WO2000058514A2 - Methods for improving sensitivity and specificity of screening assays - Google Patents
Methods for improving sensitivity and specificity of screening assays Download PDFInfo
- Publication number
- WO2000058514A2 WO2000058514A2 PCT/US2000/007882 US0007882W WO0058514A2 WO 2000058514 A2 WO2000058514 A2 WO 2000058514A2 US 0007882 W US0007882 W US 0007882W WO 0058514 A2 WO0058514 A2 WO 0058514A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sample
- cancer
- nucleic acid
- precancer
- assay
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
- Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
- Y10T436/143333—Saccharide [e.g., DNA, etc.]
Definitions
- the invention relates to assays to detect nucleic acid markers of cancer with high specificity and high sensitivity for detection.
- Cancer is thought to arise from a multi-step process that typically involves multiple genetic mutations leading to uncontrolled cell growth. Many cancers are curable if detected early in their development. For example, colorectal cancers typically originate in the coionic epithelium, and are not extensively vascularized (and therefore not invasive) during early stages of development. The transition to a highly- vascularized, invasive and ultimately metastatic cancer commonly takes ten years or longer. If the presence of cancer is detected prior to extensive vascularization, surgical removal typically is an effective cure. However, colorectal cancer is often detected only upon manifestation of clinical symptoms, such as pain and bloody stool. Generally, such symptoms are present only when the disease is well established, and often after metastasis has occurred. Similarly, with the exception of the Pap smear for detection of pre-malignant cervical lesions, diagnostic screening methods for other types of cancer are best at detecting established disease. Most diagnostic assays for cancer are invasive, or at least uncomfortable.
- Invasive procedures range from performing a tissue biopsy to surgery. Cancer screening procedures frequently result in significant patient discomfort. For example, magnetic resonance imaging requires confinement of the patient, and colonoscopy requires sedation. The discomfort associated with typical invasive screening methods reduces patient compliance with routine screening procedures.
- the likelihood of a false positive test result is a function of the specificity of the test.
- the specificity of a test (expressed as a percentage) is the likelihood that any individual who is negative for disease tests negative for that disease.
- false negative results are a property of the sensitivity of the test. Sensitivity (also expressed as a percentage) provides the likelihood that a test for a specific disease will identify as positive an individual having that disease. Thus, 5% of the individuals determined to have a disease using an assay with a specificity of 95% will actually not have the disease.
- an assay with a sensitivity of 95% will incorrectly identify a diseased individual as disease-free 5% of the time.
- the problems of sensitivity and specificity are exaggerated in assays for the early detection of cancer because patient samples on which such early detection is performed typically contain relatively small amounts of cancerous cellular material in relation to non-cancerous cellular material.
- patient samples are a heterogeneous mixture of large amounts of normal cells and small amounts of cancerous cells.
- a good example of such a heterogeneous sample is stool.
- the typical stool sample contains cells and cellular debris sloughed from the coionic epithelium, byproducts of digestion, and bacteria.
- colorectal cancer In its early stages, colorectal cancer is thought to affect only about 1% of coionic epithelial cells. Any attempt to detect nucleic acids from the 1 % of affected cells in the heterogeneous background of the stool sample might give rise to very low sensitivities. Attempts to identify the presence of the indicia of cancer in other heterogeneous samples, such as sputum, pus, urine, nipple aspirate, etc., presents similar problems.
- Methods of the invention solve the problem of obtaining accurate (high sensitivity and high specificity) results in an assay for indicia of cancer or precancer in a heterogeneous sample.
- the present invention provides assays conducted on samples obtained non- invasively or minimally-invasively for cancer or precancer in which the assays have a high sensitivity for detection of cancer or precancer when it is present in a patient sample, and a high specificity against false positive results.
- methods of the invention provide the benefits of high sensitivity and high specificity in an assay to detect a small amount of a cancer marker (e.g., a nucleic acid) in a heterogeneous sample having predominantly non-cancerous cells and cellular debris. Accordingly, such methods are especially useful for early detection of cancer or precancer. Methods of the invention greatly increase the accuracy of molecular screening and diagnostic assays for the early detection of cancer or precancer.
- the present invention contemplates that one reason prior art non-invasive methods (i.e., methods conducted on samples obtained non-invasively or minimally invasively) for detecting molecular indicia (especially nucleic acid mutations) of cancer have failed to provide satisfactory results is that such methods have not addressed maintaining high specificity and/or high sensitivity in the assay. Such methods also fail to recognize the benefits of combining high sensitivity and high specificity features in an assay to detect early indicia of cancer, especially when the detection is performed in a heterogeneous sample.
- the present invention recognizes that screening assays for indicia of cancer, especially early-stage cancer (e.g., when cancer indicia represents about 1% of the cells and cellular debris in an appropriate sample as discussed below), are improved by increasing the specificity and/or the sensitivity of the assay. As described below, the specificity and sensitivity of molecular assays can be improved in several ways.
- methods of the invention comprise selecting one or more nucleic acid target(s) that is (are) suspected to be mutated in cancer or precancer, identifying in a biological sample the presence of the one or more selected target(s), such that the probability of identifying as positive any sample comprising target is at least about 44%, and preferably about 50%, and most preferably between about 60% and about 95%, and the probability of identifying as negative a sample not having any target is at least about 85%, and preferably between about 90% and about 100%.
- the present invention provides methods for improving the sensitivity and specificity of molecular cancer screening assays by analyzing a plurality of target nucleic acids suspected to be mutated in cancer or precancer, such that the cumulative sensitivity of analyzing the plurality of targets is at least about 50%, and the cumulative specificity of analyzing the plurality of targets is at least about 85%.
- Methods of the invention also comprise selecting nucleic acid mutations for analysis in a cancer or precancer screening assay based upon the probability of occurrence of the mutations in cancer patients, and such that the probability of identifying at least one of the mutations in a patient sample having at least one of the mutations is between about 50% and about 95%. Methods of the invention also comprise selecting one or more nucleic acid mutations in order to optimize the sensitivity and specificity of a cancer or precancer screening assay, and conducting the assay in order to diagnose cancer or precancer.
- screening assays of the invention analyze at least two, and preferable between about 3 and about 20 markers (e.g., mutations, loss of heterozygosity, sequence length variations, nucleic acid molecular weight variations, variations in amounts of amplifiable nucleic acid) in patient samples in order to improve the sensitivity and specificity of detection.
- markers e.g., mutations, loss of heterozygosity, sequence length variations, nucleic acid molecular weight variations, variations in amounts of amplifiable nucleic acid
- Such "multiple target" assays allow improved sensitivity because the increased number of markers that are analyzed decreases the likelihood that a patient presenting with indicia of cancer or precancer will be misdiagnosed as negative (i.e., as not having cancer).
- Methods of the invention further comprise selecting nucleic acid markers suspected to be indicative of cancer or precancer, validating the informativeness of the markers in order to select a subset of markers that provide high sensitivity and specificity in an assay for the detection of cancer or precancer in patient samples, and screening patient samples for the presence of the selected subset of markers.
- the nucleic acid markers are mutations known or suspected to be indicative of cancer or precancer.
- the validating step comprises determining the extent to which detection of a marker used in connection with a particular screening assay predicts whether a patient from whom the sample was obtained has cancer or precancer.
- such validating methods are performed by comparing results from samples obtained from a first group of patients known to have cancer or precancer and those obtained from a second group known not to have cancer or precancer as determined by an accepted standard (typically invasive) method.
- Methods of the invention also comprise combining detection of a mutation known or suspected to be associated with cancer or precancer with detection of loss of heterozygosity at a relevant genomic locus. The combination of analyzing both mutations in cancer-associated nucleic acids, and loss of heterozygosity increases the specificity and sensitivity of any screening assay for cancer or precancer.
- such methods comprise validating selected loci for use in a screening assay such that the assay produces results with high sensitivity and high specificity.
- the sensitivity of the assay is at least 50%, and the specificity of the assay is at least 85%.
- Methods of the invention comprise combining two or more assays for molecular indicia of cancer or precancer in order to achieve a desired level of informativeness.
- methods of the invention comprise combining two or more assays selected from quantitative PCR, multiple mutation analysis, detection of loss of heterozygosity, and hybrid capture of one or more mutant nucleic acid markers. Accordingly, increased sensitivity and specificity is observed when an assay based upon the amount of amplifiable DNA is combined with an assay for a particular cancer-associated mutation. Examples of these "combination assays", and their resulting sensitivities and specificities, are provided in the detailed description. Such methods are especially useful when applied to a heterogeneous sample in which the nucleic acid to be detected is present in a very small amount relative to other nucleic acids (as well as other molecules) in the sample.
- Methods of the invention also make use of the "informativeness" of markers used therein.
- the Informativeness of a nucleic acid marker relates to the likelihood of finding the marker in a positive sample.
- a particular mutation for example a mutation in codon 12 of K-ras
- Methods of the invention combine the use of informative markers (e.g., mutations) and high sensitivity/specificity assays in order to provide reliable screening assays for early diagnosis of cancer or precancer, especially in heterogeneous samples.
- a mutation is a deletion, addition, substitution, rearrangement, or translocation in a nucleic acid.
- a loss of heterozygosity is a form of mutation in which all or a portion of one allele is deleted.
- the terms "markers”, “targets”, and “mutations” include nucleic acid (especially DNA) mutations (substitutions, additions, rearrangements, translocations, deletions, etc.), as well as other nucleic acid indicia useful in methods of the invention.
- Such indicia include the amount of amplifiable nucleic acid in a sample, the length of nucleic acids in a sample, the ratio of long nucleic acids (greater than about 200 bp) to short nucleic acids (less than about 200 bp), and any other nucleic acid variations that differ in patients with cancer and disease- free patients.
- the terms "healthy” or “disease-free” are intended to mean a patient who does not have cancer or precancer.
- Stool is a good example of a heterogeneous sample in which methods of the invention are especially useful.
- a typical stool sample contains patient nucleic acids, but also contains heterologous nucleic acids, proteins, and other cellular debris consistent with the lytic function of the various nucleases, proteinases, etc. found in the colon.
- nucleic acid indicative of an adenoma or tumor comprise only about 1 % of the nucleic acid in a voided stool. If a patient is left untreated, proportionately more disease-related nucleic acids are found in stool over time.
- Methods of the invention are useful for detecting early-stage lesions in heterogeneous samples such as stool. Methods of the invention result in a high degree of sensitivity and specificity for the detection of early-stage disease. Methods of the invention are especially useful in detecting, for example, adenomas in the colon.
- Adenomas are non-metastatic lesions that frequently have the potential for metastasis. If all adenomas in a patient are detected and removed, the probability of complete cure is virtually certain.
- nucleic acids or nucleic acid mutations having a high degree of informativeness are chosen.
- One or more assay(s) is (are) conducted to reliably detect one or more informative nucleic acids, and a diagnosis is made based upon the presence in a patient sample of any one of the informative nucleic acids.
- nucleic acids are chosen as targets for analysis in methods of the invention based upon their length and/or sequence characteristics. For example, it has now been discovered that the quantity and/or length of nucleic acids in stool (a prototypical heterogeneous sample) presents a high degree of informativeness regarding a patient's disease status. Patients having, for example, an adenoma produce stool specimens containing more and longer DNA than specimens produced by healthy patients.
- DNA mutations are useful in methods of the invention. These include, mutations in the oncogene, Kras (especially mutations at codons 12 and 13); mutations in the cell-cycle regulator, p53; mutations in the ape gene; mutations in the bat-26 segment of the MSH2 mismatch repair gene; and loss of heterozygosity (typically indicated by massive loss of DNA in one allele but not the other).
- methods of the invention provide that the informativeness of an assay is increased by screening multiple mutations simultaneously or in sequence, or by combining different assays.
- methods of the invention provide informative molecular assays for cancer or precancer by providing samples for analysis that have sufficient amplifiable nucleic acid.
- methods of the invention comprise screening samples for amplifiable DNA; classifying samples based upon the amount of DNA capable of being amplified from them; and further screening samples with a predetermined threshold of amplified or amplifiable DNA for the presence of a mutation indicative of cancer or precancer.
- methods of the invention comprise selecting one or more mutational events that are indicative of cancer or precancer, such that the combined informativeness of the one or more events meets or exceeds a predetermined or desired level of informativeness.
- the informativeness of any mutation or combination of mutations may be validated by an accepted invasive screening technique. For example, in methods to detect colorectal cancer, the informativeness of a molecular assay may be determined by identification of a lesion using colonoscopy.
- Figure 1 is a polyacrylamide gel showing exemplary "A”, “B”, “C”, and “F” amplifications for use in assays to determine an amount of amplifiable nucleic acid in a sample.
- Lanes 1 , 4, 5, 6, and 7 show an "A” amplification
- lane 2 shows a “C” application
- lane 3 shows a "B” amplification
- lane 8 shows an "F” amplification (no amplifiable DNA).
- Methods of the invention provide non-invasive or minimally-invasive assays for the detection of cancer or precancer at early stages of disease. Methods of the invention are especially useful in detecting cancer or precancer in heterogeneous biological samples. Preferred methods comprise identifying in a patient sample one or more nucleic acid mutations(s) that provide high sensitivity and high specificity for detection of the indicia of cancer or precancer. Methods of the invention may comprise identifying mutations having a known informativeness for cancer or precancer, or may be based upon validating selected mutations or assays to detect them with respect to a standard assay for cancer.
- non-invasive or minimally-invasive means that specimens for analysis are obtained either from bodily excretions (e.g. stool, pus, sputum) or bodily fluids such as blood aspirate, or lymph.
- bodily excretions e.g. stool, pus, sputum
- bodily fluids such as blood aspirate, or lymph.
- the invention will be exemplified with experiments to detect the presence of indicia of colorectal cancer or precancer in samples prepared from patient stool specimens.
- methods of the invention can be practiced using a variety of different samples in order to detect a variety of cancers.
- a reason that detection of colorectal cancer or precancer (e.g., an adenoma) is exemplified is that a stool specimen is a good example of a heterogeneous environment in which methods of the invention are especially useful (see above).
- colonoscopy and sigmoidoscopy, a related technique
- colonoscopy is a well-known invasive standard that has a high sensitivity and high specificity (although high cost and low patient compliance) with which methods of the invention can be compared and validated.
- Methods of the invention comprise screening a sample, such as one prepared from a stool specimen, for the presence of one or more marker(s) of cancer or precancer (e.g., a colorectal tumor or adenoma), such that the sensitivity of detection is between about 50% and about 100%, and the specificity of detection is between about 85% and about 100%.
- methods of the invention combine different types of assays in order to achieve an overall increase in sensitivity and specificity.
- methods of the invention comprise conducting an assay for a mutation known to be associated with cancer or precancer, and an assay for a quantity and/or length of DNA expected to occur in cancer or precancer in order to obtain the combined benefits of the sensitivity and specificity of both assays.
- a single- marker assay is sufficient for practice of the invention if its sensitivity and specificity are within the ranges taught herein.
- genomic targets and assay methods used according to the invention can vary depending upon the desired level of sensitivity and specificity, as well as the type of cancer or precancer the detection of which is desired.
- Genomic targets e.g., mutations
- methods of the invention comprise the detection of a mutation at a single, informative locus.
- assays for informative loci are combined in order to achieve improved sensitivity and specificity of detection relative to invasive techniques.
- methods of the invention contemplate a combination of assays selected from multiple mutation detection, quantitative polymerase chain reaction (i.e., to determine the amount of amplifiable DNA in a sample), sequence-specific hybrid capture, oligo-ligation, amplification refractory mutation system, single-stranded conformational polymorphism detection, sequencing, mismatch detection, and single base extension.
- Target loci include chromosomes 1 , 5, 8, 17, and 18, particularly chromosome 5q, chromosome 17p, chromosome 8p, chromosome 1q, and chromosome 18q.
- Preferred loci for use in methods of the invention include p53, ape, bat-26, and others suspected to be predictive of cancer or precancer.
- genes are known to be associated with colorectal cancer, and their sensitivity and specificity are determined when not known in the literature by determining the percentage of tumors bearing the mutation, and the percentage of healthy specimens that bear the mutation from a sufficiently large and diverse population. This can be done empirically, or mathematically using algorithms that predict the likelihood of false positive and false negative screening results based upon data relating the presence of a mutation to the presence of cancer or precancer. Confirmation of a patient's clinical status can be accomplished by a standard test such - l i as colonoscopy in the case of colorectal cancer (which has a typical sensitivity of 95% and a typical specificity of 100%).
- preferred methods of the invention comprise obtaining at least a cross-section or circumfrential portion of a voided stool as taught in U.S. patent number 5,741 ,650, and co-pending, co-owned U.S. patent application serial number 09/059,718, both of which are incorporated by reference herein. While a cross- sectional or circumfrential portion of stool is desirable, methods provided herein are conducted on random samples obtained from voided stool, which include smears or scrapings. Once obtained, the stool specimen is homogenized.
- a preferable buffer for homogenization is one that contains at least 16mM ethylenediaminetetraacetic acid (EDTA).
- EDTA ethylenediaminetetraacetic acid
- a preferred buffer for stool homogenization comprises phosphate buffered saline, 20-100 mM NaCl or KCI, at least 150mM EDTA, and optionally a detergent (such as SDS) and a proteinase (e.g., proteinase K).
- nucleic acid is preferably isolated from the stool sample. Isolation or extraction of nucleic acid is not required in all methods of the invention, as certain detection techniques can be adequately performed in homogenized stool without isolation of nucleic acids. In a preferred embodiment, however, homogenized stool is spun to create a supernatant containing nucleic acids, proteins, lipids, and other cellular debris. The supernatant is treated with a detergent and proteinase to degrade protein, and the nucleic acid is phenol-chloroform extracted. The extracted nucleic acids are then precipitated with alcohol. Other techniques can be used to isolate nucleic acid from the sample. Such techniques include hybrid capture, and amplification directly from the homogenized stool. Nucleic acids can be purified and/or isolated to the extent required by the screening assay to be employed.
- Nucleic acids to be analyzed are chosen based upon known or suspected relationships between specific mutations and cancer or precancer. If desired, sequence-specific hybrid capture is used to isolate specific nucleic acids from the sample.
- Target nucleic acids may be analyzed by any method of the art. Examples of preferred methods include enumerative analysis of the loss of heterozygosity as taught in U.S. patent number 5,670,325, incorporated by reference herein. Enumerative methods do not require knowledge of the sequence of a mutant nucleic acid. Rather such methods determine that there has been an alteration (deletion, substitution, addition, rearrangement, or other mutation) in a wild-type nucleic acid. The investigated loci are chosen based upon the likelihood of an alteration being associated with cancer or precancer.
- Enumerative methods compare the number in a sample of a wild-type nucleic acid known not to be altered in cancer or precancer with the number of a wild- type nucleic acid known or suspected to be altered in cancer or precancer. A statistically-significant difference in the two numbers indicates a positive screen.
- Mutations in target nucleic acids may also be measured by single base extension techniques to identify a single nucleotide variant indicative of cancer or precancer.
- single base extension assay are cycled as taught in co-owned, co-pending U.S. patent application serial number 09/067,212, incorporated by reference herein.
- cycled single base extension reactions comprise annealing a nucleic acid primer immediately 5' to a region containing a single base to be detected.
- the single base to be detected represents a marker for mutation.
- the mutation may be a single point mutation or may be a larger mutation for which the single base is a marker. Two separate reactions are conducted.
- primer is annealed to target, and labeled (preferably 32 P) nucleic acids complementary to non-wild type (e.g. mutants indicative of disease) variants at the single base to be detected, and unlabeled dideoxy nucleic acids complementary to the wild-type base are combined.
- Primer extension is stopped the first time a wild-type (dideoxy) base is added to the primer. Presence of label in the extended primer is indicative of the presence of a mutation.
- a second tube, the positive control contains labeled nucleic acid complementary to the wild-type base in the presence of the primer.
- a DNA polymerase such as SequenaseTM (Amersham), is used for primer extension.
- thermostable polymerase such as Taq or thermal sequenase is used to allow more efficient cycling.
- the first and second probes bound to target nucleic acids are dissociated by heating the reaction mixture above the melting temperature of the hybrids. The reaction mixture is then cooled below the melting temperature of the hybrids and additional primer is permitted to associate with target nucleic acids for another round of extension reactions. In a preferred embodiment, 10 to 50 cycles of extension reactions are conducted. In a most preferred embodiment, 30 cycles of extension reactions are conducted. After completion of all cycles, extension products are isolated and detected. In alternative embodiments, chain-terminating methods other than dideoxy nucleotides may be used.
- methods of the invention are also useful for screening populations of patients in order to identify characteristics in population samples that are indicative of cancer or adenoma.
- methods of the invention comprise high sensitivity, high specificity screening of populations of patients in order to correlate nucleic acid mutations present in a subset of patient samples with the presence of disease in those patients.
- methods of the invention comprise detecting genomic variations in patient samples, correlating those variations with confirmed disease, and using the variations associated with confirmed disease as a diagnostic screen for the disease in subsequent patient samples. Such methods preferably are performed on pooled samples, such as stool samples, from identified populations of patients (e.g., diseased, healthy).
- Such methods are preferably based upon variations in single nucleotide polymorphic loci.
- the sensitivity and specificity of detecting variants in those loci as a function of disease is determined. Those loci that predict disease at predefined levels of sensitivity and specificity are selected for use in screening assays for unknown patient samples.
- the following examples provide specific exemplification of the concepts discussed above. The examples utilize a subset of mutational events that are shown to be predictive of disease. Other mutations are contemplated to function as high sensitivity, high specificity diagnostic or screening markers in assays of the invention. Moreover, the assays exemplified below are for purposes of illustration. The invention contemplates a variety of assays useful to screen patient samples for cancer or precancer as long as the assays provide a predetermined level of sensitivity and specificity of at least about 44% and at least about 85%, respectively.
- multiple mutation analysis is a preferred means for increasing the sensitivity and specificity of cancer or precancer detection.
- a mutation at one allele e.g., Kras, codon 13, position 2
- the informativeness of a second allele e.g., Kras codon 12, position 1 , or ape codon 1450, position 1
- the benefits of one aspect of the invention are presented below.
- Stool specimens were collected from 40 individuals who presented at the Mayo Clinic (Rochester, MN) with symptoms or history indicating that a colonoscopy should be performed. Each stool sample was frozen. Immediately after providing a stool sample, all individuals were given a colonoscopy in order to determine their disease status. Colonoscopy, an invasive test requiring sedation of the patient, has a sensitivity approaching 95%, and a specificity of nearly 100% for the diagnosis of coionic neoplasia. Based upon the colonoscopy results and subsequent histological analysis of biopsy samples taken during colonoscopy, individuals were placed into one of three groups: normal, cancer, and adenoma.
- An adenoma, or polyp is considered clinically relevant if it has a diameter of 1 cm or greater. Thus, all individuals in the adenoma group had a polyp of at least 1 cm in diameter. Patients in the cancer group had tumors diagnosed as cancer, and the disease-free individuals were those for whom colonoscopy showed no sign of cancer or adenoma. Based upon the colonoscopy results, 21 patients were diagnosed with cancer, 9 patients were diagnosed with an adenoma greater than 1 cm, and 10 patients were free of cancer or adenoma. Multiple mutation analysis was then performed, on a blinded basis (i.e., scientists performing the assays did not know the results of colonoscopy or histology), on each sample.
- Each frozen stool specimen weighing from 7-33 grams, was thawed, homogenized in 500 mM Tris, 16 mM EDTA, and 10 mM NaCl, pH 9.0, at a volume to mass ratio of about 3:1. Samples were then rehomogenized in the same buffer to a final volume-to-mass ratio of 20:1 , and spun in glass macro beads at 2356 x g. The supernatant was collected and treated with SDS and proteinase k. The DNA was then phenol-chloroform extracted and precipitated with alcohol. The precipitate was suspended in 10 mM Tris and 1 mM EDTA (1 x TE), pH 7.4. Finally, the DNA was treated with Rnase.
- K-ras probe was 5'GTGGAGTATTTGATAGTGTATTAACCTTATGTGTGAC 3' (SEQ ID NO: 1).
- apc-1309 was 5TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG 3' (SEQ ID NO: 2)
- apc-1378 was 5'CAGATAGCCCTGGACAAACAATGCCACGAAGCAGAAG 3' (SEQ ID NO: 3).
- Primer was extended, and the presence of labeled product indicated a mutation was present in the sample.
- a second reaction was run as a positive control in which only labeled wild-type complement was added to the reaction mixture.
- Primer extension incorporating the labeled base assured that the reaction was running properly.
- a positive sample was defined as one in which at least one of the two replicates possessed a mutation with 1 % heterogeneity for at least one of the single bases that was analyzed. Any sample in which at least one of the genes analyzed showed a mutation in duplicate was considered positive.
- Table 2 The total numbers of patients in the cancer/adenoma and normal groups are shown under the column "patient status”.
- a fecal occult blood test was run in parallel with the SBE test on all samples from patients diagnosed with an adenoma. Fecal occult blood testing failed to diagnosis any of the 9 adenoma-positive samples, and thus had a sensitivity of 0%. Accordingly, multiple mutation analysis has a far greater sensitivity and specificity than the most common non-invasive technique currently available (fecal occult blood).
- Example 2 the same 40 samples described in Example 1 were independently analyzed for their overall content of DNA in order to determine if the amount of amplifiable DNA in stools produced by individuals with cancer or precancer was different than the amount of amplifiable DNA produced in stools from cancer-free individuals. Samples were analyzed "blind”, and later correlated to colonoscopy results as described below.
- Figure 1 shows exemplary A, B, C, and F amplifications.
- the assay only requires that one differentiate "A” amplifications from any of "B", “C", and “F” amplifications.
- An "A” amplification is one that has a band intensity of that in lane 1 of Figure 1 , or to another gel band of similar intensity (e.g., lanes 4, 5, 6, or 7 of Figure 1).
- the markers to the right of Figure 1 show exemplary amounts of DNA giving rise to A, B, and C amplifications.
- results of the combined quantitative and multiple mutation analyses show a sensitivity of detection of 76% for cancer, and 78% for adenomas, each having a specificity of 100%. These results far exceed those of other non-invasive or minimally- invasive techniques (e.g., fecal occult blood testing which has a sensitivity of 0).
- the Bat-26 mismatch repair locus (shown in SEQ ID NO: 37) was next used to assess the same 40 samples described above. Deletions in Bat-26 have been associated with colorectal cancer or adenomas. Samples were prepared as described above. A primer was hybridized to the portion of the Bat-26 locus immediately upstream of the poly-A tract. Unlabeled deoxy thymidine, a mixture of labeled and unlabeled deoxycytosine, and unlabeled dideoxy adenine were added along with polymerase. The primer was extended through the poly-A region.
- the labeled and unlabelled cytosine was extended for the next three bases (nucleotides 222-224, all guanines in the intact sequence) such that label was incorporated into each extended primer.
- the dideoxy adenosine stops primer extension by addition at the end of a primer that has been extended through the poly-A and triguanine regions. Strands were separated, and the length of the strands was observed on a polyacrylamide gel to detect deletions in the poly-A tract. The results are presented below in Table 5: TABLE 5
- Bat-26 alone did not provide the high sensitivity achieved using multiple mutation or quantitation alone, but showed high sensitivity in comparison with other single locus detection assays.
- Bat-26 in combination with the other techniques described above produced an overall increase in sensitivity and specificity.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP00918364A EP1185693B1 (en) | 1999-03-26 | 2000-03-24 | Methods for improving sensitivity and specificity of screening assays for cancer and precancer |
| JP2000608792A JP2002539848A (ja) | 1999-03-26 | 2000-03-24 | スクリーニングアッセイの感度および特異性を改良するための方法 |
| DE60030281T DE60030281T2 (de) | 1999-03-26 | 2000-03-24 | Methoden zur verbesserung der sensitivität und spezifität von screeningverfahren für krebs und krebs-vorstufen |
| CA2369045A CA2369045C (en) | 1999-03-26 | 2000-03-24 | Methods for improving sensitivity and specificity of screening assays |
| AU39189/00A AU761722B2 (en) | 1999-03-26 | 2000-03-24 | Methods for improving sensitivity and specificity of screening assays |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US09/277,016 | 1999-03-26 | ||
| US09/277,016 US6143529A (en) | 1996-08-14 | 1999-03-26 | Methods for improving sensitivity and specificity of screening assays |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000058514A2 true WO2000058514A2 (en) | 2000-10-05 |
| WO2000058514A3 WO2000058514A3 (en) | 2001-12-13 |
Family
ID=23059077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/007882 Ceased WO2000058514A2 (en) | 1999-03-26 | 2000-03-24 | Methods for improving sensitivity and specificity of screening assays |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US6143529A (https=) |
| EP (1) | EP1185693B1 (https=) |
| JP (3) | JP2002539848A (https=) |
| AT (1) | ATE337413T1 (https=) |
| AU (1) | AU761722B2 (https=) |
| CA (1) | CA2369045C (https=) |
| DE (1) | DE60030281T2 (https=) |
| WO (1) | WO2000058514A2 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000061808A3 (en) * | 1999-04-09 | 2001-08-02 | Exact Lab Inc | Methods for detecting nucleic acids indicative of cancer |
| US6586177B1 (en) | 1999-09-08 | 2003-07-01 | Exact Sciences Corporation | Methods for disease detection |
| WO2004079004A1 (en) * | 2003-03-07 | 2004-09-16 | Istituto Oncologico Romagnolo Cooperativa Sociale A R.L. | Method for the identification of colorectal tumors |
| US6818404B2 (en) | 1997-10-23 | 2004-11-16 | Exact Sciences Corporation | Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples |
| WO2006094149A3 (en) * | 2005-03-01 | 2006-11-09 | Exact Sciences Corp | Methods and compositions for detecting adenoma |
| US9777314B2 (en) | 2005-04-21 | 2017-10-03 | Esoterix Genetic Laboratories, Llc | Analysis of heterogeneous nucleic acid samples |
Families Citing this family (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6406857B1 (en) | 1997-06-16 | 2002-06-18 | Exact Sciences Corporation | Methods for stool sample preparation |
| US6268136B1 (en) * | 1997-06-16 | 2001-07-31 | Exact Science Corporation | Methods for stool sample preparation |
| AU752817B2 (en) | 1999-02-25 | 2002-10-03 | Exact Sciences Corporation | Methods for preserving DNA integrity |
| US6849403B1 (en) * | 1999-09-08 | 2005-02-01 | Exact Sciences Corporation | Apparatus and method for drug screening |
| US6919174B1 (en) * | 1999-12-07 | 2005-07-19 | Exact Sciences Corporation | Methods for disease detection |
| CA2394921A1 (en) | 1999-12-07 | 2001-06-14 | Anthony P. Shuber | Supracolonic aerodigestive neoplasm detection |
| US7250252B2 (en) * | 1999-12-30 | 2007-07-31 | David Aaron Katz | Amplification based polymorphism detection |
| US6585646B2 (en) * | 2000-11-29 | 2003-07-01 | Hermetic Diagnostics, Inc. | Screening test and procedure using skin patches |
| US6911308B2 (en) * | 2001-01-05 | 2005-06-28 | Exact Sciences Corporation | Methods for detecting, grading or monitoring an H. pylori infection |
| US6428964B1 (en) | 2001-03-15 | 2002-08-06 | Exact Sciences Corporation | Method for alteration detection |
| US6727354B2 (en) * | 2001-12-12 | 2004-04-27 | Quest Diagnostics Investments, Inc. | Compositions and methods for TIGR genotyping assays |
| US20030180765A1 (en) * | 2002-02-01 | 2003-09-25 | The Johns Hopkins University | Digital amplification for detection of mismatch repair deficient tumor cells |
| US7776524B2 (en) | 2002-02-15 | 2010-08-17 | Genzyme Corporation | Methods for analysis of molecular events |
| WO2004046386A1 (en) | 2002-11-15 | 2004-06-03 | Genomic Health, Inc. | Gene expression profiling of egfr positive cancer |
| US20040231909A1 (en) | 2003-01-15 | 2004-11-25 | Tai-Yang Luh | Motorized vehicle having forward and backward differential structure |
| AU2004211955B2 (en) * | 2003-02-06 | 2009-05-14 | Cedars-Sinai Medical Center | Gene expression markers for response to EGFR inhibitor drugs |
| WO2004074518A1 (en) * | 2003-02-20 | 2004-09-02 | Genomic Health, Inc. | Use of intronic rna to measure gene expression |
| AU2004248140A1 (en) * | 2003-05-30 | 2004-12-23 | Cedars-Sinai Medical Center | Gene expression markers for response to EGFR inhibitor drugs |
| HUE050365T2 (hu) | 2003-06-24 | 2022-09-28 | Genomic Health Inc | Rákkiújulás valószínûségének elõrejelzése |
| AU2004258085B2 (en) * | 2003-07-10 | 2010-05-27 | Genomic Health, Inc. | Expression profile algorithm and test for cancer prognosis |
| CA2542656A1 (en) * | 2003-10-16 | 2005-05-06 | Genomic Health, Inc. | Qrt-pcr assay system for gene expression profiling |
| AU2004309396B2 (en) * | 2003-12-23 | 2010-05-13 | Genomic Health, Inc. | Universal amplification of fragmented RNA |
| ES2636470T3 (es) * | 2004-04-09 | 2017-10-05 | Genomic Health, Inc. | Marcadores de expresión génica para predecir la respuesta a la quimioterapia |
| WO2005108621A1 (en) * | 2004-04-30 | 2005-11-17 | Yale University | Methods and compositions for cancer diagnosis |
| WO2006026654A2 (en) | 2004-08-27 | 2006-03-09 | Exact Sciences Corporation | Method for detecting a recombinant event |
| CA2584723A1 (en) | 2004-10-22 | 2006-05-04 | Redpath Integrated Pathology, Inc. | Enhanced amplifiability of minute fixative-treated tissue samples, minute stained cytology samples, and other minute sources of dna |
| US9109256B2 (en) | 2004-10-27 | 2015-08-18 | Esoterix Genetic Laboratories, Llc | Method for monitoring disease progression or recurrence |
| CA2585571C (en) * | 2004-11-05 | 2020-01-21 | Genomic Health, Inc. | Predicting response to chemotherapy using gene expression markers |
| JP4939425B2 (ja) * | 2004-11-05 | 2012-05-23 | ジェノミック ヘルス, インコーポレイテッド | 乳癌の治療反応の予後および予測の分子指標 |
| US20070248546A1 (en) * | 2005-11-09 | 2007-10-25 | Exact Sciences Corporation | Clinical algorithm for excluding patients identified in virtual imaging |
| JPWO2008090930A1 (ja) * | 2007-01-23 | 2010-05-20 | オリンパス株式会社 | 癌の診断方法 |
| JP5566111B2 (ja) * | 2007-11-20 | 2014-08-06 | オリンパス株式会社 | Rna回収方法 |
| EP2816122A1 (en) | 2008-02-15 | 2014-12-24 | Mayo Foundation For Medical Education And Research | Detecting neoplasm from a stool sample |
| GB201107466D0 (en) | 2011-05-05 | 2011-06-15 | Loktionov Alexandre | Device and method for non-invasive collection of colorectal mucocellular layer and disease detection |
| US9341628B2 (en) | 2012-11-30 | 2016-05-17 | Interpace Diagnostics Corporation | Methods for measuring carcinoembryonic antigen |
| CA2902916C (en) | 2013-03-14 | 2018-08-28 | Mayo Foundation For Medical Education And Research | Detecting neoplasm |
| JP6294614B2 (ja) | 2013-05-08 | 2018-03-14 | 有限会社マイテック | 癌関連物質の定量方法 |
| US10253358B2 (en) | 2013-11-04 | 2019-04-09 | Exact Sciences Development Company, Llc | Multiple-control calibrators for DNA quantitation |
| US10138524B2 (en) | 2013-12-19 | 2018-11-27 | Exact Sciences Development Company, Llc | Synthetic nucleic acid control molecules |
| US10184154B2 (en) | 2014-09-26 | 2019-01-22 | Mayo Foundation For Medical Education And Research | Detecting cholangiocarcinoma |
| US10435755B2 (en) | 2015-03-27 | 2019-10-08 | Exact Sciences Development Company, Llc | Detecting esophageal disorders |
| CN114574585A (zh) | 2015-08-31 | 2022-06-03 | 梅约医药教育及研究基金会 | 检测胃肿瘤 |
| WO2018017710A1 (en) | 2016-07-19 | 2018-01-25 | Exact Sciences Development Company, Llc | Nucleic acid control molecules from non-human organisms |
| EP3978624B1 (en) | 2016-07-19 | 2025-03-26 | Exact Sciences Corporation | Methylated control dna |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SE501439C2 (sv) * | 1993-06-22 | 1995-02-13 | Pharmacia Lkb Biotech | Sätt och anordning för analys av polynukleotidsekvenser |
| EP0871768B1 (en) * | 1995-03-17 | 2004-07-07 | John Wayne Cancer Institute | Detection of melanoma metastases with a multiple marker assay |
| DE19736691A1 (de) * | 1997-08-22 | 1999-02-25 | Michael Prof Dr Med Giesing | Verfahren zur Charakterisierung und Identifizierung disseminierter und metastasierter Krebszellen |
-
1999
- 1999-03-26 US US09/277,016 patent/US6143529A/en not_active Expired - Lifetime
-
2000
- 2000-03-24 AT AT00918364T patent/ATE337413T1/de not_active IP Right Cessation
- 2000-03-24 EP EP00918364A patent/EP1185693B1/en not_active Expired - Lifetime
- 2000-03-24 AU AU39189/00A patent/AU761722B2/en not_active Ceased
- 2000-03-24 JP JP2000608792A patent/JP2002539848A/ja active Pending
- 2000-03-24 DE DE60030281T patent/DE60030281T2/de not_active Expired - Lifetime
- 2000-03-24 CA CA2369045A patent/CA2369045C/en not_active Expired - Fee Related
- 2000-03-24 WO PCT/US2000/007882 patent/WO2000058514A2/en not_active Ceased
-
2010
- 2010-05-17 JP JP2010113710A patent/JP2010172347A/ja active Pending
-
2013
- 2013-03-21 JP JP2013057677A patent/JP2013116131A/ja active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6818404B2 (en) | 1997-10-23 | 2004-11-16 | Exact Sciences Corporation | Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples |
| WO2000061808A3 (en) * | 1999-04-09 | 2001-08-02 | Exact Lab Inc | Methods for detecting nucleic acids indicative of cancer |
| US6586177B1 (en) | 1999-09-08 | 2003-07-01 | Exact Sciences Corporation | Methods for disease detection |
| WO2004079004A1 (en) * | 2003-03-07 | 2004-09-16 | Istituto Oncologico Romagnolo Cooperativa Sociale A R.L. | Method for the identification of colorectal tumors |
| US8343722B2 (en) | 2003-03-07 | 2013-01-01 | Istituto Oncologico Romagnolo Cooperativa Sociale a.r.l. | Method for the identification of colorectal tumors |
| WO2006094149A3 (en) * | 2005-03-01 | 2006-11-09 | Exact Sciences Corp | Methods and compositions for detecting adenoma |
| US9777314B2 (en) | 2005-04-21 | 2017-10-03 | Esoterix Genetic Laboratories, Llc | Analysis of heterogeneous nucleic acid samples |
Also Published As
| Publication number | Publication date |
|---|---|
| ATE337413T1 (de) | 2006-09-15 |
| JP2002539848A (ja) | 2002-11-26 |
| JP2010172347A (ja) | 2010-08-12 |
| US6143529A (en) | 2000-11-07 |
| CA2369045C (en) | 2010-06-01 |
| EP1185693B1 (en) | 2006-08-23 |
| WO2000058514A3 (en) | 2001-12-13 |
| JP2013116131A (ja) | 2013-06-13 |
| DE60030281T2 (de) | 2007-08-30 |
| AU3918900A (en) | 2000-10-16 |
| AU761722B2 (en) | 2003-06-05 |
| CA2369045A1 (en) | 2000-10-05 |
| DE60030281D1 (de) | 2006-10-05 |
| EP1185693A2 (en) | 2002-03-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6143529A (en) | Methods for improving sensitivity and specificity of screening assays | |
| US6475738B2 (en) | Methods for detecting mutations using primer extension for detecting disease | |
| CA2352455C (en) | Methods for stool sample preparation | |
| AU767833B2 (en) | Methods of detecting colorectal disease | |
| US6406857B1 (en) | Methods for stool sample preparation | |
| EP0655090B1 (en) | Detection of gene sequences in biological fluids | |
| JP2010279394A (ja) | 疾患検出のための方法 | |
| EP1169479A2 (en) | Methods for detecting nucleic acids indicative of cancer | |
| EP0832285A1 (en) | Detection of gene sequences in biological fluids | |
| JP2003516161A (ja) | 核酸検出のための方法 | |
| WO1998058081A1 (en) | Methods for stool sample preparation | |
| US6063567A (en) | Method, reagents and kit for diagnosis and targeted screening for retinoblastoma | |
| US20040259101A1 (en) | Methods for disease screening | |
| JP4004628B2 (ja) | 尿を用いる膀胱癌の遺伝子検査法 | |
| US8043835B1 (en) | Methods for detecting and monitoring cancer using extracellular RNA | |
| EP2004862A2 (en) | Cancer detection reagents and uses in pathology and diagnostics and cancer cell death |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AU CA JP |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref country code: CA Ref document number: 2369045 Kind code of ref document: A Format of ref document f/p: F Ref country code: JP Ref document number: 2000 608792 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000918364 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 39189/00 Country of ref document: AU |
|
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AU CA JP |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| ENP | Entry into the national phase |
Ref document number: 2369045 Country of ref document: CA |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000918364 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 39189/00 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2000918364 Country of ref document: EP |