WO2000047741A1 - Glycosylated leptin compositions and related methods - Google Patents

Glycosylated leptin compositions and related methods Download PDF

Info

Publication number
WO2000047741A1
WO2000047741A1 PCT/US2000/003652 US0003652W WO0047741A1 WO 2000047741 A1 WO2000047741 A1 WO 2000047741A1 US 0003652 W US0003652 W US 0003652W WO 0047741 A1 WO0047741 A1 WO 0047741A1
Authority
WO
WIPO (PCT)
Prior art keywords
leptin
glycosylated
seq
protein
glycosylated leptin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/003652
Other languages
English (en)
French (fr)
Inventor
Frances H. Martin
Steven G. Elliott
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Inc
Original Assignee
Amgen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amgen Inc filed Critical Amgen Inc
Priority to SI200030863T priority Critical patent/SI1151102T1/sl
Priority to AU33623/00A priority patent/AU781460B2/en
Priority to DE60027409T priority patent/DE60027409T2/de
Priority to EP00911784A priority patent/EP1151102B1/en
Priority to JP2000598639A priority patent/JP4841037B2/ja
Priority to CA2359840A priority patent/CA2359840C/en
Publication of WO2000047741A1 publication Critical patent/WO2000047741A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/5759Products of obesity genes, e.g. leptin, obese (OB), tub, fat
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the present invention relates to glycosylated leptin compositions and related methods. Included are glycosylated leptin proteins having a Stokes' radius allowing for improved properties, as well as glycosylated leptin proteins having selected sites for glycosylation, nucleic acids encoding such proteins, related host cells, vectors, processes for production, and methods of use of such compositions. Novel methods of producing glycosylated proteins are also provided. Background
  • OB protein also referred to herein as “leptin”
  • the OB protein is active _in vivo in both ob/ob mutant mice (mice obese due to a defect in the production of the OB gene product) as well as in normal, wild type mice.
  • the biological activity manifests itself in, among other things, weight loss.
  • Recombinant leptin is effective in humans to result in weight loss.
  • Greenberg AS, Heymsfield SB, Fujioka K, et al . Preliminary safety and efficacy of recombinant methionyl human leptin (rL) administered by SC injection in lean and obese subjects.
  • administration of recombinant methionyl human leptin to obese humans has resulted in weight loss without toxicities. Further, the weight that is lost is predominantly fat.
  • Heymsfield et al . Weight and body composition changes in lean and obese subjects treated with recombinant methionyl human leptin. Poster presented at: International Congress on Obesity; August 29 - September 3, 1998; Paris, France, herein incorporated by reference.
  • kidney functions to clear the blood plasma of certain substances by concentrating them in the urine. See, e.g. , Harth, The Function of the Kidneys, In: Human Physiology, Schmidt et al . , eds . , Springer-Verlag New York, Heidelberg, Berlin, 1983 at pp. 610-642, herein incorporated by reference.
  • kidney clearance rates see, Anderson et al . , Renal and Systemic Mani estations of Glomerular Disease, In: The Kidney, Brener et al . , eds . , Harcort Brace Joanovich, Inc., Philadelphia, PA 1991 at pages 1831-1843, herein incorporated by reference .
  • Leptin may be accumulated in the systemic circulation by continuous administration, such as by osmotic pump or by chemically derivatizing the protein so that the circulation time is increased. See, e.g., PCT WO96/40912, published December 19, 1996 and herein incorporated by reference in its entirety.
  • Chemical derivatization of a reco binantly-produced protein generally requires, however, a two (or more) step process: step one, make the protein; step two, add a chemical moiety (such as a polyethylene glycol or dextran moiety), see, e.g. , PCT WO96/40912, supra, at page 8 et seq. for a description of N- terminally derivatizing leptin (therein referred to as OB Protein) .
  • OB Protein N- terminally derivatizing leptin
  • a fusion protein (alternatively called a "chimeric” protein) where an additional polypeptide moiety is encoded along with the desired protein, so that both are expressed. Lengthening the protein may also increase circulation time.
  • Polypeptides such as the "Fc" portion of an antibody, or albumin have been used in this regard. See e.g. , PCT WO 98/28427, herein incorporated by reference, entitled, "OB Fusion Protein Compositions and Methods.”
  • the general disadvantage in manufacturing is that larger expression products are sometimes more difficult to fold into proper conformations, and yields may be lower than those for smaller products. Further, the overall protein load per dose is increased, and the proportion of therapeutic protein is decreased, with the use of increasingly large sized fusion proteins.
  • carbohydrate on a protein can affect its clearance rate and may improve its potency in vivo, while at the same time it can affect the protein's intrinsic activity, solubility, stability and immunogenicity.
  • European Patent Publication 0 640 619 published March 1, 1995, entitled, "Erythropoietin analogs with additional glycosylation sites,” herein incorporated by reference
  • PCT patent publication WO 96/25498 published August 22, 1996, entitled, "MPL Ligand Analogs" both herein incorporated by reference.
  • carbohydrate may be added by eukaryotic cell production, without the need for a two-step process.
  • PCT/US96/06609 published November 14, 1996, herein incorporated by reference, proposes various mammalian signal sequences for secretion of an ob protein from a mammalian cell (at pages 11-12, for example).
  • N-linked oligosaccharides are attached to serine or threonine residues while N- linked oligosaccharides are attached to asparagine residues when they are a part of the sequence Asn-X- Ser/Thr , where X can be any amino acid except proline.
  • X can be any amino acid except proline.
  • the structures of N- linked and 0- linked oligosaccharides and the sugar residues found in each type are different.
  • One type of sugar that is commonly found on both is N-acetylneuraminic acid (hereafter referred to as sialic acid) .
  • Sialic acid is usually the terminal residue of both N- linked and 0- linked oligosaccharides in mammalian cells and, by virtue of its negative charge, may confer acidic properties to the glycoprotein .
  • the predominate form of naturally occurring human leptin (provided in human cells) is not glycosylated.
  • a variant of the naturally occurring protein having a glutamine absent at position 28 of the mature protein (SEQ ID NO. 2, infra) does contain two sites for glycosylation. These sites are both for 0- linked glycosylation. It is believed, however, that this form is produced in only trace amounts in humans, and is not the predominant active form _in vivo.
  • glycosylated leptin protein is functional in vivo, and, further, certain forms of glycosylated leptin protein have longer systemic circulation times in vivo, without toxicities. It has been found, surprisingly and importantly, that a glycosylated human leptin having a single N- linked glycosylation site has in vitro as well as in vivo biological activity. Further, the biological activity is equal to or is slightly more potent than recombinant human native leptin protein. As indicated above, leptin' s effect on obesity is thought to be due, in part, by action in the brain.
  • leptin is not a naturally glycosylated molecule (in the Q+28 form, SEQ ID NO. 1, infra, which is believed to be the predominant form in human serum) .
  • glycosylated proteins generally may not enter the brain because of an inability to cross the blood-brain barrier.
  • Demonstration of equal (or slightly better) biological activity by glycosylated leptin demonstrates either that (a) the glycosylated leptin enters the brain, or (b) if it doesn't, glycosylated leptin is more biologically effective in the peripheral tissues (such as visceral areas of adipose tissue) than native recombinant human leptin.
  • a human leptin which is N-glycosylated at three sites has a far longer circulation time and potency than recombinant native human leptin or leptin N-glycosylated at a single site.
  • various two-, three-, four-, and five- site glycosylated leptins have been prepared and tested for in vitro, and in some cases, jLn vivo activity.
  • the present glycosylated leptins may have a desired, relatively long plasma half life.
  • the present glycosylated leptins which have Stokes' radius of greater than or equal to 30A have a reduced rate of filterability through the membranes, and thus a reduced rate of degradation in the kidney.
  • Stokes' radii may be determined in a variety of ways, the preferred way herein is to use gel filtration chromatography. See generally, Le Maire et al . , Analytical Biochemistry 154: 525-535 (1986) herein incorporated by reference, for gel filtration chromatography for determining the Stokes' radii of various proteins for use as standards.
  • the present glycosylated leptins are those which have a Stokes' radii of about 30 A when determined using gel filtration chromatography. It is preferred that the present glycosylated leptins also substantially avoid clearance in the liver.
  • the liver is known to have receptors which bind galactose.
  • Galactose is a sugar and may be a component of the carbohydrate moiety on the present glycosylated leptins.
  • Sialic acid will typically "cap" the galactose moiety, and prevent its reactivity with galactose receptors in the liver. Additionally, a sialic acid moiety imparts a negative charge.
  • the present glycosylated leptin proteins are preferably those having at least a majority of the galactose moieties unavailable for binding to a galactose receptor, and more preferably, having a sialic acid moiety located at least a majority of the sites available for sialation.
  • the recombinant human leptin modified to contain sites for N- linked glycosylation at one site or at three sites demonstrated that glycosylated leptin protein could be functional, and could be as functional as natural human. Glycosylation was accomplished via host cellular machinery, in cell culture, and therefore did not require an extra process step (as required to derivatize protein) to attain the desired characteristics of longer serum half life.
  • the present invention relates to a glycosylated leptin protein having a Stokes' radius greater than that of naturally occurring glycosylated human leptin of SEQ ID NO. 2 (rHu- Leptin 1-145, below).
  • the present invention relates to a glycosylated leptin protein having a Stokes' radius greater than that of a glycosylated leptin protein having one N- linked glycosylation moiety.
  • the present invention relates to a glycosylated leptin protein having a Stokes' radius equal to or greater than 30 A, as determined by gel filtration.
  • the present invention also relates to leptin proteins having at least one additional glycosylation site.
  • the present invention relates to a glycosylated leptin protein having five or greater than five sialic acid moieties.
  • the naturally occurring human leptin variant (SEQ. ID NO: 2, below) contains 2 sites for 0- linked glycosylation, and therefore may contain 4 sialic acid moieties.
  • the present working examples demonstrate that more heavily glycosylated leptin protein has substantially improved circulation time.
  • the present invention relates to a glycosylated leptin protein having five, six or seven sialic acid moieties.
  • the present invention relates to a nucleic acid encoding a glycosylated leptin protein as set forth herein, as well as a vec or containing a nucleic acid encoding a glycosylated leptin protein according to the disclosure herein.
  • the present invention relates to a host cell containing a nucleic acid encoding a glycosylated leptin protein according to the present disclosure.
  • the present invention also relates to use of the present nucleic acids for gene therapy. Further, the present invention relates to a method of preparing a glycosylated leptin protein.
  • the present invention also relates to selective binding molecules, such as antibodies which selectively bind the present glycosylated leptin proteins .
  • the present invention relates to a pharmaceutical compositions comprising a glycosylated leptin protein of the present invention in a pharmaceutically acceptable carrier.
  • the present invention also relates to a method of treatment of a human for a condition selected from among obesity, diabetes, and high blood lipid content effects; said method comprising administering an effective amount of a glycosylated human leptin according to the present invention.
  • the present invention also relates to improved methods of production of glycosylated leptin proteins, as well as production of glycosylated proteins generally.
  • the present working examples demonstrate that for the present glycosylated leptin proteins, use of a signal peptide other than the native human leptin signal peptide improve glycosylation efficiency. In this case, improved glycosylation efficiency results in the desirable property of both increased number and size of added carbohydrate chains.
  • the present compositions and methods include the use of signal peptides other than the native leptin signal peptide. Apart from the native human leptin signal, particular signal peptides, both those known to be naturally found (i.e.
  • natural signal peptides are those which have not been genetically manipulated by humans, by any means including homologous recombination, recombinant DNA techniques, or other means known or expected to alter the nucleic acid sequence constituents, although the cell containing them may have been cultured or otherwise removed from its natural in vivo environment) , as well as those not found in nature (i.e. , non-natural signal peptides are those which have been genetically manipulated by humans as described above) , are set forth below.
  • the present invention further relates to the observation that modification of signal peptides, as well as other peptides which are processed off of the mature protein, improve the yield of glycosylated proteins.
  • Signal peptide modifications include alteration of the peptidase cleavage site to improve cleavage accuracy (and thus produce a larger yield of desired glycosylated proteins having the predicted N- terminal amino acid sequence) .
  • Signal peptide modifications may also, or alternatively, largely improve glycosylation efficiency, even in the absence of "correct” cleavage of the mature protein from the presequences . ("Correct" indicating that the first amino acid on the N- terminus is one for the predicted mature protein, not having any amino acids found on the signal peptide or other presequences) .
  • glycosylated protein comprising:
  • FIGURE 1 is a graph showing weight loss relative to buffer control for animals dosed with various doses of a one -site glycosylated leptin ("Glycosylated CHO Leptin) and non- glycosylated rmetHu - Leptinl - 146 (“Leptin”) .
  • FIGURE 2 is a Western Blot, as further described in Examples 5 and 6, below, showing that alterations in amino acid sequence of the glycosylation site can alter the kind or amount of glycosylation.
  • FIGURE 3 is a graph of serum leptin concentrations following subcutaneous administration of 1.0 mg/kg rmetHu-Leptin or a three- site glycosylated leptin protein in male CD-I mice as further described in Example 7.
  • FIGURE 4 is a graph of serum leptin concentrations following intravenous administration of 1.0 mg/kg rmetHu-Leptin or a three- site glycosylated leptin protein in male CD-I mice as further described in Example 7.
  • FIGURE 5 is a graph of weight loss upon administration of a three- site glycosylated leptin protein ("GE- Leptin”) as further described in Example 8
  • FIGURE 6 is a graph of food intake upon administration of a three- site glycosylated leptin protein ("GE- Leptin") as further described in Example 9.
  • FIGURE 7 is a Western Blot illustrating the effects of various signal peptides on expression and glycosylation of a three-site glycosylated leptin protein, as further described in Example 14.
  • FIGURE 8 is a Western Blot illustrating the effects of various signal peptides, and other peptides, on the glycosylation of a three- site glycosylated leptin, as further described in Example 14.
  • FIGURE 9 is a Western Blot illustrating the effects of the peptidase cleavage site on glycosylation of a three- site glycosylated leptin protein as further described in Example 14.
  • FIGURE 10 is a Western Blot illustrating the effects of various signal peptides and other peptides on the glycosylation of a three- site glycosylated leptin as further described in Example 14.
  • FIGURE 11 is a Western Blot, as described in Example 15 below, and shows that increasing the number of glycosylation sites, at least up to five sites, increases the amount of glycosylation found on the leptin protein when expressed in CHO cells.
  • the present invention relates, in one aspect, to glycosylated leptin proteins having a Stokes' radius larger than that of naturally occurring glycosylated human leptin.
  • a therapeutic composition in the systemic circulation of the Stoke' s radius is of sufficient size to reduce filterability in the kidney.
  • the effect of having a Stokes' radius of this size is to keep the glycosylated leptin protein in the systemic circulation for a longer period of time than would be for a glycosylated, or other leptin protein, not having this effective size.
  • the size must be greater than or equal to about 30 A, as determined by methods described in further detail below.
  • the term "about” means the average Stokes' radius over a period of time for that individual glycosylated leptin protein molecule.
  • glycosylated leptin proteins having a Stoke' s radius greater than naturally occurring leptin proteins has improved properties.
  • the preferred Stokes' radius for a population of glycosylated leptin protein molecules, such as is present in a therapeutically effective dose is that which is greater than or equal to about 30 A.
  • the term "about” here indicating that of any population of glycosylated leptin protein molecules, some may have a greater Stokes' radius, some may have a lower Stokes' radius, but the mean Stokes' radius of a given population of glycosylated leptin protein is greater than or equal to 30 A.
  • the present 3- glycosylation site leptin, rHu-Leptin 1-146 with glycosylation sites at position 47, 69, and 102 i.e. , having an asparagine residue substituted at positions 47, 69 and 102, and a threonine residue substituted at position 29, 71 and 104
  • has a mean Stokes' radius of 32.1 A (based on two gel filtration measurements of 31.9 A and 32.3 A) .
  • the working example below demonstrates that this glycosylated leptin exhibited a 4- to 5-fold decrease in systemic clearance and increase in half -life compared to rmetHu-Leptin.
  • the present Stokes' radius for purposes of the present glycosylated leptin proteins, is determined using gel filtration, see, Le Maire et al . , supra, see also, Kyte, Structure in Protein Chemistry, Garland Publishing, Inc., New York and London, 1995 at pages 293-316, herein incorporated by reference.
  • the gel filtration used to determine Stokes' radius is polymer (agarose) beads to which dextran is covalently bound.
  • Commercial preparations include Superdex tm 200 HR 10/30 (Pharmacia) and Sephacryl®S - 200 high
  • a column may be of any size but a size of approximately 1 x 30 cm is preferred for ease in handling.
  • the instruction manuals for column preparation for each of the above gel filtration substances are herein incorporated by reference in their entirety (Paper number 71-7059-00 Edition AB for Superdex tm and 52-2086-00-03, for Sephacryl®) .
  • the buffer to be used should be fairly close to a physiological buffer that does not significantly alter the solution conformation of the molecule and interfere with the size separation of the protein molecules.
  • Phosphate buffered saline is preferred, and was used to determine the Stokes' radius of the present glycosylated leptin proteins.
  • the process for performing gel filtration should generally follow the instruction manuals as above incorporated.
  • the selected glycosylated leptin protein for which a Stokes' radius is to be determined should be loaded onto the column. Below, for example, a concentration of 0.4 A280/ml, which is about 0.45 mg/ml, was used for a three-site glycosylated leptin (47,49,102).
  • the buffers used herein was PBS, but other buffers may be used.
  • the buffer for the load should be compatible with good gel filtration practices and could in theory contain high salts, and other materials consistent with what one skilled in the art would consider appropriate.
  • the load or storage buffer should not interfere (either by precipitating as it hits the column or by being denaturing and requiring a refold as it elutes) with determination of the Stokes radius.
  • the washing buffer such as phosphate buffered saline, should be applied at a rate of 0.25 ml/ in or a linear flow rate of 0.3 cm/min. This value will be determined by the properties of the gel and is basically per the manufacturers instructions.
  • the fractions eluted contain the glycosylated leptin protein molecules which are not trapped in the gel filtration substance.
  • glycosylated leptin proteins are those having a Stokes' radius (of the glycosylated leptin protein moiety alone, not including any chemical derivatization which may be further performed, as indicated below) of greater than or equal to 30 A as determined by gel filtration.
  • the gel filtration may be accomplished using dextran- coated agarose gel filtration substances, such as SuperDexTM or
  • the buffer may be phosphate buffered saline.
  • N-linked glycosylation sites Generally, to prepare the present glycosylated leptin composition, one will begin with a selected amino acid sequence, and modify that sequence to include the addition of sites for N- linked or 0- linked glycosylation. The following formula is preferred for adding sites for N- linked glycosylation (see generally, Creighton, Proteins, W.H. Freeman and Company, N.Y., (1984) p. 498, plus index at pages 76-78, incorporated herein by reference) : N - X - T/S wherein "N" is Asparagine "X” is any amino acid except proline and "T/S" is Threonine or Serine.
  • N - X - T is the formula "N - X - T" ; whereby the alteration with respect to a starting leptin amino acid sequence is that "X" remains the same as that for starting leptin sequence (preferably SEQ. ID. NOS . 1 or 2 , infra) , and the amino acid immediately downstream (toward the C- terminus) is threonine.
  • N-linked sites at the outer surface of the protein are preferred.
  • Surface residues suitable for glycosylation can be identified by examination of a three dimensional structure or model, or by nuclear magnetic resonance or crystal structure (as discussed below) . Also, it has been determined that a proline at position -1 with respect to the asparagine residue (i.e.
  • O- linked glycosylation sites are found on the outer surface of proteins generally near or adjacent to proline residues.
  • 0- linked sites can be found or introduced by including serine or threonine residues near to or adjacent to proline residues. Generally, threonine residues are preferred.
  • SEQ. ID NO: 1 (below) has a proline at position 99, and a threonine at position 100 was introduced. This leptin was expressed in CHO cells and COS cells, and was 0- linked glycosylated.
  • the general rule is that the asparagine residue must be located on an external surface of the protein to be available for adding the carbohydrate moiety.
  • the asparagine residue should be on a loop, ⁇ -turn, or on an outer surface of an alpha helix. This analysis is based on the current structure of leptin and the structure functional relationship of several cytokines .
  • G-CSF granulocyte colony stimulating factor
  • SEQ. ID NO: 1 Given the apparent flexibility and apparent lack of biological significance of helix A, one may choose to modify SEQ. ID NO: 1 to include glycosylation sites at residues Vail or Pro2. Asp23 (of SEQ. ID NO: l)is on the last turn of helix A and is considered a good choice as the side chain is at least partially on the outer surface of the protein.
  • the proline residue at position 47 and the isoleucine residue at position 48 are at the end of the AB loop, only a couple of residues from the beginning of Helix B. They are on the surface of the protein, and may be suitable for glycosylation site insertion.
  • the proline residue at position 69 is on the surface of the protein, which is a good position for glycosylation.
  • the phenylalanine residue at position 92 is at the end of the C helix and its side chain is facing opposite to which may be the receptor binding face. This is likely to yield the best result in that there is the least interference from any glycosylation moiety with receptor binding.
  • Serine at position 102 is at the protein surface in the middle of the CD loop and should be in a relatively flexible portion of the structure, along with positions 101 (alanine) and 103 (glycine) .
  • the present invention relates to a glycosylated leptin protein comprising SEQ. ID NO: 1 (rHu-Leptin 1-146, below) or SEQ. ID NO: 2 (rHu-Leptin 1-145, below) having one or more sequence alterations as a site of glycosylation.
  • Said sequence alterations may be selected from among:
  • S i.e. , altering the first amino acid in SEQ. ID NO: 1, below, which is a valine, to asparagine, altering the second amino acid from proline to any of the other 19 amino acids (such as alanine) , and altering the third amino acid from isoleucine to threonine or serine
  • SEQ. ID NO: 1 which is a valine, to asparagine
  • altering the second amino acid from proline to any of the other 19 amino acids (such as alanine) altering the third amino acid from isoleucine to threonine or serine
  • 103G->N 104 L 105E->T or S i.e. , altering the 103rd amino acid in SEQ. ID NO: 1, below, from glycine to asparagine, maintaining the 104th amino acid as leucine, and altering the 105 tn amino acid from glutamic acid to threonine or serine.
  • the above shorthand notations indicate the amino acid location with respect to SEQ. ID NO: 1, and the change from one amino acid ---> to another amino acid.
  • the change in the third amino acid (the amino acid toward the C- terminus of the protein) to threonine is preferred for ease in commercial manufacture, particularly in glycosylation efficiency, although, as indicated above, a serine may also be used at this location.
  • Conventional single letter amino acid abbreviations are used, as in Stryer, Biochemistry, Third Edition (1988) , W.H. Freeman and Company, New York, inside back cover, herein incorporated by reference.
  • the present invention also relates to a glycosylated leptin protein comprising SEQ. ID NO: 1 (rHu-Leptin 1-146, below) having one or more sequence alterations as a site of glycosylation selected from among (where "T/S" denotes threonine or serine) :
  • ID NO: 1 having a glycosylation site located at a position selected from among (with respect to the numbering of SEQ. ID NO: 1: 1, 2, 4, 8, 23, 44, 47, 48, 69, 70, 93, 97, 100, 101, 102, 103, 118 and 141.
  • glycosylated leptin protein comprising amino acids 1-146 of SEQ. ID NO: 1, having two glycosylation sites, said two sites selected from among (with respect to the numbering of SEQ. ID NO: 1) : 47 + 69; 48 + 69 69 + 101 69 + 102 69 + 103 69 + 118; and, 100 + 102.
  • glycosylated leptin protein comprising amino acids 1-146 of SEQ. ID NO: 1, having three glycosylation sites, said three sites selected from among (with respect to the numbering of SEQ. ID NO: 1) 2 + 47 + 69 23 + 47 + 69; 47 + 69 + 100; 47 + 69 + 102 ;
  • glycosylated leptin protein comprising amino acids 1-146 of SEQ. ID NO: 1, having four glycosylation sites, said four sites selected from among (with respect to the numbering of SEQ. ID NO: 1) :
  • glycosylated leptin protein comprising amino acids 1-146 of SEQ. ID NO: 1, having five glycosylation sites, said five sites selected from among (with respect to the numbering of SEQ. ID NO: 1) :
  • the present invention includes the following glycosylated leptin protein amino acid sequences, DNAs encoding such sequences, and specific DNAs as set forth below: Glycosylated leptin 2,47,69 (SEQ. ID NO: 25, DNA):
  • Glycosylated leptin 47,69,102 (SEQ. ID NO: 31, DNA): 1 GTGCCCATCC AAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT
  • glycosylated proteins may be characterized by their number of sialic acid moieties. Generally, there may be zero to four sialic acid moieties at an N-linked glycosylation site, and zero to two sialic acid moieties at an O-linked glycosylation site.
  • a typical glycosylated protein preparation will contain a mixture of fully (i.e. , having a sialic acid moiety occupying all available sites) and partially (i.e., having a sialic acid moiety occupying less than all available sites) sialated glycosylated proteins molecules.
  • the number of sialic acid moieties may be determined by methods available to those skilled in the art. For example, one may measure the molecular weight of the protein or preparation thereof before and after treatment with enzymes which remove sialic acid, and calculate the molecular weight of the constituents. Alternatively, one may use isoelectric focusing or other methods to determine the sialic acid content.
  • human leptin 1-145 contains two O-linked glycosylation sites, and thus, when fully sialated, four sialic acid moieties.
  • the present working examples with a single N- linked glycosylation site contain four sialic acid moieties, when fully sialated.
  • the two-site glycosylated leptin proteins below, when fully glycosylated contain 8 sialic acid moieties, the three site, 12 sialic acid moieties, the four, 16 sialic acid moieties, and the five site glycosylated leptins, 20 sialic acid moieties.
  • the present invention thus encompasses glycosylated leptin protein preparation wherein each glycosylated leptin protein molecule in said preparation has five or more sialic acid moieties. More preferably, for purposes of enhancing a sustained release effect of a therapeutic protein, the present invention also encompasses a glycosylated leptin protein preparation wherein each glycosylated leptin protein molecule in said preparation has 8 to 20 sialic acid residues. One may also choose to add additional glycosylation sites, and increase the sialic acid content above 20 accordingly.
  • Leptin Protein Backbone The type of leptin used for the glycosylated leptin pharmaceutical compositions may be selected from those described in PCT International Publication Number WO96/05309, as cited above and herein incorporated by reference in its entirety.
  • Figure 3 of that publication depicts the full deduced amino acid sequence derived for human leptin (also referred to as the human "OB" protein) .
  • the amino acids are numbered from 1 to 167.
  • a signal sequence cleavage site is located after amino acid 21 (Ala) so that the mature protein extends from amino acid 22 (Val) to amino acid 167 (Cys) .
  • a different numbering is used herein, where the amino acid position 1 is the valine residue which is at the beginning of the mature protein.
  • amino acid sequence for mature, recombinant human leptin is presented herein as SEQ. ID NO: 1, where the first amino acid of the mature protein is valine (at position 1) (herein called rHu-Leptin 1- 146, SEQ. ID NO: 1) :
  • rHu-Leptin 1-145 SEQ.
  • glycosylated leptin proteins for the specific glycosylated leptin proteins recited herein, one may choose to use the "Q-" version of human leptin (1-145, SEQ. ID NO : 2) and modify the corresponding sites enumerated for the 1-146 amino acid human leptin to include glycosylation sites .
  • the leptin protein for use herein will be capable of therapeutic use in humans (see also, animal leptins, below). Thus, one may empirically test activity to determine which leptin protein forms may be used. As set forth in WO96/05309, leptin protein in its native form, or fragments (such as enzyme cleavage products) or other truncated forms and analogs may all retain biological activity. Any of such forms may be used to prepare the present glycosylated leptin compositions, although such altered forms should be tested to determine desired characteristics. See also, PCT International Publication Numbers WO96/40912,
  • Murine leptin is substantially homologous to human leptin, particularly as a mature protein and, further, particularly at the N-terminus. Because the recombinant human protein has biological activity in mice, such an analog would likely be active in humans. For example, in the amino acid sequence of native human leptin as presented in SEQ.
  • Rat OB protein differs from human OB protein at the following positions (using the numbering of SEQ. ID NO : 1) : 4,
  • the positions in bold print are those in which the murine OB protein as well as the rat OB protein are divergent from the human OB protein and, thus, are particularly suitable for alteration.
  • the positions from both rat and murine OB protein which diverge from the mature human OB protein are: 4, 32, 33, 35, 50, 64, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 118, 136, 138, 142, and 145.
  • An OB protein according to SEQ. ID NO:: 1 having one or more of the above amino acids replaced with another amino acid, such as the amino acid found in the corresponding rat or murine sequence, may also be effective.
  • amino acids found in rhesus monkey OB protein which diverge from the mature human OB protein are (with identities noted in parentheses in one letter amino acid abbreviation) : 8 (S) , 35 (R) , 48 (V), 53 (Q), 60 (I), 66 (I), 67 (N) , 68 (L) , 89 (L) , 100 (L) , 108 (E) , 112 (D) and 118 (L) . Since the recombinant human OB protein is active in cynomolgus monkeys, a human OB protein according to SEQ.
  • ID NO: 1 having one or more of the rhesus monkey divergent amino acids replaced with another amino acid, such as the amino acids in parentheses, may be effective.
  • certain rhesus divergent amino acids are also those found in the above murine species (positions 35, 68, 89, 100 and 112).
  • a murine/rhesus/human consensus molecule using the numbering of SEQ.
  • Other analogs may be prepared by deleting a part of the protein amino acid sequence.
  • the mature protein lacks a signal sequence (-22 to -1) .
  • One may delete a portion of the mature protein, and this deletion may be incident to manufacture, e.g.
  • the N-terminus may contain one or more additional amino acids, which may be incident to use of such presequences, such as, for example, cleavage in the middle of a signal peptide cleavage site, so that a portion of the amino acids of the cleavage site is attached.
  • the truncated forms may also have altered one or more of the amino acids which are divergent (in the murine, rat or rhesus OB protein) from human OB protein.
  • any alterations may be in the form of altered amino acids, such as peptidomimetics or D-amino acids.
  • the present glycosylated human leptin proteins may be prepared by first starting with a sequence selected from among (according to the amino acid sequence as presented in SEQ. ID NO: : 1 herein) :
  • a truncated leptin protein analog selected from among: (using the numbering of subpart (a) above) :
  • amino acids 1-99 and 112-146 having one or more of amino acids 100-111 sequentially placed between amino acids 99 and 112; and, (iv) the truncated leptin analog of subpart (i) having one or more of amino acids 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 substituted with another amino acid;
  • PCT WO96/22308 (assigned to Zymogenetics ) ; PCT WO96/29405 (assigned to Ligand
  • PCT W096/31526 (assigned to Amylin Pharmaceuticals, Inc. ) ;
  • PCT W096/34885 (assigned to Smithkline Beecham PLC) ;
  • EP 741187 (assigned to F. Hoffman LaRoche) .
  • nucleic acids encoding the present glycosylated leptin proteins.
  • Such nucleic acids may be prepared by site directed mutagenesis of an existing nucleic acid sequence or by synthetic means, or by other means as are available to those skilled in the art. Methods as disclosed in the Reference Examples below are illustrative.
  • Vectors include plasmidic as well as viral vectors as are available to those skilled in the art.
  • Vectors may be for cloning or expression, and include plasmids, cosmids, and prokaryotic or eukaryotic-cell infecting viruses.
  • vectors will be useful for expression in a eukaryotic cell.
  • the expression system may be constitutive or inducible, such as systems including an inducible mouse mammary tumor virus LTR promoter. Enhancers, transcription terminators, splice donor and acceptor sites, and other elements may be included in the overall system as is known to those skilled in the art .
  • Vectors disclosed in the Reference Examples below are illustrative.
  • the present working examples used a modified form of pDSR ⁇ 2 , to express glycosylated leptin proteins.
  • the host cells may be prokaryotic, such as bacteria used for cloning of the present nucleic acids , for example.
  • Other host cells may be eukaryotic.
  • Eukaryotic host cells may be selected from the phylum Chordata, such as those in the class Mammalia.
  • Primate cells including human cells (such as Namalwa, HeLa, human hepatocellular carcinoma, such as Hep G2 cells, human embryonic kidney cells, human liver cells, human lung cells or cells cultured from human sources) and COS cells, or other mammalian cells, such as baby hamster kidney cells ("BHK” cells), Chinese hamster ovary cells ("CHO”) cells, mouse sertoli cells, canine kidney cells, buffalo rat liver cells, mouse mammary tumor cells may be used. Insect cells may also be used. Lesser host cell organisms, such as yeasts, and fungi, are also included. See generally, Margulis, Five Kingdoms, 2d Edition (1988) W.H. Freeman & Co., New York, for classifications of organisms.
  • the present glycosylated leptin protein may be expressed in a eukaryotic host cell along with one or more other desired proteins.
  • the proteins may be separated using a number of available separation techniques, depending on the characteristics of the protein. For example, one may, in a single host cell, such as a CHO cell, express a glycosylated leptin protein, as well as a different protein, such as a different glycosylated protein desired for therapeutic use.
  • One may use, for example, molecular weight to separate the proteins for purification. In this way, economies of manufacture may be achieved, by producing two different proteins from a single cell culture.
  • transgenic animals may also use transgenic animals to express the present glycosylated leptin protein.
  • a transgenic milk-producing animal a cow or goat, for example
  • plants may use plants to produce the present glycosylated proteins, however, in general, the glycosylation occurring in plants is different from that produced in mammalian cells, and may result in a glycosylated product which is not suitable for human therapeutic use.
  • the DNA provided herein may also be used for gene therapy.
  • a review article on gene therapy is Verma, Scientific American, November 1990, pages 68-84 which is herein incorporated by reference.
  • the present invention provides for a population of cells expressing the present glycosylated leptin protein.
  • Such cells are suitable for transplantation or implantation into an individual for therapeutic purposes.
  • One may then implant such cells into an individual.
  • Such cells may, for example, be liver cells, bone marrow cells, or cells derived from umbilical cord.
  • circulating cells such as blood progenitor cells, T cells or other blood cells.
  • human cells may be used.
  • Cells may be in the form of tissue. Such cells may be cultured prior to transplantation or implantation.
  • the cells to be transferred to the recipient may be cultured using one or more factors affecting the growth or proliferation of such cells if appropriate.
  • Hematopoietic factors may be used in culturing hematopoietic cells.
  • Such factors include G-CSF, EPO, MGDF, SCF, Flt-3 ligand, interleukins (e.g., IL1-IL13), GM-CSF, LIF, and analogs and derivatives thereof as available to one skilled in the art.
  • Nerve cells such as neurons or glia, may also be used, and these may be cultured with neurotrophic factors such as BDNF, CNTF, GDNF, NT3 , or others .
  • the capsules encapsulate cells transfected with recombinant DNA molecules comprising DNA sequences coding for biologically active molecules operatively linked to promoters that are not subject to down regulation in vivo upon implantation into a mammalian host.
  • the devices provide for the delivery of the molecules from living cells to specific sites within a recipient.
  • U.S. Patent Numbers 4,892,538, 5,011,472, and 5,106,627 each of which is specifically incorporated herein by reference.
  • a system for encapsulating living cells is described in PCT Application WO 91/10425 of Aebischer et al . , specifically incorporated herein by reference. See also. PCT Application WO 91/10470 of Aebischer et al . , Winn et al . , Exper. Neurol . 11_3: 322-329 (1991) ,
  • In vivo and in vitro gene therapy delivery of the present glycosylated leptin protein is also envisioned.
  • In vivo gene therapy may be accomplished by introducing the nucleic acid encoding a present glycosylated leptin protein into cells via local injection of a polynucleotide molecule or other appropriate delivery vectors.
  • a polynucleotide molecule encoding a glycosylated leptin protein may be contained in an adeno-associated virus vector for delivery into the targeted cells (e.g., Johnson, International Publication No. WO 95/34670; International Application No. PCT/US95/07178 the disclosure of which is hereby incorporated by reference) .
  • the recombinant adeno-associated virus (AAV) genome contains AAV inverted terminal repeats flanking a DNA sequence encoding the neurotrophic factor operably linked to functional promoter and polyadenylation sequences.
  • Alternative viral vectors include, but are not limited to, retrovirus, adenovirus, herpes simplex virus and papilloma virus vectors.
  • U.S. 5,672,344 (issued September 30, 1997, Kelley et al . , University of Michigan) , the disclosure of which is hereby incorporated by reference, describes an in vivo viral- mediated gene transfer system involving a recombinant neurotropic HSV-1 vector.
  • U.S. 5,399,346 issued March 21, 1995, Anderson et al .
  • Nonviral delivery methods include liposome- mediated transfer, naked DNA delivery (direct injection) , receptor-mediated transfer (ligand-DNA complex) , electroporation, calcium phosphate precipitation and microparticle bombardment (e.g., gene gun) .
  • Gene therapy materials and methods may also include inducible promoters, tissue-specific enhancer- promoters, DNA sequences designed for site-specific integration, DNA sequences capable of providing a selective advantage over the parent cell, labels to identify transformed cells, negative selection systems and expression control systems (safety measures), cell- specific binding agents (for cell targeting), cell- specific internalization factors, transcription factors to enhance expression by a vector as well as methods of vector manufacture.
  • inducible promoters tissue-specific enhancer- promoters
  • DNA sequences designed for site-specific integration DNA sequences capable of providing a selective advantage over the parent cell, labels to identify transformed cells, negative selection systems and expression control systems (safety measures), cell- specific binding agents (for cell targeting), cell- specific internalization factors, transcription factors to enhance expression by a vector as well as methods of vector manufacture.
  • Expression control techniques include chemical induced regulation (e.g., WO 9641865 and WO 9731899), the use of a progesterone antagonist in a modified steroid hormone receptor system (e.g., U.S. 5,364,791), ecdysone control systems (e.g., WO 9637609), and positive tetracycline-controllable transactivators (e.g., U.S. 5,589,362; U.S. 5,650,298; and U.S. 5,654,168) .
  • the present gene therapy or cell therapy can further include the delivery of a second therapeutic composition.
  • the host cell may be modified to express and release both a glycosylated leptin protein and native human leptin. Alternatively, they may be expressed in and released from separate cells. Such cells may be separately introduced into the patient or the cells may be contained in a single implantable device, such as the encapsulating membrane described above.
  • Selective Binding Molecules The present invention also relates to selective binding moieties of the present glycosylated human leptin proteins.
  • a “selective binding moiety” denotes a substance which selectively binds to the present glycosylated human leptin proteins, in glycosylated or unglycosylated form. Selectivity is determined by whether the binding moiety binds to the subject leptin protein above background (nonselective) levels .
  • selective binding moieties include antibodies, such as monoclonal, polyclonal, monospecific polyclonal, produced by, for example hybridoma technology or using recombinant nucleic acid means. See, e.g., Huse et al . , Science 246 : 1275 (1989).
  • nucleic acids, vectors, host cells and other materials and methods used in the recombinant nucleic acid expression of a selective binding moiety such as a recombinant antibody.
  • a selective binding moiety such as a recombinant antibody.
  • detectable labels such as chemiluminescent, fluorescent, colorimetric, or radioactive, using materials and methods available to those skilled in the art.
  • Illustrative is a kit including monoclonal antibodies selective for a particular glycosylated leptin protein, and means to detect selective binding of said monoclonal antibodies to said glycosylated leptin protein.
  • Other materials and methods for such kits are available to those skilled in the art.
  • compositions of the present glycosylated leptin compositions, and derivatives may be for administration by injection, or for oral, intrathecal, pulmonary, nasal, transdermal or other forms of administration.
  • pharmaceutical compositions comprising effective amounts of protein or derivative products of the invention together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifier ⁇ , adjuvants and/or carriers.
  • Such compositions include diluents of various buffer content (e.g.
  • additives such as detergents and solubilizing agents (e.g. , Tween 80, Polysorbate 80), anti-oxidants (e.g. , ascorbic acid, sodium metabisulfite) , preservatives (e.g. , Thimersol, benzyl alcohol) and bulking substances (e.g. , lactose, mannitol); incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes . See, e.g. , PCT W096/29989, Collins et al .
  • compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives . See, e.g., Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712 which are herein incorporated by reference.
  • the compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form. Implantable sustained release formulations are also contemplated, as are transdermal formulations.
  • Protein may be chemically modified so that oral delivery of the derivative is efficacious.
  • the chemical modification contemplated is the attachment of at least one moiety to the protein (or peptide) molecule itself, where said moiety permits (a) inhibition of proteolysis ; and (b) uptake into the blood stream from the stomach or intestine.
  • the increase in overall stability of the protein and increase in circulation time in the body See PCT W095/21629, Habberfield, "Oral Delivery of Chemically Modified Proteins" (published August 17, 1995) herein incorporated by reference, and U.S. Patent No. 5,574,018, Habberfield et al . , "Conjugates of Vitamin B12 and Proteins," issued November 12, 1996, herein incorporated by reference.
  • the materials and methods disclosed therein are applicable to the present glycosylated leptin compositions and methods.
  • pulmonary delivery of the present protein, or derivative thereof is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream.
  • the protein derivative
  • the present glycosylated leptin proteins may be spray-dried into particles having an average size of less than 10 microns, or more preferably, 0.5 to 5 microns. Larger sized particles may be used depending on the density of each particle.
  • Nasal delivery of the protein is also contemplated.
  • Nasal delivery allows the passage of the protein to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung.
  • Formulations for nasal delivery include those with absorption enhancing agents, such as dextran or cyclodextran. Delivery via transport across other mucous membranes is also contemplated.
  • the present glycosylated leptin proteins may also be derivatized by the attachment of one or more chemical moieties to the protein moiety.
  • Chemical modification of biologically active proteins has been found to provide additional advantages under certain circumstances, such as increasing the stability and circulation time of the therapeutic protein and decreasing immunogenicity. See U.S. Patent
  • the addition of a chemical moiety will likely require an additional manufacturing step, but may result in further benefits in terms of improved product characteristics (with the caveat that under some conditions, chemical derivatization may make the product less desirable, such as by inducing the formation of kidney vacuoles, see supra) .
  • the chemical moieties should be attached to the protein with consideration of effects on functional or antigenic domains of the protein. There are a number of attachment methods available to those skilled in the art. E.g. , PCT W096/11953, "N-Terminally Chemically Modified Protein Compositions and Methods," published April 25, 1996, herein incorporated by reference in its entirety, and EP 0 401 384 herein incorporated by reference (coupling PEG to G-CSF) .
  • the methods and polymers disclosed therein in the above publications are applicable to the present glycosylated leptin compositions, if derivatization is desired to further improve characteristics of a therapeutic composition, for example.
  • Fusion proteins may be prepared by attaching polyaminoacids to glycosylated leptin protein moiety.
  • the polyamino acid may be a carrier protein which serves to further increase the circulation half life of the protein.
  • such polyamino acid should be those which do not create neutralizing antigenic response, or other adverse response.
  • Such polyamino acid may be selected from the group consisting of serum album (such as human serum albumin) , an antibody or portion thereof (such as an antibody constant region, sometimes called "F c ”) or other polyamino acids.
  • the location of attachment of the polyamino acid may be at the N-terminus of the glycosylated leptin protein moiety, or other place, and also may be connected by a chemical "linker" moiety to the protein. See, e.g. , PCT WO 98/28427, published
  • the polyamino acid may be used to aid in detection or purification, such as using a "FLAG” tag, "his” tag, “myc” tag or other polyamino acid tag known to those skilled in the art.
  • detectable labels may be attached to the present glycosylated leptin proteins .
  • Radioisotopes e.g. , fluorescent or chemiluminescent compounds
  • enzymatically cleavable compounds e.g. , detectable antibody (or modification thereof) or other substances
  • Detecting protein via use of the labels may be useful for identifying the presence or amount of the present proteins, or a compound containing such proteins (such as an antibody/protein complex) .
  • rmetHu-leptin 1-146 has been demonstrated to be effective at doses of 0.3 mg protein/kg body weight/day, and has been seen to be less effective at a dose of 0.1 mg protein/kg body weight/day.
  • Greenberg et al . Preliminary safety and efficacy of recombinant methionyl human Leptin administered by SC injection in lean and obese subjects. Poster presented at: Annual Meeting of the American Diabetes Association; June 16, 1998, Chicago, IL.
  • the desired dosage range, to have advantage over the existing rmetHu-leptin 1-146 is the same or lower than the above.
  • a desired dosage range may be one in which the same (or lower) protein load is administered less frequently.
  • the effective dosages may be determined using diagnostic tools over time. For example, a diagnostic for measuring the amount of leptin in the blood (or plasma or serum) may first be used to determine endogenous levels of leptin. Such diagnostic tool may be in the form of an antibody assay, such as an antibody sandwich assay. The amount of endogenous leptin is quantified initially, and a baseline is determined. The therapeutic dosages are determined as the quantification of endogenous and exogenous leptin (that is, protein, analog or derivative found within the body, either self-produced or administered) is continued over the course of therapy. The dosages may therefore vary over the course of therapy, with a relatively high dosage being used initially, until therapeutic or cosmetic benefit is seen, and lower dosages used to maintain the therapeutic or cosmetic benefits.
  • dosages may be administered whereby weight loss and concomitant fat tissue decrease increase is achieved. Once sufficient weight loss is achieved, a dosage sufficient to prevent re-gaining weight, yet sufficient to maintain desired weight or fat mass may be administered. These dosages can be determined empirically, as the effects of leptin are reversible. E.g. , Campfield et al . , Science 269 :
  • Therapeutic uses include weight modulation, the treatment or prevention of diabetes, blood lipid reduction (and treatment of related conditions) , increasing lean body mass and increasing insulin sensitivity.
  • the present compositions may be used for manufacture of one or more medicaments for treatment or amelioration of the above conditions .
  • Cosmetic For those desiring solely appearance enhancement, the present compositions may be used for weight loss, or weight maintenance which has no concomitant effect on an adverse medical condition.
  • the present compositions may be used for manufacture of one or more preparations for cosmetic purposes .
  • the present compositions and methods may be used for weight reduction. Viewed another way, the present compositions may be used for maintenance of a desired weight or level of adiposity. As has been demonstrated in murine models (see supra) , administration of the present glycosylated leptin proteins results in weight loss. The body mass lost is primarily of adipose tissue, or fat. Such weight loss, or maintenance of a particular weight, can be associated with the prevention or treatment of concomitant conditions, such as those below, and therefore constitute a therapeutic application. Treatment of Diabetes. The present compositions and methods may be used in the prevention or treatment of Type I or Type II diabetes.
  • Type II diabetes can be correlated with obesity
  • use of the present invention to reduce weight (or maintain a desired weight, or reduce or maintain an adiposity level) can also alleviate or prevent the development of diabetes.
  • the present compositions may be used to prevent or ameliorate diabetes .
  • compositions may result in an increased sensitivity to endogenous or exogenous insulin, and allow an individual to reduce or eliminate the amount administration of exogenous insulin required to treat type II diabetes . It is further contemplated that the present compositions may be used in the treatment, prevention or amelioration of Type I diabetes .
  • the present compositions and methods may be used in the modulation of blood lipid levels. Ideally, in situations where solely reduction in blood lipid levels is desired, or where maintenance of blood lipid levels is desired, the dosage will be insufficient to result in weight loss. Thus, during an initial course of therapy of an obese patient, dosages may be administered whereby weight loss and concomitant blood lipid level lowering is achieved. Once sufficient weight loss is achieved, a dosage sufficient to prevent re-gaining weight, yet sufficient to maintain desired blood lipid levels, or other conditions as set forth herein, for example, may be administered. Thus, if a dosage resulting in weight loss is observed when weight loss is not desired, one would administer a lower dose in order to achieve the desired blood lipid levels, yet maintain the desired weight. See, e.g. , PCT Publication WO97/06816 herein incorporated by reference.
  • Increasing Lean Mass or Insulin Sensitivity in situations where solely an increase in lean body mass is desired, the dosage will be insufficient to result in weight loss.
  • dosages may be administered whereby weight loss and concomitant fat tissue decrease/lean mass increase is achieved. Once sufficient weight loss is achieved, a dosage sufficient to prevent re-gaining weight, yet sufficient to maintain desired lean mass increase (or prevention of lean mass depletion) may be administered. For increasing an individual's sensitivity to insulin, similar dosage considerations may be taken into account.
  • Lean mass increase without weight loss may be achieved sufficient to decrease the amount of insulin (or, potentially, amylin, amylin antagonists or agonists, or thiazolidinediones , or other potential diabetes treating drugs) an individual would be administered for the treatment of diabetes.
  • insulin or, potentially, amylin, amylin antagonists or agonists, or thiazolidinediones , or other potential diabetes treating drugs
  • Lean mass increase with concomitant increase in overall strength may be achieved with doses insufficient to result in weight loss.
  • Other benefits, such as an increase in red blood cells (and oxygenation in the blood) and a decrease in bone resorption or osteoporosis may also be achieved in the absence of weight loss.
  • PCT W097/18833 published May 29, 1997, herein incorporated by reference in its entirety.
  • compositions and methods may be used in conjunction with other therapies, such as altered diet and exercise.
  • Other medicaments such as those useful for the treatment of diabetes (e.g. , insulin and possibly amylin, antagonists or agonists thereof, thiazolidinediones, or other potential diabetes treating drugs) , cholesterol and blood pressure lowering medicaments (such as those which reduce blood lipid levels or other cardiovascular medicaments), activity increasing medicaments (e.g. , amphetamines), diuretics (for liquid elimination), and appetite suppressants (such as agents which act on neuropeptide ⁇ receptors, serotonin reuptake inhibitors or gastric fat uptake inhibitors) .
  • Such administration may be simultaneous or may be in seriatim.
  • the present methods may be used in conjunction with surgical procedures, such as cosmetic surgeries designed to alter the overall appearance of a body (e.g. , liposuction or laser surgeries designed to reduce body mass, or implant surgeries designed to increase the appearance of body mass) .
  • surgical procedures such as cosmetic surgeries designed to alter the overall appearance of a body (e.g. , liposuction or laser surgeries designed to reduce body mass, or implant surgeries designed to increase the appearance of body mass) .
  • the health benefits of cardiac surgeries such as bypass surgeries or other surgeries designed to relieve a deleterious condition caused by blockage of blood vessels by fatty deposits, such as arterial plaque, may be increased with concomitant use of the present compositions and methods.
  • Methods to eliminate gall stones, such as ultrasonic or laser methods may also be used either prior to, during or after a course of the present therapeutic methods.
  • signal sequence (sometimes referred to in the art as “signal peptide”) is use to denote an peptide, found at or near the N- terminus of the mature protein, usually about 15 to about 30 amino acids long, rich in hydrophobic amino acids, which facilitates secretion of the mature protein into the endoplasmic reticulum.
  • the signal sequence normally found connected to the tissue plasminogen activator sequence when used in conjunction with the expression of various of the multiply-glycosylated leptin proteins described herein, results in higher levels of glycosylation (e.g. , glycosylation moieties at all suitable sites in a higher proportion of the expressed molecules of mature protein) .
  • the present invention also relates to a method of manufacturing a glycosylated leptin protein comprising:
  • the present invention relates to a method of manufacturing a glycosylated leptin protein wherein said signal is selected from among: a) (SEQ. ID NO. 3) (native human leptin signal peptide) MHWGTLCGFLWLWPYLFYVQA
  • nucleic acid sequences encoding such signal peptides.
  • the below DNA sequences with the exception of the modified human leptin signal peptide signal sequence (d, SEQ. ID NO:
  • SEQ. ID NO: 16 modified human leptin signal peptide DNA
  • SEQ. ID NO: 17 modified human leptin signal peptide DNA
  • SEQ. ID NO: 18 modified human leptin signal peptide DNA
  • SEQ. ID NO: 19 (native human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCT TCGTTTCGCCCAGC
  • SEQ. ID NO: 20 (native human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCT TCGTTTCGCCC
  • SEQ. ID NO: 21 (modified human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCT TCGTTTCGAACAGC
  • SEQ. ID NO: 22 modified human tPA signal peptide DNA
  • SEQ. ID NO: 24 (Leptin/tPA signal peptide DNA) ATGCATTGGGGAACCCTGTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTT CGCCC
  • Signal sequences known to be associated with highly glycosylated proteins are those native to erythropoietin, Factor VIII, beta-interferon, serum albumin, insulin, von Willebrand's factor, CDll , IgG, follistatin, intrinsic factor, G-CSF, ceruloplasmin, LAMP-1, secreted hormones, growth factors and other proteins, human or non-human (such as other primate, mouse, rat, or other mammal), which are secreted in eukaryotic cells.
  • yeast cells yeast ⁇ -factor, and others may be used.
  • various other genes have leader sequences which may facilitate secretion of proteins in mammalian cells systems, such as human influenza virus A, human preproinsulin, and bovine growth hormone.
  • substitution of an existing cleavage site (the site at the carboxy- terminal end of a signal peptide at which the signal peptide is enzymatically cleaved to generate the mature protein) with a different cleavage sites may provide manufacturing advantages, particularly in mammalian cell systems, and increase glycosylation efficiency.
  • tissue plasminogen activator signal peptide to express a three site glycosylated leptin protein resulted in a higher glycosylation efficiency than use of the native human leptin signal peptide. It was further found that the cleavage site of the tPA (serine-proline-serine) signal peptide, when substituted into the native human leptin signal peptide, conferred improved glycosylation efficiency over the use of the non-modified native human leptin signal peptide.
  • tPA serine-proline-serine
  • the site serine- asparagine-serine may function to improve the glycosylation efficiency.
  • SNS site serine- asparagine-serine
  • substitution of the natural human tPA signal peptide cleavage site with an "SNS" site resulted in a high yield of correctly cleaved glycosylated leptin protein (having glycosylation sites at positions 2, 47, 69, and 92) .
  • Other cleavage sites include, serine- proline-serine ("SPS”), serine-asparagine-serine
  • SNS serine-proline
  • SP serine-proline
  • SPA serine-proline- alanine
  • a new cleavage site may be substituted into any signal peptide by known methods, including site directed mutagenesis of encoding DNA, DNA synthesis, and alteration of genomic DNA within a cell.
  • One may choose to manufacture a signal peptide, particularly a signal peptide not found in associated with any known secreted protein, such as natural signal peptides, and include a cleavage site as above to optimize or maximize glycosylation efficiency.
  • cleavage sites such as the serine- proline-serine cleavage site of natural human tissue plasminogen activator ("tPA"), are incompletely cleaved from the N-terminal region of the mature protein. Thus, there leaves a serine residue at the N-terminus of the mature protein, herein referred to as the -1 position.
  • the present invention also includes the present leptin glycosylated proteins having, or optionally having if one chooses to use a subject cleavage site, one or more amino acid residues at the N-terminus of the mature protein sequence.
  • the present invention also includes, more specifically, glycosylated leptin proteins having a serine, arginine, proline or alanine residue at the -1 position, a serine at the -1 position and a proline at the -2 position, a serine-proline-serine sequence at the -1, -
  • the present invention includes truncated forms of glycosylated leptin protein, such as those having up to and including five amino acid residues deleted from the N- terminus of the mature protein, such as a leptin protein of SEQ. ID NO : 1 or 2 , having the subject glycosylation sites. Therefore, the present invention also relates to an improved method of manufacturing a glycosylated protein comprising:
  • the non-naturally occurring cleavage site may be selected from among SPS, SP, SNS, and SPA.
  • the signal peptides and glycosylated leptin proteins as set forth in the specification, including the working examples, are illustrative, although these methods and compositions are broadly applicable to a wide variety of proteins sought to be secreted and/or glycosylated by a eukaryotic cell. Such proteins include but are not limited to tissue plasminogen activator, Factor VIII and other blood clotting factors, erythropoietin and analogs thereof, and other glycosylated proteins.
  • a “prosequence” is an amino acid sequence optimally having the motif R-X-R/K-R, where "X” is any amino acid (and the one letter abbreviations are those conventionally used, see infra) .
  • the prosequence is cleavable (after the final R) with furin-like proteases normally present in CHO cells Watanabe et al . , FEBS letters, 320: 215-218 (1993 ) (herein incorporated by reference) .
  • the ability of CHO cells to cleave such prosequences has been shown to be improved when furin expression plasmids are transfected into the cells.
  • Yanagita et al . Endocrinology 133 : 639-644 (1993) (herein incorporated by reference) .
  • the mature human leptin sequence begins with a valine, which would interfere with removal of the presequence by furin.
  • Better prosequence removal could be achieved by changing this valine to a more preferred amino acid, such as serine or alanine, or inserting such an amino acid before the valine (by, e.g. , site-directed mutagenesis or other methods available to those skilled in the art) . Therefore, the present methods also optionally include use of such prosequences in conjunction with the natural leptin signal peptide or with other signal peptides.
  • compositions such as nucleic acids, vectors, and host cells, such as those recited above and herein incorporated by reference, which contain nucleic acids encoding the present altered signal peptides and/or pro sequences .
  • Example 1 demonstrates the Stokes' radius measurement of various glycosylated leptins.
  • Example 2 demonstrates the in vivo biological activity of a one-site glycosylated leptin, denoted "N48T50". This example demonstrates that this glycosylated leptin has activity at least equal to native recombinant human leptin lacking glycosylation.
  • Example 3 demonstrates the in vitro biological activity of additional one site glycosylated leptins .
  • Example 4 demonstrates in vitro biological activity of two-site glycosylated leptin proteins, in terms of a receptor binding assays .
  • Example 5 demonstrates the effect on glycosylation efficiency of using a threonine residue, rather than a serine residue, in the glycosylation consensus sequence.
  • Example 6 demonstrates that amino acids adjacent to the consensus sequence affect glycosylation efficiency.
  • Example 7 that a three site glycosylated leptin protein has a substantially longer systemic circulation time than non-glycosylated leptin.
  • Example 8 demonstrates in ob/ob mice that a three site glycosylated leptin protein has improved weight loss biological activity as compared to non- glycosylated leptin.
  • Example 9 demonstrates in ob/ob mice that a three site glycosylated leptin protein has improved appetite suppressant biological activity as compared to non-glycosylated leptin.
  • Example 10 demonstrates in ob/ob mice that intermittent administration of a three site glycosylated leptin has improved weight loss biological activity as compared to non-glycosylated leptin.
  • Example 11 provides additional dose response studies using a three site glycosylated leptin on wild type animals, demonstrating that a far lower dose of the three site glycosylated leptin results a substantial weight loss, as compared to non-glycosylated leptin.
  • Example 12 provides dose frequency studies using a three site glycosylated leptin on wild type mice, and demonstrates that a three site glycosylated leptin may be dosed less frequently than non-glycosylated leptin to obtain the same weight loss response in animals.
  • Example 13 sets forth additional multiple glycosylation site leptin proteins and in vitro biological activity data.
  • Example 14 sets forth the expression and glycosylation efficiency of a three site glycosylated leptin protein using a variety of signal peptides and other sequences affecting glycosylation or yield.
  • Example 15 sets forth additional expression data on a variety of multiple glycosylation site leptin proteins using various signal peptides and other sequences affecting glycosylation or yield.
  • the present example demonstrates that various leptins have different Stokes' radii, as determined by gel filtration.
  • the present example also demonstrates the consistency of the gel filtration method for determining the Stokes' radius of a single leptin glycosylated protein, as when repeated measurements were taken, the measurements varied by less than 2 A.
  • Methods Gel filtration experiments were carried out on a Pharmacia FPLC system equipped with a Unicorn controller for system control, data acquisition and analysis, a UV-1 detector and a 280 nm filter. Separations were performed at 4°C and at a flow rate of 0.25 ml/min on a SuperDex 200 (HR10/30) column equilibrated in Dulbeccos phosphate buffered saline. Protein samples, dissolved in elution buffer, were applied to the column in 0.25 ml volumes containing C.l A280 as determined by a Hewlett Packard Model 8435 Spectrophotometer .
  • a population of three site glycosylated leptin protein molecules has a Stokes' radius above 30 A, as determined by gel filtration.
  • the mean Stokes' radius ((31.9 + 32.3) /2)) is 32.1 A.
  • the present gel filtration method furthermore demonstrated consistency to one Angstrom.
  • the same glycosylated leptin protein had Stokes' radius of 31.2 A when determined by sedimentation velocity (using standard methods not detailed here) .
  • the unglycosylated leptin protein (rmetHu- Leptin) , as well as the two single site glycosylated leptin proteins, had Stokes' radii less than 30 A.
  • the N48T50 glycosylated leptin protein had biological activity comparable to rmetHu-Leptin.
  • the three-site glycosylation protein (47, 69, 102) had substantially improved biological activity in terms of increased circulation time (and therefore increase in vivo exposure to drug) . This demonstrates the principle that enlarging the effective size (expressed here as the Stokes' radius) prolongs circulation time by decreasing the filterability and ultimate degradation in the kidney.
  • This Example demonstrates that a one-site glycosylated leptin has biological activity approximately the same or modestly improved from rmetHu-Leptin 1-146 (SEQ. ID NO : 1) .
  • the glycosylation did not hinder activity or prevent receptor binding.
  • the serum circulation time of a one-site glycosylated leptin is the same or modestly longer than rmetHu-Leptin 1-146 (SEQ. ID NO: 1) .
  • Age and weight Animals were age 8-10 weeks and weighed approximately 20 g each.
  • mice were weighed and then injected with sample in bolus subcutaneously.
  • Baseline weight was determined in animals allowed to acclimate in animal facility for 1 week prior to study. Baseline weight was taken just before receiving the first dose. Weights were monitored daily throughout each study. After final weights were recorded, animals were sacrificed and the amount of abdominal fat was graded from 0-3, with 0 being no visible fat remaining, and a score of 3 reflecting an amount of visible fat in a normal animal.
  • mice treated with both forms of leptin had reduced amounts of abdominal fat and that the amount of abdominal fat was reduced with increased dose. This indicates that the glycosylated leptin is effective at reducing fat content and it can be administered less frequently than unglycosylated rmetHu-leptin.
  • Leptin A one site glycosylated leptin as above (sites N48 T50) was used, formulated at 10 mg/ml in Dulbecco's Phosphate Buffered Saline without calcium chloride without magnesium chloride. Recombinant methionyl human leptin 1-146 (SEQ. ID NO : 1 with a methionyl residue at position -1), expressed in E ⁇ coli was used as a control, formulated at 2.0 mg/ml in buffer. 2. Animals .
  • Table 2.1 shows the pharmacokinetic parameters of glycosylated Leptin and rmetHu-Leptin in mice. Comparing the IV data, glycosylated Leptin exhibited a lower systemic clearance (500 mL/h/kg vs. 676 mL/h/kg) and a longer terminal half-life (1.24 h vs. 0.733 h) . The volumes of distribution at steady-state (V ss ) were similar between glycosylated Leptin and rmetHu-Leptin. These data indicate that the glycosylated protein was cleared slower than rmetHu-Leptin from the systemic circulation, therefore increasing the half-life and the exposure (AUC estimates of 2000 ng «h/mL vs.
  • amino acid sequence location for alteration to include a glycosylation site is based on the numbering of SEQ. ID NO : 1, above, which is rHu-Leptin.
  • Protein was expressed as in the Reference Examples below, using the natural human leptin signal peptide and COS cells. The expression products were then put through four types of analysis (methods used are described below) :
  • * ESP77 indicates a glycosylation site at position 77 and expression using the signal peptide of erythropoietin, as described in more detail infra
  • glycosylated leptin proteins Some of these analogs were secreted at normal or higher levels and most had receptor binding activity comparable to rHu- Leptin 1-146 expressed and analyzed in the same manner. Surprisingly some of the glycosylated leptin proteins had low in vitro biological activity even though they retained receptor binding activity. Thus the glycosylated leptin proteins could be divided into 2 classes according to whether they retained in vitro biological activity or not. The glycosylated leptin proteins that had low in vitro biological activity may be leptin antagonists.
  • glycosylation notations indicate the approximate percent of material which had one chain or two chain, as determined by visual examination of a Western Blot, as described below. For example, for the glycosylated leptin protein 25 + 29, 50% of the material had one chain, and 5% of the material had two chains .
  • glycosylated leptin proteins containing combinations of two glycosylated sites can be made which retain receptor binding and display biological activity.
  • glycosylation efficiency is affected by both the amino acid in the -1 position (relative to the substituted asparagine residue) as well as substitution of a proline immediately "upstream" (i.e. , toward the N-terminus) from the asparagine residue in the consensus sequence.
  • FIGURE 2 is a Western Blot comparing the N-linked glycosylation site to the O-linked glycosylation site, as indicated. As can be seen, use of the sequence "TAS" as indicated (with reference to SEQ. ID NO: 1) results in O-linked glycosylation.
  • glycosylated leptin having greater than one glycosylation site has a circulation time which is substantially longer than non-glycosylated recombinant human leptin.
  • glycosylated Leptin exhibited a 4- to 5-fold decrease in systemic clearance and increase in half-life compared to rmetHu-Leptin.
  • subcutaneous bioavailability -10% decrease as compared to non-glycosylated
  • glycosylated leptin still resulted in a higher drug exposure following subcutaneous dosing.
  • Age/weight Animals were approximately 6-9 weeks old and weighed approximately 30 grams.
  • FIGURES 3 and 4 are illustrated in FIGURES 3 and 4.
  • FIGURE 3 is a graph showing the serum leptin concentration after subcutaneous administration
  • FIGURE 4 is a graph showing serum leptin concentration after intravenous administration.
  • Table 7.1 shows the pharmacokinetic parameters of glycosylated leptin and rmetHu-Leptin in mice.
  • glycosylated leptin exhibited a lower systemic clearance (120 mL/h/kg vs. 676 mL/h/kg) and a longer terminal half- life (2.76 h vs. 0.733 h) .
  • the volumes of distribution at steady-state (V ss ) were similar between glycosylated leptin and rmetHu-Leptin.
  • This Example demonstrates that a glycosylated human leptin having a Stokes' radius greater than 30 A has improved in vivo biological activity as compared to non-glycosylated recombinant human leptin.
  • ob/ob mice lost -6.8 times more weight with the three-site glycosylated leptin here administered than with non-glycosylated leptin.
  • Leptin The three-glycosylation site leptin, prepared as described below (sites 47, 69 and 102, SEQ. ID NO: 32), was used, formulated at a concentration of 1.9 mg/ml in Dulbecco's phosphate- buffered saline, pH 6.8. Recombinant methionyl human leptin 1-146 (SEQ. ID NO : 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg/ml in 10 mM sodium acetate with 5% sorbitol, pH 4.C. Ten mM sodium acetate with 5% sorbitol, pH 4.0, was used as a vehicle control.
  • Animals Animals were housed in a temperature-, light-, and humidity-controlled conditions, with lights on at 0600 hours and lights off at 1800 hours. The Amgen, Inc. animal research facility is approved by the USDA and AAALAC-accredited. Six female ob/ob mice (Jackson Laboratories) were used per treatment group. Mice were 2 months old at the time of study, and weighed an average of 45.6 grams. Mice were randomized to treatment groups such that the mean body weights of the groups were equivalent prior to treatment initiation. Animals were housed two per cage and fed standard laboratory rodent chow pellets ad libitum.
  • the three-site glycosylated leptin resulted in the largest amount of weight loss, with an average weight loss of 10.8 ⁇ 0.3 grams (-23.8 ⁇ 0.5 % of initial body weight).
  • Administration of the same dose of r-metHu-Leptin (“hLeptin”) produced an average weight loss of 1.6 ⁇ 0.4 grams (-3.5 ⁇ 1.1 % of initial body weight), while administration of placebo resulted in an average weight gain of 2.6 ⁇ 0.2 grams (5.7 ⁇ 0.3 % of initial body weight) .
  • This Example demonstrates a substantially improved in vivo biological activity of glycosylated leptin as compared to non-glycosylated recombinant human leptin.
  • This Example demonstrates that a glycosylated human leptin having a Stokes' radius greater than 30 A has improved in vivo biological activity as compared to non-glycosylated recombinant human leptin. As can be seen, with daily administration after 7 days, ob/ob mice ate -11 times less food with the glycosylated leptin than with non-glycosylated leptin.
  • Animals Animals were housed in a temperature-, light-, and humidity-controlled conditions, with lights on at 0600 hours and lights off at 1800 hours.
  • the Amgen, Inc. animal research facility is approved by the USDA and AAALAC-accredited.
  • Six female ob/ob mice (Jackson Laboratories) were used per treatment group. Mice were 2 months old at the time of study, and weighed an average of 45.6 grams. Mice were randomized to treatment groups such that the mean body weights of the groups were equivalent prior to treatment initiation. Animals were housed two per cage and fed standard laboratory rodent chow pellets ad libitum.
  • Food intake is reported as the grams eaten per mouse per day, and was calculated as follows: (weight of the food in the cage the previous day - weight of the food that day) /the number of mice per cage (two) . All data are reported as the mean ⁇ SE .
  • results As can be seen in FIGURE 6, administration of the three-site glycosylated leptin resulted in the largest reduction of food intake, with an average food intake of 0.4 ⁇ 0.04 grams/mouse/day for the final 24- hour period after the seventh dose.
  • Administration of recombinant methionyl human leptin produced a reduction in food intake to 4.4 ⁇ 0.4 grams/mouse/day, in comparison to the food intake of vehicle-treated controls (7.0 ⁇ 0.3 grams/mouse/day) , for the same 24-hour period.
  • This Example demonstrates a substantially improved in vivo biological activity of glycosylated leptin as compared to non-glycosylated recombinant human leptin.
  • This Example demonstrates that the improved in vivo biological activity of a three site glycosylated human leptin having a Stokes' radius greater than 30 A is maintained when the material is administered on an intermittent basis.
  • ob/ob mice lost significantly more weight with either daily or every- other-day administration of glycosylated leptin, than when treated with a 10-fold higher dose of non- glycosylated leptin.
  • Leptin The t ree-glycosylation site leptin, prepared as described below (sites 47, 69 and 102, SEQ. ID NO: 32), was used, formulated at a concentration of 1.9 mg/ml in Dulbecco's phosphate- buffered saline, pH 6.8. Recombinant methionyl human leptin 1-146 (SEQ. ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg/ml in 10 mM sodium acetate with 5% sorbitol, pH 4.C. Ten mM sodium acetate with 5% sorbitol, pH 4.0, was used as a vehicle control.
  • Animals Animals were housed under temperature-, light-, and humidity-controlled conditions, with lights on at 0600 hours and lights off at 1800 hours. The Amgen, Inc. animal research facility is approved by the USDA and AAALAC-accredited. Six female ob/ob mice (Jackson Laboratories) were used per treatment group. Mice were 4.5 months old at the time of study, and weighed an average of 66.6 grams. Mice were randomized to treatment groups such that the mean body weights of the groups were equivalent prior to treatment initiation. Animals were housed two per cage and fed standard laboratory rodent chow pellets ad libitum.
  • glycosylated leptin or r-metHu-Leptin The dose of leptin was 1 or 10 mg/kg body weight/day for mice injected every-other-day with glycosylated leptin or r- metHu-Leptin . Injections were given on 7 consecutive days, beginning on study day 0, in the late afternoon (within 2 hours of lights off in the colony) . Mice injected every other day with leptin received injections of vehicle on alternate days. Animals were weighed daily at the time of injection. Percent weight loss is calculated as: ((Body weight on day 7 - Body weight on day 0)/Body weight on day 0) multiplied by 100. All data are reported as the mean ⁇ SE .
  • Table 10.1 Weight loss (expressed as a % of initial body weight) after 7 days of daily dosing of Glycosylated Leptin or recombinant methionyl human leptin.
  • Table 10.2 Weight loss (expressed as a % of initial body weight) after 7 days of daily dosing of glycosylated leptin or recombinant methionyl human leptin.
  • Leptin The three-glycosylation site leptin, prepared as described below (sites 47, 69 and 102, SEQ. ID NO: 32), was used, formulated at a concentration of 5.1 mg/ml in Dulbecco's phosphate- buffered saline, pH 6.8. Recombinant methionyl human leptin 1-146 (SEQ. ID NO : 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg/ml in 10 mM sodium acetate with 5% sorbitol, pH 4.0. Ten mM sodium acetate with 5% sorbitol, pH 4.0, was used as a vehicle control. 2. Animals .
  • mice Animals were housed under temperature-, light-, and humidity-controlled conditions, with lights on at 0600 hours and lights off at 1800 hours.
  • the Amgen, Inc. animal research facility is approved by the USDA and AAALAC-accredited.
  • Six female C57B1/6J mice (Jackson Laboratories) were used per treatment group. Mice were 2.5 months old at the time of study, and weighed an average of 20.0 grams. Mice were randomized to treatment groups such that the mean body weights of the groups were equivalent prior to treatment initiation. Animals were housed two per cage and fed standard laboratory rodent chow pellets ad libitum.
  • Table 11.1 Weight loss (expressed as a % of initial body weight) after 7 days of daily dosing of Glycosylated Leptin or recombinant methionyl human leptin.
  • the present example demonstrates that the three-site glycosylated leptin having a Stokes' radius greater than 30 A has a improved biological activity as compared to r-metHu-Leptin 1-146. Further, the example demonstrates that the improved biological activity is sustained when glycosylated leptin is administered on a less frequent dosing schedule than r-metHu-Leptin 1-146, in wild type mice.
  • Leptin The three-glycosylation site leptin, prepared as described below (sites 47, 69 and 102, SEQ. ID NO: 32), was used, formulated at a concentration of 5.1 mg/ml in Dulbecco's phosphate- buffered saline, pH 6.8. Recombinant methionyl human leptin 1-146 (SEQ. ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg/ml in 10 mM sodium acetate with 5% sorbitol, pH 4.0. Ten mM sodium acetate with 5% sorbitol, pH 4.0, was used as a vehicle control .
  • Animals Animals were housed under temperature-, light-, and humidity-controlled conditions, with lights on at 0600 hours and lights off at 1800 hours. The Amgen, Inc. animal research facility is approved by the USDA and AAALAC-accredited. Six female C57B1/6J mice (Jackson Laboratories) were used per treatment group. Mice were 2.5 months old at the time of study, and weighed an average of 20.0 grams. Mice were randomized to treatment groups such that the mean body weights of the groups were equivalent prior to treatment initiation. Animals were housed two per cage and fed standard laboratory rodent chow pellets ad libitum.
  • Table 12.1 Weight loss (expressed as a % of initial body weight) after 7 days of every-other-day dosing of glycosylated leptin or recombinant methionyl human leptin.
  • This example demonstrates that the enhanced biological activity of glycosylated leptin, relative to non-glycosylated leptin, is preserved when the protein is administered intermittently to non-obese mice.
  • Table 13.1 Presented below in Table 13.1 are additional glycosylated human leptin proteins which were also prepared.
  • the table columns present: (1) the position of the N-glycosylation (with respect to the numbering of SEQ. ID NO 1., rHu-Leptin 1-146 ) (unless otherwise noted); (2) the expression yield as compared to "wild type" ("WT", here, rHu-Leptin 1-146 as in SEQ. ID NO: 1) ; (3) the glycosylation species which were detected; (4) the receptor binding relative to "WT”; (5) the bioactivity relative to "WT” . Methods used are described below.
  • the term “ND” means not determined. (The specific sequences used herein for expression are more fully set forth in the Example below pertaining to expression of glycosylated leptin protein 47 + 69 + 102)
  • RRR denotes the use of three C-terminal arginine residues on the glycosylated leptin protein. Additionally, the following multiple site glycosylated leptin proteins have been made and tested as further described in Example 15, below.
  • the present invention also encompasses a glycosylated leptin protein having glycosylation sits at position 47, 69, 92, and 102.
  • Affecting Glycosylation This example illustrates the differences in glycosylation of a three-site glycosylated leptin protein having sites available for glycosylation located at positions 47, 69, and 102 of rHu-Leptin 1- 146 (SEQ. ID NO: 1 having the noted glycosylation sites using the formula N-X-S/T, prepared as described herein) , also as described above.
  • Expression in two cell types, COS cells, and CHO cells was generally according to methods in the Reference Examples, below.
  • Glycosylation was determined according to the methods set forth in the Reference Examples, below. The degree of glycosylation was scored on a scale of 1 to 5, with 5 having the appearance of the maximum occupancy of glycosylation sites.
  • the term “ND” means "not determined. "
  • Leptin R81, R85 (analog) - the naturally occurring human leptin signal sequence, and glycosylated leptin protein being the amino acid sequence of SEQ. ID NO: 1 with arginine at positions 81 and 85, and glycosylation sites at positions 47, 69 and 102
  • TPO Thrombopoietin
  • Tissue Plasminogen Activator Tissue Plasminogen Activator (TPA)- the naturally occurring human tissue plasminogen activator signal sequence
  • TPA tissue plasminogen activator signal sequence having the three c- terminal amino acids being the amino acids serine- proline-alanine
  • TPA(SP)- the naturally occurring human tissue plasminogen activator signal sequence having the two c-terminal amino acids being the amino acids serine-proline
  • TPA(SFS)- the naturally occurring human tissue plasminogen activator signal sequence having the three c- terminal amino acids being the amino acids serine- phenylalanine-serine
  • TPA(SWS)- the naturally occurring human tissue plasminogen activator signal sequence having the three c- terminal amino acids being the amino acids serine- tryptophan-serine
  • TPA the naturally occurring human tissue plasminogen activator signal sequence having the three c- terminal amino acids being the amino acids isoleucine- asparagine-serine
  • TPA-A2- the naturally occurring human tissue plasminogen activator signal sequence having additional c-terminal amino acids of arginine-glycine-arginine-phenylalanine- arginine-arginine
  • TPA(SP)-A2 the naturally occurring human tissue plasminogen activator signal sequence having the last serine of the naturally occurring sequence eliminated and having additional c-terminal amino acids of arginine- glycine-arginine-phenylalanine-arginine-arginine
  • TPA-A4- the naturally occurring human tissue plasminogen activator signal sequence additional c-terminal amino acids of glutamine-glutamic acid-isoleucine-arginine- glycine-arginine-phenylalanine-arginine-arginine
  • TPA-A5- the naturally occurring human tissue plasminogen activator signal sequence having additional c-terminal amino acids of glutamine-glutamic acid-isoleucine- histidine-alanine-arginine-phenylalanine-arginine- arginine
  • Intrinsic factor- the naturally occurring human intrinsic factor signal sequence
  • Serum albumin (pre-pro) the naturally occurring human serum albumin signal sequence and prosequence
  • G-CSF the naturally occurring human granulocyte colony stimulating factor signal sequence von Willebrand's factor (vW) - the naturally occurring human von Willebrand's factor signal sequence
  • EPO or "ESP” denoting erythropoietin signal peptide
  • EPO EPO
  • RRR ⁇ c-term the naturally occurring human erythropoietin signal sequence and also having, at the c- terminus of the amino acid sequence for the glycosylated leptin protein, three arginine residues
  • EPO-HSApro the naturally occurring human erythropoietin signal sequence having at the c-terminus the "pro" sequence from human serum albumin
  • EPO-modifiedHSApro the naturally occurring human erythropoietin signal sequence having at the c-terminus a modified "pro" sequence from human serum albumin (modified as indicated in the table below)
  • TPA signal peptides particularly those with modified c-termini (such as the addition of a prosequence) appeared to have the greatest glycosylation efficiency in both CHO and COS cells.
  • FIGURE 7 is a Western Blot which shows the results of a comparison of the various expression conditions for the three-site glycosylated leptin protein 47 + 69 + 102 as above. Beginning at the left hand side of the Western Blot in the FIGURE, the lanes are loaded as follows:
  • Lane 1 molecular weight standards
  • Lane 2 47+69+102 having a c-terminal amino acid sequence of three arginines, expressed in COS cells using the native human leptin signal peptide
  • Lane 3 Same as lane 2, expressed in CHO cells
  • Lane 4 Same as lane 2, expressed using a native human erythropoietin signal peptide
  • Lane 5 "QTT COS ESP", rHu-Leptin 1-145 (SEQ. ID NO: 2) having the amino acid change 27T29S > 27T29T, expressed in COS cells using a native human erythropoietin signal peptide;
  • Lane 6 "QTT CHO ESP", same as lane 5, expressed in CHO cells using a native human erythropoietin signal peptide; Lane 7: “EA2 47 + 69 + 102 COS”, same as Lane 2, lacking the C-terminal arginines, expressed in COS cells, using the erythropoietin signal peptide and a modified human albumin prosequence, as indicated in this Example;
  • Lane 8 "EA2 47 + 69 + 102 CHO", same as lane 7, expressed in CHO cells;
  • Lane 9 "EA2 47 + 69 + 102 + Furin in CHO" same as lane 8, using the furin construct as indicated in this Example.
  • the triple glycosylated leptin protein (lanes 2, 3, 4, 7, 8, an 9 ) has more glycosylation than the modified rHu- Leptin 1-145, having a single O-linked site (lanes 5 and 6) .
  • Use of CHO cells resulted in an increased amount of glycosylation as compared to COS cells (lane 2 versus lane 4, for example), and the use of the erythropoietin signal peptide appeared also to improve glycosylation (lanes 3 versus lane 5, for example).
  • FIGURE 9 is a Western Blot comparing the use of either the leptin signal peptide or the tPA signal peptide, or use of either one with a substituted enzyme cleavage site of the other.
  • Use of the tPA signal peptide resulted in greater glycosylation than use of the leptin signal peptide (left two lanes) .
  • glycosylation efficiency decreased ( "Tpa/Leptin" lanes) .
  • FIGURE 10 is a Western Blot comparing glycosylation efficiency by observation of results of removal of the carbohydrate moiety by N-glycanase.
  • the leptin protein migrates to the same molecular weight as non- glycosylated leptin. Comparing the apparent amount of carbohydrate in the lanes without N-glycanase ("-"), use of the erythropoietin signal peptide ("ESP" or "E” in combination with another notation, as used above) appears to more efficiently glycosylated the three site glycosylated leptin protein tested.
  • ESP erythropoietin signal peptide
  • glycosylated leptin proteins refer to glycosylation sites added to SEQ. ID NO: 1, using the preferred formula of N-X-S/T. Expression was in COS cells .
  • the percent (“%”) glycosylation means that percent of the molecules containing any carbohydrate. This was determined by visual examination of a Western Blot (as further described below in the Reference Examples) and determining subjectively that proportion of glycosylated protein of total leptin protein visualized. Controls
  • the human leptin 1-145 (SEQ. ID NO: 2, herein denoted to be "Q-") was expressed as a glycosylated protein.
  • ESP signal peptide from erythropoietin
  • WT denotes rHu-Leptin 1-146 (SEQ. ID NO : 1)
  • ESP denotes the native human erythropoietin signal peptide, as set forth in Example 14, above
  • ESP Ob+ denotes use the above with the native human erythropoietin signal peptide
  • EA denotes use of the native human erythropoietin signal peptide with the human albumin prosequence, as in Example 14, above.
  • FIGURE 11 shows that increasing the number of glycosylation sites, at least up to five sites, increases the amount of glycosylation found on the leptin protein when expressed in CHO cells .
  • the samples are as follows:
  • Lane 0 “MOCK” is non-leptin containing cell culture supernatant; Lane 1: “ESP(W.T.)' ⁇ rHu-Leptin 1-146 (SEQ. ID NO : 1) expressed using an erythropoietin signal peptide; Lane 2: “ESP (N48)", same as above, using the single site glycosylated leptin protein indicated (as described above) ;
  • Lane 3 "ESP (N47 + N69)", same as above, using the two-site glycosylated leptin protein indicated (as described above) ; Lane 4: “ESP (N47 + N69 + N102)", same as above, using the three site glycosylated leptin protein indicated (as described above) ;
  • Lane 5 "Tpa(SNS) N2 + N46 + N69 + N92" indicates the four site glycosylated leptin protein as described above, expressed using a human tPA signal peptide having an enzyme cleavage site of SNS (see Example 14 for sequence information) ;
  • Lane 6 “Tpa N2 + N23 + N47 + N69 + N92” indicates the five site glycosylated leptin protein as described above, expressed using the natural human tPA signal peptide (see Example 14 for sequence information) . As can be seen, the molecular weight increases with the increase in glycosylation sites (compare lane 1 to lane 6) . This indicates that the sites are adding carbohydrate and that up to five chains can be added to leptin simultaneously.
  • Table 15.14 presents a comparison of the different N-terminal amino acids of the subject glycosylated leptin protein incident to the use of various substituted enzyme cleavage sites for various signal peptides.
  • Leptin(SNS) also was highly glycosylated, and produced a leptin having an N-terminal amino acid of serine (e.g. , serine at the -1 position of SEQ. ID NO: 1 in a glycosylated leptin with a modified amino acid sequence of SEQ. ID NO: 1) .
  • the 5' (forward) flanking primer encoded the amino terminus of the rHu-Leptin signal peptide, an Xbal restriction enzyme site, and an optimized Kozak sequence (TCT ATC TAG ACC ACC ATG CAT TGG GGA ACC CTG T) .
  • the 3' (reverse) flanking primer sequence contained the complement of the carboxyl terminus of rHu-Leptin (1-146 ) and termination codons , as well as a Sail restriction site.
  • the PCR amplification product was digested with Xbal and Sail restriction enzymes, electrophoresed on an agarose gel, then isolated from the gel using the Promega® Wizard® kit procedure (Promega® Corporation, Madison, WI).
  • the purified product was ligated to Xbal and Sail cut pDSR ⁇ 2 expression vector modified slightly from that described in WO 90/14363 1990, e.g., at Figure 12, herein incorporated by reference in its entirety.
  • the pDSR ⁇ 2 used herein maintained the same functional elements, but was slightly modified from that set forth in WO 90/14363.
  • the sequence at the Hind III site was modified to AAGCTTCTAGA to generate an Xbal site, and the sequence at the Ncol site was modified to GTCGACCTAGG to generate a Sail site, with sufficient DNA sequence ( "stuffer DNA”) in between the two sites to allow efficient cutting by both Xbal and Sail to produce the cut plasmid for directional cloning of the present leptin protein expression construct.
  • the resulting pDSR 2/leptin plasmid was used for mammalian cell expression as below, and as a template for in vitro site directed mutagenesis.
  • Step 1 Two reactions (PCRl and PCR2 ) were performed on leptin template DNA using a total of four oligonucleotides: the 5' (forward) flanking rHu-Leptin primer, a reverse mutagenic primer, a forward mutagenic primer (complementary at least in part to the reverse mutagenic primer) and the 3' (reverse) flanking rHu- Leptin primer.
  • the mutagenic primers contained the desired nucleotide changes as well as 6-20 nucleotides exactly matching the template on each side of the changes.
  • PCRl used the 5' (forward) flanking primer and the reverse mutagenic primer.
  • PCR2 used the 3' (reverse) flanking primer and the forward mutagenic primer.
  • the DNA products of PCRl and PCR2 contained overlapping sequences at and on both sides of the mutations.
  • the amplified DNA fragments were separated by agarose gel electrophoresis . Small pieces of agarose containing DNA fragments of the correct size were excised from the gel.
  • Step 2 The DNA fragments from PCRl and PCR2 were combined together and a third PCR reaction was performed using only the 5 ' forward and 3 ' reverse flanking primers. Annealing of the complementary 3'- terminal regions of the appropriate strands of the PCRl and PCR2 products and subsequent strand elongation resulted in formation of full-length leptin DNA fragments. Thus, a full length DNA segment containing the desired mutations was amplified.
  • the 5' (forward) primer contained sequences which introduced a stop codon, a Kpnl site and a Kozak sequence (ACCACC) in front of the leptin signal peptide coding region ( 5 ' -TCTGGTACCTAGACCACCATGCATTGGGGAACCCTGT-3 ' ) .
  • the 3 ' (reverse) primer contained sequences which introduced a stop codon, a Kpnl site and a Kozak sequence (ACCACC) in front of the leptin signal peptide coding region ( 5 ' -TCTGGTACCTAGACCACCATGCATTGGGGAACCCTGT-3 ' ) .
  • the 3 ' (reverse) primer contained sequences which introduced a stop codon, a Kpnl site and a Kozak sequence (ACCACC) in front of the leptin signal peptide coding region ( 5 ' -TCTGGTACCTAGACCACCATGCATTGGGGAACCCTGT-3 ' ) .
  • PCR reactions were performed using a protocol adapted from Cheng et. al . , PNAS . 91: 5695 (1994) (herein incorporated by reference in its entirety) : 4 ⁇ l each of forward and reverse primers (5 pm/ ⁇ l) , 1 ⁇ l template (50 ng) , 10 ⁇ l of 5X LP buffer (100 mM Tricine, pH 8.7/25% glycerol/425 mM KOAc) , 2 ⁇ l dNTP stock (1 mM each of dATP, dTTP, dCTP, dGTP) , 0.8 ⁇ l rtTh polymerase (Perkin Elmer®; 2.5 U/ ⁇ l), and 2 ⁇ l Vent polymerase (NEB; 0.01 U/ ⁇ l after 1:100 fresh dilution in IX LP buffer).
  • 5X LP buffer 100 mM Tricine, pH 8.7/25% glycerol/425 mM KOAc
  • H2O was added to bring the final volume to 50 ⁇ l . All the components were added together in the order shown and the PCR was started when the temperature during the first cycle was above 60 C by adding 1 ⁇ l of 10 mM MgOAc . Reaction conditions were: 2 cycles of 94°C, 10 sec/45°C, 1 min/
  • PCR was performed using Taq DNA Polymerase (Boehringer Mannheim) or preferably, the proofreading DNA polymerase Pfu polymerase (Stratagene) , which unlike Taq polymerase does not tend to add an extra untemplated nucleotide at the 3' terminus of the extended strands.
  • Taq polymerase PCRs the DNA template was combined with 2.5 ⁇ l 10X Taq PCR buffer, 2.5 ⁇ l ImM dNTPs, 5 pmol of each primer, and water in a final volume of 25 ⁇ l. 0.5 units of Taq polymerase was added after the PCR mixture reached 94°C.
  • PCR reactions were then carried out for 25 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.
  • Pfu polymerase PCRs the DNA template was combined with 5 ul lOxPfu buffer (Stratagene) , 5 ⁇ l ImM dNTPs, 10 pmol of each primer, and water in a final volume of 50 ⁇ l and 1.2 U Pfu polymerase were added.
  • Four cycles of PCR with an annealing temperature of 48°C were performed followed by 20 cycles with an annealing temperature of 66 " C.
  • the tubes were allowed to incubate an extra 5 minutes at the elongation temperature.
  • the resulting PCR products for each analog were cleaned using the Promega® Wizard® PCR Cleanup kit.
  • the purified DNA was digested in a 50 ul restriction digest with Xbal and Sail restriction enzymes (Boehringer Mannheim) at
  • glycosylation sites Two or more glycosylation site mutations were combined by introducing a new substitution into DNA already containing a change, using the same PCR process.
  • double glycosylation site leptin analog genes single site glycosylated leptin plasmids (produced as described above) were used as PCR templates, and an additional glycosylation site was introduced by site directed mutagenesis with the appropriate primers.
  • plasmids encoding leptin analogs with three glycosylation sites were constructed using double N-glycosylation site leptin DNAs as template, and the process could be iterated for introduction of further glycosylation sites.
  • new combinations of glycosylation site mutations can be produced by using two different DNA templates, containing different glycosylation sites, in PCRl and PCR2.
  • a DNA encoding an analog with glycosylation sites at positions 2, 47, 69 and 102 could be produced by the mutagenic primer pair for position 47 glycosylation, by using a DNA template with a glycosylation site at position 2 in PCRl and a DNA with glycosylation sites at positions 69 and 102 in PCR2.
  • This DNA was used as template in a PCR to generate a DNA fragment encoding the exogenous signal peptide preceded by a consensus Kozak sequence and immediately followed by the first part of the coding region of mature rHu- leptin (or leptin analog) .
  • the primers used in this PCR reaction were a 5' (forward) flanking primer for the exogenous gene and a reverse primer whose 5 ' portion (10-25 nucleotides) was complementary to the sequence encoding the amino terminal portion of mature leptin (or leptin analog) .
  • a second PCR reaction was performed with leptin or leptin analog DNA as template, using the leptin 3' (reverse) flanking primer and a forward primer encoding the region of the junction of the exogenous signal peptide and the mature leptin (or leptin analog) sequence.
  • the forward primer in this reaction was designed to overlap the DNA generated by the first PCR, usually over a length of 15-35 nucleotides.
  • the products of the two PCR reactions were gel purified as described earlier, mixed, and were annealed and amplified in a PCR with just the exogenous gene 5' (forward) flanking primer and the 3' (reverse) flanking leptin primer.
  • DMEM was filter sterilized with a 0.45 ⁇ m Acrodisc® membrane (Gelman Sciences). 100 ⁇ L of lipofectamine (Gibco®/BRL@) was added and the DNA-lipofectamine mix was incubated for 20 minutes at RT . Medium was removed from plates containing 293 cells and 4 mL of DMEM and the DNA/lipofectamine solution was added. After 4-6 hours at 37°C, 5 ml of DMEM with 20% fetal bovine serum was added and the cultures incubated overnight. The next day the cells were rinsed with 293 medium and 5 ml of fresh 293 medium was added. The conditioned medium was collected after 3 days, aliquoted and stored at
  • glycosylated leptin proteins in COS cells. cDNA clones of glycosylated leptin proteins were transferred into COS-1 cells (ATCC No. CRL-1650) by electroporation. COS-1 cells were harvested from semi-confluent dishes, washed with medium (DMEM containing 10% fetal bovine serum and 1% L-glutamine/penicillin/ streptomycin (Irvine Scientific)) and resuspended at 6 x 106 cells/ml.
  • medium DMEM containing 10% fetal bovine serum and 1% L-glutamine/penicillin/ streptomycin (Irvine Scientific)
  • One half ml of cells was transferred to a 0.2 cm electroporation cuvette (Bio-Rad®) and electroporated with a BTX Electroporation System Electrocell Manipulator 600® at 650 uF and 130 volts on the low voltage setting with 25 ⁇ g of plasmid DNA encoding the glycosylated leptin protein.
  • the electroporated cells were plated on 100 mm tissue culture dish in 7 ml of medium.
  • the conditioned medium was collected 3 days after electroporation, filtered using a 0.45 ⁇ m Acrodisc® membrane (Gelman Sciences) and stored at minus 80 S C.
  • glycosylated leptin protein in CHO cells .
  • Stable expression of rHu-Leptin 1-146 or glycosylated leptin protein was performed by transformation of dihydrofolate reductase deficient (DHFR-) Chinese Hamster Ovary (CHO) cells with pDSR ⁇ 2 with the selected glycosylated leptin protein DNA as above followed by isolation and testing of individual clones.
  • DHFR- dihydrofolate reductase deficient Chinese Hamster Ovary
  • a 60 mm tissue culture dish was plated with lxlO 6 CHO DHFR " cells grown in CHO D ⁇ medium (DMEM-high glucose, 10% fetal bovine serum, 1% penicillin/ streptomycin/glutamine, 1% nonessential amino acids (Gibco®) and 1% HT supplement (Gibco®)) the day before transfection.
  • CHO D ⁇ medium DMEM-high glucose, 10% fetal bovine serum, 1% penicillin/ streptomycin/glutamine, 1% nonessential amino acids (Gibco®) and 1% HT supplement (Gibco®)
  • a 10 ⁇ g DNA precipitate was then formed and added to the plates dropwise as per the Mammalian Cell Transfection Kit instructions (Specialty Media, incorporated herein by reference) . After 24 hours in a tissue culture incubator, the medium was replaced with fresh CHO D- medium.
  • CHO select medium D-MEM high glucose, 10% dialyzed fetal bovine serum, 1% penicillin /streptomycin /glutamine, 1% nonessential amino acids (Gibco®) .
  • Medium was changed weekly until colonies appeared. After 10-14 days colonies were picked using 5 mm cloning discs (Labcore®) soaked in IX trypine-EDTA (Life Technologies®) and cultured in 24 well tissue culture plates with CHO select medium.
  • glycosylated leptin protein expression was determined using a leptin EIA assay described below.
  • the best expressing clones i.e. , those which demonstrated the most intense response using the EIA were expanded and frozen in cryogenic storage.
  • Electroporation experiments used 200 ⁇ g of pDSR ⁇ 2 with the glycosylated leptin protein insert as described above, and 200 ⁇ g of herring sperm carrier DNA. The DNAs were phenol- chloroform extracted and ethanol precipitated, then resuspended in 800 ⁇ l IX HEBS along with 2 X 10 7 DHFR-
  • CHO Chinese Hamster Ovary (CHO) cells grown in CHO D ⁇ medium. The cells and DNA were incubated at room temperature for 10 minutes. Electroporation was carried out at 290 volts, and 960 ufarads using a BIO RAD Gene PulserTM in 0.4 cm electroporation cuvettes. Cells were then incubated for 10 minutes at room temperature, washed with 10 ml CHO D- media, spun for 10 minutes at 1000 rpm in a Damon®/IEC Division IEC HN-SII Centrifuge, then resuspended in 20 ml CHO D- media and added to two 10 centimeter dishes.
  • Cells were grown for 2 days at 37°C, then split 1:4 into CHO selection media and grown to -70% confluency. Cells were then split 1:2 into selection media plus 6 nM methotrexate and grown at 37°C until clones were visible (approximately 2 weeks). Pools were generated from plates containing at least 4 colonies and were grown in selection media with 6 nM methotrexate until confluent (approximately 1 week) . The pools were then frozen in cryogenic storage.
  • N48 T50 Leptin Single glycosylation site leptin protein
  • CHO cells were transformed with DNA expressing N48 T50 Leptin as described in above.
  • Cells were expanded in spinner culture in growth medium (DMEM/F12 (1:1), 365 mg/1 L-Glutamine, IX MEM Non- Essential Amino Acids, 5% FBS) .
  • Roller bottles with breathable caps were then inoculated with 2e7 cells/bottle in 400 ml of growth medium and gassed for 10 seconds with 10% C0 2 in air.
  • Serum-free production medium 400 ml/bottle, DMEM/F12 (1:1), 365 mg/1 (IX) L- Glutamine, IX MEM Non-Essential Amino Acids, lO ⁇ M CUS04, 1.5g/l additional glucose.
  • Serum-free conditioned medium from three successive harvests were collected (180 Liters) and filtered through a 0.45 urn filter, concentrated about 30 fold, and diafiltered into 1 mM CHAPS, 10 mM Tris, pH 7.5 using a tangential- flow ultrafiltration system (Amicon®) with a 10,000 molecular weight cutoff membrane. The diafiltered media was stored at -20°C.
  • the following steps were performed at 2 to 8°C.
  • the DFM was applied to a Q-Sepharose Fast Flow column (Pharmacia®, 8 cm x 14 cm) equilibrated in 10 mM Tris, pH 7.9 and washed with about two column volumes of 10 mM Tris to elute all non-binding species.
  • Tris, pH 7.9 was added to the N48 T50 leptin pool from the Bio-Gel® HT column.
  • Tris, pH 7.9 to lOmM Tris, pH 7.9 collected into fractions. Fractions containing F3 , as determined by SDS-PAGE analysis, were combined.
  • Solid ammonium sulfate was added to the N48 T50 leptin pool from the Source 15PHE column to a final concentration of about 2.5 M and incubated overnight . The overnight precipitate was harvested by centrifugation .
  • the harvested ammonium sulfate precipitate was resolubilized in water, titrated to pH 4.5 with acetic acid, applied to a Source 15S column (Pharmacia®, 5.5 cm x 1.6 cm) equilibrated in lOmM NaCH2COOH, pH 4.5, then washed with about two column volumes lOmM NaCH2COOH, pH 4.5.
  • N48 T50 leptin which remains bound to the column was then eluted by a 72 column volume gradient from 50 mM NaCl, lOmM NaCH2COOH, pH 4.5 to 150 mM NaCl, lOmM NaCH COOH, pH 4.5 collected into fractions. Fractions containing N48 T50 leptin, as determined by SDS-PAGE analysis, were combined and titrated to pH 7.5.
  • the N48 T50 leptin pool from the Source 15S column was concentrated to about 1 mg/ml, diafiltered into Dulbecco's PBS (Gibco®), then concentrated to about 5 mg/ml using a stirred cell ultrafiltration system (Amicon®) with a 10,000 molecular weight cutoff membrane (Filtron®) .
  • the N48 T50 leptin was further concentrated to 10 mg/ml using centrifugal ultrafiltration (Centricon 10, Amicon®) .
  • the concentrated N48 T50 leptin was filtered (0.22 um) and stored at 2 to 8°C. II . Analytical Methods
  • Receptor Binding Assay membrane-bound leptin receptor was used as a target to measure the amount of binding by radioactively labeled test glycosylated leptins.
  • CHO Chinese Hamster Ovary
  • human leptin receptor DNA short form; Tartaglia et al . , Cell 83_i. 1271 et seq.(1995) herein incorporated by reference in its entirety; the entire article is herein incorporated by reference
  • Leptin receptor expressing cells were grown and collected by low speed centrifugation. The pelleted cells (approximately 50 mg wet weight) were resuspended in 0.32 M sucrose/25 mM HEPES and homogenized in glass homogenizing tubes using a Glas-col® motor.
  • the cell membranes were washed two times by centrifugation (48,000 x g) , dispersion using a polytron homogenizer (Tissue Tearor®) , and resuspension in cold binding buffer (MEM, Gibco BRL®/ 25 mM HEPES, Gibco
  • the membrane preparation was resuspended at a final concentration of 2-3 mg wet weight/mL in cold binding buffer.
  • in vitro biological activity was determined using a chimeric leptin receptor, having an extracellular domain of a leptin receptor, a transmembrane and intracellular domains of an erythropoietin receptor.
  • a chimeric leptin receptor having an extracellular domain of a leptin receptor, a transmembrane and intracellular domains of an erythropoietin receptor.
  • the cells exhibited a biological activity of proliferation, measured by H 3 - thymidine uptake.
  • Interleukin-3 (IL-3) dependent 32D (clone3) murine myeloid progenitor cells Greenberger et al .
  • chimeric leptin receptor-EPO receptor was constructed by standard techniques and subcloned into an expression vector containing the transcriptional promoter of Moloney murine sarcoma virus resulting in the vector OBR-EPOR/pLJ.
  • the chimeric receptor contained the coding regions for the extracellular domain of a human leptin receptor (amino acids 1-839; Tartaglia et al . , Cell: 83.
  • chimeric receptor was then transfected into 32D cells by electroporation. Transfected cells were initially selected on G418 (750 ug/ml) . Leptin responsive cells were then selected in RPMI 1640 (Gibco®) supplemented with 10% fetal bovine serum and 25 ng/ml Hu Leptin, resulting in 32D-OBECA cells. 32D cells which were not transfected with the chimeric receptor remained unresponsive to leptin.
  • 32D-OBECA cells were grown in 1640 RPMI medium (lx liquid, without L-Glutamine, Gibco®) containing 10% fetal bovine serum (Hyclone Laboratories®) and 1.0 ng/ml of recombinant murine IL-3 (Biosource®) to a density of approximately 5.0E+05 cells/ml.
  • a volume of lOO ⁇ l of each sample was added to appropriate wells of 96 well microtiter tissue culture plates.
  • Cells with sample or standard were grown at 10,000 cells per well (in lOO ⁇ l) for approximately 48 hours at 5+1% C0 2 and 37+2°C high humidity incubator.
  • 3H-Thymidine 0.5 ⁇ Ci per well, Dupont®
  • EIA Enzyme Immuno Assay
  • HRP horseradish peroxidase
  • Anti-rmetHu-Leptin 1-146 monoclonal antibodies were developed from Lou rats that were injected multiple times with KLH conjugated rmetHu-Leptin 1-146, mixed with Freunds complete adjuvant (primary injection) or with Freunds incomplete adjuvant (subsequent injections) .
  • Rat sera were tested for reactivity with rmetHu-Leptin 1-146, and spleen cells from those with the highest titers were fused to rat myeloma line Y3Ag 1.2.3 by standard hybridoma techniques. The hybrid cells were plated in 96-well plates, allowed to form colonies, assayed for anti-rmetHu-Leptin 1-146 activity, and single-cell cloned.
  • Monoclonal antibody from a rat hybridoma was used as one component of the leptin sandwich EIA.
  • Microtiter plates (96-well standard [Immulon®] or half-well [Costar®] ) were coated with 75 ⁇ l or 30 ⁇ l, respectively, of either polyclonal (1.5 ⁇ g/ml) or monoclonal (2.0 ⁇ g/ml) antibody in carbonate/bicarbonate buffer (NaHC0 3 0.029M, Na 2 C0 3 0.015M, pH 9.6).
  • the plates were blocked (1% bovine serum albumin [BSA] , 5% sucrose) and samples, diluted appropriately in 2% BSA in phosphate buffered saline (PBS) were added, in duplicate, to the wells.
  • BSA bovine serum albumin
  • the present Western-blot type analysis was used to determine the amount of carbohydrate present on the expressed glycosylated leptin proteins.
  • a volume of supernatant containing approximately 400-600 pg of glycosylated leptin protein from COS or CHO cells transfected with glycosylated leptin protein cDNAs as described above was mixed with SDS-PAGE 3X sample buffer (0.1875 M Tris-HCl pH 6.8 , 6% SDS, 30% glycerol, 15% 2-mercaptoethanol) .
  • the samples were analyzed by 14% acrylamide Tris-Glycine SDS-polyacrylamide gel electrophoresis (Novex®) and transferred to 0.45 ⁇ m nitrocellulose membrane (Novex®) .
  • the nitrocellulose membrane was rinsed, blocked with TBST (Tris 20mM, NaCl 137mM, Tween® 20 0.08%) containing 10% FBS and 2% BSA and incubated with HRP-conjugated polyclonal anti-rmetHu-Leptin 1-146 as prepared above (140 ng/ml, in TBST containing 5% FBS and 1% BSA) for 3-5 hours. After washing with TBST, five times, five minutes each, the membrane was developed with ECL reagent (Amersham®) , according to the manuf cturer's directions . The membrane was exposed to X-Omat® AR film (Kodak®) for ten to sixty seconds, and developed as for standard x-ray film. Specific protein bands were visualized, and sizes estimated from their positions relative to the molecular weight markers. The larger the size, the more carbohydrate moiety connected to the protein.
  • N-glycanase treatment removes N-linked carbohydrate resulting in an increase in mobility that is equal to that of unglycosylated leptin.
  • Treatment of glycosylated leptin proteins with N-glycanase resulted in a molecular weight similar to unglycosylated leptin. This confirms that the increased size of glycosylated leptin protein is due to N-linked carbohydrate.
  • Methods COS cell conditioned medium containing 400 pg of glycosylated leptin protein (l-3ul) was mixed with 10 ⁇ l 0.5% SDS and each sample was boiled for 3 minutes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Diabetes (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Obesity (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Hematology (AREA)
  • Endocrinology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Emergency Medicine (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
PCT/US2000/003652 1999-02-12 2000-02-11 Glycosylated leptin compositions and related methods Ceased WO2000047741A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
SI200030863T SI1151102T1 (sl) 1999-02-12 2000-02-11 Glikozilirani leptinski sestavki in s tem povezani postopki
AU33623/00A AU781460B2 (en) 1999-02-12 2000-02-11 Glycosylated leptin compositions and related methods
DE60027409T DE60027409T2 (de) 1999-02-12 2000-02-11 Glykosylierte leptinzusammensetzungen und zugehörige verfahren
EP00911784A EP1151102B1 (en) 1999-02-12 2000-02-11 Glycosylated leptin compositions and related methods
JP2000598639A JP4841037B2 (ja) 1999-02-12 2000-02-11 グリコシル化レプチン組成物および関連する方法
CA2359840A CA2359840C (en) 1999-02-12 2000-02-11 Glycosylated leptin compositions and related methods

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US24967599A 1999-02-12 1999-02-12
US09/249,675 1999-02-12

Publications (1)

Publication Number Publication Date
WO2000047741A1 true WO2000047741A1 (en) 2000-08-17

Family

ID=22944511

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/003652 Ceased WO2000047741A1 (en) 1999-02-12 2000-02-11 Glycosylated leptin compositions and related methods

Country Status (11)

Country Link
EP (1) EP1151102B1 (https=)
JP (1) JP4841037B2 (https=)
AT (1) ATE323766T1 (https=)
AU (1) AU781460B2 (https=)
CA (1) CA2359840C (https=)
CY (1) CY1107470T1 (https=)
DE (1) DE60027409T2 (https=)
DK (1) DK1151102T3 (https=)
ES (1) ES2257287T3 (https=)
PT (1) PT1151102E (https=)
WO (1) WO2000047741A1 (https=)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003020303A1 (en) * 2001-08-29 2003-03-13 The University Of Buckingham Use of leptin for infant with low birth weight for prevention of obesity
JP2004532020A (ja) * 2001-03-30 2004-10-21 メルク パテント ゲゼルシャフト ミット ベシュレンクテル ハフトング 融合タンパク質の免疫原性の低減
WO2005030963A1 (en) 2003-09-26 2005-04-07 Applied Research Systems Ars Holding N.V. Leader sequences for use in production of proteins
EP1481059A4 (en) * 2002-02-13 2006-02-01 Xoma Technology Ltd EUKARYOTIC SIGNAL SEQUENCES FOR THE EXPRESSION OF POLYPEPTIDES AND LIBRARIES FOR PRESENTING POLYPEPTIDES
WO2008067599A1 (en) * 2006-12-04 2008-06-12 Apollo Life Sciences Limited Isolated leptin and adiponectin molecules and chimeric molecules thereof
JP2010209114A (ja) * 2001-10-22 2010-09-24 Amgen Inc ヒト脂肪組織萎縮症を処置するためのレプチンの使用および該処置のための素因決定方法
US8501686B2 (en) 2008-06-05 2013-08-06 University Of Michigan Method of treating fatty liver diseases and conditions in non-lipodystrophic subjects
US8642543B2 (en) 2005-09-07 2014-02-04 Neurotez, Inc. Methods for treating progressive cognitive disorders related to neurofibrillary tangles
WO2014052583A1 (en) 2012-09-27 2014-04-03 The Children's Medical Center Corporation Compounds for the treatment of obesity and methods of use thereof
US8716220B2 (en) 2005-09-07 2014-05-06 Nikolaos Tezapsidis Leptin compositions and methods for treating progressive cognitive function disorders resulting from accumulation of neurofibrillary tangles and amyloid beta
WO2015081093A1 (en) 2013-11-26 2015-06-04 The Chilren's Medical Center Corporation Compounds for the treatment of obesity and methods of use thereof
WO2015153933A1 (en) 2014-04-03 2015-10-08 The Children's Medical Center Corporation Hsp90 inhibitors for the treatment of obesity and methods of use thereof
WO2018009921A1 (en) * 2016-07-08 2018-01-11 AskGene Pharma, Inc. Fusion protein comprising leptin and methods for producing and using the same
US9873868B2 (en) 2003-01-22 2018-01-23 Duke University Constructs for expressing lysosomal polypeptides
WO2018049424A1 (en) 2016-09-12 2018-03-15 Aegerion Pharmaceuticals, Inc. Methods of detecting anti-leptin neutralizing antibodies
US11535659B2 (en) 2010-09-28 2022-12-27 Amryt Pharmaceuticals Inc. Engineered polypeptides having enhanced duration of action

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080176790A1 (en) 2004-10-29 2008-07-24 Defrees Shawn Remodeling and Glycopegylation of Fibroblast Growth Factor (Fgf)
WO2008154639A2 (en) 2007-06-12 2008-12-18 Neose Technologies, Inc. Improved process for the production of nucleotide sugars
JP2009126856A (ja) * 2007-11-28 2009-06-11 Fancl Corp 血中中性脂肪上昇抑制剤
CN108524919A (zh) 2012-05-17 2018-09-14 延伸生物科学股份有限公司 用于改进的药物递送的载体
WO2016065052A1 (en) 2014-10-22 2016-04-28 Extend Biosciences, Inc. Insulin vitamin d conjugates
US9789197B2 (en) 2014-10-22 2017-10-17 Extend Biosciences, Inc. RNAi vitamin D conjugates
US9585934B2 (en) 2014-10-22 2017-03-07 Extend Biosciences, Inc. Therapeutic vitamin D conjugates
EP4593867A2 (en) 2022-09-30 2025-08-06 Extend Biosciences, Inc. Long-acting parathyroid hormone

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0486193A2 (en) * 1990-11-06 1992-05-20 Eli Lilly And Company A method for altering post-translational processing of tissue plasminogen activator
WO1995005465A1 (en) * 1993-08-17 1995-02-23 Amgen Inc. Erythropoietin analogs
GB2292382A (en) * 1994-08-17 1996-02-21 Univ Rockefeller Obesity(OB) polypeptides
WO1997018833A1 (en) * 1995-11-22 1997-05-29 Amgen Inc. Methods of increasing lean tissue mass using ob protein compositions
WO1997020933A2 (en) * 1995-12-06 1997-06-12 Schering Corporation MUTATIONAL VARIANTS OF MAMMALIAN Ob GENE PROTEINS
WO1997026916A1 (en) * 1996-01-25 1997-07-31 Eli Lilly And Company Obesity protein analog compounds and formulations thereof
EP0827750A2 (en) * 1996-08-23 1998-03-11 Eli Lilly And Company Obesity protein formulations
WO1999023115A1 (en) * 1997-10-31 1999-05-14 Eli Lilly And Company Glycosylated obesity protein analogs
WO2000009165A1 (en) * 1998-08-10 2000-02-24 Amgen Inc. Dextran-leptin conjugates, pharmaceutical compositions and related methods
WO2000021574A2 (en) * 1998-10-14 2000-04-20 Amgen Inc. Site-directed dual pegylation of proteins

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4766596A (en) * 1995-01-31 1996-08-21 Eli Lilly And Company Ob gene product antibodies
JPH09176198A (ja) * 1995-12-28 1997-07-08 Kikkoman Corp 抗肥満タンパク質モノクローナル抗体及びハイブリドーマ

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0486193A2 (en) * 1990-11-06 1992-05-20 Eli Lilly And Company A method for altering post-translational processing of tissue plasminogen activator
WO1995005465A1 (en) * 1993-08-17 1995-02-23 Amgen Inc. Erythropoietin analogs
GB2292382A (en) * 1994-08-17 1996-02-21 Univ Rockefeller Obesity(OB) polypeptides
WO1996005309A2 (en) * 1994-08-17 1996-02-22 The Rockefeller University Modulators of body weight, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof
WO1997018833A1 (en) * 1995-11-22 1997-05-29 Amgen Inc. Methods of increasing lean tissue mass using ob protein compositions
WO1997020933A2 (en) * 1995-12-06 1997-06-12 Schering Corporation MUTATIONAL VARIANTS OF MAMMALIAN Ob GENE PROTEINS
WO1997026916A1 (en) * 1996-01-25 1997-07-31 Eli Lilly And Company Obesity protein analog compounds and formulations thereof
EP0827750A2 (en) * 1996-08-23 1998-03-11 Eli Lilly And Company Obesity protein formulations
WO1999023115A1 (en) * 1997-10-31 1999-05-14 Eli Lilly And Company Glycosylated obesity protein analogs
WO2000009165A1 (en) * 1998-08-10 2000-02-24 Amgen Inc. Dextran-leptin conjugates, pharmaceutical compositions and related methods
WO2000021574A2 (en) * 1998-10-14 2000-04-20 Amgen Inc. Site-directed dual pegylation of proteins

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BAUDYS MIROSLAV ET AL: "Physical stabilization of insulin by glycosylation.", JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 84, no. 1, 1995, pages 28 - 33, XP000929132, ISSN: 0022-3549 *
COUSIN PATRICE ET AL: "Human variant sex hormone-binding globulin (SHBG) with an additional carbohydrate chain has a reduced clearance rate in rabbit.", JOURNAL OF CLINICAL ENDOCRINOLOGY & METABOLISM, vol. 83, no. 1, January 1998 (1998-01-01), pages 235 - 240, XP000925320, ISSN: 0021-972X *
COUSIN PATRICE ET AL: "Influence of glycosylation on the clearance of recombinant human sex hormone-binding globulin from rabbit blood.", JOURNAL OF STEROID BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 70, no. 4-6, September 1999 (1999-09-01), pages 115 - 121, XP000925370, ISSN: 0960-0760 *
LE MAIRE M ET AL: "THE USE OF HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY FOR THE DETERMINATION OF SIZE AND MOLECULAR WEIGHT OF PROTEINS A CAUTION AND A LIST OF MEMBRANE PROTEINS SUITABLE AS STANDARDS", ANALYTICAL BIOCHEMISTRY, vol. 154, no. 2, 1986, pages 525 - 535, XP000925150, ISSN: 0003-2697 *
TAKASHI MURAKAMI ET AL: "CLONING OF RAT OBESE CDNA AND ITS EXPRESSION IN OBESE RATS", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS,US,ACADEMIC PRESS INC. ORLANDO, FL, vol. 209, no. 3, 26 April 1995 (1995-04-26), pages 944 - 952, XP000602094, ISSN: 0006-291X *
WANG CHANGQING ET AL: "Influence of the carbohydrate moiety on the stability of glycoproteins.", BIOCHEMISTRY, vol. 35, no. 23, 1996, pages 7299 - 7307, XP000925259, ISSN: 0006-2960 *
YIYING ZHANG ET AL: "POSITIONAL CLONING OF THE MOUSE OBESE GENE AND ITS HUMAN HOMOLOGUE", NATURE,GB,MACMILLAN JOURNALS LTD. LONDON, vol. 372, no. 6505, 1 December 1994 (1994-12-01), pages 425 - 432, XP000602062, ISSN: 0028-0836 *
ZHANG FAMING ET AL: "Crystal structure of the obese protein leptin-E100.", NATURE (LONDON), vol. 387, no. 6629, 1997, pages 206 - 209, XP000885288, ISSN: 0028-0836 *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004532020A (ja) * 2001-03-30 2004-10-21 メルク パテント ゲゼルシャフト ミット ベシュレンクテル ハフトング 融合タンパク質の免疫原性の低減
JP2010222380A (ja) * 2001-03-30 2010-10-07 Merck Patent Gmbh 融合タンパク質の免疫原性の低減
AU2002321557B2 (en) * 2001-08-29 2006-03-30 The University Of Buckingham Use of leptin for infant with low birth weight for prevention of obesity
WO2003020303A1 (en) * 2001-08-29 2003-03-13 The University Of Buckingham Use of leptin for infant with low birth weight for prevention of obesity
JP2010209114A (ja) * 2001-10-22 2010-09-24 Amgen Inc ヒト脂肪組織萎縮症を処置するためのレプチンの使用および該処置のための素因決定方法
US20170095535A1 (en) * 2001-10-22 2017-04-06 Amgen Inc. Use of leptin for treating human lipoatrophy and method for determining predisposition to said treatment
JP2014224142A (ja) * 2001-10-22 2014-12-04 アムジェン インコーポレイテッド ヒト脂肪組織萎縮症を処置するためのレプチンの使用および該処置のための素因決定方法
US8476040B2 (en) 2002-02-13 2013-07-02 Xoma Technology Ltd. Eukaryotic signal sequences for polypeptide expression and polypeptide display libraries
EP2060628A1 (en) * 2002-02-13 2009-05-20 XOMA Technology Ltd. Eukaryotic signal sequences for polypeptide expression and polypeptide display libraries
JP2009131286A (ja) * 2002-02-13 2009-06-18 Xoma Technology Ltd ポリペプチドを発現させるための真核生物シグナル配列およびポリペプチド提示ライブラリー
US7396661B2 (en) * 2002-02-13 2008-07-08 Xoma Technology Ltd. Eukaryotic signal sequences for polypeptide expression and polypeptide display libraries
US7972811B2 (en) 2002-02-13 2011-07-05 Xoma Technology Ltd. Eukaryotic signal sequences for polypeptide expression and polypeptide display libraries
US7977068B2 (en) 2002-02-13 2011-07-12 Xoma Technology Ltd. Eukaryotic signal sequences for polypeptide expression and polypeptide display libraries
US7094579B2 (en) 2002-02-13 2006-08-22 Xoma Technology Ltd. Eukaryotic signal sequences for prokaryotic expression
EP1481059A4 (en) * 2002-02-13 2006-02-01 Xoma Technology Ltd EUKARYOTIC SIGNAL SEQUENCES FOR THE EXPRESSION OF POLYPEPTIDES AND LIBRARIES FOR PRESENTING POLYPEPTIDES
US9873868B2 (en) 2003-01-22 2018-01-23 Duke University Constructs for expressing lysosomal polypeptides
WO2005030963A1 (en) 2003-09-26 2005-04-07 Applied Research Systems Ars Holding N.V. Leader sequences for use in production of proteins
US8716220B2 (en) 2005-09-07 2014-05-06 Nikolaos Tezapsidis Leptin compositions and methods for treating progressive cognitive function disorders resulting from accumulation of neurofibrillary tangles and amyloid beta
US8642543B2 (en) 2005-09-07 2014-02-04 Neurotez, Inc. Methods for treating progressive cognitive disorders related to neurofibrillary tangles
WO2008067599A1 (en) * 2006-12-04 2008-06-12 Apollo Life Sciences Limited Isolated leptin and adiponectin molecules and chimeric molecules thereof
US8501686B2 (en) 2008-06-05 2013-08-06 University Of Michigan Method of treating fatty liver diseases and conditions in non-lipodystrophic subjects
US11535659B2 (en) 2010-09-28 2022-12-27 Amryt Pharmaceuticals Inc. Engineered polypeptides having enhanced duration of action
EP4082541A1 (en) 2012-09-27 2022-11-02 The Children's Medical Center Corporation Compounds for the treatment of obesity and methods of use thereof
WO2014052583A1 (en) 2012-09-27 2014-04-03 The Children's Medical Center Corporation Compounds for the treatment of obesity and methods of use thereof
WO2015081093A1 (en) 2013-11-26 2015-06-04 The Chilren's Medical Center Corporation Compounds for the treatment of obesity and methods of use thereof
WO2015153933A1 (en) 2014-04-03 2015-10-08 The Children's Medical Center Corporation Hsp90 inhibitors for the treatment of obesity and methods of use thereof
WO2018009921A1 (en) * 2016-07-08 2018-01-11 AskGene Pharma, Inc. Fusion protein comprising leptin and methods for producing and using the same
WO2018049424A1 (en) 2016-09-12 2018-03-15 Aegerion Pharmaceuticals, Inc. Methods of detecting anti-leptin neutralizing antibodies
US10775386B2 (en) 2016-09-12 2020-09-15 Aegerion Pharmaceuticals, Inc. Methods of detecting anti-leptin neutralizing antibodies
US11709166B2 (en) 2016-09-12 2023-07-25 Amryt Pharmaceuticals Inc. Methods of detecting anti-leptin neutralizing antibodies
EP4283304A2 (en) 2016-09-12 2023-11-29 Amryt Pharmaceuticals Inc. Methods of detecting anti-leptin neutralizing antibodies

Also Published As

Publication number Publication date
DE60027409T2 (de) 2007-04-12
DE60027409D1 (de) 2006-05-24
CA2359840C (en) 2012-10-23
ATE323766T1 (de) 2006-05-15
AU781460B2 (en) 2005-05-26
EP1151102B1 (en) 2006-04-19
AU3362300A (en) 2000-08-29
DK1151102T3 (da) 2006-05-29
CY1107470T1 (el) 2012-12-19
JP2002536018A (ja) 2002-10-29
ES2257287T3 (es) 2006-08-01
CA2359840A1 (en) 2000-08-17
JP4841037B2 (ja) 2011-12-21
PT1151102E (pt) 2006-07-31
EP1151102A1 (en) 2001-11-07

Similar Documents

Publication Publication Date Title
EP1151102B1 (en) Glycosylated leptin compositions and related methods
AU779461B2 (en) Osteoprotegerin binding proteins and receptors
AU763769B2 (en) OB fusion protein compositions and methods
EP2311955A2 (en) Osteoprotegerin binding proteins and their receptors
JP2002534962A (ja) Fc融合タンパク質としての抗肥満症タンパク質の発現および輸送
US20040067520A1 (en) OB fusion protein compositions and methods
EP1765872A1 (en) Glycosylated immunoglobulin and immunoadhesin comprising the same
JP2003507006A (ja) 血管内皮増殖因子改変体
JP2000502569A (ja) Obタンパク質レセプター及び関連組成物と関連方法
MXPA01008123A (en) Glycosylated leptin compositions and related methods
AU749719B2 (en) Stem cell factor
AU2004201574B2 (en) OB Protein Receptor and Related Compositions and Methods
MXPA99009387A (en) Osteoprotegerin binding proteins and receptors
HK1045160A (en) Expression and export of anti-obesity proteins as fc fusion proteins
SK97999A3 (en) Dna sequence, a polypeptide having hematopoietic biological property, the use thereof and pharmaceutical composition
AU2004202448A1 (en) OB Fusion Protein Compositions and Methods

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 33623/00

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2359840

Country of ref document: CA

Ref country code: CA

Ref document number: 2359840

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 598639

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/008123

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2000911784

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000911784

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 33623/00

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 2000911784

Country of ref document: EP