JP2002191398A - Method for examining allergic disease - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an indicator for examining allergic diseases, to provide a method for examining the allergic diseases, and a method for screening a candidate compound of a therapeutic agent for the allergic diseases, based on the indicator. SOLUTION: Eight kinds of genes stimulating tracheal epithelial cell by IL-4 or IL-3 and largely changing in expression in plural cells are acquired as an allergy-related gene. The method for examining the allergic diseases and the method for screening the compound useful for a therapy thereof are provided by using the gene expression levels in a biological sample as the indicator.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for testing allergic diseases.

[0002]

2. Description of the Related Art Bronchial asthma is a multifactorial disease.
ctorial diseases). Thus, bronchial asthma occurs through the interaction of the expression of many different genes, and the expression of these individual genes is affected by multiple environmental factors. For this reason, it has been very difficult to elucidate the specific genes that cause bronchial asthma. However, bronchial asthma is currently positioned as a chronic inflammatory disease in the airways. It has been pointed out that allergic reactions in airway mucosa and bronchial smooth muscle are closely involved in the pathogenesis of bronchial asthma. Therefore, in diagnosing bronchial asthma, it is important to understand the state of allergic reactions in these tissues. In the treatment of bronchial asthma, control of an allergic reaction becomes an issue.

[0003] On the other hand, it is considered that allergic diseases involve the expression of genes having mutations or deficiencies, and overexpression or reduction of the expression level of specific genes. In order to elucidate the role that gene expression plays in diseases, it is necessary to understand how genes are involved in pathogenesis and how external stimuli such as drugs alter gene expression.

[0004] Many patients with bronchial asthma have a predisposition to atopy accompanied by enhanced production of IgE antibodies. Although there are a variety of causes for bronchial asthma, there is no doubt that atopic predisposition causes hypersensitivity in many patients. As a mechanism of airway obstruction due to asthma attack, contraction of bronchial smooth muscle, edema of airway mucosa, and increased airway endocrine secretion are expected. A type I allergic reaction in the respiratory tract due to exposure to etiological allergens plays an important role in such airway changes.

[0005] Recently, it has been suggested that IL-4 and IL-13 have an important role in the development of bronchial asthma. Therefore, for example, genes whose expression levels are changed by IL-4 or IL-13 in airway epithelial cells or bronchial smooth muscle are considered to be related to bronchial asthma. But,
Based on such a concept, there is no report on the isolation of a gene whose expression level is specifically changed by IL-4 or IL-13.

[0006] At present, in the diagnosis of allergic diseases, interviews, family histories, and confirmation of personal illness are important factors in general. In addition, in order to diagnose allergy based on more objective information, a test method using blood as a sample and a method for observing a patient's immunological response to an allergen have been implemented. As an example of the former,
Examples include allergen-specific IgE measurement, leukocyte histamine release test, and lymphocyte blastogenesis test. The presence of allergen-specific IgE is evidence of an allergic reaction to the allergen. However, some patients may not always be able to detect allergen-specific IgE. In addition, due to its measurement principle, tests must be performed on all allergens required for diagnosis. The leukocyte histamine release test and lymphocyte blastogenesis test measure the response of the immune system to allergens in vitro.
This is the method of observation. These methods are complicated in operation. On the other hand, a method of using an immune response observed when a patient is actually brought into contact with an allergen for diagnosis of allergy (the latter) is also known. Such tests include brick tests, scratch tests, patch tests, intradermal reactions, or provocation tests. Although these tests can directly diagnose a patient's allergic reaction, they can be said to be highly invasive tests that actually expose the subject to an allergen.

[0007] In addition, test methods for proving the involvement of allergic reactions regardless of allergens have been attempted. For example, if the serum IgE level is high, it can be estimated that the patient has an allergic reaction. The serum IgE value is information corresponding to the total amount of allergen-specific IgE. Although it is easy to determine the total amount of IgE regardless of the type of allergen, IgE may be low in patients with diseases such as non-atopic bronchitis.

Therefore, there is little danger to the patient,
In addition, it would be useful to provide a marker for an allergic disease, from which information necessary for diagnosis can be easily obtained.
Since such a marker is considered to be deeply involved in the development of allergic diseases, it may be an important target not only in diagnosis but also in control of allergic symptoms.

[0009]

SUMMARY OF THE INVENTION An object of the present invention is to provide an index which makes it possible to test allergic diseases. Another object of the present invention is to provide a method for testing an allergic disease and a method for screening a candidate compound for a therapeutic drug for allergic disease, based on the index.

[0010]

[Means for Solving the Problems] Several reports have suggested that IL-4 and IL-13 are deeply involved in allergic reactions. For example, IL-4 (Yssel, H and Groux,
H: Int. Arch. Allergy Immunol., 121; 10-18, 2000)
And STAT6 (Akimoto, T. et al .: J. Exp. Med., 187, 1
537-1542, 1998), mice with knockouts lose airway hyperresponsiveness. In model mice, IL-13
It is involved in the formation of asthma-like pathologies regardless of gE production or Th2 type (Wills-Karp, M. et al .: Science, 282, 2258-226)
1, 1998; Grunig, G. et al .: Science, 282, 2261-226
3, 1998; Zhu, Z. et al .: J. Clin. Invest., 103, 77
9-788, 1999). In human airway epithelial cells and bronchial smooth muscle, IL-4 receptor and IL-13 receptor are highly expressed (Hein
zmann, A. et al .: Hum.Mol. Genet., 9: 549-559, 2
000). This suggests that these tissues are target cells for IL-4 and IL-13. On the other hand, it has been shown that SNP present in IL-4 receptor α and IL-13 is one of the genetic factors of allergic diseases (Mitsuyasu, H., et al .: Nature G
enet., 19, 119-120, 1998; Mitsuyasu, H., et al .:
J. Immunol., 162: 1227-1231, 1999; Kruse, S., et a
l .: Immnol., 96, 365-371, 1999; Heinzmann, A. et a
l .: Hum. Mol. Genet., 9: 549-559, 2000). Furthermore, it has been shown that inhibiting the action of IL-4 or IL-13 by soluble IL-4 receptor α is effective as a treatment for bronchial asthma (Borish, LC et al .: Am. J. . Respir. Cri
t. Care Med., 160: 912-922, 1999). As mentioned above,
L-4 and IL-13 have been suggested to be closely related to allergic reactions, especially respiratory symptoms. That is, IL-4 and
Genes constituting the IL-13 signaling pathway can be said to be genes closely related to allergic reactions. Thus, by isolating these genes and elucidating their relevance to allergic reactions, new targets for the treatment of allergic diseases can be found.

[0011] Based on this concept, the present inventors searched for a gene showing a change in the expression level when human bronchial epithelial cells were treated with IL-4 and IL-13.
We thought that genes related to allergic reactions could be isolated. With a similar approach, IL
Some studies have attempted to isolate genes whose expression levels are altered by treatment with IL-4 or IL-13 (Wang et al., Immunology 2
000, Seattle, May 12-16, 2000). However, in the known search method, the number of cells used for analysis is small, and the range of change in the expression level is not clear, so that specificity for IL-4 or IL-13 stimulation cannot be expected.

Therefore, the present inventors increased the number of cells to be analyzed in order to isolate genes that respond more specifically to IL-4 or IL-13 stimulation, Those with a level variation of more than twice were selected. Next, it was confirmed that the expression level of the selected gene in the airway epithelial cells stimulated with IL-4 or IL-13 was significantly reduced. Based on the above findings, the present inventors have succeeded in elucidating the presence of the following eight genes closely related to allergic diseases. NB-1 E48 antigen c-fos involucrin BENE HBp17 fibronectin and Id1

Based on the above findings, the present inventors have found that it is possible to test for allergic diseases by using these genes and the proteins encoded by these genes as indices, and have discovered the present invention. completed. In addition, the present inventors have found that a therapeutic agent for an allergic disease can be screened by using the expression levels of these genes or the activities of the proteins encoded by these genes as indicators, and completed the present invention. That is, the present invention relates to the following inspection methods and screening methods. [1] A method for testing an allergic disease, comprising the following steps: a) NB-1, E48 antigen, c-fo in a biological sample of a subject
measuring the expression level of any gene selected from the group consisting of s, involucrin, BENE, HBp17, fibronectin, and Id1 b) comparing the expression level of the gene in a biological sample of a healthy subject [ 2] The test method according to [1], wherein the allergic disease is bronchial asthma. [3] The test method according to [1], wherein the expression level of the gene is measured by cDNA PCR. [4] The test method according to [1], wherein the expression level of the gene is measured by detecting a protein encoded by the gene. [5] NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7, fibronectin, and a polynucleotide comprising a nucleotide sequence of any gene selected from the group consisting of Id1, or an oligonucleotide having a length of at least 15 bases having a nucleotide sequence complementary to its complementary strand A reagent for testing allergic diseases. [6] NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7. A reagent for testing an allergic disease, comprising an antibody that recognizes a peptide containing the amino acid sequence of any protein selected from the group consisting of fibronectin and Id1. [7] A method for screening a therapeutic drug for an allergic disease, comprising the following steps. (1) NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7. a step of contacting the candidate compound with a cell expressing any gene selected from the group consisting of fibronectin and Id1 and / or any gene functionally equivalent to these genes (2) Measuring the expression level of the gene, (3) selecting a compound that increases the expression level of the gene as compared to a control [8] The method according to [7], wherein the cells are established airway epithelial cells .

[9] A method for screening a therapeutic drug for an allergic disease, comprising the following steps. (1) Step of administering a candidate compound to a test animal; (2) NB-1, E48 antigen, c-fos, invo in a biological sample of the test animal
measuring the expression intensity of any gene selected from the group consisting of lucrin, BENE, HBp17, fibronectin, and Id1, and / or any gene functionally equivalent to these genes; and 3) Step of selecting a compound that increases the expression level of the gene as compared to a control [10] A method for screening a therapeutic drug for an allergic disease, comprising the following steps. (1) NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7, the transcriptional regulatory region of any gene selected from the group consisting of fibronectin and Id1, and / or any gene functionally equivalent to these genes, and Contacting a candidate substance with a cell into which a vector containing a reporter gene to be expressed has been introduced; (2) measuring the activity of the reporter gene; and (3) a compound that increases the expression level of the gene as compared to a control [11] A method for screening a therapeutic agent for an allergic disease, comprising the following steps. (1) NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7. a step of contacting a candidate substance with any protein selected from the group consisting of fibronectin and Id1, and / or any protein functionally equivalent to these proteins, (2) the protein Measuring the activity, and (3) selecting a compound that increases the activity of the protein compared to a control [12] [7],

A remedy for allergic diseases, comprising as an active ingredient a compound obtainable by the screening method according to any one of [9], [10], and [11]. [13] NB-1, E48 antigen, c-fos, involucrin, BENE, HB
A therapeutic agent for an allergic disease, comprising, as a main component, any gene itself selected from the group consisting of p17, fibronectin, and Id1, or a protein encoded by the gene. [14] NB-1, E48 antigen, c-fos, involucrin, BENE, HB
A transgenic non-human that has reduced expression intensity in airway epithelial cells of any gene selected from the group consisting of p17, fibronectin, and Id1, and / or any gene functionally equivalent to these genes Use as a model animal for allergic diseases in human vertebrates.

These eight genes are all genes whose presence has been clarified. The usefulness of these eight genes according to the present invention that has already been clarified is shown below. As shown below, it is not known that the expression of any gene decreases in airway epithelial cells in response to IL-4 or IL-13.

NB-1: NB-1 has 85% similarity at the amino acid level to calmodulin and has four calcium binding sites. Calcium is involved in regulating the differentiation of breast and skin epithelial cells. There is no specific report on its usefulness.

E48 antigen: E48 antigen is 20-K involved in adhesion
d is a transmembrane glycoprotein and a type of squamous cell carcinoma antigen. It is expressed on keratinocytes and squamous cell carcinoma cells.
Other features are not yet well understood. The presence of E48 and related nucleic acids has been shown to be a marker for the detection of squamous and bladder cancers.

C-fos: c-fos forms a complex (AP-1) with the c-Jun protein via a leucine zipper structure and functions as a transcription factor. c-fos is known to be effective as an anti-cancer vaccine. Also, its antisense
It has also been shown to be used for the treatment of airway vasculature, inflammation, allergy, asthma, hypertension, bronchitis, emphysema, dyspnea, cancer and the like. In particular, some studies have examined the effectiveness of antisense for cancer treatment.

Involucrin: Involucrin is an envelope protein composed of 585 amino acids that is produced during terminal differentiation of epithelial cells. The keratinocytes are often present, and are initially present in the cytoplasm, but are finally crosslinked to the membrane by transglutaminase. It consists of 585 amino acids rich in glutamine and glutamic acid, and has a 390 amino acid 10-peptide repeat in the center. There are also reports that DD96 is co-localized with keratinocytes. Detailed functions are not well understood. For specific reports on usefulness,
Nothing in particular.

BENE: BENE is a protein consisting of 148 amino acids and is 76 V k of immunoglobulin V (variable) kappa.
It was cloned as part of appa, but its function was unknown. There is no specific report on its usefulness.

HBp17: HBp17 is a heparin binding protein with a molecular weight of 17,000. It is expressed on keratinocytes and squamous cell carcinoma cells. Heparin binding peptide binds to growth factors HBGF-1 and HBGF-2 and inhibits these activities. Fibr using ribozyme
It has been reported that it is useful as an inhibitor of cancer or immunodeficiency as an inhibitor of onectin growth factor production.

Fibronectin: Fibronectin is
It is an extracellular matrix molecule with a molecular weight of 450,000. A chain,
It is composed of a B-chain heterodimer, and is distributed on the cell surface and plasma (containing about 1% in serum). Binds to the receptor, integrin, and promotes adhesion of cells to the extracellular matrix. Its use as a new fibrin-binding peptide and its inhibitory effect on thrombosis formation have been elucidated. The antisense also has airway vasculature, inflammation, allergies,
It has been reported that it can be used to treat asthma, hypertension, bronchitis, emphysema, dyspnea, cancer, etc. Furthermore, it is said that it is useful for treating and diagnosing conditions in which fibrin is accumulated, such as thrombosis.

Id1: Id1 (inhibitor of DNA binding 1)
Is a transcription factor having a DNA binding activity with Helix-loop-helix structure (ET that activates the expression of immunoglobulin genes)
Proteins that inhibit the S family). Since Id1 itself has a Helix-loop-helix structure, it forms a heterodimer with transcription factors and inhibits binding to DNA. It has been shown to be a therapeutic agent for prostate cancer and a probe of cell proliferation and differentiation.

[0023]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, an allergic disease is a general term for diseases associated with allergic reactions. More specifically, it can be defined that an allergen is identified, a deep link is established between exposure to the allergen and the development of a lesion, and the lesion has an immunological mechanism. Here, the immunological mechanism means that leukocyte cells show an immune response by allergen stimulation. Examples of the allergen include a mite antigen and a pollen antigen. Representative allergic diseases can include bronchial asthma, allergic rhinitis, hay fever, or insect allergy. Allergic diathesis is a genetic factor transmitted from a parent with an allergic disease to a child.
An allergic disease that develops familially is also called an atopic disease, and a genetically transmitted factor that causes it is atopic predisposition. Asthma is a general term given to atopic diseases, particularly those associated with respiratory symptoms.

The method for testing an allergic disease of the present invention comprises:
NB-1, E48 antigen, c-fos, invo in the subject's biological sample
measuring the expression level of any gene selected from the group consisting of lucrin, BENE, HBp17, fibronectin, and Id1, and comparing the measured level with the measurement value of a healthy subject.
As a result of comparison between the two, when the expression is lower than that in a healthy subject, the subject is determined to have an allergic disease. In the present invention, the above eight genes that can be used as indicators of allergic diseases are collectively referred to as indicator genes. Unless otherwise specified, the indicator gene is used as a term indicating one or more arbitrary genes selected from the above eight genes.

In the method for testing an allergy according to the present invention, an indicator gene for which the expression level or activity is to be measured is selected from the eight indicator genes. Therefore, the test based on the present invention can be performed by measuring the expression level and activity of any one of the eight genes. Further, in the present invention, test accuracy can be improved by measuring a combination of a plurality of these genes. Since bronchial asthma patients are heterogeneous (heterogeneous) populations, more reliable diagnosis can be made by using a plurality of genes as indices. Specifically, at least one, preferably two or more, more preferably three or more, more preferably four to eight types of indicator genes can be combined.

In the present invention, the expression levels of the indicator genes include the transcription of these genes into mRNA and the translation into proteins. Therefore, the method for testing an allergic disease according to the present invention is performed based on a comparison between the expression intensity of mRNA corresponding to the gene or the expression level of a protein encoded by the gene.

The measurement of the expression level of the indicator gene in the test for allergic disease in the present invention can be carried out according to a known gene analysis method. Specifically, for example, a hybridization technique using a nucleic acid that hybridizes to the gene as a probe or a gene amplification technique using a DNA that hybridizes to the gene of the present invention as a primer can be used.

The probe or primer used in the test of the present invention can be set based on the nucleotide sequence of the indicator gene. The nucleotide sequence of the indicator gene is known. The GenBank accession numbers of the nucleotide sequences of each indicator gene are shown in the examples. In general, genes of higher animals are frequently associated with polymorphism. Also, there are many molecules that generate isoforms consisting of mutually different amino acid sequences in the process of splicing. Even a gene containing a mutation in the nucleotide sequence by polymorphism or isoform, has the same activity as the indicator gene, a gene involved in allergy,
Both are included in the indicator gene of the present invention.

As the primer or probe, a polynucleotide comprising the nucleotide sequence of the indicator gene or a polynucleotide containing at least 15 nucleotides complementary to a complementary strand thereof can be used. Here, the “complementary strand” refers to one strand of a double-stranded DNA consisting of A: T (U in the case of RNA) and G: C base pairs with respect to the other strand.
Further, `` complementary '' is not limited to a completely complementary sequence in at least 15 consecutive nucleotide regions,
It is sufficient that they have at least 70%, preferably at least 80%, more preferably 90%, even more preferably 95% or more homology on the base sequence. The homology of the nucleotide sequences can be determined by an algorithm such as BLAST.

Such a polynucleotide can be used as a probe for detecting the indicator gene and as a primer for amplifying the indicator gene. When used as a primer, usually 15 bp to 10
It has a chain length of 0 bp, preferably 15 bp to 35 bp. When used as a probe, it has at least a part or all of the sequence of the indicator gene (or its complementary strand),
DNA with a chain length of at least 15 bp is used. When used as a primer, the 3′-side region needs to be complementary, but a restriction enzyme recognition sequence, a tag, or the like can be added to the 5′-side.

The “polynucleotide” in the present invention can be DNA or RNA. These polynucleotides may be synthetic or natural. Probes used for hybridization
Usually, labeled DNA is used. As the labeling method, for example, the following method can be shown. The term oligonucleotide means a polynucleotide having a relatively low degree of polymerization among polynucleotides. Oligonucleotides are included in polynucleotides. Labeling by nick translation using DNA polymerase I Terminal labeling using polynucleotide kinase Fill-in labeling using Klenow fragment (Be
rger SL, Kimmel AR. (1987) Guide to Molecular Clon
ing Techniques, Method in Enzymology, Academic Pre
ss; Hames BD, Higgins SJ (1985) Genes Probes: A Pr
actical Approach. IRL Press; Sambrook J, Fritsch E
F, Maniatis T. (1989) Molecular Cloning: a Laborat
ory Manual, 2nd Edn. Cold Spring Harbor Laboratory
Press) Labeling by transcription using RNA polymerase (Melton D
A, Krieg, PA, RebagkiatiMR, Maniatis T, Zinn K, Gre
en MR. (1984) Nucleic Acid Res., 12,7035-7056) ・ Incorporation of modified nucleotides without radioisotopes into DNA (KrickaLJ. (1992) Nonisotopic DNA P
robing Techniques. Academic Press)

The test for allergic diseases using the hybridization technique can be performed using, for example, Northern hybridization, dot blotting, a method using a DNA microarray, and the like. Furthermore, gene amplification techniques such as the RT-PCR method can be used. In the RT-PCR method, the gene amplification process
By using the PCR amplification monitoring method, it is possible to perform more quantitative analysis on the expression of the gene of the present invention.

In the PCR gene amplification monitoring method, a probe whose both ends are labeled with different fluorescent dyes that cancel each other's fluorescence is used to hybridize to a detection target (reverse transcript of DNA or RNA). PCR reaction proceeds and Taq
5'-3 'exonuclease of polymerase (exonuclea
se) When the same probe is decomposed due to the activity, the two fluorescent dyes are separated and the fluorescence is detected. This fluorescence is detected in real time. Simultaneous measurement of a standard sample with a clear copy number for the detection target
Determine the number of copies to be detected in the target sample by the number of linear cycles of PCR amplification (Holland, PM et al., 19
91, Proc. Natl. Acad. Sci. USA 88: 7276-7280; Liva
k, KJ et al., 1995, PCR Methods and Application
s 4 (6): 357-362; Heid, CA et al., Genome Researc
h 6: 986-994; Gibson, EMU et al., 1996, Genome
Research 6: 995-1001). In the PCR amplification monitoring method, for example, ABI PRISM7700 (PE Biosystems)
Can be used.

The method for testing an allergic disease of the present invention can also be carried out by detecting a protein encoded by the above-mentioned indicator gene. Hereinafter, in the present specification, a protein encoded by the indicator gene is referred to as an indicator protein. As such a test method, for example, a Western blotting method, an immunoprecipitation method, an ELISA method, or the like using an antibody that binds to these indicator proteins can be used.

An antibody that binds to the indicator protein used for this detection can be obtained using techniques well known to those skilled in the art. The antibodies used in the present invention are polyclonal antibodies or monoclonal antibodies (Milstein C, et al., 1983, N
ature 305 (5934): 537-40). For example, a polyclonal antibody against an indicator protein is obtained by extracting blood of a mammal sensitized with an antigen and separating serum from the blood by a known method. As the polyclonal antibody, serum containing the polyclonal antibody can be used. Alternatively, if necessary, a fraction containing a polyclonal antibody can be further isolated from the serum. In order to obtain a monoclonal antibody, immune cells are removed from a mammal sensitized with the above antigen, and are fused with myeloma cells or the like. The hybridoma thus obtained is cloned, and the antibody is recovered from the culture to obtain a monoclonal antibody.

For detection of the indicator protein, these antibodies may be appropriately labeled and used. Further, without labeling the antibody, a substance that specifically binds to the antibody, for example, protein A or protein G can be labeled and detected indirectly. A specific detection method includes, for example, an ELISA method. A protein or a partial peptide thereof used as an antigen can be prepared, for example, by incorporating the gene or a part thereof into an expression vector, introducing this into an appropriate host cell, preparing a transformant, and culturing the transformant to obtain a recombinant. The protein can be obtained by expressing the protein and purifying the expressed recombinant protein from a culture or a culture supernatant. Alternatively, an oligopeptide consisting of an amino acid sequence encoded by these genes or a partial amino acid sequence of an amino acid sequence encoded by a full-length cDNA can be chemically synthesized and used as an immunogen.

Further, in the present invention, not only the expression level of the indicator gene but also the activity of the indicator protein in a biological sample can be used as an indicator for testing for allergic diseases. The activity of the indicator protein refers to the biological activity of each protein. The activity of the indicator protein can be detected based on a known method. For example, HBp17
Can utilize biochemical activity of heparin to detect its activity. Similarly, the activity of fibronectin can be known using the binding activity to integrin as an index. Alternatively, the presence of c-fos can be known by evaluating its activity as a transcription factor in the presence of c-Jun.

In the test method of the present invention, a biological sample of a subject is usually used as a sample. Airway epithelial cells and the like can be used as the biological sample. Methods for obtaining airway epithelial cells are known. That is, under a bronchoscope, it is possible to physically exfoliate and collect using a rod. The obtained sample can be prepared by freezing, fixing in formalin, or culturing in a medium. In addition, blood, sputum, secretions of nasal mucosa, bronchoalveolar lavage fluid, lung scraping cells, and the like can also be used as the biological sample in the present invention. Methods for collecting these biological samples are also known. When the biological sample is cells such as airway epithelial cells, a lysate can be prepared and used as a sample for immunological measurement of the protein. Alternatively, if mRNA is extracted from this lysate, it can be used as a sample for measuring mRNA corresponding to the gene.
For extraction of lysate and mRNA from a biological sample, it is convenient to use a commercially available kit. Alternatively, a liquid biological sample such as blood, nasal mucosa secretion, or bronchoalveolar lavage fluid can be diluted with a buffer or the like, if necessary, to prepare a sample for protein or gene measurement.

The measured value of the expression level of the indicator gene in airway epithelial cells can be corrected by a known method. With the correction, changes in the expression level of the gene in the cells can be compared. Correction of the measured value is a gene that is expressed in airway epithelial cells and whose expression level does not fluctuate greatly regardless of the cell state (housekeeping gene)
The present invention is performed by correcting the measured value of the expression level of the gene to be used as an index in the present invention based on the measured value of the expression level. The indicator gene of the present invention showed decreased expression levels in a plurality of airway epithelial cell lines stimulated with IL-4 or IL-13. Therefore, an allergic disease such as bronchial asthma can be tested using the expression level of the indicator gene as an indicator.

The test for an allergic disease in the present invention includes, for example, the following tests. Even if a patient cannot show a symptom of bronchial asthma and cannot be determined to be an allergic disease by a general test, the test according to the present invention can easily determine that the patient is an allergic disease patient. More specifically, the decrease in the expression of the indicator gene in patients showing symptoms suspected of having an allergic disease,
This indicates that the cause of the symptom is likely to be an allergic disease. Some bronchial asthma is caused by an allergic reaction, while others are not. Diagnosing which of these causes the symptoms of bronchial asthma is a very important therapeutic step, since the treatment methods are quite different. The test method of the present invention can provide extremely important information in identifying the cause of bronchial asthma. Alternatively, a test can be performed to determine whether allergic symptoms are improving. The indicator gene of the present invention is IL-4
Alternatively, the expression level was reduced in airway epithelial cells stimulated with IL-13. Airway epithelial tissue is a tissue that shows significant lesions in bronchial asthma. Therefore, IL-4 or IL-1 is a cytokine that strongly induces allergic reactions
Genes whose expression fluctuates in airway epithelial cells stimulated in 3 are useful for judging the therapeutic effect. More specifically, a decrease in the expression of an indicator gene in a patient diagnosed with an allergic disease indicates that there is a high possibility that allergic symptoms have progressed.

The present invention also relates to the use of a transgenic non-human animal having a reduced expression level of an indicator gene in airway epithelial cells as a model animal for an allergic disease. Allergic disease model animals are useful for elucidating in vivo changes in bronchial asthma.
Furthermore, the allergic disease model animal of the present invention is useful for evaluating a therapeutic drug for allergic bronchial asthma.

According to the present invention, it was revealed that the expression level of the indicator gene in airway epithelial cells was reduced by stimulation of IL-4 or IL-13. Therefore, animals in which expression levels of these genes or genes functionally equivalent to these genes in the airway epithelial cells are artificially suppressed can be used as model animals for allergic diseases. The decrease in the expression level in airway epithelial cells includes a decrease in the expression level of the target gene in the whole airway tissue. That is, the expression level of the gene is reduced not only in the airway epithelium but also in the entire airway tissue or when the expression level of the gene is reduced systemically. In the present invention, a functionally equivalent gene is a gene that encodes a protein having an activity similar to that of the protein encoded by each indicator gene. A representative example of a functionally equivalent gene is a counterpart of a marker gene in a transgenic animal originally provided in a transgenic animal.

Genes whose expression is reduced by stimulation of IL-4 or IL-13 can be said to be genes on the pathway of signal transmission by these cytokines. In other words, it is considered that the stimulation of IL-4 or IL-13 is manifested as an allergic symptom through suppression of the expression of these genes. In other words, a gene whose expression is reduced by stimulation of IL-4 or IL-13 can be said to be a gene that plays an important role in the formation of allergic pathology in airway epithelium. Therefore, a drug that promotes the expression of this gene or enhances its activity, in the treatment of allergy, not only ameliorates allergic symptoms,
It can be expected to remove the essential cause of allergic pathogenesis. Furthermore, the therapeutic effect of allergic symptoms can be achieved by supplementarily administering the proteins encoded by these indicator genes. The protein can be supplemented by administering the protein itself or by introducing a vector capable of expressing the indicator gene into a patient by a gene therapy technique.

As described above, genes whose expression decreases in airway epithelial cells stimulated with IL-4 or IL-13 have important significance. Therefore, it is of great significance to use transgenic animals that can be obtained by reducing the expression level of this gene as model animals for allergic diseases, and to evaluate the role of the gene and drugs that target the gene. . In addition, the allergic disease model animal according to the present invention is used not only for screening pharmaceuticals for treating or preventing allergic diseases described below, but also for elucidating the mechanism of allergic diseases and further testing the safety of the screened compounds. Useful. For example, if the allergic disease model animal according to the present invention develops bronchial asthma or shows a change in a measured value related to any allergic disease, a screening system for searching for a compound having an action to restore it can be constructed.

In the present invention, the expression level is reduced by
It means either a state where transcription of a marker gene or a gene functionally equivalent to the indicator gene provided in the host and translation into a protein are suppressed, and a state where degradation of a protein as a translation product is promoted. The expression level of the gene
For example, it can be confirmed by quantitative PCR as shown in Examples. The activity of the protein as a translation product can be confirmed by comparing with the normal state.

Representative transgenic animals include animals in which the indicator gene or a functionally equivalent gene has been knocked out, animals in which the gene has been replaced (knocked in) with another gene, and the like. In addition, an antisense DNA against an indicator gene or a functionally equivalent gene,
A transgenic animal into which a DNA encoding a ribozyme or a DNA functioning as a decoy nucleic acid has been introduced can also be used as the transgenic animal in the present invention. Other examples include animals in which a mutation has been introduced into the coding region of an indicator gene or a functionally equivalent gene to suppress its activity or have been modified to an easily degradable amino acid sequence. Mutations in the amino acid sequence can indicate substitutions, deletions, insertions, or additions. In addition, the expression itself of the gene of the present invention can be regulated by mutating the transcription regulatory region of the gene.

A method for obtaining a transgenic animal using a specific gene is known. That is, a method in which a gene and an egg are mixed and treated with calcium phosphate, a method in which a gene is directly introduced into a nucleus of a pronuclear stage egg with a micropipette under a phase contrast microscope (microinjection method, US Patent No. 4,873,191), A transgenic animal can be obtained by a method using embryonic stem cells (ES cells) or the like. In addition, a method of inserting a gene into a retroviral vector and infecting an egg, a method of introducing a gene into an egg via sperm, and a sperm vector method have also been developed.
The sperm vector method is a genetic recombination method in which a foreign gene is introduced into sperm cells by attaching a foreign gene to sperm or by a method such as electroporation, and then fertilizing the egg to introduce the foreign gene (M. Lavitranoet et Cel
l, 57, 717, 1989).

The transgenic animal used as the allergic disease model animal of the present invention can be prepared using any vertebrate other than human. Specifically, transgenic animals in which various genes have been introduced or expression levels of which have been modified in vertebrates such as mice, rats, rabbits, minipigs, goats, sheep, and cattle have been created.

The present invention further relates to a method for screening a candidate compound for a therapeutic drug for allergic diseases. In the present invention, the expression levels of all indicator genes are significantly reduced in airway epithelial cells stimulated with IL-4 or IL-13. Therefore, a therapeutic agent for an allergic disease can be obtained by selecting a compound that can increase the expression levels of these genes. In the present invention, the compound that increases the expression level of a gene is a compound that has an effect of inductively acting on any of the steps of gene transcription, translation, and protein activity expression. The method for screening a candidate compound for treating an allergic disease of the present invention can be performed in vivo or in vitro. This screening can be performed, for example, according to the following steps. The indicator gene in the screening method of the present invention includes, in addition to those listed above as indicator genes, any gene functionally equivalent to those genes. (1) a step of administering a candidate compound to a test animal, (2)
Measuring the expression level of the indicator gene in a biological sample of a test animal; (3) selecting a compound that increases the expression level of the indicator gene as compared to a control

As a test animal in the screening method of the present invention, for example, an allergic disease model animal consisting of a transgenic animal in which a human indicator gene is forcibly expressed can be used. When a promoter whose transcription is regulated by a substance such as an appropriate drug is used as the promoter used in the expression vector, the expression level of the exogenous indicator gene in the transgenic animal can be adjusted by administering the substance.

The drug candidate compound is administered to the model animal in which the indicator gene has been forcibly expressed as described above, and the effect of the compound on the expression of the indicator gene in the biological sample of the model animal is monitored, whereby the expression level of the indicator gene is reduced. It is possible to detect the influence of the drug candidate compound. Fluctuations in the expression level of the indicator gene in the biological sample of the test animal can be monitored by the same method as in the test method of the present invention. Further, by selecting a drug candidate compound that increases the expression level of the indicator gene based on the result of this detection, the drug candidate compound can be screened. More specifically, the screening according to the present invention can be performed by collecting a biological sample from a test animal and comparing the expression level of the indicator gene with a control. Biological samples include smooth muscle cells,
Keratinocytes, nasal mucosal epithelial cells, intestinal epithelial cells, lymphocytes, mast cells, eosinophils, basophils, neutrophils and the like can be used. Methods for collecting and preparing these biological samples are known. By such a screening, it is possible to select drugs that are involved in various forms in the expression of the indicator gene. Specifically, for example, drug candidate compounds having the following action points can be found. Suppression of signal transduction pathways that lead to the expression of indicator genes, reduction of transcriptional activity of indicator genes, promotion of instability or degradation of transcripts of indicator genes,

In the in vitro screening, for example, there is a method in which a candidate compound is brought into contact with cells expressing the indicator gene, and a compound that increases the expression level of these genes is selected. This screening can be performed, for example, according to the following steps. (1) a step of bringing a candidate compound into contact with cells expressing the indicator gene; (2) a step of measuring the expression level of the indicator gene; and (3) selecting a compound that increases the expression level of the indicator gene as compared with a control. Process

In the present invention, cells that express the indicator gene can be obtained by inserting the indicator gene into an appropriate expression vector and introducing the vector into an appropriate host cell. Usable vectors and host cells may be any as long as they can express the gene of the present invention. Examples of host cells in the host-vector system include Escherichia coli, yeast, insect cells, animal cells, and the like, and any available vector can be appropriately selected.

As a method for introducing a vector into a host, a biological method, a physical method, a chemical method and the like can be mentioned. Examples of the biological method include a method using a viral vector, a method using a specific receptor, a cell fusion method (HVJ (Sendai virus), polyethylene glycol (PEG), an electric cell fusion method, micronucleus fusion). Method (chromosome transfer)). Examples of the physical method include a microinjection method, an electroporation method, and a method using a gene particle gun. Examples of the chemical method include a calcium phosphate precipitation method, a liposome method, a DEAE dextran method, a protoplast method, an erythrocyte ghost method, an erythrocyte membrane ghost method, and a microcapsule method.

As cells expressing the indicator gene, human lung cancer cell A549 and human bronchial epithelial cell BEAS-2B are suitable for the screening method of the present invention. These cells are
It can be purchased from ATCC.

In the screening method of the present invention, first, a candidate compound is added to the cell line. Thereafter, the expression level of the indicator gene in the cell line is measured, and a compound that increases the expression level of the gene is selected.

In the screening method of the present invention, the expression levels of the indicator genes are determined not only by the expression levels of the proteins encoded by these genes but also by the corresponding mRs.
Comparison can also be made by detecting NA. In order to compare expression levels by mRNA, the step of preparing an mRNA sample as described above is performed instead of the step of preparing a protein sample. Detection of mRNA and protein can be carried out by a known method as described above.

Further, based on the disclosure of the present invention, a transcription regulatory region of the indicator gene of the present invention can be obtained, and a reporter assay system can be constructed. The reporter assay system refers to an assay system that screens for a transcription regulatory factor acting on the transcription regulatory region, using the expression level of a reporter gene located downstream of the transcription regulatory region as an index.

Examples of the transcription control region include a promoter, an enhancer, and a CAAT box, a TATA box, and the like usually found in a promoter region. As a reporter gene, CAT (chlorampheni
col acetyltransferase) gene, luciferase (lucif
erase) gene, growth hormone gene and the like can be used. Many of the indicator genes of the present invention have transcription regulatory regions already clarified. Alternatively, the transcription regulatory region of the indicator gene in the present invention can be obtained as follows. That is, first, based on the nucleotide sequence of the indicator gene disclosed in the present invention, from a human genomic DNA library such as a BAC library or a YAC library, screening is performed by a method using PCR or hybridization, and the cDNA sequence is included. Obtain a genomic DNA clone. Based on the sequence of the obtained genomic DNA, the transcription control region of the cDNA disclosed in the present invention is estimated, and the transcription control region is obtained. The obtained transcription regulatory region is cloned so as to be located upstream of the reporter gene to construct a reporter construct. The resulting reporter construct is introduced into a cultured cell line to obtain a transformant for screening. By contacting a candidate compound with this transformant, a compound that controls the expression of a reporter gene can be screened.

The test candidate compounds used in these screenings include compound preparations synthesized by existing chemical methods such as steroid derivatives, compound preparations synthesized by combinatorial chemistry, extracts of animal and plant tissues, A mixture containing a plurality of compounds such as a culture of a microorganism, and a sample purified from the mixture, and the like.

The compounds selected by the screening method of the present invention are useful as remedies for allergic diseases. Alternatively, the protein encoded by the indicator gene or a gene functionally equivalent to the indicator gene in the present invention is useful as a therapeutic drug for allergic diseases. The remedy for allergic diseases of the present invention comprises the compound selected by the screening method as an active ingredient, and can be produced by mixing with a physiologically acceptable carrier, excipient, or diluent. it can. The therapeutic agent for allergic diseases of the present invention can be administered orally or parenterally for the purpose of improving allergic symptoms. When the compound to be administered consists of a protein, a therapeutic effect can be achieved by introducing a gene encoding the protein into a living body using a gene therapy technique. Techniques for treating a disease by introducing a gene encoding a protein having a therapeutic effect into a living body and expressing the gene in a living body are known. As oral preparations, dosage forms such as granules, powders, tablets, capsules, solvents, emulsions, and suspensions can be selected. Injections include subcutaneous injections, intramuscular injections, intraperitoneal injections, and the like.

The dosage varies depending on the age, sex, weight and condition of the patient, therapeutic effect, administration method, treatment time, and the type of active ingredient contained in the pharmaceutical composition. 0.1 mg to 500 mg per serving
, Preferably in the range of 0.5 mg to 20 mg. However, since the dose varies depending on various conditions, a dose smaller than the above dose may be sufficient, or a dose exceeding the above range may be required. Hereinafter, the present invention will be described specifically with reference to Examples.
The present invention is not limited to these embodiments.

[0063]

EXAMPLES [Example 1] Selection of candidate genes using DNA microarray Culture of normal human bronchial epithelial cells and IL-4 or IL-
13 Stimulation Three lots of normal human bronchial epithelial cells sold by Clonetics were purchased (8F1756, 8F1548, 8F1805). 5x10 ⁵ cells in 1 vial are unstimulated, IL-4 stimulated, IL
Divide into three equal parts (1.67 × ¹⁰ 5/75 cm ² flask) for -13 stimulation, SABM
The cells were cultured in a medium (Clonetics) for about 8 to 10 days (about 10 passages) while changing the medium. At that time, BPE (bovine pituitary extract), Hydrocortisone, hEGF, Epinephrine,
Transferrin, Insulin, Retinoic Acid, BSA-FAF, Trii
odothyronine, GA-1000 (Gentamicin / Amphotericin-B) was added according to the attached protocol. Cells were washed with PBS before cytokine stimulation, and then replaced with SABM from which additional factors had been removed. IL-4 (10 ng / ml) and IL-13 (50 ng / ml) were added thereto (both manufactured by Peprotech) and cultured for 24 hours.

2. Other Cytokine Stimulation of Normal Human Bronchial Epithelial Cells Cells of lot 8F1548 were used and cultured as in 1. IL-4
50 ng / ml TNFα, IL-1β, IL-5, IL-
6, and IL-9 (all manufactured by Peprotech) were added and cultured for 24 hours.

3. Preparation of RNA for GeneChip The airway epithelial cells treated as described above were dissolved in Isogen (Nippon Gene; Wako Pure Chemical), and RNA was isolated from this solution according to the protocol attached to Isogen. Chloroform was added, and the mixture was centrifuged with stirring to collect an aqueous layer. Next, isopropanol was added, and the mixture was centrifuged with stirring to collect the total RNA in the precipitate.

4. CDNA synthesis for GeneChip total RNA 3-5 mg (5 mg for lot 8F1756 and 3 mg for the other two lots)
From T7- (dT) ₂₄ (Amersham Pharmacia) as a primer using Expression Analysis Technica of Affymetrix.
l Superscript II Reverse Transcr according to Manual method
Reverse transcribed using iptase (Life Technologies) and single stranded
cDNA was prepared. The T7- (dT) ₂₄ primer consists of a nucleotide sequence obtained by adding d (T) ₂₄ to the nucleotide sequence of the T7 promoter as follows. T7- (dT) 24 primer (SEQ ID NO: 1) 5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG- (dT) ₂₄
-3 'Next, according to Expression Analysis Technical Manual,
Add DNA Ligase, DNA polymerase I and RNase H, add 2
Single-stranded cDNA was synthesized. After extracting the cDNA with phenol / chloroform, the cDNA was passed through Phase Lock Gels, precipitated with ethanol, and purified. In addition, BioArray High Yield RNA Transcript
Biotin-labeled cRNA was synthesized using the ion labeling kit. The cRNA was purified using an RNeasy Spin column (QIAGEN) and fragmented by heat treatment. Of which 12.5 μg
Hydrate cRNA according to Expression Analysis Technical Manual
Added to bridization Cocktail. Put this in an array,
Hybridization was performed at 45 ° C for 16 hours. After washing the array, Streptavidin Phycoerythrin was added for staining. After washing, an antibody mixture of normal goat IgG and biotinylated goat IgG was added to the array. Further, for the purpose of enhancing the fluorescence intensity, Streptavidin Phycoerythrin was added again for staining. After washing, set it on the scanner and use GeneChip Softw
Analyzed by are.

5. GeneChip Analysis Data analysis was performed using Suite, which is GeneChip analysis software. Average Intensity (1) by Absolute analysis
And Background Average (2), and subtraction of (2) from (1), the average of the three unstimulated, IL-4, or IL-13 stimuli was used as the correction factor (Scale Factor) for Comparison Analysis.
Was done. First, Absolute Analysis was performed to analyze one chip data. Compare the fluorescent intensities of the perfect match and mismatch of the probe set, and
negative was determined. Pos Fraction, Log Avg, Pos / Neg
P (present) which is an Absolute Call determined from the value of A, A
(absent) and M (marginal). Pos Fraction; Positive pair ratio. Log Avg; Average of the logarithm of the fluorescence intensity ratio of the perfect match and mismatch probe cells Pos / Neg; Ratio of the number of positive pairs and the number of negative pairs In each gene, the difference in the fluorescence intensity of the perfect match and mismatch probe cells Average Difference (Avg Diff), which is the average of, was also calculated.

Next, the two data are compared and analyzed (Comparison
Analysis). Unstimulated and IL-4 stimulated or Unstimulated and IL-
Comparison was made between 13 stimuli, and the difference in expression level was ranked as follows. Inc / Dec, Inc Ratio, Dpos-Dneg Ratio, Log
Difference Call determined from the value of Avg Ratio Change
5 categories of I, D, MI, MD, and NC were determined. Inc: The number of pairs for which it was determined that IL-4 stimulation or IL-13 stimulation was increased for the corresponding probe pairs that were not stimulated with IL-4 stimulation or IL-13 stimulation. Dec: Number of pairs judged to be decreased in IL-4 stimulation or IL-13 stimulation. Inc / Dec: The ratio of the number of pairs judged as Inc to the number of pairs judged as Dec. Inc Ratio: The number of pairs judged as Inc / the number of pairs actually used. Dpos / Dneg Ratio: The ratio of Pos Change minus Neg Change to the number of pairs actually used Pos Change: Absolute An stimulated by IL-4 or IL-13
Positive pairs in analysis and unstimulated Absolute Analysi
Positive difference in the number of pairs in s. Neg Change: Absolute An stimulated by IL-4 or IL-13
Negative number of pairs in alysis and unstimulated Absolute Analysi
Log Avg Ratio Change: Difference in Log Avg between IL-4 or IL-13 stimulation and unstimulated Absolute Analysis. Increase: I (Increased), Decrease: D (Decreased), Slight increase: MI (Marginally Increased), Slight decrease: MD (Marginally Decreased), and No change: NC (no change)

In addition, unstimulated and IL-4 stimulated or unstimulated
Avg Diff ratio in Absolute Analysis of IL-13 stimulation
Fold Change values were selected as genes whose expression fluctuation (enhancement or decrease) was observed by IL-4 stimulation or IL-13 stimulation. Table 1 shows the results of narrowing down the genes expressed by airway epithelial cells by Lot.

[0070]

[Table 1]

In the table, “increase or decrease by [Diff Call]” indicates the number of genes whose expression levels differed by IL-4 stimulation or IL-13 stimulation. Genes having a difference in expression level include genes determined to be slightly increased (or slightly decreased) in the ranking.
For each lot, the number of genes that showed a difference in both IL-4 and IL-13 was indicated as “variable common genes”. Furthermore, “[Fold Change]” indicates the number of genes in which the change was more than twice (> 2 or <−2) and more than three times (> 3 or <−3). Was.

As a result, in both the IL-4 stimulation and the IL-13 stimulation, the expression level was reduced by 以下 or less, and the genes commonly reduced in two or more lots were as follows. Eight genes were selected. These genes are allergic-related cytokines, IL-4 and
It is a gene closely related to allergy, the expression level of which is reduced to 以下 or less by any stimulation of IL-13. NB-1 E48 antigen c-fos involucrin BENE HBp17 (heparin BP17) fibronectin (fibronectin) and Id1

Example 2 Confirmation of Expression Level of Candidate Genes In order to quantitatively confirm the expression levels of each of the eight genes selected in Example 1, cultured airway epithelial cells (Clonetics)
Was used for further quantitative PCR using ABI 7700.
As cultured cells, 3 of 8F1756, 8F1548, and 8F1805
One lot was used. Primers and TaqMan probes used for measurement by ABI 7700 were designed by Primer Express (PE Biosystems) based on the sequence information of each gene. The 5 'end of the TaqMan probe is FAM (6-carboxy-fl
uorescein) and the 3 'end is TAMRA (6-carboxy-N, N, N',
N'-tetramethylrhodamine). The nucleotide sequences of the oligonucleotides used for the forward primer (F), reverse primer (R), and TaqMan probe (TP) for each gene are as shown below.
The accession number of Genbank corresponding to the nucleotide sequence of each indicator gene is shown in parentheses following the name.

NB-1 (m58026) F: atgagtgagatcgaccggga (SEQ ID NO: 2) R: tcatcttcctggccatcatg (SEQ ID NO: 3) TP: ccgtggacttccccgagttcctg (SEQ ID NO: 4) E48 antigen (x82693) F: aagcattctgtgt: SEQ ID NO: R: ttcaccagattccccctcagag (SEQ ID NO: 6) TP: ctcgcttctgcaagaccacgaacaca (SEQ ID NO: 7) c-fos (v01512) F: ggcaaggtggaacagttatctcc (SEQ ID NO: 8) R: agtgtatcagtcagctccctcctc (SEQ ID NO: 9) gg: ctca ggcag ggca
0) involucrin (m13903) F: agcaacacacactgccagtgac (SEQ ID NO: 11) R: gtttcatttgctcctgatggg (SEQ ID NO: 12) TP: agctcctcaagactgttcctcctccagtca (SEQ ID NO: 1)
3) BENE (u17077) F: tgcccgagctgatatttgg (SEQ ID NO: 14) R: catacatcacccatccttgcag (SEQ ID NO: 15) TP: tagccgccacccacatagtatacccctt (SEQ ID NO: 1)
6) HBp17 (m60047) F: gacttcacagcaaagtggtctca (SEQ ID NO: 17) R: gggcctgcttttctgcttaatc (SEQ ID NO: 18) TP: aacaaaaggacactctgggcaacaccc (SEQ ID NO: 1)
9) Fibronectin (x02761) F: cccataaggcataggccaag (SEQ ID NO: 20) R: gccaacaggatgacatgaaatg (SEQ ID NO: 21) TP: ccatacccgccgaatgtaggacaaga (SEQ ID NO: 22) Id1 (x77956) F: atgaacggctgtcctgcc: sequence: (SEQ ID NO: 24) TP: tggagattctccagcacgtcatcgact (SEQ ID NO: 2)
5)

The total RNA extracted by the method described above was treated with DNase (Nippon Gene). Then, random hexamer (GIBC
The reverse transcribed cDNA was used as a template with OBRL) as a primer. For a standard curve for calculating the copy number, a plasmid clone containing a nucleotide sequence region amplified by both primers was prepared for each gene, and the reaction was performed using the serial dilution as a template. The composition of the reaction solution for monitoring the PCR amplification is shown in Table 2.

[0076]

[Table 2] Reaction composition of ABI-PRISM 7700 (reaction volume per well) ━━━━━━━━━━━━━━━━━━━━━ Sterile distilled water 23.75 (μL) 10x TaqMan buffer A 5 25 mM MgCl ₂ 7 dATP (10 mM) 1.0 dCTP (10 mM) 1.0 dGTP (10 mM) 1.0 dUTP (20 mM) 1.0 Forward Primer (10 μM) 1.0 Reverse Primer (10 μM) 1.0 TaqMan probe (2.0 μM) 2.5 AmpliTaq Gold (5U / μL) 0.25 AmpErase UNG (1U / μL) 0.5 Template solution 5 ───────────────────── Total volume 50 ━━━━━━━━━━━━━ ━━━━━━━━

Further, in order to correct the difference in cDNA concentration in the sample, β-actin gene and glyceraldehyde triphosphate dehydrogenase (GAP) were used as correction internal standards.
The same quantitative analysis was performed on the DH) gene, and the copy number of the target gene was calculated by correcting based on the copy number of those genes.

Primers and probes for β-actin or GAPDH measurement were obtained from TaqMan β-actin Control Reagen.
ts (PE Biosystems) was used. The base sequence is as follows. Figures 1 to 8 show the expression levels (copy / 5ng RNA) of each gene corrected by β-actin.
Shown in β actin forward primer (SEQ ID NO: 26) TCA CCC ACA CTG TGC CCA TCT ACG A β actin reverse primer (SEQ ID NO: 27) CAG CGG AAC CGC TCA TTG CCA ATG G β actin TaqMan probe (SEQ ID NO: 28) ( FAM) ATGCCC-T (TAMRA) -CCCCCATGCCATCCTGCGTp-3 ′ GAPDH forward primer (SEQ ID NO: 29) GAAGGTGAAGGTCGGAGT GAPDH reverse primer (SEQ ID NO: 30) GAAGATGGTGATGGGATTTC GAPDH TaqMan probe (SEQ ID NO: 31) (FAM) CAAGCTTCCCGTTCTCAGCCCC -3 'FAM: 6-carboxy-fluorescein TAMRA: 6-carboxy-N, N, N', N'-tetramethylrhodamine

As a result of the quantitative PCR, 8 selected in Example 1 was obtained.
The expression levels of the two genes in airway epithelial cells were all reduced to less than 1 / 2-fold in three different airway epithelial cells upon IL-4 or IL-13 stimulation. Based on these results, it was predicted that the expression levels of these indicator genes were reduced in airway epithelial cells in response to IL-4 and IL-13. By the stimulation of IL-4 or IL-13, which is known to be closely related to allergic reactions, the indicator gene of the present invention shows a common behavior in bronchial epithelial cells of different lots. Therefore, the indicator gene of the present invention is considered to be an important gene that controls the progress of an allergic reaction.

[0080]

According to the present invention, a gene whose expression is reduced in airway epithelial cells stimulated with IL-4 or IL-13 has been found. Genes whose expression is reduced in airway epithelial cells stimulated with IL-4 or IL-13 are likely to be an essential cause of allergic symptoms in bronchial asthma. Therefore, the indicator gene provided by the present invention is a useful indicator that can reliably determine whether bronchial asthma is caused by allergic symptoms. By being able to reliably diagnose bronchial asthma caused by allergy, an appropriate treatment method can be selected at an early stage.

[0081] IL-4 or IL-13 is an important factor that enhances allergic reactions. Therefore, it is considered that the genes whose expression decreases in response to stimulation of these factors play an important role in the pathogenesis of allergic symptoms. Moreover, the expression of the indicator gene provided by the present invention was clearly reduced in a plurality of airway epithelial cells. This is not the first study focusing on changes in gene expression levels following IL-4 or IL-13 stimulation. However, any of the genes provided by the present invention are:
It is an allergy-related gene found by the strict criteria as described here. Therefore, the indicator gene of the present invention is considered to be a gene that plays an important role in allergic reactions as compared to known allergy-related genes obtained by a similar approach. Because, the indicator gene of the present invention always responds sharply to IL-4 or IL-13 stimulation in different cells. This supports that the indicator gene of the present invention is indispensable for allergic reactions. As described above, since the decrease in the expression of any of the indicator genes of the present invention is linked to the disease state, promoting its expression is a target of a therapeutic strategy for allergic diseases, and such a new therapeutic method It can be expected to be useful as a new clinical diagnostic index for monitoring in the method. Alternatively, supplementing the decreased expression level by supplementary administration of a protein encoded by the gene is established as a method for treating allergic diseases.

The indicator gene provided by the present invention comprises:
Regardless of the type of allergen, its expression level can be easily known. Therefore, the pathology of the allergic reaction can be comprehensively grasped. In addition, the method for testing allergy according to the present invention can analyze the expression level of a biological sample as a sample, and therefore has low invasiveness to patients. Moreover, with regard to gene expression analysis, highly sensitive measurement using a small amount of sample is possible. Gene analysis technology has been increasing in throughput and lowering its price year by year. Therefore, the method for testing allergies according to the present invention comprises:
In the near future, it is expected to become an important bedside diagnostic method. In this sense, the diagnostic value of these disease-related genes is high.

[0083]

[Sequence List] SEQUENCE LISTING <110> Genox Research, Inc. <120> Method for examination for allergosis <130> G1-A0009 <140> <141> <160> 31 <170> PatentIn Ver. 2.1 <210> 1 < 211> 63 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized T7-d (T) 24 primer sequence <400> 1 ggccagtgaa ttgtaatacg actcactata gggaggcggt tttttttttt tttttttttt 60 ttt 63 <210 > 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 2 atgagtgaga tcgaccggga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 3 tcatcttcct ggccatcatg 20 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_bi nding <222> (23) <223> Label TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine) <400> 4 ccgtggactt ccccgagttc ctg 23 <210> 5 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 5 aagcattctg tggtctgccc 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 6 ttcaccagat tccccctcag ag 22 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (26) <223> Label TAMRA (6-carboxy- (N, N, N ', N'-tetramethylrhodamine) <400> 7 ctcgcttctg caagaccacg aacaca 26 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 8 ggcaaggtgg aac agttatc tcc 23 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 9 agtgtatcag tcagctccct cctc 24 <210> 10 <211 > 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy -fluorescein) <220> <221> misc_binding <222> (29) <223> Label TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine) <400> 10 tccgaaggga aaggaataag atggctgca 29 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 11 agcaacacac actgccagtg ac 22 <210> 12 <211> 21 <212> DNA < 213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 12 gtttcatttg ctcctgatgg g 21 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223 > Descri ption of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (30) < 223> Label TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine) <400> 13 agctcctcaa gactgttcct cctccagtca 30 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 14 tgcccgagct gatatttgg 19 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 15 catacatcac ccatccttgc ag 22 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (28) <223> Label TAMRA (6-carboxy-N, N, N ', N '-tetramethylrhodamine) <400> 16 tagccgccac c cacatagta tacccctt 28 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 17 gacttcacag caaagtggtc tca 23 <210> 18 <211 > 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 18 gggcctgctt ttctgcttaa tc 22 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (27) <223> Label TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine) <400> 19 aacaaaagga cactctgggc aacaccc 27 <210> 20 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 20 cccataaggc ataggccaag 20 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Des cription of Artificial Sequence: an artificially synthesized primer sequence <400> 21 gccaacagga tgacatgaaa tg 22 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (26) <223> Label TAMRA (6-carboxy- (N, N, N ', N'-tetramethylrhodamine) <400> 22 ccatacccgc cgaatgtagg acaaga 26 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 23 atgaacggct gttactcacg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 24 gattccgagt tcagctccaa 20 <210> 25 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> mi sc_binding <222> (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (27) <223> Label TAMRA (6-carboxy-N, N, N ', N '-tetramethylrhodamine) <400> 25 tggagattct ccagcacgtc atcgact 27 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 26 tcacccacac tgtgcccatc tacga 25 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 27 cagcggaacc gctcattgcc aatgg 25 <210> 28 <211 > 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222> (1) <223> Label FAM (6-carboxy -fluorescein) <220> <221> misc_binding <222> (7) <223> Label TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine) <400> 28 atgccctccc ccatgccatc ctgcgt 26 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> D escription of Artificial Sequence: an artificially synthesized primer sequence <400> 29 gaaggtgaag gtcggagt 18 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized primer sequence <400> 30 gaagatggtg atgggatttc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially synthesized TaqMan probe sequence <220> <221> misc_binding <222 > (1) <223> Label FAM (6-carboxy-fluorescein) <220> <221> misc_binding <222> (20) <223> Label TAMRA (6-carboxy-N, N, N ', N'-tetramethylrhodamine ) <400> 31 caagcttccc gttctcagcc 20

[Brief description of the drawings]

FIG. 1 is a graph showing the results of measuring the expression level of the NB-1 gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. The left side is β-
The result corrected with the actin gene and the right side are the result corrected with the GAPDH gene. Upper graph is contrast (left)
5 is a graph showing the relative expression level of each cell lot when stimulated with IL-4 (middle) and IL-13 (right). The lower part is a graph showing the movement of the expression level after 24 hours when treated with other cytokines.

FIG. 2 is a graph showing the results of measuring the expression level of the E48 antigen gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. Each graph shows the same contents as in FIG.

FIG. 3 is a graph showing the results of measuring the expression level of c-fos gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. Each graph shows the same contents as in FIG.

FIG. 4. Involucrin in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines
5 is a graph showing the result of measuring the expression level of a gene. Each graph shows the same contents as in FIG.

FIG. 5 is a graph showing the results of measuring the expression level of BENE gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. Each graph shows the same contents as in FIG.

FIG. 6 is a graph showing the results of measuring the expression level of the HBp17 gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. Each graph shows the same contents as in FIG.

FIG. 7 is a graph showing the results of measuring the expression level of the fibronectin gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. Each graph shows the same contents as in FIG.

FIG. 8 is a graph showing the results of measuring the expression level of the Id1 gene in cultured bronchial epithelial cells stimulated with IL-4 and IL-13 or other cytokines. Each graph shows the same contents as in FIG.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/15 G01N 33/50 Z 33/50 33/53 M 33/53 D Q 33/566 33/566 A61K 37/02 // C12N 15/09 C12N 15/00 A (72) Inventor Yasu Yoshida 907 Nogawa, Miyamae-ku, Kawasaki-shi, Kanagawa Inside, Biotechnology Research Center, Teikyo University Inside Genox Drug Discovery Institute, Inc. (72) Inventor Yuji Sugita 907 Nogawa, Miyama-ku, Kawasaki City, Kanagawa Prefecture Inside the Biotechnology Research Center, Teikyo University Inside Genox Drug Discovery Laboratory Inc. F term (reference) 2G045 AA25 AA34 AA35 AA40 CB01 CB09 DA12 DA13 DA14 DA36 DA77 FB01 FB03 4B024 AA11 CA01 CA09 HA12 4B063 QA19 QQ02 QQ53 QQ79 QQ96 QR08 QR32 QR42 QR48 QR62 QS25 QS33 QX02 4C084 AA02 AA17 CA56 CA59 ZB132

Claims (14)

[Claims] 1. A method for testing an allergic disease, comprising the following steps: a) NB-1, E48 antigen, c-fo in a biological sample of a subject
measuring the expression level of any gene selected from the group consisting of s, involucrin, BENE, HBp17, fibronectin, and Id1 b) comparing the expression level of the gene in a biological sample of a healthy subject 2. The test method according to claim 1, wherein the allergic disease is bronchial asthma. 3. The method according to claim 1, wherein the expression level of the gene is measured by cDNA PCR. 4. The method according to claim 1, wherein the expression level of the gene is measured by detecting a protein encoded by the gene.
Inspection method described in 1. (5) NB-1, E48 antigen, c-fos, involucrin, BEN
E, a polynucleotide comprising a nucleotide sequence of any gene selected from the group consisting of HBp17, fibronectin, and Id1, or an oligonucleotide having a length of at least 15 nucleotides having a nucleotide sequence complementary to its complementary strand An allergic disease test reagent comprising nucleotides. 6. NB-1, E48 antigen, c-fos, involucrin, BEN
A reagent for testing an allergic disease, comprising an antibody that recognizes a peptide containing the amino acid sequence of any protein selected from the group consisting of E, HBp17, fibronectin, and Id1. 7. A method for screening a therapeutic agent for an allergic disease, comprising the following steps: (1) NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7. a step of contacting the candidate compound with cells expressing any gene selected from the group consisting of fibronectin and Id1, and / or any gene functionally equivalent to these genes (2) Measuring the expression level of the gene, (3) selecting a compound that increases the expression level of the gene as compared to a control 8. The method according to claim 7, wherein the cells are established airway epithelial cells. 9. A method for screening a therapeutic agent for an allergic disease, comprising the following steps: (1) Step of administering a candidate compound to a test animal; (2) NB-1, E48 antigen, c-fos, invo in a biological sample of the test animal
measuring the expression intensity of any gene selected from the group consisting of lucrin, BENE, HBp17, fibronectin, and Id1, and / or any gene functionally equivalent to these genes; and 3) selecting a compound that increases the expression level of the gene as compared to a control 10. A method for screening a therapeutic agent for an allergic disease, comprising the following steps. (1) NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7, the transcriptional regulatory region of any gene selected from the group consisting of fibronectin and Id1, and / or any gene functionally equivalent to these genes, and Contacting the candidate substance with a cell into which the vector containing the expressed reporter gene has been introduced, (2) measuring the activity of the reporter gene, and (3) a compound that increases the expression level of the gene as compared to a control The process of selecting 11. A method for screening a therapeutic agent for an allergic disease, comprising the following steps: (1) NB-1, E48 antigen, c-fos, involucrin, BENE, HBp1
7. a step of contacting a candidate substance with any protein selected from the group consisting of fibronectin and Id1, and / or any protein functionally equivalent to these proteins, (2) the protein Measuring the activity and (3) selecting a compound that increases the activity of the protein compared to a control 12. A remedy for allergic diseases, comprising as an active ingredient a compound obtainable by the screening method according to any one of claims 7, 9, 10, and 11. 13. An NB-1, E48 antigen, c-fos, involucrin, BE
A therapeutic agent for an allergic disease, comprising as a main component any one of the genes themselves selected from the group consisting of NE, HBp17, fibronectin, and Id1, or a protein encoded by the gene. 14. NB-1, E48 antigen, c-fos, involucrin, BE
A trans gene that has reduced expression intensity in airway epithelial cells of any gene selected from the group consisting of NE, HBp17, fibronectin, and Id1, and / or any gene functionally equivalent to these genes. Use of a transgenic non-human vertebrate as a model animal for allergic disease.