the sequence of c2217-09 was obtained. Similarly, the AP1 primer and B2217
PCR was performed with specific primer 2217-09R. When the amplified fragment was subcloned and sequenced, c2217-
A 1.6 kb sequence including the 09 sequence was obtained, for a total of 1684 bp. The determined nucleotide sequence 1684 bp is shown in SEQ ID NO: 1. Primer sequence 2217-09F: CCGTACCCTGTATTTCTTGAAGTGA (SEQ ID NO:
12) 2217-09R: GGAAGAGCAGAACACTCAGGAACT (SEQ ID NO: 1)
3)

[0074]

According to the present invention, there is provided a gene whose expression in eosinophils is different between the exacerbation period and the remission period of atopic dermatitis patients. By using the expression of the gene of the present invention as an index, it has become possible to carry out a test for an allergic disease and a screening for a candidate therapeutic drug. The expression level of the allergic disease-related gene provided by the present invention can be easily determined regardless of the type of allergen. Therefore, the pathology of the allergic reaction can be comprehensively grasped. In addition, the method of testing for allergy according to the present invention can analyze the expression level of peripheral blood eosinophils as a sample, and therefore has low invasiveness to patients. Moreover, regarding gene expression analysis, unlike the measurement of proteins such as ECP, highly sensitive measurement using a small amount of sample is possible. Gene analysis technology has been increasing in throughput and lowering its price year by year. Therefore, the method for testing allergies according to the present invention comprises:
In the near future, it is expected to become an important bedside diagnostic method. In this sense, the diagnostic value of these disease-related genes is high. Furthermore, the screening method of the present invention is carried out using a gene closely related to increase and decrease in eosinophils, which is a typical clinical marker of atopic dermatitis, as an index. Therefore, compounds that can be found by this screening method are expected to be useful for controlling a wide range of allergic disease states.

[0075]

[Sequence List] SEQUENCE LISTING <110> Genox Research, Inc. <120> Method for examination for allergosis <130> G1-A0001 <140> <141> <160> 14 <170> PatentIn Ver. 2.1 <210> 1 < 211> 1684 <212> DNA <213> Homo sapiens <400> 1 gtttgcagtc tggggtgcat ggttttgttt tttttaaacg ctgtgacagt ttgttgggtg 60 gtatctatgc agtttttgtt ataattgtgg tgaccaccat aaccagatag agaggggttg 120 atttggtaac ccagccttac gtgcggtggg ttggttatac cctttctagg ctcctggaga 180 agtaatcgaa attgaaaccg accgctttcc ttcccacctg cctgcatata cgtcagcaca 240 cacataacac taatggttct agaacctgtt cttcaaattc ctgaagtctg ttgagcagaa 300 cctgtggtca cattgtacct ggggctagag acttaagggg caagcagcat aggagagaat 360 tgctgtttct tctgttgggt cgtgtaataa aaacaatgga accttttcag aagttcacgc 420 tagaaacctg aacttgttct tcaacctgca ggagcttatt gtctgttaaa ttgcagagat 480 tacctatgtt acaggcttaa attatagatg tgaagatggt aaagggagac actattttaa 540 tcaaaagctt cctgggtaca aagctaatga gaggaaaaat tacacatttt atcaagctct 600 ttttcaagta aagaatagct ttcttttttc atctggcttc ttgcctgacc ttctcccctt 660 cccctaaatg gtgagaggaa ggagagcttg cagatagatt ttccatatcg taggggattt 720 ttatatctgg gaagcacagc atttcatatt tataggaggg tgtatattgc caaatgggat 780 atttggcatt acgagtcatt tccagctgag agagtaagga tgcagcctgg aggggaaaat 840 agagacaaaa gaggtagagg agaaagaaag gaaaaggagg aagtaatggg aatcttttag 900 aatatagact gataagccaa aggtctccaa atggaaagag atgcttacca aggatcagtt 960 ctatttcatt gtgtgaagag aaatttcctg tcctccctac actgcatgat ctgaatttaa 1020 gtcagtgtta gaaataggcc caatttgtag aaaacgaaga taaaaattgt ggagaatata 1080 caaagtttta gtgttcaaga gacctgaatt tatagagagc attttaaaca catcattcat 1140 tgctgctggt tacctagtgc tgcttctgaa gacacttgaa tttaccttaa gttcccatta 1200 ttgagtactt gtcctgttct ttaggggtga gcttttcctt gctttgtgat agggagagtt 1260 atttctaagg gaaaggaatg taccctgtat ttctttcttt ttcttttctt tttttttttt 1320 tttgagacag agtcttgctc tcttgcccag gctggaatac agtggggtga tcttggctca 1380 ctgcaacctt tgcctcctgg gttcaagtga tcctcctgcc tcagcctcct gagtagctgg 1440 gactataggc gcctgccacc acacccggct aatttttgta tttttagtag agatggagtt 1500 tcaccatgtt ggccaggttg gtctcgaact gctgacctca agtgataaag tgctgggatt 1560 acaggcatga gccaccacgc ccagcccgta ccctgtattt cttgaagtga agaatataaa 1620 gtctgtatgg gtgcagttcc Tgagtgttct gctcttccct aaattttata 1st> <tg> <tt> attachment> artificially synthesized primer sequence <400> 2 gttttttttt tttttta 17 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 3 gttttttttt ttttttc 17 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 4 gttttttttttt ttttttg 17 <210> 5 <211> 10 < 212> DNA <213> Artificial Sequence <400> 5 atcgaactgc 10 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 6 ggaactgcac ccatacagac tt 22 <210> 7 <211> 19 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 7 ttacaggcat gagccacca 19 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized probe sequence <400> 8 ttcacttcaa gaaatacagg gtacgggctg 30 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 9 tcacccacac tgtgcccatc tacga 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 10 cagcggaacc gctcattgcc aatgg 25 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (7) <223> Label TAMRA <400> 11 atgccctccc ccatgccatc ctgcgt 26 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 12 ccgtaccctg tatttcttga agtga 25 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 13 ggaagagcag aacactcagg aact 24 <210> 14 <211> 156 <212> DNA <213> Homo sapiens <400> 14 acttaagcta aaaaaatata taaactttag ggaagagcag aacactcagg aactgcaccg gg tgattg ggattgattcggtcattgattcggtcattg 120 atgcctgtaa tcccagcact ttatcacttg aggtca 156

[Brief description of the drawings]

FIG. 1 shows the results of patients with atopic dermatitis (patient numbers 1 to 7).
2217 corrected by beta-actin in exacerbations and remissions
The figure which shows -09 gene expression level (copy / ng RNA).

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 37/08 A61P 37/08 4C084 C07K 14/47 C07K 14/47 4C086 16/18 16/18 4H045 C12N 1 / 15 C12N 1/15 1/19 1/19 1/21 1/21 5/10 C12P 21/02 C 15/09 ZNA C12Q 1/02 C12P 21/02 G01N 33/15 Z C12Q 1/02 33/50 Z G01N 33/15 C12P 21/08 33/50 C12N 5/00 A // C12P 21/08 B 15/00 ZNAA (72) Inventor Ryoichi Hashida Infant, National Children's Hospital 3-35-31 Taishido, Setagaya-ku, Tokyo Inside the Medical Research Center Inside the Genox Drug Discovery Institute Inc. (72) Inventor Kaoru Ogawa 3-35-31 Taishido, Setagaya-ku, Tokyo National Children's Medical Research Center, Inc. Inside Genox Drug Discovery Research Laboratory (72) Inventor Masaya Obayashi 3-6-6 Asahimachi, Machida-shi, Tokyo Kyowa Fermentation Industry Co., Ltd. Tokyo Research Laboratory (72) Inventor Takeshi Nagasu 5-1 Tokodai, Tsukuba-shi, Ibaraki Pref. -3 Eisai Co., Ltd. Tsukuba Research Laboratories (72) Inventor Gozo Tsujimoto 3-35-31 Taishido, Setagaya-ku, Tokyo F-term (reference) 2G045 AA34 AA35 BB10 CA15 CB01 DA13 FA11 FB02 FB07 GC15 4B024 AA11 BA80 CA04 CA09 CA11 DA01 DA02 DA05 DA11 EA04 GA11 GA23 HA14 HA15 4B063 QA01 QA07 QA18 QA19 QQ03 QQ52 QR32 QR42 QR55 QR62 QR77 QS10 QS13 QS16 QS25 QS35 AA94Y AB01 BA01 BA06 CA24 CA46 4C084 AA17 NA14 ZB132 4C086 AA01 EA16 MA01 MA04 NA14 ZB13 4H045 AA10 AA11 AA20 AA30 CA42 DA75 DA76 EA50 FA74

Claims (25)

[Claims] 1. A method for testing an allergic disease, comprising the following steps: a) a step of measuring the expression level of a gene containing the nucleotide sequence of SEQ ID NO: 1 in eosinophil cells of a subject; b) a step of comparing the expression level of the gene in eosinophil cells of a healthy subject 2. The test method according to claim 1, wherein the allergic disease is atopic dermatitis. 3. The method according to claim 1, wherein the expression level of the gene is measured by cDNA PCR. 4. A reagent for testing an allergic disease, comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or an oligonucleotide having a nucleotide sequence complementary to a complementary strand thereof and having a length of at least 15 bases. . 5. A candidate compound comprising the following step (a):
Or a method for detecting the effect on the expression level of the polynucleotide according to (b). (1) A step of contacting a candidate compound with a cell expressing the polynucleotide described in (a) or (b) below: (a) A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1. (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. (2) measuring the expression level of the polynucleotide according to (a) or (b), 6. The method according to claim 5, wherein the cells are established leukocytes. 7. A candidate compound comprising the following step (a):
Or a method for detecting the effect on the expression level of the polynucleotide according to (b). (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. (1) a step of administering a candidate compound to a test animal; and (2) a step of measuring the expression intensity of the polynucleotide according to (a) or (b) in eosinophil cells of the test animal; 8. The method according to claim 5, further comprising detecting an effect on the expression level and selecting a compound that increases the expression level as compared to a control. A method for screening a compound that increases the expression level of the polynucleotide according to a) or (b). 9. The method according to claim 9, wherein the candidate compound comprises the following steps:
A method for detecting an effect on the activity of a transcription regulatory region of a gene comprising the nucleotide sequence according to 1. (1) contacting a candidate substance with a cell into which a vector containing a transcription regulatory region of a gene containing the nucleotide sequence of SEQ ID NO: 1 and a reporter gene expressed under the control of the transcription regulatory region has been introduced; and (2) a step of measuring the activity of the reporter gene; 10. The method according to SEQ ID NO: 1, comprising the step of detecting the effect of a candidate compound on the activity by the method of claim 9, and selecting a compound that increases the activity as compared to a control. A method for screening a compound that increases the activity of a transcription regulatory region of a gene containing the nucleotide sequence of 11. A vector comprising a transcription regulatory region of a gene comprising the nucleotide sequence of SEQ ID NO: 1, and a reporter gene expressed under the control of the transcription regulatory region. 12. A cell into which the vector according to claim 11 has been introduced. (13) A therapeutic agent for an allergic disease, comprising as an active ingredient a compound obtainable by the screening method according to (8) or (10). 14. A therapeutic agent for an allergic disease, comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 or a part thereof as an antisense DNA as a main component. 15. A polynucleotide according to the following (a) or (b). (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. 16. A protein encoded by the polynucleotide according to claim 15. 17. A vector which carries the polynucleotide according to claim 15 in an expressible manner. 18. The polynucleotide according to claim 15, wherein
Or a transformed cell carrying the vector according to claim 17. 19. The method for producing a protein according to claim 16, comprising a step of culturing the transformed cell according to claim 18 and collecting an expression product thereof. (20) an antibody against the protein according to (16); 21. The antibody according to claim 20, and 16)
The method for immunologically measuring a protein according to claim 16, comprising a step of observing an immunological reaction of the protein according to (1). 22. A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, or an oligonucleotide having a nucleotide sequence complementary to a complementary strand thereof, wherein at least 15
Oligonucleotides with base length. 23. The method for measuring a polynucleotide according to claim 15, comprising a step of observing the hybridization between the oligonucleotide according to claim 22 and the polynucleotide according to claim 15. 24. An allergic disease model animal comprising a transgenic non-human vertebrate, wherein the expression intensity of the polynucleotide according to the following (a) or (b) is reduced in eosinophil cells. (A) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; (B) a polynucleotide that hybridizes under stringent conditions to a DNA comprising the nucleotide sequence of SEQ ID NO: 1, wherein the eosinophils are reduced during the remission of atopic dermatitis, A polynucleotide encoding a protein whose expression is increased in the above. 25. The model animal according to claim 24, wherein the transgenic animal is a knockout animal.