MXPA01008123A - Glycosylated leptin compositions and related methods - Google Patents

Abstract

The present invention relates to glycosylated leptin compositions and related methods. Included are glycosylated leptin proteins having a Stokes'radius allowing for improved properties, as well as glycosylated leptin proteins having selected sites for glycosylation, nucleic acids encoding such proteins, related host cells, vectors, processes for production, and methods of use of such compositions. Novel methods of producing glycosylated proteins are also provided. The glycolysated leptin protein can be used for preparing a pharmaceutical composition that can be used in the treatment of a human for a condition selected among obesity, diabetes and high blood lipid content.

Description

COMPOSITIONS OF GLUCOSILATED LEPTINE AND RELATED METHODS FIELD OF THE INVENTION The present invention relates to glycosylated leptin compositions and related methods. Included are glycosylated leptin proteins that have a Stokes radius that allows improved properties, as well as glycosylated leptin proteins that have sites selected for glycosylation, nucleic acids encoding such proteins, related host cells, vectors, processes for production, and methods of using such compositions. The novel methods for the production of glycosylated proteins are also provided.

BACKGROUND OF THE INVENTION Although the molecular basis for obesity is largely unknown, the identification of the "OB gene" and the encoded protein ("OB protein", also referred to herein as "leptin") has shed some light on the mechanisms that the body Used to regulate the deposition or storage of body fat. Zhang et al., Nature 372: 425-432 (1994) incorporated by reference in the REF: 132139 present; see also, the Correction at Nature 374: 479 (1995) also incorporated by reference herein.

The OB protein is active in vivo in ob / ob mutant mice (mice obese due to a defect in the production of the OB gene product) as well as in normal wild type mice. The biological activity manifests itself among other things, in the loss of weight. See in general, Barinaga, "Obese" Protein Slims Mice, Science 269: 475-476 (nineteen ninety five) . See PCT International Publication No. O96 / 05309, "Modulators of Body Weight, Nucleic Acids and Corresponding Proteins, and Diagnostic and Therapeutic Uses of Themselves", incorporated by reference herein in its entirety. See also, PCT International Publications Nos. WO96 / 40912, WO97 / 06816, 097/18833, WO97 / 38014, WO98 / 08512, and W098 / 28427, all of which describe the OB methods and compositions in greater detail and are incorporated by reference in the present in its entirety. The other biological effects of the OB protein are not well characterized. See generally, Friedman et al., Nature 395: 763-770 (October 1998) for a review of leptin and the regulation of body weight in mammals, incorporated by reference herein. It is known, for example, that in ob / ob mutant mice, administration of the OB protein results in a decrease in serum insulin levels, and serum glucose levels. It is also known that administration of the OB protein results in a decrease in body fat. This was observed in ob / ob mutant mice as well as in normal non-obese mice. Pelleymounter et al., Science 269: 540-543 (1995); Halaas et al., Science 269: 543-546 (1995). See also, Campfield et al., Science 269: 546-549 (1995) (peripheral and central administration of microgram doses of OB protein reduced dietary intake and body weight of ob / ob mice and obese mice induced by diet , but not in obese db / db mice). In none of these reports have toxicities been observed, even at the highest doses. Recombinant leptin is effective in humans to result in weight loss. Greenberg AS, Heymsfield SB, Fujioka K., et al., Safety and preliminary efficacy of recombinant methionyl human leptin (rL) administered by subcutaneous injection in thin and obese subjects. Poster presented at: the 58th Annual Meeting and Scientific Sessions of the American Diabetes Association; June 14, 1998; Chicago, IL, incorporated by reference herein. As has been demonstrated, the administration of recombinant human methionyl leptin to obese humans has resulted in weight loss without toxicities.

In addition, the weight that is lost is predominantly fat. Heymsfield et al., Changes in body composition and weight in thin and obese subjects treated with recombinant human methionyl leptin. Poster presented at: International Congress on Obesity; August 29-September 3, 1998; Paris, France, incorporated by reference in the present. It is known that native human leptin has a relatively fast half life in humans. Lau et al. , Pharmacokinetics of recombinant human methionyl leptin and the effect of antibody formation in thin and obese subjects after subcutaneous dosing. Poster presented at: International Congress on Obesity; Aug. 29-September 3, 1998, Paris, France, incorporated herein by reference. In the systemic circulation, the accumulation can be achieved either by giving larger doses or more frequent doses of the target protein. Reports indicate that exogenous leptin, as well as endogenous leptin, is removed from the circulation, at least in part, by the kidney. See, for example, Cumin et al., Journal of Endccrinology, 155: 577-585 (1997) and Cumin et al., Internal Journal of Obesity 21: 495-504 (1997), both incorporated by reference herein. In general, the kidney works to clear the blood plasma of certain substances by concentrating them in the urine. See, for example, Harth, The Function of the Kidneys, in: Human Physiology, Schmidt et al., Eds., Springer-Verlag New York, Heidelberg, Berlin, 1983 on pages 610-642, incorporated by reference herein. . The proportion or degree to which a serum protein can pass through the kidney is difficult to estimate, but in general, the anatomy of the kidney allows the free passage of water and solutes stick, but imposes a barrier to the passage of plasma proteins. Different substances have different "filtration capacity", clearance rates of the kidney, see Anderson et al., Renal and Systemic Manifestations of Glomerular Disease, in: The Kidney, Brener et al., Eds., Harcort Brace Joanovich, Inc., Philadelphia, PA, 1991 on pages 1831-1843, incorporated by reference herein. Leptin can be accumulated in the systemic circulation by continuous administration, such as by the osmotic pump or by guimic derivatization of the protein, so that the circulation time is increased. See, for example, PCT WO9640912, published December 19, 1996 and incorporated by reference herein in its entirety. The guímica derivatization of a recombinantly produced protein reguides in general, however, a process of two (or more) steps: step one, elaborate the protein; step two, add a guymic portion (such as a polyethylene glycol or dextran portion), see, for example, PCT O96 / 40912, supra, on page 8 and subsequent, for a description of the N-terminal derivatization leptin (referred to in the present as OB protein). For a "one step" process, in a recombinant DNA system, a fusion protein (alternatively called a "guimeric" protein) can be encoded where an additional polypeptide portion is encoded together with the desired protein, so that both are expressed. The lengthening of the protein can also increase the circulation time. Polypeptides such as the "Fc" portion of an antibody, or albumin have been used in this regard. See, for example, PCT WO 98/28427, incorporated by reference herein, entitled "Compositions of OB Fusion Proteins and Methods". The general disadvantage in manufacturing is that larger expression products are sometimes more difficult to fold in suitable conformations, and yields may be lower than those for smaller products. In addition, the total protein load per dose is increased, and the proportion of the therapeutic protein is decreased, with the use of fusion of increasing size.

The presence of carbohydrate on a protein may affect its clearance rate and may improve its potency in vivo, while at the same time affecting the intrinsic activity of the protein, solubility, stability and immunogenicity thereof. See, for example, European Patent Publication 0,640,619, published March 1, 1995, entitled "Erythropoietin analogues with additional glycosylation sites", incorporated by reference herein, and PCT patent publication WO 96/25498. , published on August 22, 1996, entitled "MPL Ligand Analogs" incorporated by reference herein. In addition, carbohydrate can be added by the production of eukaryotic cells, without the need for a two-step process. For example, application PCT / US96 / 06609, published on November 14, 1996, incorporated by reference herein, proposes various mammalian signal sequences, for the secretion of an ob protein from a mammalian cell (in the following pages). 11-12, for example). See also, PCT WO 97/20933, published on June 12, 1997, entitled "Mutational Protein Variants of the Mammalian OB Gene", particularly on page 11, which proposes the glycosylation alterations of the OB protein. Glycosylation occurs at specific sites along the polypeptide backbone.

There are usually two types of glycosylation: the O-linked oligosaccharides are linked to the serine or threonine residues while the N-linked oligosaccharides are attached to the asparagine residues when they are a part of the sequence Asn-X-Ser / Thr, where X can be any amino acid except proline. The structures of the N-linked and O-linked oligosaccharides and the sugar residues found in each type are different. One type of sugar that is commonly found on both is N-acetylneuraminic acid (hereafter referred to as sialic acid). Sialic acid is usually the terminal residue of the N-linked and O-linked oligosaccharides in mammalian cells and, by virtue of their negative charge, can confer acidic properties on the glycoprotein. The predominant form of human leptin of natural origin (provided in human cells) is not glycosylated. A variant of the naturally occurring protein that has a glutamine absent at position 28 of the mature protein (SEQ ID No. 2, infra) does contain two sites for glycosylation. These sites are both for O-linked glycosylation. It is believed, however, that this form is produced only in trace amounts in humans, and is not the predominant active form in vivo. It may be desirable to have a process, which results in a leptin having an increased systemic circulation time, which would not be governed by such a second derivatization step as described above. It is also desirable to increase the intrinsic activity, and the solubility of leptin, without causing or increasing immunogenicity or other harmful effects.

BRIEF DESCRIPTION OF THE INVENTION The present invention emerges from the observation that, compared to native, non-altered recombinant human leptin, the glycosylated leptin protein is functional in vivo and, in addition, certain forms of glycosylated leptin protein have longer systemic circulation times, in vivo, without toxicities. It has been found, surprisingly, of. Importantly, a glycosylated human leptin having a simple N-linked glycosylation site has biological activity both in vi tro and in vivo. In addition, the biological activity is equal to or slightly more potent than the recombinant human native leptin protein. As indicated above, the effect of leptin on obesity is thought to be due, in part, to the action in the brain. As indicated above, leptin is not a naturally-glycosylated molecule (in the Q + 28 form), SEQ ID NO. 1, infra, which is believed to be the predominant form in human serum). In addition, glycosylated proteins (glycoproteins) in general can not enter the brain due to an inability to cross the blood-brain barrier. The demonstration of equal biological activity (or slightly better) by glycosylated leptin demonstrates either that (a) the glycosylated leptin enters the brain, or (b) if it does not, the glycosylated leptin is more biologically effective in the peripheral tissues (such as the areas of adipose tissue viscera) than native recombinant human leptin. It has also been observed that a human leptin which is N-glycosylated at three sites has a much longer circulation time and a greater potency than native, recombinant human leptin, or N-glycosylated leptin at a single site. As described in the following working examples, various glycosylated leptins in two, three, four and five sites have been prepared and tested for in vitro activity, and in some cases in vivo. The present glycosylated leptins can have a desired, relatively long plasma half-life. The present glycosylated leptins having a Stokes radius greater than or equal to 30A have a reduced rate of filtration capacity through the membranes, and thus a reduced rate of degradation in the kidney. Although the Stokes radii can be determined in a variety of ways, the preferred form here is to use gel filtration chromatography. See generally, Le Maire et al., Analytical Biochemistry 154: 525-535 (1986) incorporated by reference herein, for gel filtration chromatography, to determine Stokes radii of various proteins for use as standards. Thus, the present glycosylated leptins are aguellas having a Stokes radius of about 30A when determined using gel filtration chromatography. It is preferred that the present glycosylated leptins also substantially prevent clearing in the liver. It is known that the liver has receptors that bind to galactose. Galactose is a sugar and may be a component of the carbohydrate portion of the present glycosylated leptins. Sialic acid will typically "lock" the galactose portion, and prevent its reactivity with gaacitose receptors in the liver. In addition, a portion of sialic acid imparts a negative charge. The more negatively charged the present glycosylated leptins are, the more they will "repel" the negatively charged membranes of the liver and kidney. Thus, the present glycosylated leptin proteins are preferably those having at least a majority of the galactose portions not available for binding to a galactose receptor, and more preferably, having a sialic acid moiety located at least in a majority of the sites available for sialation. As discussed herein, recombinant human leptin modified to contain sites for N-linked glycosylation at one site or at three sites, demonstrated that the glycosylated leptin protein could be functional, and could be as functional as natural human leptin. The glycosylation was achieved by means of the cellular machinery of the host, in cell culture, and therefore did not require an extra processing step (as required to derivatize the protein) to achieve the desired characteristics of the longer serum half-life. . Thus, in one aspect, the present invention relates to a glycosylated leptin protein having a Stokes radius greater than that of the naturally occurring glycosylated human leptin of SEQ ID NO. 2 (rHu-Leptin 1-145, following). In another aspect, the present invention relates to a glycosylated leptin protein having a Stokes radius greater than that of a glycosylated leptin protein having an N-linked glycosylation moiety. Y, in yet another aspect, the present invention relates to a glycosylated leptin protein having a Stokes radius equal to or greater than 30 Á, as determined by gel filtration. The present invention also relates to leptin proteins that have at least one additional glycosylation site. In still another form, the present invention relates to a glycosylated leptin protein having five or more than five sialic acid portions. The human leptin variant of natural origin (SEQ ID No. 2, below) contains 2 sites for O-linked glycosylation, and therefore may contain 4 portions of sialic acid. The present working examples demonstrate that the more strongly glycosylated leptin protein has substantially improved circulation time. In addition, the present invention relates to a glycosylated leptin protein having five, six or seven sialic acid portions. In other aspects, the present invention relates to a nucleic acid encoding a glycosylated leptin protein as described herein, as well as to a vector containing a nucleic acid encoding a glycosylated leptin protein according to the description in the present.

Thus, in still other aspects, the present invention relates to a host cell containing a nucleic acid encoding a glycosylated leptin protein according to the present disclosure. The present invention also relates to the use of the present nucleic acids for gene therapy. In addition, the present invention relates to a method for the preparation of a glycosylated leptin protein. The present invention also relates to selective binding molecules, such as antibodies that selectively bind to the present glycosylated leptin proteins. In other aspects more fully described below, the present invention relates to pharmaceutical compositions comprising a glycosylated leptin protein of the present invention, in a pharmaceutically acceptable carrier. The present invention also relates to a method of treating a human for a condition selected from obesity, diabetes, and effects of high blood lipid content; said method comprises the administration of an effective amount of a glycosylated human leptin according to the present invention. The present invention also relates to improved methods for the production of glycosylated leptin proteins, as well as the production of glycosylated proteins in general. The present working examples demonstrate that for the present glycosylated leptin proteins, the use of a signal peptide different from the native human leptin signal peptide, improves the glycosylation efficiency. In this case, the improved glycosylation efficiency results in the desirable property of. number and increased size of added carbohydrate chains. Thus, the present compositions and methods include the use of signal peptides other than the native leptin signal peptide. Apart from the native human leptin signal, the particular signal peptides are known to be found naturally (for example, natural signal peptides are those that have not been genetically engineered by humans, by any means that include recombination homologous, recombinant DNA techniques or other means known or expected to alter the constituents of the nucleic acid sequence, although the cell containing them may have been cultured or otherwise removed from their natural environment in vivo), as well as those not found in nature (for example, unnatural signal peptides are those that have been genetically engineered by humans as described above), as described below. The present invention further relates to the observation that modification of the signal peptides, as well as other peptides that are processed from the mature protein, improve the performance of the glycosylated proteins. Modifications to the signal peptide include altering the peptidase cleavage site to improve cleavage accuracy (and thereby produce a higher yield of desired glycosylated proteins having the predicted N-terminal amino acid sequence). Modifications to the signal peptide may also, or alternatively, greatly improve the glycosylation efficiency, even in the absence of the "correct" cleavage of the mature protein from the presequences. ("Correct" indicates that the first amino acid on the N-terminus is one for the predicted mature protein, which does not have any amino acids found on the signal peptide or other presequences). Other modifications include the addition of "prosequences" that are also cleaved but also generate improved glycosylation efficiency. Signal peptides of natural as well as non-natural origin can be modified as such. The specific examples are provided herein.

Therefore, the present invention also relates to an improved method of making a glycosylated protein comprising: a). the cultivation, under conditions suitable for expression and glycosylation, of a host cell containing a DNA sequence encoding, in the 5 'to 3' direction (i) a signal peptide, and (ii) a DNA encoding a glycosylated protein; and b) obtaining the glycosylated protein wherein the enhancement comprises the use of a signal peptide having an optimized peptidase cleavage site to maximize the yield of the glycosylated protein and, optionally, the addition of a prosequence.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a graph showing weight loss in relation to control with buffer, for animals dosed with various doses of a glycosylated leptin in a single site ("Glucosylated CHO Leptin") and non-glycosylated rmetHu-Leptinl-146 ( "Leptin"). Figure 2 is a Stain analysis or Western blot as described below in Examples 5 and 6 below, which shows that alterations in the amino acid sequence of the glycosylation site can alter the type or amount of glycosylation. Figure 3 is a graph of serum leptin concentrations after subcutaneous administration of 1.0 mg / kg of rmetHu-Leptin or a glycosylated leptin protein at three sites, in male CD-1 mice as described later in Example 7 Figure 4 is a graph of serum leptin concentrations after intravenous administration of 1 mg / kg of rmetHu-Leptin or a glycosylated leptin protein at three sites, in male CD-1 mice as described later in Example 7. Figure 5 is a graph of weight loss after administration of a glycosylated leptin protein at three sites ("GE-Leptin") as described later in Example 8. Figure 6 is a graph of the uptake of food after administration of a glycosylated leptin protein at three sites ("GE-Leptin") as described later in Example 9. Figure 7 is a Western blot that illustrates the effects of of the various signal peptides on the expression and glycosylation of a glycosylated leptin protein at three sites, as described later in Example 14.

Figure 8 is a Western blot illustrating the effects of various signal peptides, and other peptides, on the glycosylation of a glycosylated leptin at three sites, as described later in Example 14. Figure 9 is a Western blot. This illustrates the effects of the peptidase cleavage site on the glycosylation of a glycosylated leptin protein at three sites, as described later in Example 14. Figure 10 is a Western blot illustrating the effects of the various signal and signal peptides. other peptides on the glycosylation of a glycosylated leptin at three sites, as described later in Example 14. Figure 11 is a Western blot, as described in Example 15 below, and shows that the increase in the number of glycosylation, at least up to five sites, increases the glycosylation increase found on the leptin protein when expressed in CHO cells.

DETAILED DESCRIPTION OF THE INVENTION As indicated above, the present invention relates, in one aspect, to glycosylated leptin proteins which have a Stokes radius greater than that of glycosylated human leptin, of natural origin. Preferably, to increase the half-life of a therapeutic composition in the systemic circulation, the Stoke radius is of sufficient size to reduce the filtering capacity in the kidney. The effect of having a Stoke radius of this size is to keep the glycosylated leptin protein in the systemic circulation for a longer period of time and that it could be for another glycosylated leptin protein, which does not have this effective size. After the empirical determination of the Stokes radius for the present glycosylated leptin protein, the size must be greater than or equal to about 30A, as determined by the methods described in detail below. When used with reference to a single glycosylated leptin protein molecule, the term "approximately" means the average Stokes radius over a period of time for that individual glycosylated leptin protein molecule. As provided herein, glycosylated leptin proteins having a higher Stoke radius than leptin proteins of natural origin have improved properties. The preferred Stoke radius for a population of glycosylated leptin protein molecules, as present in a therapeutically effective dose, is that it is greater than or equal to about 30 Á. The term "approximately" indicates that any population of the glycosylated leptin protein molecules, some may have a higher Stoke radius, some may have a lower Stokes radius, but the Stokes average radius of a given population of leptin protein. glycosylated is greater than or equal to 30 Á. The more above 30 A is the Stokes radius, the greater the effective size of the glycosylated leptin protein molecule (s). The larger the effective size, for example, the greater the hydrodynamic volume achieved by the addition of the oligosaccharide, the slower the effective movement through the basal membranes throughout the body. In order for the leptin to reach the renal tubules where it is degraded, it must first pass through the basal membranes of the glomerulus. Thus, by increasing the hydrodynamic size, filtration is retarded through the glomerular membrane, and therefore degradation is retarded and thus also the final clearance of the polypeptide in the proximal tubules. For example, the present leptin at the 3-glycosylation site, rHu-Leptin 1-146 with glycosylation sites at positions 47, 69 and 102 (for example, having a substituted asparagine residue at positions 47, 69 and 102, and a substituted threonine residue at positions 29, 71 and 104) has a Stokes average radius of 32.1 A (based on two gel filtration measurements of 31.9 A and 32.3 A). The following working example demonstrates that this glycosylated leptin showed a 4- to 5-fold decrease in systemic clearance and an increase in half-life compared to rmetHu-Leptin. Also as indicated above, there are several ways to determine the Stokes radius of a molecule. The present Stokes radius, for purposes of the present glycosylated leptin proteins, is determined using gel filtration, see Le Maire et al., Supra, see also, Kyte, Structure in Protein Chemistry, Garland Publishing, Inc., New York and London, 1995 on pages 293-316, incorporated by reference herein. Currently, the gel filtration used to determine the Stokes radius are polymeric spheres (agarose) to which dextran is covalently linked. Commercial preparations include SuperdexMR 200 HR 10/30 (Pharmacia) and Sephacryl®S-200 high resolution (Pharmacia). These two preparations were alternatively used to determine the Stokes radius of the present glycosylated leptin proteins. A column can be of any size, but a size of approximately 1 x 30 cm is preferred for ease of handling. The instruction manuals for the column preparation for each of the above gel filtration substances are incorporated by reference herein in their entirety (Paper Number 71-7059-00 Editions AB for SuperdexMR and 52-2086-00 -03, for Sephacryl®). The buffer that is to be used should be clearly similar to a physiological buffer that does not significantly alter the conformation of the molecule's solution and interfere with the size separation of the protein molecules. Saline solution buffered with phosphate is preferred, and was used to determine the Stokes radius of the present glycosylated leptin proteins. The process for carrying out the gel filtration should generally follow the instruction manuals as incorporated above. The selected glycosylated leptin protein for which a Stokes radius is to be determined, must be loaded onto the column. Later, for example, a concentration of 0.4 of A280 / ml, which is approximately 0.45 mg / ml, was used for a glycosylated leptin at three sites (47, 49, 102). The shock absorbers used in this were PBS, but other shock absorbers may be used. The shock absorber for the load must be compatible with good gel filtration practices and could theoretically contain high content of salts and other materials consistent with what a person skilled in the art could consider appropriate. The load or storage buffer must not interfere (either by precipitation as it hits the column or by being denaturing and require refolding as it elutes) with the determination of the Stokes radius. A column of gel filtration substances that has not been previously used is preferred. The wash buffer, such as phosphate buffered saline, should be applied at a rate of 0.25 ml / minute or a linear flow rate of 0.3 cm / minute. This value will be determined by the properties of the gel and is basically following the instructions of the manufacturers. The eluted fractions contain the glycosylated leptin protein molecules that are not trapped in the gel filtering substance. To determine the Stokes radius, it is necessary to compare the glycosylated leptin protein test, to know the proteins used to calibrate the gel filtration column. The methods as in the Manual Instruction of Gel Filtration Calibration Equipment (Pharmacia Biotech document ll-B-033-07, Rev. 2), are incorporated by reference herein. In general, selected proteins of known Stokes radio are filtered through the column, and the fraction where each of them elutes is annotated. The fraction containing the target glycosylated leptin protein is compared to the fraction of the calibrated proteins. Thus, the glycosylated leptin proteins are those that have a Stokes radius (from the glycosylated leptin protein portion alone, which does not include any other chemical derivatization that can be further performed, as indicated below), or greater than or equal to 30 Á as determined by gel filtration. Gel filtration can be accomplished using the dextran-coated agarose gel filtration substances, such as Superdex ™ or Sephacryl®, as described above. The buffer can be saline buffered with phosphate.

Amino Acid Sequences of Leptin 1. Glycosylation sites. In general, to prepare the glycosylated leptin composition of the present invention, will begin with a selected amino acid sequence, and that sequence will be modified to include the addition of sites for N-linked or O-linked glycosylation. The following formula is preferred for the addition of sites for N-linked glycosylation (see generally, Creighton, Proteins, WH Freeman and Company, NY, (1984) page 498, plus the index on pages 76-78 incorporated by reference. in the present): N - X - T / S where "N" is Asparagine, "X" is any amino acid except proline and "T / S" is Treonine or Serine. The formula "N-X-T" is preferred; whereby the alteration with respect to an initial leptin amino acid sequence is that in which "X" remains the same as for the initial leptin sequence (preferably SEQ ID Nos. 1 or 2, infra), and the amino acid immediately in the downward direction (towards the C-terminus) is threonine. The N-linked sites on the outer surface of the protein are preferred. Surface residues suitable for glycosylation can be identified by examination of a three-dimensional structure or model, or by nuclear magnetic resonance or crystal structure (as discussed below). Also, it has determined that a proline in position -1 with respect to the Asparagine residue (for example, towards the N-terminus) in some glycosylation sites can be harmful, and it is sought to avoid a proline residue in such a site. Working examples 5 and 6 demonstrate the effect of glycosylation site occupancy of N-X-S versus N-X-T and adjacent amino acids.

O-linked glycosylation sites are found on the outer surface of the proteins in general near or adjacent to the proline residues. O-linked residues can be found or introduced by the inclusion of serine or threonine residues near or adjacent to the proline residues. In general, threonine residues are preferred. For example, SEQ ID NO. 1 (below) which has a proline in position 99, and a threonine in position 100, was introduced. This leptin was expressed in CHO cells and COS cells, and was O-linked glycosylated. In addition, one can select to combine the N-linked sites and O-glycosylation in the present glycosylated leptin proteins. As described above, one or more O-linked glycosylation sites can be added, and, in addition, add one or more N-linked glycosylation sites. 2. Sites for Glucosylation. In general, the protein backbone will be modified using the above formulas to add an N-linked or O-linked glycosylation site. In order to select a site along the main chain of the protein for N-glycosylation, the general rule is that the asparagine residue must be located on an outer surface of the protein to be available for the addition of the carbohydrate portion. For example, with respect to the three-dimensional structure of leptin, the asparagine residue must be on a loop, ß turn, or on an outer surface of an alpha helix. This analysis is based on the current structure of leptin and functional structural relationship of several cytokines. When the site for glycosylation is selected, the three-dimensional conformation of leptin can be considered. The first several amino acids of leptin are disordered, which indicates a certain amount of flexibility. Topologically, the structure of leptin (see, Zhang et al., Nature 387: 206-209 (1997) (which reports the crystal structure of leptin E-100 of the obese protein, incorporated by reference in the present) is similar to the structure of the cytokine, the granulocyte colony stimulation factor ("G-CSF") (see, for example, U.S. Patent No. 5,581,476, Osslund, which describes the three-dimensional structure of crystalline rmetHuG-CSF) Given the apparent flexibility and the apparent lack of biological significance of helix A, one can choose to modify SEQ ID NO.1 to include the glycosylation sites in the ValI or Pro2 residues.

Asp23 (of SEQ ID No. 1) is on the last turn of helix A and is considered a good choice since the side chain is at least partially on the outer surface of the protein. The proline residue at position 47 and the isoleucine residue at position 48 (of SEQ ID No. 1) are at the end of loop AB, only a pair of residues from the beginning of helix B. These are about the surface of the protein, and may be suitable for the insertion of the glycosylation site. The proline residue in position 69 is on the surface of the protein, which is a good position for glycosylation. The residue of the phenylalanine in position 92 is at the end of the helix C and its side chain is opposite to the face of which the receptor can be bound. This is likely to produce the best result since there is the least interference from any portion of glycosylation with the link to the receptor. The serine at position 102 is on the surface of the protein in the middle part of the CD loop and must be in a relatively flexible portion of the structure, together with the positions 101 (alanine) and 103 (glycine).

Thus, the present invention relates to a glycosylated leptin protein comprising SEQ ID NO. 1 (rHu-Leptin 1-145, below) or SEQ ID NO. 2 (rHu-Leptin 1-145, below) having one or more sequential alterations as a glycosylation site. Said sequential alterations can be selected from: 01V- >; N 02P- > A 03I- > T or S (for example, the alteration of the first amino acid in SEQ ID No. 1, below, which is a valine, to asparagine, by altering the second amino acid of proline to any of the other 19 amino acids (such as alanine), and altering the third amino acid of isoleucine to threonine or serine); 02P- > N 031 04Q- > T or S (for example, by altering the second amino acid in SEQ ID NO.1, next, which is a proline, to asparagine, keeping the third amino acid as isoleucine, and altering the fourth amino acid from glutamine to threonine or serine), - 23D- > N 241 25S- > T or keep as S (for example, alter the 23rd amino acid in SEQ ID NO. 1 below, which is an aspartic acid to asparagine, keeping the 24th amino acid as isoleucine, and for the 25th amino acid, either maintaining serine or changing to threonine); 47P- > 481 49L- > or S (for example, by altering the 47th amino acid from proline to asparagine, maintaining the 48th amino acid as isoleucine, and altering the 49th amino acid from leucine to threonine or serine), - 48I- > N 49L 50T or T- > S (for example, by altering the 48th amino acid from isoleucine to asparagine, keeping the 49th amino acid as leucine, and keeping the 50th amino acid as threonine, or altering it to serine); 69P- > N 70S 71R- > T or S (for example, altering the 69th amino acid in SEQ ID No. 1, following, from proline to asparagine, maintaining the 70th amino acid as serine, and altering the 71st amino acid from arginine to threonine), - 92F- > N 93S 94K- > T or S (for example, by altering the 92nd amino acid of SEQ ID No. 1, below, from phenylalanine to asparagine, keeping the 93th amino acid as a serine, and altering the 94th amino acid of lysine to threonine or serine); 101A- > N 102S 103G- > T or S (for example, by altering the 101st amino acid in SEQ ID No. 1, below, from alanine to asparagine, maintaining the 102th amino acid as serine, and altering the 103th amino acid of glycine to threonine or serine). 102S- > N 103G 104L- > T or S (for example, altering the 102nd amino acid in SEQ ID No. 1 below, from tryptophan to asparagine, keeping the 103th amino acid as glycine, and altering the 14th amino acid from leucine to threonine or serine). 103G- > N 104L 105E- > T or S (for example, by altering the 103rd amino acid in SEQ ID No. 1, below, from glycine to asparagine, maintaining the 104th amino acid as leucine, and altering the 105th amino acid of glutamic acid to threonine or serine). Thus, the above brief notations indicate the location of the amino acid with respect to SEQ ID NO. 1, and the change of an amino acid - > to another amino acid. As indicated below, the change in the third amino acid (the amino acid towards the C-terminus of the protein) to threonine is preferred for ease in commercial manufacture, particularly in the glycosylation efficiency, although, as indicated above, a serine It can also be used on this site. Conventional abbreviations of single-letter amino acids are used, as in Stryer, Biochemistry, Third Edition (1988), W.H. Freeman and Company, New York, within the back cover, incorporated by reference herein. In view of the above, the present invention also relates to a glycosylated leptin protein comprising SEQ ID NO. 1 (rHu-Leptin 1-146, below) having one or more alterations in the sequence as a glycosylation site selected from (where "T / S" denotes threonine or serine): a) 01V- > N 02P- > X (where X is any amino acid except proline) 03I- > T / S b) 02P- > N 031 04Q- > T / S c) 23D- > N 241 25S- > T / S d) 47P- > N 481 49L- > T / S e) 48I- > N 49L 50T / S f) 69P- > N 70S 71R- > T / S g). 92F- > N 93S 94K- > T / S h) 101A- > N 102S 103G- > T / S i) 102S- > N 103G 104L- > T / S j) 103G- > N 104L 105E- > T / S The following working examples demonstrate the biological activity that at least approximates the non-glycosylated rmetHu-Leptin 1-146 (SEQ ID No. 1) for the leptin proteins of single and double glycosylation sites. In addition, the particular leptin proteins of three, four and five glycosylation sites have demonstrated increased biological activity. Thus, the present invention also includes the particular glycosylated leptin proteins, as described in the working examples: a glycosylated leptin protein comprising amino acids 1-146 of SEQ ID NO. 1, which has a glycosylation site located at a position selected from (with respect to the numbering of SEQ ID No. 1: 1, 2, 4, 8, 23, 44, 47, 48, 69, 70, 93 , 97, 100, 101, 102, 103, 118 and 141. A glycosylated leptin protein comprising amino acids 1-146 of SEQ ID NO 1, which has two glycosylation sites, the two sites selected from among (with respect to to the numbering of the SEQ ID NO. 1): 47 + 69; 48 + 69; 69 + 101, 69 + 102, 69 + 103 69 + 118; and 100 + 102. - a glycosylated leptin protein comprising amino acids 1-146 of SEQ ID NO. 1, which has three glycosylation sites, the three sites selected from among (with respect to the numbering of the SEQ ID NO. 1 ); 2 + 47 + 69; 23 + 47 + 69; 47 + 69 + 100; 47 + 69 + 102; 48 + 69 + 118; 69 + 102 + 118; and 69 + 103 + 118. a glycosylated leptin protein comprising amino acids 1-146 of SEQ ID NO. 1, which has four glycosylation sites, the four sites are selected from (with respect to the numbering of the SEQ ID NO. 1): 2 + 47 + 69 + 92; 2 + 47 + 69 + 102; 23 + 47 + 69 + 92; 23 + 47 + 69 + 102; and 47 +69 + 100 + 102. a glycosylated leptin protein comprising amino acids 1-146 of SEQ ID NO. 1, which has five glycosylation sites, the five sites are selected from among (with respect to the numbering of the SEQ ID NO. 1): 2 + 23 + 47 + 69 + 92 2 + 47 + 69 + 92 + 102 23 + 47 + 69 + 92 + 102. More particularly, the present invention includes the following amino acid sequences of the glycosylated leptin protein, the DNAs encoding such sequences, and the specific DNAs as described below: glycosylated leptin 2, 47, 69 (SEQ ID NO: 25, DNA): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCTTCTCTA AGAGCTGCCA CTTGCCCTGG 301 GCCAGTGGCC TGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTAAGCC CTGGGTGC Glycosylated Leptin 2, 47, 69 (SEQ ID NO.26, Protein): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL AFSKSCHLPW 101 ASGLETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC Glycosylated Leptin 2, 47, 69, 92 (SEQ ID No. 27, DNA): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCAACTCTA CCAGCTGCCA CTTGCCCTGG 301 GCCAGTGGCC TGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC Leptin glycated 2, 47, 69, 92 (SEQ ID NO. 28, protein) 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL ANSTSCHLPW 101 ASGLETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC Glycosylated Leptin 2, 47, 69, 102 (SEQ ID NO.29, DNA): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCTTCTCTA AGAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC Glycosylated leptin 2, 47, 69, 102 (SEQ ID NO: 30, protein): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL AFSKSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC Glycosylated leptin 47, 69, 102 (SEQ ID NO 31, DNA.): 1 GTGCCCATCC AAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCTTCTCTA AGAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC Glycosylated Leptin 47, 69, 102 (SEQ ID No. 32, Protein): 1 VPIQKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL AFSKSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC Glycosylated Leptin 2, 47, 69, 92, 102 (SEQ ID No. 33, DNA) 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCAACTCTA CCAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC glycosylated Leptin 2, 47, 69, 92, 102 (SEQ ID NO 34, protein.): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL ANSTSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC Glycosylated Leptin 47, 69, 92, 102 (SEQ ID NO 35, DNA): 1 GTGCCCATCC AAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCAACTCTA CCAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC Glycosylated Leptin 47, 69, 92, 102 (SEQ ID NO 36, Protein): 1 VPIQKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL ANSTSCHLPW 101 A? GTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC These were the specific amino acid sequences and the corresponding DNAs used in the following working examples.

Characterization by Serum Sialic Acid In addition, the present glycosylated proteins can be characterized by their number of sialic acid portions. In general, there can be zero to four portions of sialic acid in an N-linked glycosylation site, and zero to two portions of sialic acid in a 0-linked glycosylation site. A typical glycosylated protein preparation will contain a mixture of completely glycosylated protein molecules (eg, having a portion of sialic acid that occupies all available sites) and partially (eg, having a sialic acid portion that occupies less than all of them). available sites). The number of sialic acid molecules can be determined by methods available to those skilled in the art. For example, the molecular weight of the protein or the preparation thereof can be measured before and after treatment with enzymes that remove the sialic acid, and calculate the molecular weight of the constituents. Alternatively, isoelectric focusing or other methods can be used to determine sialic acid content. For example, human leptin 1-145 (SEQ ID No. 2, below) contains two 0-linked glycosylation sites, and thus, when fully sialylated, four portions of sialic acid. The present working examples with a simple N-linked glycosylation site, contain four portions of sialic acid, when fully sialylated. The glycosylated leptin proteins at two sites, when fully glycosylated, contain 8 portions of sialic acid, all three sites, 12 portions of sialic acid, all four, 16 portions of sialic acid, and the glycosylated leptins at five sites, 20 portions of sialic acid. The present invention thus encompasses the preparation of glycosylated leptin protein wherein each glycosylated leptin protein molecule in said preparation has five or more portions of sialic acid. More preferably, for purposes of increasing a sustained release effect of a therapeutic protein, the present invention also encompasses a glycosylated leptin protein preparation, wherein each glycosylated leptin protein molecule in said preparation has 8 to 20 sialic acid residues. You can also choose to add additional glycosylation sites, and increase the sialic acid content above 20, accordingly. 3. Main Chain of Protein Leptin. The type of leptin used for the glycosylated leptin pharmaceutical compositions can be selected from those described in PCT International Publication Number WO96 / 05309, as cited above incorporated by reference herein in its entirety. Figure 3 of that publication (as cited herein in SEQ ID No. 4) describes the complete, deduced derived amino acid sequence for human leptin (also referred to as the human "OB" protein). The amino acids are numbered from 1 to 167. A cleavage site of the signal sequence is located after amino acid 121 (Ala) so that the mature protein extends from amino acid 22 (Val) to amino acid 167 (Cys). For the present description, a different numbering is used, where the position of amino acid 1 is the valine residue that is at the beginning of the mature protein. The amino acid sequence for mature recombinant human leptin is presented herein as SEQ ID NO. 1, where the first amino acid of the mature protein is valine (in position 1) (in the present call rHu-Leptin 1-146, SEQ ID NO.1): V P I Q K V Q D D T K T L I K T I V T R I N D I S H T Q S V S S K Q K V T G L D F I P G L H P I L T L S K M D Q T L A V Y Q Q I L T S M P S R N V I Q I S N D L E N L R D L L H V L A F S K S C H L P WA S G L E T L D S L G G V L E S S G AND S T E V V A L S R L Q G S L Q D M L W QLDLSPGC Alternatively, a natural variant of human leptin, which has 145 amino acids, can be used, and, compared to rHu-Leptin 1-146, it has a glutamine absent at position 28, presented immediately (called t. Leptin 1-145, SEQ ID NO 2, where the blank ("") indicates absence of amino acid) VPIQKVQDDTKTLIKTIVTRI NDISHT _ SVSSKQKVTGLDFIPGLHPIL TLSKMDQTLAVYQQILTSMPS RNVIQISNDLENLRDLLHVLA FSKSCHLPWASGLETLDSLGG VLEASGYSTEVVALSRLQGSL QDMLWQLDLSPGC For example, for specific, glycosylated leptin protein indicated herein, can choose to use the "Q_" version of human leptin (1-145, SEQ ID NO. 2) and modifying the corresponding sites listed for human leptin of 1-146 amino acids to include the glycosylation sites. In general, the leptin protein for use herein will be capable of therapeutic use in humans (see also, animal leptins, below). In this way, the activity can be empirically tested to determine how leptin protein forms can be used. As described in WO96 / 05309, the protein leptin in its native form, or fragments (such as enzymatic cleavage products) or other truncated forms and analogues can all retain biological activity. Any such forms can be used to prepare the present glycosylated leptin compositions, although such altered forms must be tested to determine the desired characteristics. See also, PCT International Publication Nos. WO96 / 40912, WO97 / 06816, W097 / 18833, WO97 / 38014 and WO98 / 08512, all incorporated by reference. An analogue of recombinant human leptin can be prepared by altering the amino acid residues in the recombinant human sequence, such as substituting the amino acids which diverge from the murine sequence. The murine leptin is substantially homologous to human leptin, particularly as a mature protein and, in addition, particularly at the N-terminus. Because the recombinant human protein has biological activity in mice, such an analogue could likewise be active in humans. For example, in the amino acid sequence of native human leptin as presented in SEQ ID NO. 1, one or more of the amino acids can be substituted with another amino acid at positions 32, 35, 50, 64, 68, 71, 74, 77, 89, 97, 100, 105, 106, 107, 108, 111, 118 , 136, 138, 142, and 145. The amino acid in the corresponding position of the murine protein (SEQ ID No. 3) can be selected on another amino acid. It is also possible to prepare the synthetic molecules based on rat leptin, called the OB protein sequence. Murakami et al., Biochem. Biophys. Res. Comm. 209: 944-52 (1995) incorporated by reference herein. The rat OB protein differs from the human OB protein in the following positions (using the numbering of SEQ ID No. 1): 4, 3_2, 33, 35_, 50, 68, 71, 74, 77, 78, 39 , 97, 100, 101, 102, 105, 106, 107, 108, 111, 118, 136, 138 145 It can be substituted with another amino acid, one or more amino acids in these divergent positions. The underlined positions are agüellas in which the mature OB protein as well as the rat OB protein are divergent from the human OB protein and, thus, are particularly suitable for alteration. In one or more of the positions, an amino acid of the corresponding rat OB protein, or another amino acid, can be substituted. The positions of the human rat OB protein that diverge from the mature human OB protein are: 4, 32, 33, 35, 50, 64, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 118, 136, 138, 142, and 145. An OB protein according to SEQ ID NO. 1 that has one or more of the above amino acids replaced with another amino acid, such as the amino acid found in the corresponding rat or murine sequence, can also be effective. In addition, the amino acids found in the protein OB of the rhesus monkey, which diverge from the mature human OB protein are (with the identities noted in parentheses in the single-letter amino acid abbreviation): 8 (S), 35 (R), 48 (V), 53 (Q ), 60 (I), 66 (I), 67 (N), 68 (L), 89 (L), 100 (L), 108 (E), 112 (D) and 118 (L). Since the recombinant human OB protein is active in cynomolgus monkeys, a human OB protein according to SEQ ID NO. 1 that has one or more of the divergent amino acids of the rhesus monkey replaced with another amino acid, such as the amino acids in parentheses, can be effective. It should be noted that certain divergent amino acids of rhesus are also those found in the above murine species (positions 35, 68, 89, 100 and 112). Thus, a murine / rhesus / human consensus molecule (using the numbering of SEQ ID NO.1) having one or more of the amino acids in the positions replaced by another amino acid can be prepared: 4, 8, 32, 33, 3_5, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145. Other analogs can be prepared by deleting a part of the amino acid sequence of the protein. For example, the mature protein lacks a signal sequence (-22 to -1). A portion of the mature protein can be deleted, and this deletion can be incident to the manufacture, for example, the cleavage of the signal peptide or other presequences beyond the first amino acid-terminus of the mature protein. Also, the end? may contain one or more additional amino acids, which may be incidental to the use of such presequences, such as, for example, cleavage in the middle part of a signal peptide cleavage site, such that a portion of the amino acids of the excision site is coupled.

The following truncated forms of mature leptin protein molecules can be prepared (using the numbering of SEQ ID NO: 1): a) amino acids 98-146; b) amino acids 1-99 and (connected to) 112-146; c) amino acids 1-99 and (connected to) 112-146 having one or more of amino acids 100-111 sequentially placed between amino acids 99 and 112. In addition, truncated forms may also have altered one or more of the amino acids that they are divergent (in the murine, rat or rhesus OB protein) of the human OB protein. In addition, any alterations may be in the form of altered amino acids, such as peptidomimetics or D-amino acids. Those proteins as described above are included with amino acid substitutions that are "conservative" according to acidity, charge, hydrophobicity, polarity, size or any other characteristic known to those skilled in the art. These are described in Table 1 below. See in general, Creighton, Proteins, W.H. Freedman and Company, N.Y. , (1984), p. 498, more index, passi. See, in general Ford et al., Protein Expression and Purification 2: 95-107, 1991, which is incorporated by reference herein.

Table 1 Conservative Amino Acid Substitutions Therefore, the present glycosylated leptin proteins can be prepared first by starting with a sequence selected from (according to the amino acid sequence as presented in SEQ ID No. 1 herein): a) the sequence of amino acids of SEQ ID NO. 1, which optionally lacks a glutaminyl residue at position 28; b) an amino acid sequence of subpart (a) having a different amino acid substituted in one or more of the following positions: 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67 , 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145; c) a truncated leptin protein analogue, selected from: (using the numbering of subpart (a) above): i) amino acids 98-146 ii) amino acids 1-99 and 112-146 iii) amino acids 1- 99 and 112-146 having one or more of amino acids 100-111 sequentially placed between amino acids 99 and 112; and iv) the truncated leptin analog of subpart (i), which has one or more of the amino acids 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 substituted with another amino acid; v) the truncated leptin analog of subpart (ii), which has one or more of the amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 112, 118, 136, 138, 142 and 145 replaced with another amino acid; vi) the truncated leptin analog of subpart (iii), which has one or more of the amino acids 4, 8, 32, 33, 35, 48, 50, 53, 60, 64, 66, 67, 68, 71, 74, 77, 78, 89, 97, 100, 102, 105, 106, 107, 108, 111, 112, 118, 136, 138, 142 and 145 replaced with other amino acids; and d) a leptin protein of any of subparts (a) - (c) having one or more amino acid substitutions conserved, and then selecting a site, preferably on the outer surface of an alpha helix, to insert, by addition or substitution , a glycosylation site. The particular glycosylation sites are indicated above. Leptin proteins, analogs and related molecules are also reported in the following publications; however, no representation is made with respect to the activity of any reported composition: United States Patent Nos. 5,521,283 ,525,705 5,532,336 5,552,522 5,552,523 5,552,524 5,554,727 5,559,208 5,563,243 5,563,244 5,563,245 5,567,678 5,567,803 5,569,743 5,569,744 5,574,133 5,580,954 5,594,101 5,594,104 5,605,886 5,614,379 5,691,309; 5,719,266 (all assigned to Eli Lilly and Company); PCT W096 / 23513; W096 / 23514; W096 / 23515; W096 / 23516; W096 / 23517; W096 / 23518; W096 / 23519; WO96 / 23520; W096 / 23815; WO96 / 24670; W096 / 27385; EP-725078; EP-725079 (all assigned to Eli Lilly and Company); PCT WO96 / 22308 (assigned to Zymogenetics); PCT WO96 / 29405 (assigned to Ligand Pharmaceuticals, Inc.); PCT W096 / 31526 (assigned to Amylin Pharmaceuticals, Inc.); PCT W096 / 34885 (assigned to Smithkline Beecham PLC); PCT W096 / 35787 (assigned to Chiron); EP-736599 (assigned to Takeda); EP-741187 (assigned to F. Hoffman LaRoche). To the extent that these references provide useful leptin proteins or analogs, or the associated compositions or methods, such compositions and / or methods can be used in conjunction with the present glycosylated leptin pharmaceutical compositions, such as for co-administration (jointly or separately). , in a selected dosage scheme). With the above conditions, these publications are incorporated by reference herein.

Nucleic Acids, Vectors, Host Cells and Other Expression Systems Also encompassed by the present invention are the nucleic acids encoding the present glycosylated leptin proteins. Such nucleic acids can be prepared by site-directed mutagenesis, an existing nucleic acid sequence or by synthetic means, or by other means as are available to those of skill in the art. The methods as described in the following Reference Examples are illustrative. Vectors include plasmid as well as viral vectors, as are available to those skilled in the art. The vectors can be for cloning or expression, and include plasmids, cosmids, and viruses that infect prokaryotic or eukaryotic cells. For the expression of the glycosylated protein, the vectors will be useful for expression in a eukaryotic cell. The expression system may be constitutive or inducible, such as systems that include an inducible mouse mammary tumor virus LTR promoter. Augmentators, transcription terminators, splice donors and acceptor sites, and other elements can be included in the complete system, as is known to those skilled in the art. The vectors described in the following Reference Examples are illustrative. The present working examples used a modified form of pDSRa2, to express the glycosylated leptin proteins. The host cells can be prokaryotic, such as the bacteria used for the cloning of the present nucleic acids, for example. Other host cells can be eukaryotic. Eukaryotic host cells can be selected from phylum Chordata, such as agüellas in the Mammalia class. Primate cells, including human cells (such as Namalwa, HeLa cells, from human hepatocellular carcinoma, such as Hep G2 cells, human embryonic kidney cells, human liver cells, human lung cells or cells cultured from human sources) and COS cells, or other mammalian cells, such as baby hamster kidney cells ("BHK" cells), Chinese hamster ovary cells ("CHO"), mouse sertoli cells, Canine kidney cells, buffalo rat liver cells, mouse mammary tumor cells, can be used. Insect cells can also be used. Organisms of minor host cells, such as yeast, and fungi, are also included. See in general, Margulis, Five Kingdoms, 2 * Edition (1988) W.H. Freeman & Co., New York, for organism classifications. You can search to co-express more than one desired protein. For example, the present glycosylated leptin protein can be expressed in a eukaryotic host cell together with one or more other desired proteins. The proteins can be separated using a number of available separation techniques, depending on the characteristics of the protein. For example, one can, in a simple host cell, such as a CHO cell, express a glycosylated leptin protein, as well as a different protein, such as a different glycosylated protein desired for therapeutic use. For example, the molecular weight can be used to separate the proteins for purification. In this way, manufacturing economies can be achieved by producing two different proteins from a single cell culture. Transgenic animals can also be used to express the glycosylated leptin protein. current. For example, a transgenic milk producing animal (a cow or a goat, for example) can be used to obtain the present glycosylated leptin protein in the milk produced. Plants can be used to produce the present glycosylated proteins, however in general, the glycosylation that occurs in plants is different from that produced in mammalian cells, and can result in a glycosylated product that is not suitable for human therapeutic use.

Gene therapy The DNA provided herein (or the corresponding RNAs) can also be used for gene therapy. A review article on gene therapy is Verma, Scientific American, November 1990, pages 68-84 which is incorporated by reference herein. Thus, the present invention provides a population of cells that express the glycosylated leptin protein currently mentioned. Such cells are suitable for transplantation or implant in an individual, for therapeutic purposes. Such cells can then be implanted within an individual. Such cells can, for example, be liver cells, bone marrow cells, or cells derived from the umbilical cord. Alternatively, it may be desired to use circulating cells such as blood progenitor cells, T cells or other blood cells. For humans, human cells can be used. The cells can be in the form of tissue. Such cells can be cultured before transplantation or the implant. Cells that are to be transferred to the recipient or patient can be cultured using one or more factors that affect the development or proliferation of such cells, if appropriate. Hematopoietic factors can be used in hematopoietic cells in culture. Such factors include G-CSF, EPO, MGDF, SCF, the ligand Flt-3, interleukins (eg, IL1-I113), GM-CSF, LIF, and analogs and derivatives thereof are available to a person skilled in the art. Nerve cells, such as neurons or glia, can also be used, and these can be cultured with neurotrophic factors such as BDNF, CNTF, GDNF, NT3, or others. Techniques for the encapsulation of living cells are familiar to those of ordinary skill in the art, and the preparation of the encapsulated cells and their implantation in patients can be achieved without undue experimentation. For example, Baetge et al. (International Publication No. WO 95/05452; Application International No. PCT / US94 / 09299, the disclosure of which is incorporated by reference herein) disclose membrane capsules containing cells engineered for the effective administration of biologically active molecules. The capsules are biocompatible and easily recoverable. The capsules encapsulate the cells transfected with the recombinant DNA molecules comprising the DNA sequences encoding the biologically active molecules operably linked to the promoters which are not subject to in vivo down-regulation after implantation in a mammalian host. The devices provide for the administration of molecules from living cells to specific sites within a patient. In addition, see U.S. Patent Nos. 4,892,538, 5,011,472, and 5,106,627, each of which is incorporated by reference specifically herein. A system for the encapsulation of living cells is described in PCT Application WO 91/10425 of Aebischer et al., Specifically incorporated by reference herein. See also, PCT application WO 91/10470 of Aebischer et al., Winn et al., Exper. Neurol. 113: 322-329 (1991), Aebischer et al., Exper. Neurol. 111: 269-275, (1991); Tresco et al., ASAIO 38: 17-23 (1992), each of which is specifically incorporated by reference herein. The therapeutic administration of genes in vivo and in vitro of the present glycosylated leptin protein is also considered. In vivo gene therapy can be achieved by the introduction of the nucleic acid encoding one of the present glycosylated leptin proteins, within the cells via a local injection of a polynucleotide molecule or other appropriate distribution vectors. (Hefti, J. Neurobiology, 25: 1418-1435, 1994). For example, a polynucleotide molecule encoding a glycosylated leptin protein may be contained in an adeno-associated viral vector for administration to target cells (eg, Johnson, International Application No. WO 95/34670).; International Application No. PCT / US95 / 07178 the description of which is incorporated by reference herein). The adeno-associated virus (AAV) genome contains the inverted terminal AAV repeats that flange a DNA sequence encoding the neurotrophic factor operably linked to the functional promoter and the polyadenylation sequences. Alternative viral vectors include, but are not limited to, retroviral, adenoviral vectors, herpes simplex virus and papilloma virus. U.S. Patent No. 5,672,344 (issued September 30, 1997, to Kelley et al., University of Michigan), the disclosure of which is incorporated by reference herein, describes a gene transfer system mediated by virus in vivo, which involves a recombinant neurotropic HSV-1 vector. U.S. Patent No. 5,399,346 (Issued March 21, 1995, to Anderson et al., Department of Health and Human Services), the description of which is incorporated by reference herein, provides examples of a process to provide a patient with a therapeutically effective protein by administering human cells which have been treated in vitro, to insert a segment of DNA encoding a therapeutic protein. Additional methods and materials for the practice of gene therapy techniques, the descriptions of which are incorporated by reference herein, are described in U.S. Patent No. 5,631,236 (issued May 20, 1997 to Woo et al., Baylor College of Medicine) which involves adenoviral vectors; U.S. Patent No. 5,672,510 (Issued September 30, 1997, to Eglitis et al., Genetic Therapy, Inc.) which involves retroviral vectors; and the United States Patent no. 5,635,399 (issued June 3, 1997, Kriegler et al., Chiron Corporation) which involves retroviral vectors expressing cytokines. Non-viral delivery methods include liposome-mediated transfer, administration of naked DNA (direct injection), receptor-mediated transfer (ligand-DNA complex), electroporation, calcium phosphate precipitation, and microparticle bombardment (e.g. genes). Materials for gene therapy and methods therefor can also include inducible promoters, tissue-specific enhancer promoters, DNA sequences designed for site-specific integration, DNA sequences capable of providing a selective advantage over the progenitor cell, markers for identify transformed cells, negative selection system and expression control systems (safety measures), cell-specific binding agents (for the targeting of cells), cell-specific internalization factors, transcription factors to increase the expression by a vector, as well as the methods of manufacturing vectors. Such additional methods and materials for the practice of gene therapy techniques, the descriptions of which are incorporated by reference herein, are described in U.S. Patent No. 4,970,154 (issued November 13, 1990, DC Chang, Baylor College of Medicine) electroporation techniques; WO 9640958 (published 961219, Smith et al., Baylor College of Medicine) nuclear ligands; U.S. Patent No. 5,679,559 (issued October 21, 1997, Kim et al., University of Utah Research Foundation) concerning a system containing lipoproteins for the administration of genes; U.S. Patent No. 5,676,954 (issued October 14, 1997, K.L. Brigham, Vanderbilt University) which involves liposomal carriers; U.S. Patent No. 5,593,875 (issued January 14, 1997, Wurm et al., Genentech, Inc.) concerning methods for transfection with calcium phosphate; and U.S. Patent No. 4,945,050 (issued July 31, 1990, Sanford et al., Cornell Research Foundation) wherein the biologically active particles are propelled into the cells at a rate by which the particles penetrate the surface of the cells and they are incorporated into the interior of the cells. Expression control techniques include chemically induced regulation (e.g., WO 9641865 and WO 9731899), the use of a progesterone antagonist in a modified steroid hormone receptor system (e.g., U.S. Pat. No. 5,364,791), ecdysone control systems (e.g. WO 9637609), and positive transactivators controllable by tetracycline (e.g., U.S. Patent No. 5,589,362; U.S. Patent No. 5,650,298; and U.S. Pat. United No. 5, 654, 168). It is also contemplated that the present gene therapy or cell therapy may also include the distribution of a second therapeutic composition. For example, the host cell can be modified to express and release a glycosylated leptin protein and native human leptin. Alternatively, these can be expressed in and released from the separated cells. Such cells may be separately introduced into the patient or the cells may be contained in a simple implantable device, such as the encapsulation membrane described above.

Selective Linker Molecules The present invention also relates to the selective linker portions of the present human, glycosylated leptin proteins. A "selective binding portion" denotes a substance that selectively binds to the present human, glycosylated leptin proteins, in glycosylated or non-glycosylated form. The selectivity is determined either by the binding portion that binds to the target leptin protein above the background levels (non-selective). The selectivity is determined either by the binding portion that binds to the target leptin protein above the background levels (non-selective). Particular examples of the selective binding moieties include antibodies, such as monoclonal, polyclonal, monospecific polyclonal antibodies, produced for example by hybridoma technology or by using recombinant nucleic acid media. See, for example, Huse et al., Science 246: 1275 (1989). Also encompassed herein are nucleic acids, vectors, host cells and other materials and methods used in the expression of recombinant nucleic acid from a selective binding moiety, such as a recombinant antibody. Detectable labels can be coupled to such selective binding portions, such as chemiluminescent, fluorescent, colorimetric, or radioactive labels, using materials and methods available to those skilled in the art. Trials or kits, containing one or more of these selective binding molecules, can be prepared for the detection or measurement of the present leptin proteins. Illustrative is the kit which includes selective monoclonal antibodies to a particular glycosylated leptin protein, and means to detect the selective binding of said monoclonal antibodies to the glycosylated leptin protein. Other materials and methods for such equipment are available to those skilled in the art.

Formulations and Derivatives In yet another aspect of the present invention, methods are provided for using the pharmaceutical compositions of the present glycosylated leptin compositions, and the derivatives (see below). Such pharmaceutical compositions may be for administration by injection, or for oral, intrathecal, pulmonary, nasal, transdermal or other administration administration. In general, comprised by the invention are pharmaceutical compositions that include effective amounts of protein or products derived from the invention, together with pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and / or carriers. Such compositions include diluents of various buffer contents (eg, Tris-HCl, acetate, phosphate), pH and ionic strength; additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, beyl alcohol) and bulk substances (e.g., lactose) , mannitol), - the incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or in liposomes, see for example PCT Application W096 / 29989, Collins et al., "Stable Protein: Phospholipid Compositions and Methods," published on October 3, 1996, incorporated by reference herein. Hyaluronic acid can also be used, and this can have the effect of promoting sustained duration in the circulation. Such compositions may influence the physical state, the stability, the rate of release in vivo, and the speed of in vivo clearance of the present proteins and derivatives. See, for example, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712 which are incorporated by reference herein. The compositions can be prepared in a liguid form, or they can be in the form of dry powder, such as lyophilized form. Sustained-release and implantable formulations are also contemplated, as are transdermal formulations. Specifically contemplated are the oral dosage forms of the above derivatized proteins. The protein can be guanically modified so that oral administration of the derivative is effective. In general, the contemplated guymic modification is the binding of at least a portion to the protein (or peptide) molecule itself, wherein said portion allows (a) the inhibition of proteolysis; and (b) uptake into the blood stream from the stomach or intestine. The increase in the complete stability of the protein and the increase in circulation time in the body are also desired. See PCT W095 / 21629, Habberfield, "Oral Delivery of Chemically Modified Protein" (published August 17, 1995) incorporated by reference herein, and U.S. Patent No. 5,574,018, Habberfield et al., "Conjugates of Vitamin B12 and Proteins ", issued on November 12, 1996, incorporated by reference herein. The materials and methods described herein are applicable to the present glycosylated leptin compositions and methods. The pulmonary administration of the present protein, or a derivative thereof, is also contemplated herein. The protein (derivative) is distributed to the lungs of a mammal as it inhales, and traverses the pulmonary epithelial lining into the bloodstream. See, PCT WO94 / 20069, Niven et al., "Pulmonary Administration of Granulocyte Colony Stimulation Factor", published September 15, 1994, incorporated by reference herein, and PCT WO96 / 05309, previously incorporated by reference on page 83 and subsequent ones, for example The present glycosylated leptin proteins can be dried by particle spray which have an average size of less than 10 microns, or more preferably from 0.5 to 5 micrometers. Larger size particles can be used, depending on the density of each particle. Nasal administration of the protein (or analog or derivative) is also contemplated. Nasal administration allows the passage of the protein into the blood stream directly after the administration of the therapeutic product to the nose, without the need for the deposition of the product in the lung. Formulations for nasal administration include aguellas with absorption-enhancing agents, such as dextran or cyclodextran. Administration by means of transport through other mucous membranes is also contemplated. The present glycosylated leptin proteins can also be derivatized by coupling one or more guymic portions to the protein portion. It has been found that the chemical modification of the biologically active proteins provides additional advantages under certain circumstances, such as the increase in the stability and the circulation time of the therapeutic protein and the decrease in immunogenicity. See U.S. Patent No. 4,179,337, Davis et al., Issued December 18, 1979. For a review, see Abuchowski et al., In Enzymes as Drugs. (J.S. Holcerberg and J. Roberts, eds. Pp. 367-383 (1891)). A review article describing protein modification and fusion proteins is Francis, Focus on Growth Factors 3: 4-10 (May 1992) published by Mediscript, Mountview Court, Friern Barnet Lane, London N20, OLD, United Kingdom. There may be a desire to further modify the present glycosylated leptin compositions, such as the addition, by chemical modification, of a water-soluble polymer. The addition of a chemical portion will probably require an additional manufacturing step, but may result in additional benefits in terms of improved product characteristics (with the caveat that under some conditions, chemical derivatization can make the product less desirable, such as by inducing the formation of renal vacuoles, see above). The chemical portions must be coupled to the protein with consideration of the effects on the functional or antigenic domains of the protein. There are various coupling methods available to those skilled in the art. For example, PCT W096 / 11953, "Compositions of N-Terminally Modified Chemically-Modified Protein and Methods," published April 25, 1996, incorporated by reference herein in its entirety, and European Patent EP 0,401,384 incorporated by reference in the present (coupling of PEG to G-CSF) The methods and polymers described in the above publications are applicable to the present glycosylated leptin compositions, if derivatization is desired to further improve the characteristics of a therapeutic composition, for example. The fusion proteins can be prepared by coupling the polyamino acids to the glycosylated leptin protein portion. For example, the polyamino acid can be a carrier protein which serves to further increase the circulating half life of the protein. For the present therapeutic or cosmetic purposes, such polyamino acid should be those that do not create antigenic neutralization response, or other adverse response. Such a polyamino acid can be selected from the group consisting of serum albumin (such as human serum albumin), or an antibody or portion thereof (such as an antibody constant region, sometimes called "Fc") or other polyamino acids. The location of the polyamino acid linkage may be at the N-terminus of the glycosylated leptin protein portion, or at another site, and may also be connected by a chemical "linker" portion to the protein. See, for example, PCT WO 98/28427, published July 2, 1998, entitled "Fusion Protein Compositions 0b and Methods", incorporated by reference herein in its entirety. The polyamino acid can be used to aid detection or purification, such as the use of a "FLAG" marker, a "his" tag, "myc" tag or another polyamino acid tag known to those skilled in the art. Apparently, the detectable markers can be coupled to the present glycosylated leptin proteins. Radioisotopes, light-emitting compounds (for example, fluorescent or chemiluminescent compounds), enzymatically cleavable, detectable antibody (or modification thereof) or other substances can be used for such labeling of the present proteins. Detection of the protein via the use of the labels can be useful for the identification of the presence or amount of the present proteins, or a compound containing such proteins (such as an antibody / protein complex).

Dosages A person of ordinary skill in the art will be able to ascertain the effective doses by administration and observation of the desired therapeutic effect. Currently, unmodified rmetHu- leptin 1-146 has been shown to be effective at doses of 0.3 mg protein / kg body weight / day, and it has been found to be less effective at a dose of 0.1 mg protein / kg body weight. body / day Greenberg et al., Safety and preliminary efficacy of recombinant human methionyl leptin administered by SC injection in thin and obese subjects. Poster presented at: Annual Meeting of the American Diabetes Association; June 16, 1998, Chicago, IL. The desired dose range, to have advantages over rmetHu-leptin 1-146 is the same or less than the previous one. Also, a desired dose range may be one in which the same (or smaller) protein load is administered less frequently. Effective doses can be determined using diagnostic tools over time. For example, a diagnosis for the measurement of the amount of leptin in the blood (or in plasma or serum) can first be used to determine the endogenous levels of leptin. Such a diagnostic tool may be in the form of an antibody assay, such as an antibody sandwich assay. The amount of endogenous leptin is quantified initially, and a baseline is determined. Therapeutic doses are determined as the quantification of endogenous and exogenous leptin (ie, the protein, analog or derivative found within the body, whether self-produced or administered) is continued in the course of therapy. The doses may therefore vary in the course of therapy, with a relatively high dose which is initially used, until a therapeutic or cosmetic effect is observed, and lower doses used to maintain the cosmetic or therapeutic benefits. During an initial course of therapy of an obese person, doses can be administered by which weight loss and concomitant decrease in fat tissue is achieved. Once sufficient weight loss is achieved, a sufficient dose to prevent weight gain can be sufficient to maintain the desired weight or fat mass can be administered. These doses can be determined empirically, since the effects of leptin are reversible. For example, Campfield et al., Science 269: 546-549 (1995) at 547. Thus, if a dose that results in weight loss is observed when weight loss is not desired, a dose should be administered. lower, still maintain the desired weight.

Methods of Therapeutic Use. Therapeutic uses include weight modulation, the treatment of diabetes prevention, the reduction of blood lipids (and the treatment of related conditions), the increase in lean body mass and the increase in sensitivity to insulin. In addition, the present compositions can be used for the manufacture of one or more medicaments for the treatment or improvement of the above conditions.

Cosmetics For those who desire only the improvement of appearance, the present compositions can be used for weight loss, or weight maintenance which has no concomitant effect on an adverse medical condition. In addition, the present compositions can be used for the manufacture of one or more preparations for cosmetic purposes.

Weight Modulation The present compositions and methods can be used for weight reduction. In other words, the present compositions can be used for the maintenance of a desired weight or level of adiposity. As demonstrated in murine models (see above), the administration of the current glycosylated leptin proteins results in weight loss. The lost body mass is mainly adipose tissue, or fat. Such weight loss, or maintenance of a particular weight, may be associated with the prevention or treatment of concomitant conditions, such as those that occur immediately, and therefore constitute a therapeutic application.

Treatment of Diabetes The present compositions and methods can be used in the prevention or treatment of Type I or Type II diabetes. Since Type II diabetes may be correlated with obesity, the use of the present invention to reduce weight (or maintain a desired weight, or reduce or maintain a level of adiposity) may also alleviate or prevent the development of diabetes. In addition, even in the absence of sufficient doses to result in weight loss, the present compositions can be used to prevent or ameliorate diabetes. Administration of the present compositions may result in increased sensitivity to insulin, endogenous or exogenous, and allow an individual to reduce or eliminate the amount of administration of the exogenous insulin required to treat type II diabetes. It is further contemplated that the present compositions may be used in the treatment, prevention or amelioration of type I diabetes.

Modulation of Lipids in Blood. The present ccmpositions and methods can also be used in the modulation of blood lipid levels. Ideally, in situations where only the reduction of blood lipid levels is desired, or where the maintenance of blood lipid levels is desired, the dose will be insufficient to result in weight loss. Thus, during an initial course of therapy of an obese patient, doses can be administered by which weight loss and concomitant decrease in the level of blood lipids is achieved. Once sufficient weight loss is achieved, a sufficient dose can be administered to prevent the regain of weight, still sufficient to maintain the desired blood lipid levels, or other conditions as described herein, for example. . Thus, if a dosage that results in weight loss is observed when weight loss is not desired, a lower dose could be administered in order to achieve the desired levels of desired lipids in blood, while still maintaining the weight wanted.

See, for example, PCT Publication WO97 / 06816 incorporated by reference herein.

Increase in Lean Mass or Insulin Sensitivity. Ideally, in situations where only an increase in lean body mass is desired, the dosage will be insufficient to result in weight loss. Thus, during an initial course of therapy of an obese person, doses can be administered by which weight loss and decreased fat tissue / concomitant lean fat increase is achieved. Once sufficient weight loss is achieved, a sufficient dose can be administered to prevent weight re-gain, still sufficient to maintain the desired increase in lean mass (or prevention of depletion of lean fat). For the increase of an individual sensitivity to insulin, similar considerations of dosage can be taken into account. The increase in lean mass without weight loss can be carried out enough to decrease the amount of insulin (or, potentially, amylin, antagonist or amylin agonists, or thiazolidinediones, or other potential drugs for the treatment of diabetes) An individual could be administered for the treatment of diabetes. For the increase in full strength, similar dosing considerations may exist. The increase in lean mass with concomitant increase in total strength can be achieved with insufficient doses to result in weight loss. Other benefits, such as an increase in red blood cells (and oxygenation in the blood) and a decrease in bone resorption or osteoporosis can also be achieved in the absence of weight loss. For example, PCT W097 / 18833, published May 29, 1997, incorporated by reference herein in its entirety.

Combination Therapies The present compositions and methods can be used in conjunction with other therapies, such as altered diet and exercise. Other drugs, such as drugs useful for the treatment of diabetes (for example, insulin and possibly amylin, antagonists or agonists thereof, thiazolidinediones, or other potential drugs for the treatment of diabetes), drugs that lower cholesterol and blood pressure (such as drugs that reduce blood lipid levels or other cardiovascular drugs), drugs that increase activity (for example, amphetamines), diuretics (for the elimination of lipids), and appetite suppressants (such as agents that increase act on gamma neuropeptide receptors, serotonin reuptake inhibitors or inhibitors of gastric fat uptake). Such administration may be simultaneous or may be serial. In addition, the present methods can be used in conjunction with surgical procedures, such as cosmetic surgeries designed to alter the overall appearance of a body (e.g., liposuction or laser surgeries designed to reduce body mass, or implant surgeries designed to increase the appearance of body mass). The health benefits of cardiac surgeries, such as bypass surgeries or other surgeries designed to alleviate a harmful condition caused by blockage of blood vessels by fatty deposits, such as arterial plaque, can be increased with use concomitant of the present compositions and methods. Methods for removing gall stones, such as ultrasonic or laser methods, can also be used either before, during or after a course of the present therapeutic methods. In addition, the present methods can be used as an adjunct to surgeries or therapies for fractured bones, damaged muscles, or other therapies that could be improved by an increase in lean tissue mass.

Methods of Manufacturing As indicated above, it has also been observed that particular constructs of signal sequences and mature protein sequences can improve glycosylation efficiency. In this regard, the term "signal sequence" (sometimes referred to in the art as "signal peptide") is used to denote a peptide, found at or near the N-terminus of the mature protein, usually from about 15 to about 30. Amino acids long, rich in hydrophobic amino acids, which facilitates the secretion of the mature protein towards the endoplasmic reticulum.It is in the endoplasmic reticulum, or in the region of the cell membrane, that the initial glycosylation of proteins occurs. are cleaved from the mature sequence prior to the secretion of the mature protein, see Watson et al., Molecular Biology of the Gene, 4th Ed., 1987, on page 731 (The Benjamin / Cummings Publishing Company, Inc., Menlo Park. , California) incorporated by reference herein, In particular, several signal sequences which are not naturally found to be operably linked to a leptin protein of natural origin, have been used, and have been found to improve the glycosylation efficiency of multiple glycosylated leptin proteins.

For example, it has been found that, compared to the signal sequence, native human leptin, the signal sequence normally found connected to the tissue plasminogen activator sequence, when used in conjunction with the expression of several of the leptin proteins multiply glycosylated, described herein, results in higher glycosylation levels (eg, glycosylation moieties at all suitable sites in a higher proportion of the expressed molecules of the mature protein). Therefore, the present invention also relates to a method for making a glycosylated leptin protein comprising: (a) the cultivation, under conditions suitable for expression, of a host cell containing a DNA sequence encoding, in the 5 'to 3' direction, (i) a signal sequence, and (ii) a DNA encoding a glycosylated leptin protein; and (b) obtaining said glycosylated leptin protein. Furthermore, as discussed above, the present invention relates to a method for the manufac of a glycosylated leptin protein wherein the signal is selected from: (a) (SEQ ID No. 3) (human leptin signal peptide) native) MHWGTLCGFLWLWPYLFYVQA (b) (SEQ: ID No. 4) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSPS (c) (SEQ ID No. 5) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSP (d) (SEQ. ID No. 6) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSPA (e) (SEQ ID No. 7) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSNS (f) (SEQ ID No. 8) (peptide of native human tPA signal) MDAMKRGLCCVLLLCGAVFVSPS (g) (SEQ ID No. 9) (native human tPA signal peptide) MDAMKRGLCCVLLLCGAVFVSP (h) (SEQ ID No. 10) (modified tPA signal peptide) MDAMKRGLCCVLLLCGAVFVSNS ( i) (SEQ ID No. 11) (modified tPA signal peptide) MDAMKRGLCCVLLLCGAVFV SPA (j) (SEQ ID No. 12) (Leptin / tPA signal peptide) MHWGTLCCVLLLCGAVFVSPS (k) (SEQ. ID No. 13) (Leptin / tPA signal peptide) MHWGTLCCVLLLCGAVFVSP It appears that nucleic acid sequences encoding such signal peptides can be used. The following DNA sequences, with the exception of the signal sequence of the modified human leptin signal peptide (d, SEQ ID No. 6) which was not performed, were used as described in the following working examples , to encode the corresponding signal peptides, as described above.

I KNOW THAT. ID No. 14 (DNA of the native human leptin signal peptide) ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCA AGCT I KNOW THAT. ID No. 15 (modified human leptin signal peptide DNA) ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTTTC GCCCAGC I KNOW THAT. ID No. 16 (modified human leptin signal peptide DNA) ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGCCCTATCTTTTCTATGTTTCG CCC I KNOW THAT. ID No: 17 (DNA DNA of the modified human leptin signal peptide) ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTTTC GCCCGCT SEQ. ID No: 18 (Modified human leptin signal peptide DNA) ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTTTC GAACAGC SEQ ID. No: 19 (Native human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGT TTCGCCCAGC SEQ ID. No. 20: (Native human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGT TTCGCCC SEQ ID. No. 21: (modified human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGT TTCGAACAGC SEQ ID. No. 22: (modified human tPA signal peptide DNA) ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGT TTCGCCCGCT SEQ ID. No. 23 (leptin DNA / tPA signal peptide) ATGCATTGGGGAACCCTGTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCC CAGC SEQ ID. No. 24 (leptin DNA / tPA signal peptide) ATGCATTGGGGAACCCTGTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCC C The signal sequences known to be associated with highly glycosylated proteins can be selected. The signal sequences that can be used are those native to erythropoietin, with Factor VIII, beta-interferon, serum albumin, insulin, von Willebrand's factor, CDlla, IgG, follistatin, intrinsic factor, G-CSF, ceruloplasmin , LAMP-1, secreted hormones, growth factors and other proteins, human or non-human (such as primate, mouse, rat, or other mammals), which are secreted in eukaryotic cells. For yeast cells, the yeast a factor, and others can also be used. Also other diverse genes have guiding sequences that can facilitate the secretion of proteins in mammalian cell systems, such as human influenza A virus, preproinsulin, and bovine growth hormone.

The amino acid compositions of the signal sequences of a trial and error base can also be optimized to improve glycosylation efficiency, and prepare signal sequences of non-natural origin. For example, one can increase the number of hydrophobic amino acid residues, or alter the cleavage site of the signal peptidase, to increase the amount of time that the protein spends on the membrane, in order to extend the time period in which the protein is exposed to the cellular "machinery" which carries out the glycosylation ("maguinaria" which is a term at hand for those enzymes and other portions that perform the glycosylation within the membrane region of the cells). It has also been found that substitution of an existing cleavage site (the site at the carboxyl-terminal end of a signal peptide in which the signal peptide is enzymatically cleaved to generate the mature protein) with different cleavage sites, can provide manufacturing advantages, particularly in mammalian cell systems, and increase glycosylation efficiency. Previously, those of skill in the art had altered enzyme cleavage sites of the prosequences (see below) in relation to the signal peptides.

As will be demonstrated in the following working examples, the use of the tissue plasminogen activator signal peptide to express a glycosylated leptin protein at three sites resulted in a higher glycosylation efficiency than the use of the human leptin signal peptide. native It was further found that the cleavage site of the tPA signal peptide (serine-proline-serine), when substituted in the native human leptin signal peptide, conferred improved glycosylation efficiency on the use of the native, unmodified human leptin signal peptide. For particular proteins, the serine-asparagine-serine ("SNS") site may function to improve glycosylation efficiency. For example, as described herein, replacement of the cleavage site of the native, human tPA signal peptide with an "SNS" site resulted in a high yield of correctly cleaved, glycosylated leptin protein (having the sites of glycosylation at positions 2, 47, 69, and 92). Other cleavage sites include, serine-proline-serine ("SPS"), serine-asparagine-serine ("SNS"), serine-proline ("SP"), and serine-proline-alanine ("SPA"). A new cleavage site can be substituted into any signal peptide by known methods, including site-directed mutagenesis of the coding DNA, DNA synthesis, and alteration of the genomic DNA within a cell. It may be chosen to make a signal peptide, particularly a signal peptide not found in association with any known secreted protein, such as natural signal peptides, and to include a cleavage site as described above to optimize or maximize the efficiency of glycosylation Some cleavage sites, such as the serine-proline-serine cleavage site of the natural human tissue plasminogen activator ("tPA"), are incompletely cleaved from the N-terminal region of the mature protein. In this way, a serine residue is left at the N-terminus of the mature protein, referred to herein as position -1. The present invention also includes the present glycosylated leptin proteins having, or having optionally, if one chooses to use a target cleavage site, one or more amino acid residues at the N-terminus of the mature protein sequences. The present invention also includes, more specifically, glycosylated leptin proteins having: a serine, arginine, proline or alanine residue at position -1, a serine at position -1 and a proline at position -2, a sequence serine-proline-serine in the positions. -1, -2 and -3, one serine in position -1 and one arginine in position -2, one serine in position -1, one arginine in position -2 and one serine in position -3, one arginine in position -1 and a serine in position -2; and an alanine in position -1 and proline in position -2. In addition, cleavage sites of the signal peptides that break a portion of the mature protein may exist. Thus, as indicated above, the present invention includes the truncated forms of the glycosylated leptin protein, such as those having up to and including five amino acid residues deleted from the N-terminus of the mature protein, such as a leptin protein of the SEQ IN No. 1 or 2, which has the targets glycosylation sites. Therefore, the present invention also relates to an improved method of making a glycosylated leptin protein comprising: (a) the cultivation, under conditions suitable for expression and glycosylation, of a host cell containing a DNA sequence that encodes, in the 5 'to 3' direction (i) a signal peptide, and (ii) a DNA encoding a glycosylated protein; and (b) obtaining said glycosylated protein wherein the enhancement comprises the use of a signal peptide having a peptidase cleavage site optimized for glycosylation efficiency. The cleavage site of non-natural origin can be selected from among SPS, SP, SNS, and SPA. Signal peptides and glycosylated leptin proteins as described in the specification, including the working examples, are illustrative, although these methods and compositions are broadly applicable to a wide variety of proteins that are sought to be secreted and / or glycosylated by a eukaryotic cell. Such proteins include but are not limited to tissue plasminogen activator. Factor VIII and other factors of blood accumulation, erythropoietin and its analogues, and other glycosylated proteins. It was also found that, in conjunction with the use of the native leptin leader sequence, the use of a "prosequence" may also improve glycosylation efficiency. A "prosequence" is an amino acid sequence that optimally has the portion R-X-R / K-R, where "X" is any amino acid (and the abbreviations of a single letter are those conventionally used, see below). The prosequence is cleavable (after the final R) with furin-like proteases, normally present in CHO cells, Watanabe et al., FEBS letters, 320: 215-218 (1993) (incorporated by reference herein). The ability of CHO cells to break such prosequences has been shown to be improved when the furin expression plasmids are transfected into the cells. Yanagita et al., Endocrinology 133: 639-644 (1993) (incorporated by reference herein). For example, the mature human leptin sequence begins with a valine, which could interfere with the removal of prosequence by furin. A better elimination of prosequence could be achieved by changing this valine to a more preferred amino acid, such as serine or alanine, or the insertion of such an amino acid before valine (for example, by site-directed mutagenesis or other available methods). for those skilled in the art). Therefore, the present methods have also optionally included the use of such prosequences in conjunction with the natural leptin signal peptide or with other signal peptides.

The present invention also encompasses compositions, such as nucleic acids, vectors, and host cells, such as aguelas indicated above and incorporated by reference herein, which contain the nucleic acids encoding the present altered signal peptides and / or the prosequences. EXAMPLES The following examples are offered to more fully illustrate the invention, but are not considered to be limiting of the scope thereof. Example 1 demonstrates the measurement of the Stokes radius of various glycosylated leptins. Example 2 demonstrates the in vivo biological activity of a glycosylated leptin in a single site, denoted "N48T50". This example demonstrates that this glycosylated leptin has activity at least equal to native, recombinant human leptin, which lacks glycosylation. Example 3 demonstrates the in vitro biological activity of additional glycosylated leptins at a single site. Example 4 demonstrates the in vitro biological activity of glycosylated leptin proteins at two sites, in terms of a receptor binding assay.

Example 5 demonstrates the effect on glycosylation efficiency of using a threonine residue, rather than a serine residue, in the glycosylation consensus sequence. Example 6 demonstrates that amino acids adjacent to the consensus sequence affect glycosylation efficiency. Example 7 demonstrates that a glycosylated leptin protein at three sites has a substantially longer systemic circulation time than non-glycosylated leptin. Example 8 demonstrates in ob / ob mice that a glycosylated leptin protein at three sites has improved biological weight loss activity, as compared to non-glycosylated leptin. Example 9 demonstrates in ob / ob mice that a glycosylated leptin protein at three sites has improved appetite suppressor biological activity, compared to non-glycosylated leptin. Example 10 demonstrates in ob / ob mice that intermittent administration of a glycosylated leptin at three sites has improved biological weight loss activity, as compared to non-glycosylated leptin. Example 11 provides additional dose-response studies using a glycosylated leptin at three sites on wild-type animals, demonstrating that a much lower dose of the glycosylated leptin at three sites results in a substantial loss of weight, compared to non-glycosylated leptin. Example 12 provides dose frequency studies using a glycosylated leptin at three sites, on wild type mice, and demonstrates that a glycosylated leptin at three sites can be dosed less frequently than non-glycosylated leptin to obtain the same loss response of weight in animals. Example 13 describes leptin proteins from additional multiple glycosylation sites, and in vitro biological activity data. Example 14 describes the expression and efficiency of glycosylation of a glycosylated leptin protein at three sites using a variety of signal peptides and other sequences that affect glycosylation or performance. Example 15 describes the additional expression data on a variety of leptin proteins from multiple glycosylation sites, using various signal peptides and other sequences that affect glycosylation or performance.

The reference examples of the methods used are shown below.

EXAMPLE 1 Stokes Radio of Several Leptins The present example demonstrates that several leptins have different Stokes radii, as determined by gel filtration. The present example also demonstrates the consistency of the gel filtration method for the determination of the Stoke 'radius of a glycosylated leptin protein at a single site, when repeated measurements were taken, the measurements varied by less than 2 A.

Methods: Gel filtration experiments were carried out on a Pharmacia FPLC system equipped with a Unicom controller for system control, data acquisition and analysis, a UV-1 detector and a 280 nm filter. The separations were performed at 4 ° C and at a flow rate of 0.25 ml / min on a SuperDex 200 (HR10 / 30) column equilibrated in Dulbecco's phosphate-buffered saline. The protein samples, dissolved in elution buffer, were applied to the column in 0.25 ml volumes containing 0.1 A280 as demonstrated by a Hewlett Packard Model 8435 spectrophotometer. The standard proteins found in the Pharmacia Gel Filtration Calibration equipment , of High Molecular Weight and of Low Molecular Weight, were used according to the manufacturer's recommendations, to calibrate the columns. (As recommended by the manufacturer, catalase was not used as a standard.) Additional standards, including human transferrin (36A), soybean trypsin inhibitor (22A) and horse muscle myoglobin (19A) ) were purchased from Sigma Chemicals. Dextran Blue (Pharmacia Gel Filtration Calibration Eguipo) was used to define the empty volume. Values for the Stokes radius (Rs) for any of the various forms of leptin were calculated from a plot of V-log (Kav) vs Rs where Kav = (Ve-Vo) / Vt-Vo and Ve is the elution volume of the protein, Vo is the void volume, and Vt is the total bed volume of the column.

Results: Using the above methods, and SuperDex 200MR as the gel filtration material, the following Stokes radii were determined for rHu-Leptin 1-146 (SEQ ID No. 1, below) having the following glycosylation sites: Table 1.1: Stokes Radio of Several Leptins As can be seen, a population of glycosylated leptin protein molecules at three sites has a Stokes radius above 30 A, as determined by gel filtration. The average Stokes radius ((31.9 + 32.3) / 2)) is 32.1 Á. The present gel filtration method also demonstrated consistency up to an Angstrom. As a comparison, the same glycosylated leptin protein had a Stokes 31.2 Á radius when determined by sedimentation rate (using standard methods not detailed here). The non-glycosylated leptin protein (rmetHu- Leptin), as well as the glycosylated leptin proteins in two simple sites, had Stokes radii less than 30 Á. As will be demonstrated in the following working examples, the glycosylated leptin protein N48T50 had biological activity comparable to rmetHu-Leptin. The glycosylation protein at three sites (47, 69, 102) had substantially improved biological activity in terms of increased circulation time (and therefore increased in vivo exposure to the drug). This demonstrates the principle that the enlargement of the effective size (expressed here as the Stokes radius) prolongs the circulation time by decreasing the filtration capacity and the final degradation in the kidney.

EXAMPLE 2 Biological Activity in vivo and Time of Circulation in Serum of a Glucosilated Leptin in a single Site, N48T50 This Example demonstrates that the glycosylated leptin at one site had approximately equal or modestly improved biological activity of rmetHu-Leptin 1-146 (SEQ ID NO: 1). The glycosylation did not prevent the activity or prevent the binding to the receptor. In addition, it was shown that the serum circulation time of a glycosylated leptin at a single site is the same or modestly longer than rmetHu-Leptin 1-146 (SEQ ID NO: 1). The animals were administered with the glycosylated leptin in a single site or the rmetHu-Leptin at the same daily dose for 7 days. At the end of the 7 days, the animals were sacrificed, and the fat content was examined. Compared to rmetHu-Leptin, administration of the glycosylated leptin in a single site resulted in approximately 25% additional fat loss. This demonstrates that the present glycosylated leptin compositions having a glycosylation site of non-natural origin retain biological activity.

Methods: 1. Leptin compositions used. This glycosylated leptin, "N48T50" had the amino acid sequence of native human leptin 1-146 (SEQ ID NO.1) with isoleucine ("I") at position 48 substituted with asparagine ("N"), and the following two remaining amino acids (leucine ("L") and threonine ("T")), without substitution. For the daily dosage groups (100 μl injection volume for all): 0.2 mg / ml for the dose group of 1 mg / kg, 2.0 mg / ml for the dose group of 10 mg / kg. For the dose groups only on day 0: 5 mg / ml concentration, 400 μl injected, dose of 100 mg / kg. 2. Animals: Number and type: 5 C57BL 6 female mice, from Charles River Laboratories (Wilmington, MA).

Age and weight: The animals were between 8 and 10 weeks old and weighed approximately 20 grams each. 3. Administration. At the beginning of each study, the mice were weighed and then injected with the bolus sample subcutaneously. Weighing: The baseline weight was determined in animals that were allowed to acclimate in animal facilities for a week before the study, the baseline weight was taken just before receiving the first dose. The weights were checked periodically daily throughout the entire study. After the final weights were recorded, the animals were sacrificed and the amount of abdominal fat was rated from 0 to 3, with 0 being non-visible fat remaining, and a rating of 3 reflecting an amount of visible fat in an animal normal. Results: Mice treated daily with rmetHu-leptin (1-146) expressed in E. coli lost weight relative to the controls with buffer as shown in FIGURE 1. Surprisingly, mice treated with glycosylated leptin (Leptin N48 T50) also They lost weight. The amount of weight loss increased as the dose was increased (1 mg / kg and 10 mg / kg) for both forms of leptin. When single injections of 100 μg / kg were carried out, mice treated with glycosylated leptin lost more weight than mice treated with rmetHu-leptin (1-146). In addition, weight loss persisted longer for mice treated with glycosylated leptin than for mice treated with rmetHu-leptin. Visual examination of mice treated with rmetHu-leptin and leptin N48 T50 indicated that mice treated with both forms of leptin had reduced amounts of abdominal fat and that the amount of abdominal fat was reduced with the increased dose. This indicates that glycosylated leptin is effective in reducing fat content and can be administered less frequently than non-glycosylated methotretin.

Pharmacokinetic Studies of a Glucosylated Leptin in a Single Site This study demonstrates that for intravenous administration, a glycosylated leptin in a single site had a longer half-life than non-glycosylated leptin. For subcutaneous administration, circulation times were similar for glycosylated and non-glycosylated leptin.

Materials: 1. Leptin. The glycosylated leptin was used in a single site as before (sites N48 T50), formulated at 10 mg / ml in buffered saline with Dulbecco's Phosphate without calcium chloride and without magnesium chloride. Recombinant human methionyl leptin 1-146 (SEQ ID NO: 1 with a methionine residue in position -1), expressed in E. coli was used as a control, formulated at 2.0 mg / ml in buffer. 2. Animals . Number used / type: 32 male CD-1 mice (for the glycosylated leptin protein) and 81 male CD-1 mice (for rmetHu-leptin) (Charles River Laboratories, Hollister, CA). Age / weight: The animals were approximately 6 to 9 weeks old and weighed approximately 30 grams. Care / handling: The animals were individually housed and fed a diet of croguettes for rodent from the laboratory ad libitum. All the animals were managed in accordance with good animal handling practices. 3. Administration. The animals were injected with glycosylated leptin at a dose of 1 mg / kg body weight intravenously (IV) or subcutaneously (SC). 4. Sampling . The animals were anesthetized, and blood samples were collected at the designated time points, using standard cardiac puncture techniques. Serum concentrations of glycosylated leptin were determined using an immunoassay (as described below).

. Comparison. The time data in circulation were compared to the data previously obtained for rmetHu-leptin at the same dose, in animals of similar size, using the same routes of administration.

Results: Table 2.1 shows the pharmacokinetic parameters of glycosylated leptin and rmetHu-leptin in mice. Comparing the IV data, the glycosylated leptin showed a lower systemic clearance (500 ml / h / kg vs 676 ml / h / kg) and a longer terminal half-life (1.24 h vs 0.733 h). The volumes of distribution at rest (Vss) were similar between glycosylated leptin and rmetHu-leptin. These data indicate that the glycosylated protein was cleared more slowly than the methotrepine from the systemic circulation, thus increasing the half-life and exposure (AUC estimates of 2000 ng »h / ml vs. 1480 ng < / ml). After the SC dose, similar peak serum concentrations (Cmax) were obtained between glycosylated leptin and rmetHu-leptin (1230 ng / ml vs 1380 ng / ml), although there was a delay in the peak time (traax) for leptin glycosylated Estimates of similar exposure (based on AUC) were obtained for both molecules. The subcutaneous bioavailability was approximately 60.5% for glycosylated leptin vs. 79.6% for rmetHu-leptin.

Table 2.1 Pharmacokinetic Parameters of Glucosylated Leptin (N48, T50) and rmetHu-Leptin After Administration IV and SC EXAMPLE 3 In vitro biological activity of other glycosylated leptins in a single site Table 3.1 below, the location of the amino acid sequence for the alteration to include a glycosylation site, is based on the numbering of the SEQ. ID. DO NOT. 1 above, which is rHu-Leptin. The protein was expressed as in the following reference examples, using the natural human leptin signal peptide, and COS cells. The expression products were then subjected to four types of analysis (the methods used are described below). 1. Expression relative to the wild type. The yield of the protein was compared in relation to rHu-Leptin 1-146, as expressed in COS cells. The amount of rHu-Leptin 1-146 was assigned with the number "1.00" under conditions as defined below. 2. Percent Glucosylation. The yield of the fully glycosylated protein was determined as a percentage of the total leptin protein by visual inspection of a Western blot, as described below. 3. Link, Leptin-R, in relation to the wild type. In an in vitro competition assay using a leptin receptor preparation, the glycosylated, radiolabeled, prepared leptin proteins were compared to the radiolabeled rHu-Leptin 1-146, in binding strength to the leptin receptor, according to the methods described later. 4. In vitro bioactivity in relation to the wild type. In an in vitro assay using a guimeric leptin receptor, as described below, the prepared glycosylated leptin proteins were compared to rHu-Leptin 1-146, according to the methods described below. "ND" means that the data is not available because the experiments were not performed.

Table 3.1 * ESP77 indicates a glycosylation site at position 77 and expression using the erythropoietin signal peptide, as described in more detail below. 1 / "Position" indicates the position of the amino acid according to SEQ. ID. DO NOT. 1, which is rHu-Leptin 1-146. The particular sequence listed (eg, "53", "55", etc.) indicates the "N" position in the consensus glycosylation sequence of "N-X-S / T".

Results: As can be observed, with leptin glycosylation proteins in a single site prepared, in comparison to non-glycosylated leptin, most of the glycosylated leptin proteins in a single site did not show a substantial increase in biological activity as determined by the in vitro assay used herein, except for the protein with a glycosylation site at position 118, which appeared to have an increased amount of activity. Some of these analogs were secreted at normal or higher levels and most had receptor binding activity comparable to rHu-Leptin 1-146 expressed and analyzed in the same manner. Surprisingly, some of the glycosylated leptin proteins had biological activity in. Vitro low to one when these retained receptor binding activity. In this way, the glycosylated leptin proteins could be divided into 2 classes according to whether they conserved biological activity in vitro or not. The glycosylated leptin proteins that had low biological activity can be leptin antagonists.

EXAMPLE 4 In vitro biological activity of glycosylated leptins at two sites As presented in Table 4.1, various glycosylated leptin proteins at two sites were also produced and tested as described above for single-site proteins. The notations and abbreviations are the same as those for Table 3.1 for single-site proteins. Glycosylation notations indicate the approximate percentage of material that had a chain or two chains, as determined by visual examination of a Western blot, as described below. For example, for the 25 + 29 glycosylated leptin protein, 50% of the material had a chain, and 5% of material had two chains.

Table 4.1 Many glycosylated leptin proteins containing combinations of two glycosylated sites can be elaborated, which retain the link to the receptor and show biological activity.

Example 5 Improvement of Glucosylation Efficiency Using a Threonine Instead of a Serine in the Sequence of Consensus This example demonstrates that the efficiency of the glycosylation site is improved by using a threonine instead of a serine in the glycosylation consensus sequence. In this example, all the sites in the amino acid sequence for the alterations to include glycosylation sites are based on the numbering of the SEQ. ID. DO NOT. 1, which is rHu-Leptin 1-146.

The glycosylated leptin proteins were constructed, expressed and analyzed using the methods in the following reference examples. The results are shown in FIGURE 2. The introduction of a single glycosylation site by the double substitution W100, S102 to N100, T102 resulted in the addition of the N-linked carbohydrate and the proportion of molecules containing the carbohydrate (by SDS PAGE as determined by Western Spotting) was substantially greater than with a substitution W100, S102 to N100, S102. This indicates that more of the protein molecules that have a threonine in the consensus sequence were glycosylated, than those that have a serine in the consensus sequence. Thus, the glycosylation efficiency in this expression system is higher using the Asn-Xxx-Thr consensus sequence than when using Asn-Xxx-Ser. As such, the use of the threonine residue is preferred.

EXAMPLE 6 The Glucosylation Efficiency is effected by the Upward Direction Sequence This example shows that the glycosylation efficiency is affected by the amino acid at position -1 (relative to the substituted asparagine residue) as well as the substitution of a proline immediately "with an upward direction" (for example, towards the N) end of the asparagine residue in the consensus sequence. It was found that rHu-Leptin 1-146 with alterations of: S99, N100, S102 was more efficiently glycosylated than the same alterations lacking the serine substitution at position 99. This indicates that substitutions around the consensus glycosylation site may result in further improvement in glycosylation site occupancy. Furthermore, and surprisingly, a substitution of W0OO to TlOO resulted in the O-glycosylation of leptin presumably at position 100. This indicates that the carbohydrate either 0-linked or N-linked can be added to the same position, depending of the particular substitution that is made. FIGURE 2 is a Western blot that compares the N-linked glycosylation site to the 0-linked glycosylation site, as indicated. As can be seen, the use of the sequence "TAS" as indicated (with reference to SEQ ID NO.1) results in O-linked glycosylation.

EXAMPLE 7 Improved time of systemic circulation of a glycosylated leptin at three sites This example demonstrates that a glycosylated leptin having more than one glycosylation site has a circulation time that is substantially longer than non-glycosylated recombinant human leptin. As can be seen, glycosylated leptin showed a 4- to 5-fold decrease in systemic clearance and an increase in half-life compared to rmetHu-Leptin. Although there was a small decrease in subcutaneous bioavailability (approximately 10% decrease compared to non-glycosylated bioavailability), glycosylated leptin still resulted in greater exposure to the drug after subcutaneous dosing.

Materials : 1. Leptin A glycosylated leptin at three sites as prepared below (sites 47, 69 and 102, SEQ ID NO: 32) was used, formulated at 1.76 mg / ml in Dulbecco's buffered saline solution, without calcium chloride and without magnesium chloride (Gibco). Human methionyl leptin 1-146, recombinant (SEQ ID.

DO NOT. 1 with a methionine residue in position -1), expressed in E ^ Coli was used as a control, formulated at 2.0 mg / ml in buffer. 2. Animals . Number used / type: 27 male CD-1 mice (for the glycosylated leptin protein) and 81 male CD-1 mice (for r-metHu-leptin) (Charles River Laboratories, Hollister, CA) Age / weight: The animals were approximately 6 to 9 weeks old and weighed approximately 30 grams. Care / handling: The animals were individually housed and fed a diet of croquettes for laboratory rodent ad libitum. All animals were # managed according to good animal handling practices. 3. Administration. The animals were injected with glycosylated leptin at a dose of 1.0 mg / kg body weight intravenously (IV) or subcutaneously (SC). 4. Sampling The animals were anesthetized, and blood samples were collected at the designated time points using standard cardiac puncture techniques. Serum concentrations of glycosylated leptin were determined using an immunoassay (as described below).

. Comparison. The data of the circulation times were compared to the data previously obtained for the rmetHu-leptin, at the same dose, in animals of similar size, using the same administration ttes.

Results: The results are illustrated in the FIGURES 3 and 4. FIGURE 3 is a graph showing the concentration of leptin in serum after subcutaneous administration, and FIGURE 4 is a graph showing the concentration of leptin in serum after intravenous administration. In general, after intravenous and subcutaneous administration of glycosylated leptin having a Stokes radius greater than about 30A, serum concentrations were higher than those observed for rmetHu-Leptin as well as that for a glycosylated leptin in a single site (N48 T50). For rmetHu-Leptin, serum concentrations declined by 1.0 ng / ml within 6 hours after both routes of administration; while serum concentrations of glycosylated leptin remained above 1.0 lll ng / ml for 24 hours after intravenous or subcutaneous administration. Table 7.1 shows the pharmacokinetic parameters of glycosylated leptin and rmetHu- Leptin in mice.

Table 7.1 Pharmacokinetic parameters of Glucosilated Leptin and rmetHu-Leptin after Administration IV and SC Comparing IV data (see FIGURE 4), glycosylated leptin showed a lower systemic clearance (120 ml / h / kg vs 676 ml / h / kg) and a longer terminal half-life (2.76 h vs 0.733 h). The distribution volumes in the resting state (Vas) were similar between glycosylated leptin and rmetHu-Leptin. These data indicate that the glycosylated protein was cleared more slowly than rmetHu-Leptin from the systemic circulation, thus increasing the half-life and exposure (AUC estimates of 8350 ng »h / ml vs 1480 ng * h / ml). After the SC dose (see FIGURE 3), similar maximal serum concentrations (Cma?) Were obtained between glycosylated leptin and rmetHu-Leptin (1430 ng / ml vs 1380 ng / ml), although there was a delay in the maximum time (tmax) for glycosylated leptin. Similar to the results obtained from IV administration, the subcutaneous administration of glycosylated leptin showed an increased terminal half-life (2.21 h vs 0.541 h) and the area under the curve ("AUC") (5800 ng »h / ml vs 1180 ng «h / ml), probably due to decreased systemic clearance for glycosylated leptin. Subcutaneous bicisponsibility was approximately 69.5% for glycosylated leptin vs. 79.6% for rmetHu-Leptin.

EXAMPLE 8 Enhanced Weight Loss Activity of Glucosylated Leptin in Three Sites This example demonstrates that a glycosylated human leptin having a Stokes radius greater than 30 A has improved biological activity in vivo, compared to non-glycosylated recombinant human leptin. As can be seen, with daily administration after 7 days, the ob / ob mice lost approximately 6.8 times more weight with the glycosylated leptin at three sites, administered here, than with the non-glycosylated leptin.

Methods: 1. Leptin. Leptin with three glycosylation sites, prepared as described below (sites 47, 69 and 102, SEQ ID NO: 32), was used, formulated at a concentration of 1.9 mg / ml in phosphate buffered saline, of Dulbecco, pH 6.8. Recombinant 1-146 methionyl human leptin (SEQ ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg / ml in 10 mM sodium acetate with 5% sorbitol, pH 4.0. 10 mM sodium acetate with 5% sorbitol, pH 4.0 as a vehicle control was used. 2. Animals . The animals were housed in controlled conditions of temperature, light and humidity with lights on at 6:00 am and lights off at 6:00 pm. The animal research facility of Amgen, Inc. is approved by the USDA and accredited by the AAALAC. Six female ob / ob mice (Jackson Laboratories) were used per treatment group. The mice were 2 months old at the time of the study, and weighed an average of 45.6 grams. The mice were randomized to treatment groups such that the average body weights of the groups were equivalent before the start of treatment. The animals were housed two per cage and fed with croquettes for laboratory rodents, ad libitum standards. 3. Administration. All treatment procedures were approved by the Amgen Institutional Animal Care and Use Committee. The glycosylated leptin, r-metHu-Leptin, or placebo, were administered daily by means of subcutaneous injection in the intermediate scapular region in a volume of 0.1 ml. The leptin dose was 0.5 mg / kg body weight / day, for glycosylated leptin and for rmet-Hu-Leptin. The injections were administered in 7 consecutive days, beginning the study on day 0, in the afternoon (within 2 hours of light off in the colony). The animals were weighed daily at the time of injection. All data are reported as the mean + SE.

Results As can be seen in FIGURE 5, glycosylated leptin at three sites ("GE-leptin") resulted in the greatest amount of weight loss, with an average weight loss of 10.8 ± 0.3 grams (-23.8 ± 0.5% of initial body weight). The administration of the same dose of rmetHu-Leptin ("hLeptine") produced an average weight loss of 1.6 ± 0.4 grams (-3.5 ± 1.1% of initial body weight), while the administration of placebo resulted in a gain of body weight of 2. 6 ± 0.2 grams (5.7 ± 0.3% of initial body weight).

This example demonstrates a substantially improved in vivo biological activity of glycosylated leptin, as compared to non-glycosylated recombinant human leptin.

EXAMPLE 9 Enhanced Appetite Suppression Activity of Glucosylated Leptin in Three Sites This example demonstrates that a glycosylated human leptin having a Stokes radius greater than 30 A has improved biological activity in vivo compared to non-glycosylated recombinant human leptin. As can be seen, with daily administration after 7 days, the ob / ob mice ate approximately 11 times less food with the glycosylated leptin than with the non-glycosylated leptin.

Methods: 1. Leptin. Leptin with three glycosylation sites, prepared as described below (sites 47, 69 and 102, SEQ ID NO: 32), was used, formulated at a concentration of 1.9 mg / ml in phosphate buffered saline, of Dulbecco, pH 6.8. Recombinant 1-146 methionyl human leptin (SEQ ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg / ml in 10 mM sodium acetate with 5% sorbitol, pH 4.0. 10 mM sodium acetate with 5% sorbitol, pH 4.0 as a vehicle control was used. 2. Animals . The animals were housed in controlled temperature, light, and humidity conditions with lights on at 6:00 am and lights off at 6:00 pm. The research facilities of Amgen, Inc., are approved by the USDA and accredited by the AAALAC. Six female ob / ob mice (Jackson Laboratories) were used per treatment group. The mice were 2 months old at the time of the study, and weighed an average of 45.6 grams. The mice were randomized to the treatment groups, such that the average body weights of the groups were eguivalent before the start of treatment. The animals were housed two per cage and fed with roguettes for rodents, ad libitum standards. 3. Administration. All treatment procedures were approved by the Amgen Institutional Animal Care and Use Committee. The glycosylated leptin, r-metHu-Leptin, or placebo, were administered daily by means of subcutaneous injection in the middle scapular region in a volume of 0.1 ml. The leptin dose was 0.5 mg / kg body weight / day, for glycosylated leptin and for rmetHu-Leptin. Injections were administered for 7 consecutive days, beginning the study on day 0, in the afternoon (within 2 hours of light off in the colony). 4. Measurement of the food. Feed intake was measured daily at the time of injection by weighing the amount of feed in each animal cage each day. Food intake is reported as grams eaten per mouse per day, and was calculated as follows: (weight of food in the cage the previous day -weight of feed that day) / number of mice per cage (two). All data are reported as the mean ± SE.

Results: As can be seen in FIGURE 6, the administration of glycosylated leptin in three sites resulted in the greatest reduction in food intake, with an average food intake of 0.4 ± 0.04 grams / mouse / day for the final period 24 hours after the seventh dose. The administration of recombinant human methionyl leptin produced a reduction in food intake of 4.4 ± 0.4 grams / mouse / day, compared to the food intake of vehicle-treated controls (7.0 ± 0.3 grams / mouse / day), for the same 24-hour period. This Example demonstrates a substantially improved in vivo biological activity of glycosylated leptin, as compared to non-glycosylated recombinant human leptin.

EXAMPLE 10 Improvement in Weight Loss Activity of Glucosilated Leptin in Three Sites, Intermittently Administered This Example demonstrates that the enhanced in vivo biological activity of a glycosylated human leptin at three sites having a Stokes radius greater than 30 A, is maintained when the material is administered is an intermittent base. As can be seen, the ob / ob mice lost significantly more weight with the daily or every third day administration of the glycosylated leptin, when treated with a 10-fold higher dose of the non-glycosylated leptin.

Methods 1. Leptin. Leptin with three glycosylation sites, prepared as described below (sites 47, 69 and 102, SEQ ID No. 32), was used, formulated at a concentration of 1.9 mg / ml in Dulbecco's phosphate-buffered saline, pH 6.8. Recombinant 1-146 methionyl human leptin (SEQ ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg / ml in 10 mM sodium acetate with 5% sorbitol, pH 4.0. 10 mM sodium acetate with 5% sorbitol, pH 4.0 as a vehicle control was used. 2. Animals . The animals were housed in controlled conditions of temperature, light and humidity with lights on at 6:00 am and lights off at 6:00 pm. The animal research facility of Amgen, Inc. is approved by the USDA and accredited by the AAALAC. Six female ob / ob mice (Jackson Laboratories) were used per treatment group. The mice were 4.5 months old at the time of the study, and weighed an average of 66.6 grams. The mice were randomized to treatment groups such that the average body weights of the groups were eguivalent before the start of treatment. The animals were housed two per cage and fed with croguettes for laboratory rodents, ad libitum standards. 3. Administration. All treatment procedures were approved by the Amgen Institutional Animal Care and Use Committee. The glycosylated leptin, r-metHu-Leptin or placebo, were administered either daily or every third day by means of a subcutaneous injection in the middle scapular region in a volume of 0.1 ml. The leptin dose was 0.25 to 2.5 mg / kg body weight / day for mice injected daily with glycosylated leptin or r-metHu-Leptin. The leptin dose was 1 or 10 mg / kg of body weight / day for mice injected every third day with glycosylated leptin or r-metHu-Leptin. The injections were administered in the 7 consecutive days, beginning the study on day 0, in the afternoon (within 2 hours of light off in the colony). Mice injected every third day with leptin received vehicle injections on alternate days. The animals were weighed daily at the time of injection. The percentage loss in weight is calculated as: ((Body weight on day 7 - body weight on day 0) / Body weight on day 0) multiplied by 100. All data are reported as the mean ± SE.

Results: As shown in Table 10.1, mice injected daily with 0.25 mg / kg body weight / day of glycosylated leptin, lost more weight than mice that received either the same dose or a ten-fold dose lost. of recombinant methionyl human leptin. Table 10.1: Weight loss (expressed as a percentage of initial body weight) after 7 days of daily dosing of glycosylated leptin or recombinant human methionyl leptin.

As shown in Table 10.2, the mice injected every third day with 1 mg / kg of body weight / day of glycosylated leptin, lost more weight than the mice that received the same dose or a dose ten times greater than the mice. Recombinant human methionyl leptin.

Table 10.2: Weight loss (expressed as a percentage of initial body weight) after 7 days of daily dosing of glycosylated leptin or recombinant human methionyl leptin.

This example demonstrates that the enhanced biological activity of glycosylated leptin, relative to non-glycosylated leptin, is preserved when the protein is administered intermittently to obese mice.

EXAMPLE 11 Dose-Response Studies of a Glucosylated Leptin in Three Sites, on Wild-type Mice This example demonstrates that the present glycosylated leptin at three sites having Stokes radius greater than 30 A has biological activity in non-obese mice. In addition, the present example confirms in wild-type mice, that a much lower dose of the glycosylated leptin results in substantial weight loss, compared to non-glycosylated leptin. 1. Leptin Leptin with three glycosylation sites, prepared as described below (sites 47, 69 and 102, SEQ ID NO: 32), was used, formulated at a concentration of 5.1 mg / ml in phosphate buffered saline. , by Dulbecco, pH 6.8. Recombinant 1-146 methionyl human leptin (SEQ ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg / ml in 10 mM sodium acetate with 5% sorbitol, pH 4.0. 10 mM sodium acetate with 5% sorbitol, pH 4.0 as a vehicle control was used. 2. Animals . The animals were housed in controlled conditions of temperature, light and humidity with lights on at 6:00 am and lights off at 6:00 pm. The animal research facility of Amgen, Inc. is approved by the USDA and accredited by the AAALAC. Six female C57B1 / 6J mice (Jackson Laboratories) were used per treatment group. The mice were 2.5 months old at the time of the study, and weighed an average of 20.0 grams. The mice were randomized to treatment groups such that the average body weights of the groups were equivalent before the start of treatment. The animals were housed two per cage and fed with croquettes for laboratory rodents, ad libitum standards. 3. Administration. All treatment procedures were approved by the Amgen Institutional Animal Care and Use Committee. The glycosylated leptin, r-metHu-Leptin or placebo were administered daily by means of subcutaneous injection in the intermediate scapular region in a volume of 0.1 ml. The leptin dose was 1 or 10 mg / kg of body weight / day. The injections were administered in the 7 consecutive days, beginning the study on day 0, in the afternoon (within 2 hours of light off in the colony). The animals were weighed daily at the time of injection. The percentage loss in weight is calculated as: ((Body weight on day 7 - body weight on day 0) / Body weight on day 0) multiplied by 100. All data are reported as the mean ± SE.

Results As observed in Table 11.1, mice injected daily with 1 mg / kg body weight / day of glycosylated leptin, lost more weight than mice who received either the same dose or a ten-fold dose of Recombinant human methionyl leptin.

Table 11.1: Weight loss (expressed as a percentage of initial body weight) after 7 days of daily dosing of glycosylated leptin or recombinant human methionyl leptin.

This example demonstrates that the enhanced biological activity of glycosylated leptin, relative to non-glycosylated leptin, is also present in non-obese mice.

EXAMPLE 12 Improvement in the Weight Loss Activity of the Glycosylated Leptin in Three Sites, Intermittently Administered to Wild Type Mice The present example demonstrates that glycosylated leptin at three sites having a Stokes radius greater than 30 A has improved biological activity compared to r-metHu-Leptin 1-146. In addition, the example demonstrates that the improved biological activity is sustained when the glycosylated leptin is administered in a less frequent dosing scheme than r-metHu-Leptin 1-146, in wild-type mice. 1. Leptin Leptin with three glycosylation sites, prepared as described below (sites 47, 69 and 102, SEQ ID NO: 32), was used, formulated at a concentration of 5.1 mg / ml in phosphate buffered saline, of Dulbecco, pH 6.8. Recombinant 1-146 methionyl human leptin (SEQ ID NO: 1 with a methionyl at position -1) was used as a basis for comparison, formulated at 20 mg / ml in 10 mM sodium acetate with 5% of sorbitol, pH 4.0. 10 mM sodium acetate with 5% sorbitol, pH 4.0 as a vehicle control was used. 2. /Animals . The animals were housed in controlled conditions of temperature, light and humidity with lights on at 6:00 am and lights off at 6:00 pm. The animal research facility of Amgen, Inc. is approved by the USDA and accredited by the AAALAC. Six female C57B1 / 6J mice (Jackson Laboratories) were used per treatment group. The mice were 2.5 months old at the time of the study, and weighed an average of 20.0 grams. The mice were randomized to treatment groups such that the average body weights of the groups were equivalent before the start of treatment. The animals were housed two per cage and fed with croquettes for laboratory rodents, ad libitum standards. 3. Administration. All treatment procedures were approved by the Amgen Institutional Animal Care and Use Committee. The glycosylated leptin, r-metHu-Leptin or placebo were administered daily by means of subcutaneous injection in the intermediate scapular region in a volume of 0.1 ml. The leptin dose was 1, 5, or 10 mg / kg of body weight, injected every third day. The leptins were injected every third day for 7 consecutive days, beginning the study on day 0, in the afternoon (within 2 hours of lights off in the colony). The mice received vehicle injections on alternate days. The animals were weighed daily at the time of injection. The percentage loss in weight is calculated as: ((Body weight on day 7 - body weight on day 0) / Body weight on day 0) multiplied by 100. All data are reported as the mean ± SE.

Results: As shown in Table 12.1, mice injected every third day with 1, 5 or 10 mg / kg body weight of glycosylated leptin lost more weight than mice that received the same dose of human leptin lost Recombinant methionilic every third day.

Table 12.1: Weight loss (expressed as a percentage of initial body weight) after 7 days of dosing every third day of glycosylated leptin or recombinant human methionyl leptin.

This example demonstrates that the enhanced biological activity of glycosylated leptin, relative to non-glycosylated leptin, is preserved when the protein is administered intermittently to non-obese mice.

EXAMPLE 13 Leptin Proteins from Multiple, Additional Glucosylation Sites The additional glycosylated human leptin proteins, which were also prepared, are presented in Table 13.1 below. The columns of the table present: (1) the position of the N-glycosylation (with respect to the numbering of SEQ ID NO.1, rHu-Leptin 1-146) (unless otherwise indicated) ); (2) expression performance as compared to "wild type" ("WT"), here, rHu-Leptin 1-146 as in SEQ. ID. DO NOT. 1); (3) the glycosylation species that were detected; (4) the link to the receiver in relation to "WT"; (5) the bioactivity relative to "WT". The methods used are described below. The term "ND" means not determined. (Specific sequences not used herein for expression are more fully described in the following Example pertaining to the expression of the glycosylated leptin protein 47 + 69 + 102).

Table 13.1 The abbreviations and notations are the same as those used previously, see for example, Table 4.1. * "RRR" denotes the use of three C-terminal arginines on the glycosylated leptin protein.

In addition, the following multiple glycosylated leptin proteins have been elaborated and tested as described later in Example 15. 2 + 23 + 47 + 69 + 92 2 + 47 + 69 + 92 + 102 23 + 47 + 69 + 92 + 102 2 + 47 + 69 + 92 2 + 47 + 69 + 102 23 + 47 + 69 + 102 23+ 47 + 69 + 92 Q-47 + 69 + 92 + 102 ("Q-" indicates that SEQ ID No. 2, rHu- Leptin 1-145, was used as the protein backbone to which the proteins were added). glycosylation sites) 47 + 69 + 100e + 102 In addition, the present invention also encompasses a glycosylated leptin protein having glycosylation sites at positions 47, 69, 92, and 102.

EXAMPLE 14 Expression of a Glucosylated Protein in Three Sites, Using a Variety of Signal Sequences and other Sequences Affecting Glucosylation This example illustrates the differences in the glycosylation of a glycosylated leptin protein at three sites, which has sites available for glycosylation, located at positions 47, 69, and 102 of rHu-Leptin 1-146 (SEQ ID NO. 1 having the annotated glycosylation sites, using the NXS / T formula, prepared as described herein), also as described herein. Expression in two cell types, COS cells, and CHO cells, was generally according to the methods in the following reference examples. The glycosylation was determined according to the methods described in the following Reference Examples. The degree of glycosylation was rated on a scale of 1 to 5, with 5 having the appearance of maximum occupancy of the glycosylation sites. The term "ND" means "not determined." A variety of sequence signals were used. The amino acid sequences of these signal sequences are presented below in Table 14.1. The following terms were used to denote which signal sequences or other amino acid sequences were used to express the present glycosylated leptin.

Leptin - the naturally occurring human leptin signal sequence Leptin / TPA (L / T) - the first five N-terminal amino acids of human leptin, followed by the 15 amino acids of human tPA signal, which end with SP Leptin / TPA (T / L) - the seven N-terminal amino acids from the human tissue plasminogen activator, followed by 16 amino acids of the human leptin signal sequence, beginning in LCG Leptin (SP) - the leptin signal sequence human of natural origin, except that it has the last two c-terminal amino acids replaced with serine-proline Leptin (SPS) - the signal sequence of human leptin of natural origin, except that it has the two c-terminal amino acids replaced with serine-proline-serine Leptin (SNS) - the naturally occurring leptin signal sequence from leptin human, except that it has the two c-terminal amino acids replaced with serine-asparagine-serine Leptin-pro-signal sequence of human leptin of natural origin, plus an additional "pro" sequence at the c-Leptin-modified end (LGDVMT) - the signal sequence of human leptin of natural origin, except with six c-terminal amino acids substituted with LGDVMT Leptin + RRR at c-term - the signal sequence of human leptin of natural origin, and additionally, at the end c of the glycosylated leptin protein, three arginine residues Leptin R81, R85 (analogue) - the naturally occurring human leptin signal sequence, and the glycosylated leptin protein which is the amino acid sequence of the S EQ ID No. 1 with arginine at positions 81 and 85, and glycosylation sites at positions 47, 69 and 102 Thrombopoietin (TPO) - the human thrombopoietin signal sequence of natural origin Tissue Plasminogen Activator (TPA) - the signal sequence of human tissue plasminogen activator, naturally occurring TPA (SNS) - the signal sequence of the human tissue plasminogen activator of natural origin, which has the three c-terminal amino acids that are the amino acids serine-asparagine-serine TPA (SPA) - the signal sequence of the human tissue plasminogen activator of natural origin, which has the three c-terminal amino acids that are the amino acids serine-proline-alanine TPA (SP) - the signal sequence of the tissue plasminogen activator human of natural origin, which has the two c-terminal amino acids which are the amino acids serine-proline TPA (SFS) - the signal sequence of the human tissue plasminogen activator of origin natural, which has the three c-terminal amino acids that are the amino acids serine-phenylalanine-serine TPA (SWS) - the signal sequence of human tissue plasminogen activator of natural origin, which has the three c-terminal amino acids which are the amino acids serine-tryptophan-serine TPA (INS) - the signal sequence of the human tissue plasminogen activator of natural origin, which has the three c-terminal amino acids that are the amino acids isoleucine -asparagine-serine TPA (INA) - the signal sequence of human tissue plasminogen activator of natural origin, which has the three c-terminal amino acids that are the amino acids isoleucine-asparagine-alanine TPA-A2 - the signal sequence of the activator of human tissue plasminogen of natural origin, which has additional c-terminal amino acids, of arginine-glycine-arginine-phenylalanine-arginine-arginine TPA (SP) -A2 - the signal sequence of the human tissue plasminogen activator of natural origin, which has the last serine of the sequence of natural origin deleted and that has additional c-terminal amino acids of arginine-glycine-arginine-phenylalanine-arginine-arginine TPA-A4- l a signal sequence of the human tissue plasminogen activator of natural origin, which has the additional c-terminal amino acids of glutamine-glutamic acid-isoleucine-arginine-glycine-arginine-phenylalanine-arginine-arginine TPA-A5 - the signal sequence of the human tissue plasminogen activator of natural origin, which has the additional c-terminal amino acids of glutamine-glutamic acid-isoleucine-histidine-alanine-arginine-phenylalanine-arginine-arginine Intrinsic factor - the signal sequence of human intrinsic factor of natural origin Serum albumin (pre-pro) - the signal sequence and prosequence of human serum albumin of natural origin G-CSF - the signal sequence of the granulocyte colony stimulation factor, human, of natural origin von Willebrand factor (vW ) - the signal sequence of human von Willebrand factor of natural origin MAC-1 (CD11 alpha) - the human CDlla signal peptide of natural origin Tie (receptor) - the human Tie receptor sequence of natural origin Factor VIII - the signal sequence of human factor VIII of natural origin IgG-1, murine - the murine IgG-1 signal sequence of natural origin Folistatine ( FS) - the signal sequence of human folistatin of natural origin LAMP-1 - the signal peptide of human LAMP-1 of natural origin Ceruloplasmin (CP) - the signal peptide of human ceruloplasmin of natural origin EPO (or " ESP "denoting the erythropoietin signal peptide) - the human erythropoietin signal sequence of natural origin EPO (ESP) RRR @ -term - the human erythropoietin signal sequence of natural origin and which also has, at the extreme of the amino acid sequence for the glycosylated leptin protein, three arginine residues EPO-HSApro - the human erythropoietin signal sequence of natural origin having at the c-terminus the "pro" sequence from the human serum albumin mana EPO-dHSApro-modified - the human erythropoietin signal sequence of natural origin having at end c a modified "pro" sequence from human serum albumin (modified as indicated in the following table) EPO-dHSApro-modified + furina - the signal sequence of human erythropoietin of natural origin having at the c-terminus a modified "pro" sequence from human serum albumin (modified as indicated in the following table) co-expressed with furin EP0-NT3 pro - la signal sequence of human erythropoietin of natural origin, which has at the end c a "pro" sequence from NT-3 EPO-HSApro (leptin NH2 VtoA) - the signal sequence of human erythropoietin of natural origin, which has end with a "pro" sequence from human serum albumin and with Vali from the leptin sequence changed to the Ala to improve the cleavage of prosequence by furin.

Table 14.1 Expression of glycosylated leptin protein 47 + 69 + 102 The various TPA signal peptides, particularly those with modified c-ends (such as the addition of a prosequence) appeared to have the highest glycosylation efficiency in CHO and COS cells. This was confirmed in a stained or Western transfer (FIGURE 7). As can be seen, the use of the signal peptide for tPA resulted in the highest molecular weight, and therefore the most highly glycosylated sample. FIGURE 8 is a Western blot showing the results of a comparison of the various expression conditions for the glycosylated leptin protein at three sites, 47 + 69 + 102, as described above. Starting on the left hand side of the Western Spot in FIGURE, the bands are loaded as follows: Band 1: molecular weight standards; Lane 2: 47 + 69 + 102 having a c-terminal amino acid sequence of three arginines, expressed in COS cells using the native human leptin signal peptide; Band 3: Same as band 2, expressed in CHO cells Band 4: Same as band 2, expressed using a native human erythropoietin signal peptide. Band 5: "QTT COS ESP", rHu-leptin 1-145 (SEQ ID No. 2) having the amino acid change 27T29S > 27T29T, expressed in cells. COS using a native human erythropoietin signal peptide; Band 6: "QTT CHO ESP", the same as band 5, expressed in CHO cells using a native human erythropoietin signal peptide; Lane 7: "EA2 47 +69 + 102 COS", as well as band 2, which lacks the c-terminal arginines, expressed in COS cells, using the erythropoietin signal peptide and a prosequence of modified human albumin, as is indicated in this Example; Band 8: "EA2 47 + 69 + 102 CHO", the same as band 7, expressed in CHO cells; Band 9: "EA2 47 + 69 + 102 + Furina in CHO", the same as band 8, using the furin construction as indicated in this Example. As can be observed by notation of the density of high molecular weight bands (indicating glycosylation), the triple glycosylated leptin protein (bands 2, 3, 4, 7, 8 and 9) has more glycosylation than rHu-Leptin 1-145 modified, which has a simple O-linked site (lanes 5 and 6). The use of CHO cells resulted in an increased amount of glycosylation compared to COS cells (band 2 versus band, for example), and the use of the erythropoietin signal peptide appeared to also improve glycosylation (band 3 versus band 5). , for example) . FIGURE 9 is a Western blot that compares the use of the leptin signal peptide or the tPA signal peptide, or the use of one or the other with a substituted enzyme cleavage site. The use of the tPA signal peptide resulted in higher glycosylation than the use of the leptin signal peptide (two left bands). When the c-terminal portion of the leptin signal peptide containing its peptidase cleavage site was used with the N-terminal portion of the tPA signal peptide, the glycosylation efficiency decreased ("Tpa / leptin" bands). But when the C-terminal portion of the tPA signal peptide containing its cleavage site was used with the N-terminal portion of the leptin signal peptide, the glycosylation efficiency was increased ("Leptin / Tpa" bands). Good glycosylation efficiency was found when only the tPA cleavage site was introduced into the leptin signal peptide ("leptin (SPS)"). This had greater glycosylation efficiency than the substitution of a sequence at the partial cleavage site ("leptin (SP)"). FIGURE 10 is a Western blot that compares the glycosylation efficiency by observing the results of the removal of the carbohydrate portion by N-glycanase. As can be seen, in the bands that have eliminated the carbohydrate (indicated by the "+"), the leptin protein migrates towards the same molecular weight as the non-glycosylated leptin. Comparing the apparent amount of the carbohydrate in the bands without N-glycanase ("-"), the use of the erythropoietin signal peptide ("ESP" or "E" in combination with other notation, as previously used) appears to glycosylate more efficiently the glycosylated leptin protein in three sites, tested.

EXAMPLE 15 Additional Expression Studies of Glucosilated Leptin Proteins in Multiple Sites, Using a Variety of Signal Peptides and Other Sequences That Affect Glucosylation This example presents the additional data for the expression of leptin proteins from simple and multiple glycosylation sites, using a variety of signal peptides and another sequence. Unless indicated otherwise, the following glycosylated leptin proteins refer to glycosylation sites added to the SEQ. ID No. 1, using the preferred formula of? -X-S / T. The expression was in COS cells. The percentage ("%") of glycosylation means that percentage of the molecules that contain any carbohydrate. This was determined by visual examination of a Western blot (as described further below in the Reference Examples) and subjectively determining that proportion of glycosylated protein of the total leptin protein visualized.

Controls Presented next in Table 15.1 are the data for various leptin proteins. Human leptin 1-145 (SEQ ID.sub.2, denoted herein as "Q-") was expressed as a glycosylated protein. When expressed in COS cells using its native glycosylation site, using a signal peptide, derived from erythropoietin ("ESP" as in the previous Examples), there was 25% glycosylation (indicating that 25% of the sites available for glycosylation were glycosylated, in a population of expressed protein molecules). This was above the 10% glycosylation observed when the native human leptin signal peptide was used (as described above). When one of the glycosylation sites was changed to have a threonine at position 29 instead of a serine (as shown in the Table), the results doubled, indicating that a "T" is better than an "S" for O-glycosylation. The "T" and "S" of the naturally linked 0-linked site can each be glycosylated with a mixture of one and two carbohydrate chains. When the site is changed to have a "T" in position 29, the percentage of these two sites that have one and / or two chains is increased.

Table 15.1 Position of Change of Expression% of Linkage of Bioactivity glycosylation Sequence Reí. to WT Glucosilación Receptor Reí. I laughed to WT to WT WT none 1 0 1 1 ESP Ob + EPO sp 2 0 1 0.95 (-Q) Ob + (-) Q @ 28 1.3 10 1.3 0.14 ESP (-Q) Ob + EPO sp 1.1 25 0.6 0.36 ESP (-Q [TT]) Ob + 27T29S > 0.72 60 0.71 0.3 27T29T EA Ob + 0.13 0 3.5 1.8"WT" denotes rHu-Leptin 1-146 (SEQ ID NO: 1) "ESP" denotes the signal peptide of native human erythropoietin, as described in Example 14 , above "ESP ob +" denotes the use of the above with the native human erythropoietin signal peptide "(-Q) Ob +" denotes rHu-Leptin 1-145 (SEQ ID NO: 2) "EA" denotes the use of the native human erythropoietin signal peptide with the prosequence of human albumin, as Example 14 above.

Expression of Glucosylated Leptin Proteins in a Single Site Site Comparisons 2 As can be seen from Table 15.2, below, the addition of three terminal arginines resulted in improved glycosylation efficiency.

Table 15.2 Expression Position a% Glucosylation Link to Receptor Bioacrivity Reí. to glycosylation WT Reí. to WT WT ESP2 0.3 60 0.9 0.16, 0.012 EA V > A2 0.45 35 1, 0.7 0.53, 0.73 2 RRR ND 90 ND ND Where two trials were performed, both results are presented. The abbreviations are the same as those for Example 14, above. "ND" as used in all Tables, means not determined.

Site Comparisons 23 As indicated in Table 15.3, the highest levels of expression and the highest bioactivity occurred with the use of the native leptin signal peptide (first row, 23a). The expression was in COS cells.

Table 15.3 Position of Expression Changes Reí. a% Bioactivity Linkage glycosylation WT Sequence Glucosylation Receptor Reí. to Reí. to WT WT 23a DIS > NIT 7.8 50 ND 0.53 ESP * 23a EPO sp 0.49 30 0.5 0.79 ESP (-Q) 23 EPO sp 0.78 45 0.87 < 0.03 ESP (-Q [TT]) 23 EPO sp 0.32 60 ND O.004 The abbreviations are the same as those for Example 14, above. "ND" as used in all tables, means not determined.

Site comparisons 47 As can be seen in Table 15.4, below, the addition of the three terminal arginine residues ("RRR") resulted in additional glycosylation for the glycosylated leptin protein with a glycosylation site at position 47.

Table 15.4 Expression Position a% Glucosylation Link to Receptor Bioativity Reí. to glycosylation T Reí. to WT WT 47 1. 06 80 0. 66 0. 84 47 RRR 0. 07 95 ND 0. 86 Where two trials were performed, both results are presented. The abbreviations are the same as those for Example 14, above. "ND" as used in all Tables, means not determined.

Site Comparisons 48 As indicated in Table 15.5, below, the highest level of expression for glycosylated leptin at a single site at position 48, using COS cells was with the signal peptide from erythropoietin combined with the prosequence of serum albumin human As can be seen, this single-site protein had a higher biological activity than non-glycosylated leptin.

Table 15.5 Change Position of the Expulsion Reí. a% Bioactivity Linkage glycosylation WT Sequence Glucosylation Receptor Reí. to Reí. to WT WT 48 ILT > NLT 0.92 50 0.8 0.53 ESP 48 EPO sp 0.54 75 0.8 < 0.001 EA 48 EPO sp + 1.8 80 1 1.2 HAS pro AA 48 HSA sp + 1 90 1 0.78 HSA pro The abbreviations are the same as those for the previous Examples. The percent glycosylation is expressed in the same terms as in Table 15.1, above.

Site 69 comparisons As can be seen from Table 15.6, the use of the tPA signal peptide plus three terminal arginines resulted in the highest glycosylation efficiency.

Table 15.6 Expression Position a% Glucosylation Link to Receptor Bioactivity Reí. to glycosylation WT Reí. to WT WT 69 0. 8 75 0. 6 1. 1 T 69 ND 85 ND ND 69RRR 0. 07 65 ND ND T 69RRR 0. 04 95 ND ND The abbreviations used are the same as those used for the previous Examples. The percent glycosylation is expressed in the same terms as in Table 15.1 above.

Site comparisons 92 As can be seen in Table 15.7, the addition of the three terminal arginines improved glycosylation efficiency.

Table 15.7 Position of N- Expression Reí. a% Glucosylation Link to Receptor Bioactivity Reí. to glycosylation WT Reí. a WT WT 92 4.8 45 1.6 0.8 92 RRR 0.03 95 ND ND The abbreviations are the same as those used for the previous Examples. The percent glycosylation is expressed in the same terms as in Table 15.1 above.

Site Comparisons 102 As indicated in Table 15.8, the addition of three C-terminal arginine residues resulted in improved glycosylation efficiency.

Table 15.8 Position of N- Expression Reí. a% Glucosylation Link to Receptor Bioactivity Reí. to glycosylation WT Reí. to WT WT 102 1.8 70 0.5 0.66 102RRR 0.07 95 ND 0.33 The abbreviations are the same as those used for the previous Examples. The percent glycosylation is expressed in the same terms as in Table 15.1 above.

Expression of the Protein Leptin Glucose in Two Sites Comparisons of the Site 47 + 69 As can be seen in Table 15.9, for the glycosylated leptin protein at site 47 + 69 (as described above), the use of the native leptin signal peptide gave the highest levels of expression. The use of the erythropoietin signal peptide with the prosequence of human serum albumin, or the use of the human serum albumin signal peptide and the prosequence, gave the highest bioactivity results.

Table 15.9 Position of N- Change of Expression Reí. % Link of the Bioactivity glycosylation Sequence to WT Glucosylation Receptor Reí. to Reí. to WT WT 47 + 69 47 + 69 1.3 l'-10.2'-50 1 0.69 ESP 47 + 69 EPO sp 0.35 l '-10.2'-60 0.6 < 0.002 EA 47 + 69 EPO sp + 0.3 l '-5.2'-85 0.3 HSA pro AA 47 + 69 EPO sp + 0.82 1' -20.2'-50 1.7 HSA pro The abbreviations are the same as those previously used. The glycosylation is expressed in the same terms as previously used, see for example, Table 4.1.

Site 69 + 102 comparisons As can be seen from Table 15.10, the use of the erythropoietin signal peptide in COS cells apparently had a deleterious effect on the expression of glycosylated leptin at the two sites 69 + 102 (as described above).

Table 15.10 Expression Change Position Reí. a% Bioactivity Linkage glycosylation WT Sequence Glucosylation Receptor Reí. to Reí. a WT WT 69 + 102 69 + 102 1.7 l '-40.2'-30 0.5 0.63 ESP 69 + 102 EPOsp / 0.6 l '-20.2'-50 1 < 0.001 69 + 102 47 + 102 47 + 102 2.7 l '-50.2'-25 1.08 0.42 The abbreviations are the same as those used previously, see for example, Example 14 for more details. The glycosylation is expressed in the same terms as previously used, see for example, Table 4.1.

Expression of the Glucosylated Protein Leptin in Three Sites As can be seen in Table 15.11, the use of the erythropoietin signal peptide had variant effects on the various glycosylated leptin proteins expressed in COS cells. Interestingly, the glycosylated leptin protein with the highest bioactivity had the highest receptor binding (the lower the number the greater the affinity for the receptor).

Table 15.11 Position of Expression Changes% Linkage of Bioactivity glycosylation Sequence Reí. to WT Glucosilación Receptor Reí. to WT Reí. a WT ESP 2 + 47 + 69 EPO sp 0.2 l '-5.2'-70.3'-20 0.7 0.24 L / T 2447 + 69 (see Ex. 14) 0.21 l '-5.2'-60.3'-30 1.25 ND L (SNS) 2 + 47 + 69 (see Ex. 14) 0.31 ND 1.63 ND T 2 + 47 + 69 (see Ex. 14) 0.1 l '-5.2'-50.3'-40 ND ND ESP 23 + 47 + 69 EPO sp 0.51 r-5.2'-10.3'-45 0.5 1.4 ESP 47 + 69 + 77 EPO sp 0.51 l '-10.2'-75.3'-5 4.2 < 0.006 ESP 47 + 69 + 92 EPO sp 0.39 T-15.2'-50.3'-15 0.71 0.47 ESP (-Q) 47 + 69 + 92 EPO sp 0.76 r-15.2'-50.3'-15 0.8 0.88 The abbreviations are the same as those used previously, see for example, Example 14 for more details. The glycosylation is expressed in the same terms as previously used, see for example, Table 4.1.

Expression of the Glucosylated Protein Leptin in Four Sites As can be seen in Table 15.12, for expression of the glycosylated leptin protein at four sites in COS cells, several levels of expression were obtained, and the resulting glycosylated proteins had varying degrees of receptor binding and bioactivity. For this group of quadruple site leptins, the leptins of the site 23 + 47 + 69 + 92 and 23 + 47 + 69 + 102 had the highest bioactivity in relation to the wild type (for example, rmetHu-Leptin 1-146, SEQ ID NO: 1).

Table 15.12 Summary of the Results of the Expression, Enl ace t Glycosylation of a Quadruple Site, of the Glucosylation of Lipt ina in COS Cells Glycosylation Position Expression Reí. a Glucosylation Link to Bioactivity WT Receptor Reí. I laughed to WT to WT None 1 0 1 1 ESP2 + 47 + 69 + 92RRR 0.004 l '-5.2'-5.3'-30.4'-70 ND ND 2 + 47 + 69 + 92RRR 0.13 l'-5.2'-5.3'-60.4'-25 ND 0.2 T 2 + 47 + 69 + 92 0.052 l'-5.2'-5.3'-45.4'-40 ND ND T 2 + 47 + 69 + 92RRR 0.01 l'-52.2'-5.3'-35.4'-50 ND ND T (SNS) 2 + 47 + 69 + 92 0.15 r-5.2'-20.3'-45.4'-25 1.1 < 0.01 T (-S) 2 + 47 + 69 + 92 0.14 r-5.2'-20.3'-45.4'-25 1.1 < 0.01 EA2 2 + 47 + 69 + 92 0.24 l '-5.2'-10.3'-50.4'-30 ND ND TA4 2 + 47 + 69 + 92 0.24 l '-10.2'-25.3'-15.4'-45 0.6 0.49 TA5 2 + 47 + 69 + 92 0.13 l'-10.2'-25.3'-15.4'-45 0.8 0.88 L / T 2 + 47 + 69 + 92 0.2 l '-5.2'-25.3'-45.4'-25 1.2 ND L (SNS) 2 + 47 + 69 + 92 0.28 ND 0.75 ND T 2 + 47 + 69 + 102 0.16 ND ND ND L (SNS) 2 + 47 + 69 + 102 0.28 ND 1.1 ND ESP 23 + 47 + 69 + 102 0.48 r-20.2'-20.3'-20.4'-10 0.5 1.8 ESP 23 + 47 + 69 + 92 0.41 r-20.2'-20.3'-20.4'-5 0.5 2.3 ESP (-Q) 47 + 69 + 92 + 102 0.32 l'-10.2'-40.3'-40 0.57 0.13 47 + 69 + 100e + 102 1.5 r-25.2'-40.3'-20 0.7 0.66 The abbreviations are the same as those used previously, see for example, Example 14 for more details. The glycosylation is expressed in the same terms as previously used, see for example, Table 4.1.

Expression of Glucosylated Protein Leptin in Five Sites As presented in Table 15.13, the expression levels of various glycosylated proteins at five sites were clearly lower using the indicated signal peptides. Some data were not determined ("ND").

Table 15.13 Summary of Expression Results, Enl ace, Glucosylation of the Quintuple Site, of Gl ucosylation of Leptin in COS Cells Position of N- Expression Reí. a Glucosilación Link to the Bioactivity glycosylation WT Receptor Reí. I laughed to WT to WT None 1 0 1 1 2 + 23 + 47 + 69 + 92 RRR 0.11 l'-5.2'-5.3'-20.4'-40.5'-25 1 ND T 2 + 23 + 47 + 69 + 92 0.045 2'-5.3, -20.4'-40.5 '-25 ND ND T 2 + 23 + 47 + 69 + 92 RRR 0.01 2'-5.3'-10.4'-45.5'-30 ND ND T 2 + 47 + 69 + 92 + 102 0.19 2'-20.3'-30.4'-30.5'-15 0.83 ND ESP 23 + 47 + 69 + 92 + 102 0.34 T-20.2'-20.3'-20.4'-20.5'-5 0.3 1.3 L / T 2 + 47 + 69 + 92 + 102 0.29 2'-30.3'-30.4'-30.5'-5 0.75 ND L (SPS) 2 + 47 + 69 + 92 + 102 0.18 r-5.2'-10.3'-20.4'-30.5'-25 1.42 ND T (SNS) 2 + 47 + 69 + 92 + 102 0.16 2'-30.3'-30.4'-30.5'-5 0.5 ND T (SPA) 2 + 47 + 69 + 92 + 102 0.19 2'-20.3'-30.4'-30.5'-15 0.58 ND L (SNS) 2 + 47 + 69 + 92 + 102 0.21 ND 0.38 ND The abbreviations are the same as those used previously, see for example, Example 14 for more details. The glycosylation is expressed in the same terms as previously used, see for example, Table 4.1. In addition, Western blots of the present glycosylated leptin proteins also illustrate that differences in expression conditions and compositions result in different glycosylation efficiencies. FIGURE 11 shows that the increase in the number of glycosylation sites, at least up to five sites, increases the amount of glycosylation found in the leptin protein when expressed in CHO cells. The samples are as follows: Band 0: "Negative Control" is the cell culture supernatant that does not contain leptin; Lane 1: "ESP (W.T.)", FHu-Leptin 1-146 (SEQ ID NO: 1) expressed using an erythropoietin signal peptide; Band 2: "ESP (N48)" 7 the same as above, using the glycosylated leptin protein in a single site, indicated (as described above); Lane 3: "ESP (N47 + N69)", as described above, using the glycosylated leptin protein at two sites, indicated (as described above); Lane 4: "ESP (N47-N69 + N102)", as described above, using the glycosylated leptin protein at three sites, indicated (as described above); Band 5: "Tpa (SNS) N2 + N46 + N69 + N92" indicates the glycosylated leptin protein at four sites, as described above, expressed using a human tPA signal peptide, which has an enzymatic cleavage site of SNS (see Example 14 for sequence information); Lane 6: "Tpa N2 + N23 + N47 + N69 + N92" indicates the glycosylated leptin protein at five sites as described above, expressed using the natural human tPA signal peptide (see Example 14 for sequence information). As can be seen, the molecular weight increases with the increase of the glycosylation sites (compare band 1 with band 6). This indicates that the sites are adding carbohydrate and that up to five chains can be added to leptin simultaneously.

Amino acids / N-terminal peptides Table 15.14 presents a comparison of the different N-terminal amino acids of the glycosylated leptin protein of interest, incident to the use of the various substituted enzymatic cleavage sites, for various signal peptides.

Table 15.14 As can be seen, the most highly glycosylated leptins that have the highest correct N-terminal amino acid yield were produced using the tPA signal peptide (SNS). Leptin (SNS) was also highly glycosylated, and produced a leptin having an N-terminal amino acid of serine (for example, serine in position -1 of SEQ ID NO: 1 in a glycosylated leptin with an amino acid sequence). modified from SEQ ID NO: l).

REFERENCE EXAMPLES The following reference examples provide the methods that were used in the above Working Examples.

Preparation of DNAs, Vectors and Host Cells 1. Construction of the Human Leptin Expression Vector (1-146). These methods result in an expression vector for rHu-Leptin 1-146 (SEQ ID NO: 1) in mammalian cells. DNA encoding rHu-Leptin 1-146, including its signal peptide, was also used as a template to prepare glycosylated leptin proteins of the present invention.

A DNA encoding amino acids 1-146 of rHu-Leptin plus a signal sequence as in Zhang et al., Nature 372: 425-432 (1994) to 430, Figure 6b, incorporated by reference herein in its entirety , was cloned from the cDNA of human adipocytes by the polymerase chain reaction (PCR). The cloned signal sequence encoded for the following amino acid sequence: M H W G T L C G F L W L W P Y L F Y V Q A Primers. The 5 'flanking primer (forward) encoded the amino terminus of the rHu-Leptin signal peptide, a Xbal restriction enzyme site and an optimized Kozak sequence (TCT ATC TAG ACC ACC ATG CAT TGG GGA ACC CTG T). The 3 'flanking primer sequence (inverse) (GAG AGT CGA CTA TCA GCA CCC AGG GCT GA) contained the carboxyl-terminus complement of rHu-Leptin (1-146) and the termination codons, as well as a Sali restriction site.

Preparation of the Vector. The PCR amplification product was digested with the Xbal and Sali restriction enzymes, electrophoresed on an agarose gel, then isolated from the gene using the Promega® Wizard® method (Promega® Corporation, Madison, Wl) . The purified product was ligated to the expression vector pDSR 2 cut with Xbal and Sali, slightly modified from that described in WO90 / 14363 1990, for example in Figure 12, incorporated by reference herein in its entirety. The pDSRa2 used in the present maintained the same functional elements, but was slightly modified from that described in WO90 / 14363. The sequence in the HindIII site was modified to AAGCTTCTAGA to generate an Xbal site, and the sequence of the Ncol site was modified to GTCGACCTAGG to generate a SalI site, with sufficient DNA sequence ("AD" filler ") between the two sites, to allow efficient cutting by Xbal and Salí to produce the cut plasmid for the directional cloning of the present leptin protein expression construct. The resulting pDSRa2 / leptin plasmid was used for expression in mammalian cells, as described below, and as a template for site-directed mutagenesis, in vi tro. 2. Construction of the Glucosylation Sites in Leptin by site-directed mutagenesis. The glycosylation sites were introduced into rHu-Leptin 1-146 (SEQ ID? O. 1, mentioned above) by site-directed mutagenesis using the overlap extension PCR methods similar to those described by Ho et al., Gene Vol. 77, pp. 51-59 (1989). Plasmid pDSRa2 / leptin, prepared as described above, was used as a PCR template for the initial steps of site-directed mutagenesis.

PCR The PCR procedures were carried out in two successive steps. Step 1: Two reactions (PCR1 and PCR2) were performed on the 7? DN leptin template using a total of four oligonucleotides: the flanking rHu-leptin primer 5 / (forward), a reverse mutagenic primer, a forward mutagenic primer (complementary at least in part to the reverse mutagenic primer) and the 3 'flanking rHu-leptin primer (inverse). The mutagenic primers contained the desired nucleotide changes as well as 6-20 nucleotides that exactly fit the template on each side of the changes. PCR1 used the 5 'flanking primer (forward) and the reverse mutagenic primer. PCR2 used the 3 'flanking primer (reverse) and the forward mutagenic primer. The DNA products of PCR1 and PCR2 contained overlapping sequences on and on both sides of the mutations. The amplified DNA fragments were separated by agarose gel electrophoresis. Small pieces of DNA fragments containing agarose of the correct size were excised from the gel.

Step 2: The DNA fragments from PCRl and PCR2 were combined together and a third PCR reaction was performed using only the 3 'and 5' forward flanking primers. Annealing of the 3'-complementary regions of the appropriate strands of the PCR1 and PCR2 products and the subsequent elongation of the strand resulted in the formation of full-length leptin DNA fragments. In this way, a full-length DNA segment containing the desired mutations was amplified.

PCR for expression in COS and CHO cells. For expression in the human embryonic kidney cell line (such as that commercially available from the American Type Culture Collection), sequences containing the 5 'primer (forward) that introduced a stop codon, a KpnI site and a Kozak sequence (ACCACC) in front of the coding region of the leptin signal peptide (5 '-TCTGGTACCTAGACCACCATGCATTGGGGAACCCTGT-3'). The 3 '(reverse) primer (5' -GAAGCGGCCGCCTATCAGCACCCAGGGCTGA-3 ') contained the sequences that introduced two stop codons (TGA TAG) and a NotI restriction site at the end of the glycosylated leptin protein coding region. For expression in COS and CHO cells, the 3 'primer (reverse) contained the sequences that introduced a stop codon followed by a SalI restriction site (GAGAGTCGACTATCAGCACCCAGGGCTGA). The 5 'forward reaction primer (TCTATCTAGACCACCATGCATTGGGGAACCCTGT) had an Xbal restriction site followed by a Kozak sequence upstream of the starter codon of leptin (ATG).

PCR methods. The polymerase chain reactions were performed using either of two procedures interchangeably. In one method, used in some of the constructs for expression 293, the PCR reactions were performed using a protocol adapted from Cheng et al., PNAS _91: 5695 (1994) (incorporated by reference herein in its entirety): 4 μl of each of the forward and reverse primers (5 μm / μl), 1 μl of template (50 ng), 10 μl of 5X LP buffer (100 mM tricine, pH 8. 7/25% glycerol / KOAc 425 mM), 2 μl of dNTP pool (1 mM each of dATP, dTTP, dCTP, dGTP), 0.8 μl rtTh polymerase (Perkin Elmer®, 2.5 U / μl), and 2 μl of Vent polymerase (NEB, 0.01 U / μl after a fresh dilution 1: 100 in buffer IX LP). Water was added to bring the final volume up to 50 μl. All components were aggregated together in the order shown, and PCR was initiated when the temperature during the first cycle was above 60 ° C, by the addition of 1 μl of 10 mM MgOAc. The reaction conditions were: 2 cycles of 94 ° C, 10 seconds / 45 ° C, 1 minute / 68 ° C, 5 minutes followed by 25 cycles of 94 ° C, 10 seconds / 55 ° C, 1 minute / 68 ° C, 5 minutes. The amplified fragments were separated by agarose gel electrophoresis and the DNA fragment of correct size was purified using a "Geneclean" kit and the procedures supplied by the supplier (Bio 101, Inc.) incorporated by reference herein. The purified DNA was directed with Notl and Kpnl, then it was purified again using the Geneclean equipment. "The digestion conditions were 20 Units of Kpnl in" M "buffer (22 μl final volume) (Boehringer Mannheim) followed by the addition of 3 ul of buffer "H", 20 units of Notl in 52 μl of final volume The fragment was then ligated into the plasmid pBCB cutter with Kpnl and Notl The plasmid pBCB was derived from Prc / cmv (INVITROGEN®, Carlsbad, California ) by deletion of the pRC / CMV region comprising the origin fl, the SV40 origin, the neomycin resistance gene and the SV40 polyadenylation site, the ligated DNA was precipitated with 2 volumes of ethanol in 0.3 M sodium acetate , pH 5.2, in the presence of carrier tRNA and transformed into E. coli The DNAs of the glycosylated leptin protein were selected by colonial PCR to identify the clones that contained the DNA insert of the correct size and type. in this procedure, the cells containing the plasmids were placed inside PCR tubes in the presence of the forward and reverse leptin primers. The mixture was then subjected to PCR using the reaction conditions described above. The plasmids from the positive clones were then prepared and the glycosylated leptin protein insert was sequenced to confirm the presence of the desired glycosylation sites and to ensure that no additional amino acid changes were introduced. A slightly different PCR strategy was used in the rest of the constructions. PCR was performed using the taq DNA polymerase (Boehringer Mannheim) or preferably, the Pfu DNA polymerase test reading (Stratagene), which, contrary to the polymerase Taq does not tend to add a non-template, extra nucleotide at the 3 'end of the extended strands. In the Taq polymerase PCRs the DNA template was combined with 2.5 μl of 10X Taq PCR buffer, 2.5 μl of 1 mM dNTPs, 5 pmol of each primer and water in a final volume of 25 μl. 0.5 units of the Taq polymerase were added after the PCR mixture reached 94 ° C. The PCR reactions were carried out for 25 cycles at 94 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds. In the Pfu polymerase PCRs, the 7? DN template was combined with 5 μl of lOxPfu buffer (Stratagene), 5 μl of 1 mM dNTPs, 10 pmol of each primer, and water in a final volume of 50 μl and added 1.2 U of Pfu polymerase. Four PCR cycles were performed with an annealing temperature of 48 ° C, followed by 20 cycles with an annealing temperature of 66 ° C. In each cycle the denaturation was performed for 30 seconds at 94 ° C, the annealing was performed for 30 seconds, and the elongation was at 74 ° C for 30 seconds. After the two PCR reactions of the first step described previously, the product bands of the correct sizes were excised from an agarose gel after electrophoresis and the gel slices containing the PCRl and PCR2 products were either directly added. to a PCR tube for the second PCR step, or first combined in a tube with 300 μl of water and heated to a boil to melt the agarose before adding to the PCR tube. The PCRs were performed with the Taq or Pfu polymerase as described at the beginning, using the forward and reverse flanking primers. After the final PCR cycle, the tubes were allowed to incubate for an additional 5 minutes at the elongation temperature. The resulting PCR products for each analog were cleaned using Promega® Wizard® PCR cleaning equipment. The purified DNA was digested in a restriction digestion of 50 μl with the restriction enzymes Xbal and Salí (Boehringer Mannheim) at 37 ° C for 1 hour. The digestions were cleaned with Promega® Wizard® cleaning equipment. The digested fragment was then ligated into the vector pDSRa2 digested with Xbal and Salí. An aliquot of 1 μl of the ligation reaction, which contained the leptin analogue plasmid pDSRa2, was used to transform the DH10B cells by electroporation. A single colony for each analogue was grown overnight in a liquid culture and the plasmid was isolated using the Qiagen® MaxiDNA® plasmid isolate. The DNA for each human leptin analog of pDSRa2 was resuspended in water and sequenced to ensure the correct sequence was present.

Multiple glycosylation site. Two or more mutations at the glycosylation site were combined by introducing a new substitution within the DNA containing a change, using the same PCR process. To construct the leptin analogue genes from the double glycosylation site, the single-site glycosylated leptin plasmids (produced as described above) were used as PCR templates, and an additional glycosylation site was introduced by site-directed mutagenesis. with the appropriate primers. Similarly, the plasmids encoding the leptin analogs with three glycosylation sites were constructed using the double-site N-glycosylation leptin DNAs as a template, and the process could be iterated for the introduction of additional glycosylation sites. Alternatively, new combinations of mutations in the glycosylation site can be produced by using two different DNA templates, which contain different glycosylation sites, in PCRl and PCR2. For example, a DNA encoding an analog with glycosylation sites at positions 2, 47, 69 and 102 could be introduced by the mutagenic primer pair for glycosylation at position 47, by using a DNA template with a glycosylation site at position 2 in PCRl, and a DNA with glycosylation sites at positions 69 and 102 in PCR2. These general procedures were used to construct plasmids for the expression of the glycosylated leptin proteins shown in the previous Examples. Changes in the DNA sequence for each of the forms are shown.

Chimeric signal peptides. Constructs for expression of leptin or a leptin analog with a signal peptide not leptin, were prepared by the methods of PCR with overlapping extension for gene splicing (Horton et al, Gene. 77: 61-68 (1989) ) similar to those used for site-directed mutagenesis. In a preliminary step, a DNA encoding the signal peptide of the exogenous gene, for example the tissue plasminogen activator (TPA), was obtained by cloning methods or by a combination of chemical and enzymatic synthesis of genes. This DNA was used as a template in a PCR to generate a DNA fragment encoding the exogenous signal peptide preceded by a consensus Kozak sequence, and immediately followed by the first part of the mature rHu-leptin coding region ( or leptin analog). The primers used in this PCR reaction were a 5 'flanking primer (forward) for the exogenous gene, and an inverse primer whose 5 'portion (10-25 nucleotides) was complementary to the sequence encoding the amino-terminal portion of mature leptin (or leptin analog). A second PCR reaction was performed with the leptin or leptin analogue DNA as a template, using the 3 'flanking primer (inverse) of leptin, and a forward primer coding for the signal peptide binding region exogenous and the mature leptin sequence (or leptin analogue). The forward primer in this reaction was designed to overlap the DNA generated by the first PCR, usually at a length of 15-35 nucleotides. The products of the two PCR reactions were purified as described above, mixed, and then annealed and amplified in a PCR alone with the 5 'flanking primer (forward) of the exogenous gene, and the 3' flanking leptin primer (inverse) ).

Host cells 1. Expression of glycosylated leptin proteins in 293 cells. The DNA was transfected into the "293" human embryonic kidney cell line (such as that commercially available from the American Type Culture Collection) using the lipofectamine method. The S293 cell were developed to 40-70% confluence in tissue culture (P100) in 293 medium (DMEM (Difco®) / 20mM / lX Pen-Strep-Glutamine / 20% FBS HEPES). 20 μg of the plasmid DNA encoding the glycosylated leptin protein in 1 ml of DMEM was sterilized by filtration with a 0.45 μm Acrodisc® membrane (Gelman Sciences). 100 μl of lipofectamine (Gibco® / BRL®) were added and the DNA-lipofectamine mixture was incubated for 20 minutes at room temperature. The medium was removed from the plates containing the 293 cells and 4 ml of DMEM and the DNA / lipofectamine solution were added. After 4-6 hours at 37 ° C, 5 ml of DMEM was added with 20% fetal bovine serum and the cultures were incubated overnight. The next day the cells were rinsed with medium 293 and 5 ml of fresh 293 medium was added. The conditioned medium was collected after 3 days, aliquots were taken and stored at -70 ° C. 2. Expression of glycosylated leptin proteins in COS cells. The cDNA clones of the glycosylated leptin proteins were transferred to COS-1 cells (ATCC No. CRL-1650) by electroporation. COS-1 cells were harvested from semi-confluent boxes, washed with medium (DMEM containing 10% fetal bovine serum and 1% L-glutamine / penicillin / streptomycin (Irvine Scientific)) and resuspended at 6 x 10 6 cells / ml. Half ml of cells were transferred to a 0.2 cm electroporation cuvette (BioRad®) and subjected to electroporesis with a BTX Electroporation System Electrocell 600® Manipulator at 650 μf and 130 volts in the low voltage setting with 25 μg of the plasmid DNA which codes for the glycosylated leptin protein. The cells subjected to electroporesis were placed in a 100 mm tissue culture box in 7 ml of the medium. The conditioned medium was collected 3 days after electroporation, filtered using an Acrodisc® membrane (Gelman Sciences) and stored at minus 80 ° C. 3. Expression of glycosylated leptin protein in CHO cells. The stable expression of rHu-leptin 1-146 or the glycosylated leptin protein was performed by transforming Chinese CHO hamster ovary cells deficient in dihydrofolate reductase (DHFR ") with pDSRa2 with the glycosylated leptin protein DNA, selected , as described above, followed by isolation and testing of the individual clones.A 60 mm tissue culture box was seeded with 1 x 10 6 CHO DHFR cells "grown in CHO D medium" (glucose with high DMEM, % fetal bovine serum, 1% penicillin / streptomycin / glutamine, 1% non-essential amino acids (Gibco®) and 1% HT supplement (Gibco®) the day before transfection A DNA precipitate of 10 μg It was then formed and added to the plates drop by drop following the instructions of the Mammalian Cell Transfection Kit (Specialty Media, incorporated by reference herein.) After 24 hours in a tissue culture incubator, the medium was replaced with CHO D- fresh medium. Twenty-four hours later the cells were divided into six 100-mm culture dishes with CHO selective medium (D-MEM with high glucose content, 10% dialyzed fetal bovine serum, 1% penicillin / streptomycin / glutamine, 1% amino acids non-essential (Gibco®)). The medium was changed weekly until the colonies appeared. After 10-14 days the colonies were harvested using 5 mm cloning discs (Labcore®) soaked in IX of tripina-EDTA (Life Technologies®) and cultured in 24-well tissue culture plates with selective CHO medium. After 1-2 weeks the expression of the glycosylated leptin protein was determined using an EIA leptin assay described above. The best expression clones (for example, those that showed the most intense response using EIA) were expanded and frozen in the cryogenic storage. In some circumstances a faster protocol was used to use the analogs in the CHO cells. In this case, the electroporation was used to transfect the cells and the individual clones were not isolated. The electroporation experiments used 200 μg of pDSRa2 with the glycosylated leptin protein insert as described above, and 200 μg of the herring sperm DNA. The DNAs were extracted with phenol-chloroform and precipitated with ethanol, then resuspended in 800 μl of IX HEBS together with 2 X 107 cells of Chinese hamster ovary (CHO) DHFR "developed in the CHO D medium". Cells and DNA were incubated at room temperature for 10 minutes. Electroporation was carried out at 290 volts, and 960 ufarads using a Gene Pulser "from BIO RAD, in 0.4 cm electroporation cuvettes. The cells were then incubated for 10 minutes at room temperature, washed with 10 ml of CHO D medium -, centrifuged for 10 minutes at 1000 rpm in a Damon®IEC IEC Division HN-SII Centrifuge, then resuspended in CHO D- medium and added to two 10-centimeter boxes.The cells were developed for 10 days at 37 ° C, then divided 1: 4 within the CHO selection medium and developed to a confluence of approximately 70% The cells were then divided at 1: 2 in the selection medium plus 6 nM methotrexate, and developed at 37 ° C until the clones were visible (approximately 2 weeks), were generated in combination from the plates containing at least 4 hills and were developed in 6 nM methotrexate selection media until confluence (approximately 1 week). then frozen in cryogenic storage.

Expression and purification of Leptin N48 T50 (leptin protein with a single glycosylation site) The CHO cells were transformed with the DNA expressing N48 T50 leptin, as described above. The cells were expanded in a rotary culture in growth medium (DEMEM / F12 (1: 1), 365 mg / liter of L-glutamine, IX MEM of non-essential amino acids, 5% of FBS). Revolving bottles that were fitted with caps that allowed respiration, were then inoculated with 2 X 107 cells / bottle in 400 ml of growth medium and gasified for 10 seconds with 10% C02 in air. After 5 days, the bottles were changed to serum free production medium (400 ml / bottle, DMEM / F12 (1: 1), 365 mg / liter (IX) of L-glutamine, lx MEM of non-essential amino acids, 10 μM copper sulfate and 1.5 g / 1 additional glucose). The serum free conditioned medium from these three successive harvests was collected (180 liters) and filtered through a 0.45 μm filter, concentrated at approximately 1/30, and diafiltered in 1 mM CHAPS, 10 mM Tris, pH 7.5, using a tangential flow ultrafiltration system (Amicon®) with a molecular weight cut-off membrane of ,000. The diafiltered medium was stored at -20 ° C.

The following steps were performed from 2 to 8 ° C. The DFM was applied to a Q-Sepharose Rapid Flow column (Pharmacia®, 8 cm x 14 cm) equilibrated in 10 mM Tris, pH 7.9. and washed with approximately 2 column volumes of 10 mM Tris to elute all unbound species. Leptin N48 T50, which remains bound to the column, was then eluted with a gradient of 12 column volumes from 10 mM Tris, pH 7.9, to 200 mM sodium chloride, 10 mM Tris, pH 7.9, collected in fractions. Fractions containing fully glycosylated N48 T50 leptin, as determined by Western blot analysis, were combined and then diluted with a volume of water to reduce the concentration of sodium chloride. The mixture was then applied to a BioGel® HT column (Bio-Rad®, 10 cm x 7 cm) equilibrated in 10 mM Tris, pH 7.9 then washed with approximately four column volumes of 10 mM Tris, pH 7.9. The fractions of the unbound species were collected and those containing the N48 T50 leptin, as determined by Western blot analysis were combined. A volume of one third of 3 M ammonium sulfate, 10 mM Tris, pH 7.9, was added to the N48 T50 leptin pool from the Bio-Gel® HT column. The mixture, now in 1 M ammonium sulfate, was applied to a Source 15PHE column (Pharmacia®, 10 cm x 1.6 cm) equilibrated in 1 M ammonium sulfate, 10 mM Tris, pH 7.9, then washed with approximately two volumes of 1 M ammonium sulfate column, 10 mM tris, pH 7.9. F3, which remains bound to the column, was then eluted with a gradient of 40 column volumes from 1 M ammonium sulfate, 10 mM Tris, pH 7.9 to 10 mM Tris, pH 7.9 and was collected in fractions. The fractions containing F3, as determined by the SDS-PAGE analysis were combined. Solid ammonium sulfate was added to the N48 T50 leptin pool from the Source 15 PHE column to a final concentration of approximately 2.5 M, and incubated overnight. The overnight precipitate was harvested by centrifugation. The precipitate of harvested ammonium sulfate was re-solubilized in water, titrated to pH 4.5 with acetic acid, applied to a Source 15S column (Pharmacia®, 5.5 cm x 1.6 cm) equilibrated in 10 mM NaCH2COOH, pH 4.5, then washed with approximately two column volumes of 10 mM NaCH 2 COOH, pH 4.5. The N48 t50 leptin remaining bound to the column was then eluted with a gradient of 72 column volumes from 50 mM sodium chloride, 10 mM NaCH 2 COOH, pH 4.5 to 150 mM sodium chloride, 10 mM NaCH 2 COOH, pH 4.5, collected in fractions Fractions containing N48 T50 leptin, as determined by SDS-PAGE analysis, were combined and titrated to pH 7.5. The combined N48 T50 leptin from the Source 15S column was combined to approximately 1 mg / ml, diafiltered in Dulbeco PBS (Gibco®), then concentrated to approximately 5 mg / ml using a stirred cell ultrafiltration system (Amicon® ) with a molecular weight cut-off membrane of 10,000 (filtron®). Leptin N48 T50 was further concentrated to 10 mg / ml using centrifugal ultrafiltration (Centricon 10, Amicon®). Concentrated N48 T50 leptin was filtered (0.22 μm) and stored at 2 to 8 ° C.

II. Analytical methods The following analytical methods were used herein to characterize the present glycosylated leptin proteins.

A. Viral Trials 1. Receptor Link Test. In this assay, the membrane-bound leptin receptor was used as an objective to measure the amount of binding by the radioactively labeled glycosylated test leptins.

Chinese hamster's ovary cells ("CHO") were genetically engineered to stably express a human leptin receptor, transfecting them with the human leptin receptor DNA (short form); Tartaglia et al., Cell 83_: 1271 et seq. (1995) incorporated by reference herein in its entirety; the full article is incorporated by reference herein). Cells that express the leptin receptor were developed and harvested by low speed centrifugation. The concentrated cells (approximately 50 mg wet weight) were resuspended in 0.32 M sucrose / 25 mM HEPES, and homogenized in glass homogenization tubes using a Glas-col® motor. The cell membranes were washed twice by centrifugation (48,000 xg), dispersion using a polytron homogenizer (Tissue Tearor®), and resuspension in cold binding buffer (MEM, Gibco BRL® / 25 mM HEPES, Gibco BRL® / 0.1% BSA / 0.5 mg / ml Bacitracin ® (sigma®) /O.l mg / ml of ST1, Boehringer Mannheim / O.l mg / ml of AEBSF, Boehringer Mannheim). After the second wash, the membrane preparation was resuspended at a final concentration of 2-3 mg wet weight / ml in cold binding buffer. The competition link was made by incubating 400 μl of membrane solution, 50 μl of 125 nl-2 leptin (Amersham) and a sample of 50 μl or standard leptin (10-6 M rHu-leptin 1-146) 2 to 3 hours at room temperature in 12 mm x 75 mm tubes. Bound 125I-leptin was separated from unbound 125I-leptin by filtration through glass fiber filters and 3 washes with cold PBS using a Brandel cell harvester. The bound radioactivity was determined with a gamma counter. The affinity of each analogue for the leptin receptor was determined by calculating the intermediate point of the cold displacement curve (ICS0) for each analog. 2. Biological activity in vi tro. In this assay, in vitro biological activity was determined using a chimeric leptin receptor, which has an extracellular domain of a leptin receptor, a transmembrane domain and an intracellular domain of an erythropoietin receptor. After activation of the extracellular erythropoietin receptor domain by binding to the extracellular leptin domain, the cells showed a biological proliferation activity, as measured by H3-thymidine uptake. The 32D murine myeloid progenitor cells (clone 3) dependent on interleukin 3 (IL-3) (Greenberger et al., PNAS-USA EK): 2931 (1983) incorporated by reference herein) were grown in RPMl 1640 medium (Gibco ®) supplemented with 10% fetal bovine serum in 10 ng / ml of IL-3 (Biosource®). An EPO chimeric receptor-leptin receptor (OBR-EPOR) was constructed by standard techniques and subcloned into an expression vector containing the Moloney murine sarcoma virus transcriptional promoter, resulting in the OBR-EPOR / pLJ vector . The chimeric receptor contained the coding regions for the extracellular domain of a human leptin receptor (amino acids 1-839; Tartaglia et al., Cell: 83_: 1271 (1996) (incorporated by reference herein in its entirety) and the transmembrane and intracellular domains of the murine erythropoietin receptor (amino acids 250-507; D'Andrea et al., 5_7: 277 (1989) incorporated by reference herein in its entirety.

The chimeric receptor was then transfected into 32D cells by electroporation. The transfected cells were initially selected on G418 (750 μg / ml). The cells that respond to leptin were then selected in RPMl 1640 (Gibco®) supplemented with 10% fetal bovine serum and 25 ng / ml Hu-Leptin, resulting in 32D-OBEC cells. The 32 D cells that were not then transfected with the chimeric receptor remained unresponsive to leptin.

The 32D-OBECA cells were developed in 1640 RPMl medium (liquid lx, without L-glutamine, Gibco®) containing 10% fetal bovine serum (Hyclone Laboratories®) and 1.0 ng / ml. of recombinant murine IL-3 (Biosource®) at a density of approximately 5.0 x 10 cells / ml The cells were harvested by centrifugation (approximately 270 x G), washed twice in sterile PBS IX (Gibco®) and then resuspended at 1 x 10 5 cells / ml in a medium consisting of 20% DMEM medium (DMEM + 10% FBS) plus 80% assay medium (RPMl + 2% FBS) plus 10 ng / ml anti-TGFβ neutralizing antibody pan-specific. A standard curve of extended twelve-point rmetHu-leptin 1-146 was prepared using the test medium at a range of about 0.1 to 200 ng / ml. The test samples were diluted in the assay medium and typically run as extended multiple point curves, or at intervals that fall within the linear range of the standard curve. A volume of 100 μl of each sample was added to the appropriate wells of 96-well microtiter tissue culture plates. The cells with sample or standard were developed at 10,000 cells per well (in 100 μl) for approximately 48 hours at 5 + _% C02 and 37 + 2 ° C in a high moisture content incubator. 3H-thymidine (0.5 μCi per well, Dupont®) was then added and the plates were incubated for an additional 18 hours and their DNA was harvested on preprinted glass fiber filter meshes (Pharmacia®) using a cell harvester (Tomtek 96 Mach II®). The filters were dried in a microwave oven, bagged in LBK® sample bags plus 10 ml of scintillation fluid (LKB®), then counted in a Betaplate® scintillation counter (LKB®). The cellular response (in the form of average CPMs) was plotted versus the mass (ng / well) of a standard rHu-leptin 1-146. The bioactivity of a sample of rmetHu- leptin or glycosylated leptin was determined from the regression analysis of the standard curve. The specific activity was calculated by dividing the biological activity tested (ng / ml) between the concentration, as determined by leptin ELISA.

B. Characterization of glycosylated leptin proteins 1. Enzyme immunoassay ("EIA") Polyclonal antibodies. Anti-rmetHu-leptin 1-.146 polyclonal antibodies (SEQ ID NO.1 with a methionyl residue in position -1) were produced in New Zealand white rabbits by repeated subcutaneous injections of rmetHu- Ipetin 1-146 conjugated to hemocyanin of keyhole shaped limpet (KLH), and mixed with the adjuvant Titermax "*, or with complete Freund's adjuvant (primary injection) and complete Freund's adjuvant (subsequent injections) .The resulting rabbit sera were tested for the reactivity with rmetHu-leptin 1-146, and the sera from those rabbits with the highest titer were combined and purified by affinity on Actigel-ALD Superflow® (Sterogene # 2701-S-01) coupled to rmetHu-leptin. of the purified polyclonal antibody was coupled to horseradish peroxidase (HRP, Sigma® P-8415) to be used as a detection antibody in the sandwich enzyme (EIA) or Western blot assay.

Monoclonal antibodies. Anti-rmetHu-leptin 1-146 monoclonal antibodies were developed from Lou rats that were injected multiple times with rmetHu-leptin 1-146 conjugated to KLH, mixed with complete Freund's adjuvant (primary injection) and incomplete Freund's adjuvant (Subsequent injections). Rat sera were tested for reactivity with rmetHu-leptin 1-146, and spleen cells from these with the highest titers were fused to the rat myeloma line Y3ag 1.2.3. by standard hybridoma techniques. The hybrid cells were plated in 96-well plates, allowed to form colonies, evaluated for anti-rmetHu-leptin 1-146 activity, and cloned into single cells. The monoclonal antibody from a rat hybridoma was used as a component of the EIA of the leptin sandwich.

Sandwich Test. Microtiter plates (standard 96 wells [Immulon®] or half well (Costar®)) were coated with 75 μl or 30 μl, respectively, either polyclonal antibody (1.5 μg / ml or monoclonal (2.0 μg / ml) in carbonate / bicarbonate buffer (NaHC03 0.029M, Na2C03 0.015M, pH 9.6).

Plaques were blocked (1% bovine serum albumin [BSA], 55 sucrose) and the samples, diluted appropriately in 25 BSA in phosphate buffered saline (PBS) were added, in duplicate to the wells. To each microtiter plate was also added, in triplicate, a set of rmetHu-leptin standards, or glycosylated leptin standards, covering the range of 90 to 4580 pg / ml. Plates were incubated at 4 ° C for 18 hours, aspirated and washed three times with wash buffer (50 mM Tris, 0.15M NaCl, 10 mM EDTA, 0.05% Tween® 20, pH 7.35 [TEN]) and the anti-rmetHu-leptin 1-146 antibody, incubated at HRP approximately 70 ng / ml in 2% BSA in PBS with 0.05% Tween® 20. The plates were incubated at room temperature for 3 hours, washed five times with TEN and developed in color with the TMB substrate (tetramethylbenzidine) according to the manufacturer's instructions (Kirkegaard and Perry # 50-76-00, Gaithersburg, MD 20879). Absorbance was measured at 450 nm in a microplate reader. Leptin concentrations were calculated from a standard curve constructed for each plate, after subtraction of the antecedent color. The sensitivity of the assay was approximately 90 pg / ml; the inter- and intra-assay variations, calculated from the controls included on each microplate, were 7.5% and 5.4%, respectively. 2. Carbohydrate Analysis by Staining or Western Transfer. In general, the greater the molecular weight of a glycosylated leptin protein of the present invention, the more strongly it is glycosylated. Thus, the present stained or Western blot type analysis was used to determine the amount of carbohydrate present on the glycosylated leptin proteins, expressed. A volume of supernatant containing approximately 400-600 pg of glycosylated leptin protein from COS or CHO cells transfected with the glycosylated leptin protein cDNAs, as described above, was mixed with the SDS-PAGE 3X sample buffer (0.1875 M Tris-HCl, pH 6.8, 6% SDS, 30% glycerol, 15% 2-mercaptoethanol). The samples were analyzed by SDS-polyacrylamide gel electrophoresis of Tris-Glycine with 14% acrylamide (Novex®) and transferred to a 0.45 μm nitrocellulose membrane (Novex®). The nitrocellulose membrane was rinsed, blocked with TBST (20 mM Tris, 137 mM NaCl, Tween®, 20 0.08%) containing 10% FBS and 2% BSA and incubated with the polyclonal antibody anit-rmetHu-leptin 1 146, conjugated to HRP, as prepared above (140 ng / ml, in TBST containing 5% FBS and 1% BSA) for 3 to 5 hours. After washing with TBST, five times, five minutes each, the membrane was developed with the ECL reagent (Amersham®), according to the manufacturer's instructions. The membrane was exposed to the X-Omat® AR film (Kodak®) for ten to sixty seconds, and developed for the standard X-ray film. The specific protein bands were visualized, and the sizes estimated from their positions relative to the molecular weight markers. The larger the size, the greater the proportion of carbohydrate connected to the protein.

Treatment with N-glucanase. Treatment with N-glucanase removes the N-ligand carbohydrate resulting in an increase in mobility, which is equal to that of non-glycosylated leptin. The treatment of the glycosylated leptin proteins with N-glucanase resulted in a molecular weight similar to non-glycosylated leptin. This confirms that the increased size of the glycosylated leptin protein is due to the N-linked carbohydrate.

Methods The conditioned COS cell medium containing 400 pg of glycosylated leptin protein (1-3 μl) was mixed with 10 μl of 0.5% SDS and each sample was heated to boiling for 3 minutes. Then 10.5 μl of a 0.5 M sodium phosphate mixture, pH 8.6 + 7.5% nonidet P40 was added with 3 μl of 250 units / ml N-glucanase (Genzyme®). Each sample was incubated overnight at 37 ° C and the reaction stopped by the addition of SDS-PAGE sample buffer and subjected to Western analysis of SDS-PAGE as described above. These results indicate that the reduced mobility on SDS-PAGE observed is due to the addition of N-linked carbohydrate. The fact that numerous glycosylated leptin proteins were identified indicates that there are multiple positions in leptin that can support the addition of N-linked carbohydrate. Similar results were obtained when the analogues were expressed in 293 cells. Similarly, when leptin proteins with multiple glycosylation sites were treated with N-glucanase, their mobility also changed to that of non-glycosylated leptin, indicating that differences in mobility they are due to the presence of N-linked carbohydrate. While the invention has been described in what are considered the preferred embodiments, it is not limited to the described embodiments, but on the contrary, is intended to cover various equivalent modifications included within the spirit and scope of the appended claims, Scope has to be agreed to the broadest interpretation to cover all such modifications and equivalents.

LIST OF SEQUENCES < 110 > AMGEN INC. < 120 > COMPOSITIONS OF GLUCOSYLED LEPTINE AND RELATED METHODS < 130 > A-549 < 140 > 09 / 249,675 < 141 > 1999-02-12 < 160 > 36 < 170 > Patentln Ver. 2.1 < 210 > 1 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence; rHu leptin 1 to 146 < 400 > 1 Val Pro lie Gln Lys Val Gln Asp Asp Thr Lys Thr Leu lie Lys Thr 1 5 10 15 lie Val Thr Arg lie Asn Asp lie Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe lie Pro Gly Leu His Pro lie 35 40 45 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Pro Ser Arg Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Phe Ser Lys Ser Cys 85 90 95 His Leu Pro Trp Wing Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120 125 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 130 135 140 Gly Cy & 145 < 210 > 2 < 211 > 145 < 212 > PRT < 213 > Artificial sequence < 220 > < 223 > Description of Artificial Sequence: rhu leptin 1 145 < 400 > 2 Val Pro He Gln Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Ser Val Ser Ser Lys 20 25 30 Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He Leu 35 40 45 Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln He Leu 50 55 60 Thr Ser Met Pro Ser Arg Asn Val He Gln He Ser As Asp Leu Glu 65 70 75 80 Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His 85 90 95 Leu Pro Trp Wing Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val 100 105 110 Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu 115 120 125 Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly 130 135 140 Cys 145 < 210 > 3 < 211 > 21 < 212 > PRT < 213 > Homo sapiens < 400 > 3 Met His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr Val Gln Wing 20 < 210 > 4 < 211 > 22 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: modified human lepsignal peptide < 400 > 4 Mee His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr Val Ser Pro Ser 20 < 210 > 5 < 211 > - 21 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: modified human lepsignal peptide < 400 > 5 Met His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr Val Ser Pro 20 < 210 > 6 < 211 > 22 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: modified human lepsignal peptide < 400 > 6 Met His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr Val Ser Pro Wing 20 < 210 > 7 < 211 > 22 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: modified human lepsignal peptide < 400 > 7 Met His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr Val Ser Asn Ser 20 < 210 > 8 < 211 > 23 < 212 > PRT < 213 > Homo sapiens < 400 > 8 Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15 Ala Val Phe Val Ser Pro Ser 20 < 210 > 9 < 211 > 22 < 212 > PRT < 213 > Homo sapiens < 400 > 9 Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15 Wing Val Phe Val Ser Pro 20 < 210 > 10 < 211 > 23 < 2 2 > PRT < 213 > Artificial Sequence < 220 > ,, < 223 > Description of Artificial Sequence: modified tPA signal peptide < 400 > 10 Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15 Wing Val Phe Val Ser Asn Ser 20 < 210 > 11 < 211 > 23 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: modified tPA signal peptide < 400 > 11 Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15 Wing Val Phe Val Ser Pro Wing 20 < 210 > 12 < 211 > 21 < 212 > PRT 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: signal peptide lep/ tPA < 400 > 12 Met His Trp Gly Thr Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val 1 5 10 15 Phe Val Ser Pro Ser 20 < 210 > 13 < 211 > 20 < 212 > PRT < 213 > Artificial Sequence < 220 > _ < 223 > Description of Artificial Sequence: signal peptide lep/ tPA < 400 > 13 Met His Trp Gly Thr Leu Cys Cys Val Leu Leu Leu Cys Gly Ala Val 1 5 10 15 Phe Val Ser Pro 20 < 210 > 14 < 211 > 63 < 212 > DNA < 213 > Homo sapiens < 400 > 14 atgcattggg gaaccctgtg cggattcttg tggctttggc cctatctttt ctatgtccaa 60 gct 63 < 210 > 15 < 211 > 66 < 212 > DNA < 213 > Artificial Sequence < 220 > , < 223 > Description of Artificial Sequence: Modified human lepsignal peptide DNA < 400 > 15 atgcattggg gaaccctgtg cggattcttg tggctttggc cctatctttt ctatgtttcg 60 cccagc 66 < 210 > 16 < 211 > 63 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Sequence Artificial Description: Modified human lepsignal peptide DNA < 400 > 16 atgcattggg gaaccctgtg cggattcttg tggctttggc cctatctttt ctatgtttcg 60 ccc 63 < 210 > 17 < 211 > 66 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Artificial Sequence Description: Modified human lepsignal peptide DNA < 400 > 17 atgcattggg gaaccctgtg cggattcttg tggctttggc cctatctttt ctatgtttcg 60 cccgct ee < 210 > 18 < 211 > 66 < 212 > DNA < 213 > Artificial Sequence < 220 > ' . -, ~. < 223 > Description of Artificial Sequence: Modified human leptin signal peptide DNA < 400 > 18 atgcattggg gaaccctgtg cggattcttg tggctttggc cctatctttt ctatgtttcg 60 aacagc 66 < 210 > 19 < 211 > 68 < 212 > DNA < 213 > Homo sapiens < 400 > 19 atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60 tcgcccag 68 < 210 > 20 < 211 > 66 < 212 > DNA < 213 > Homo sapiens < 400 > 20 atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60 tcgccc 66 < 210 > 21 < 211 > 69 < 212 > DNA < 213 > Artificial Sequence < 220 > , "_ < 223 > Description of Artificial Sequence: DNA of the modified human tPA signal peptide < 400 > 21 atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60 tcgaacagc 69 < 210 > 22 < 211 > 69 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: DNA of the modified human tPA signal peptide < 400 > 22 atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60 tcgcccgct 69 < 210 > 23 < 211 > 63 < 212 > DNA < 213 > Artificial Sequence < 223 > Description of Artificial Sequence: DNA of the signal peptide leptin / tPA < 400 > 23 atgcattggg gaaccctgtg ctgtgtgctg ctgctgtgtg gagcagtctt cgtttcgccc 60 age 63 < 210 > 24 < 211 > 60 < 12 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: DNA of the signal peptide leptin / tPA < 400 > 24 atgcattggg gaaccctgtg ctgtgtgctg ctgctgtgtg gagcagtctt cgtttcgccc 60 < 210 > 25 < 211 > 438 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Leptin DNA 2, 47, 69 < 400 > 25 gtgaacatca caaaagtcca agatgacacc aaaaccctca tcaagacaat tgtcaccagg 60 atcaatgaca tttcacacac gcagtcagtc tcctccaaac agaaagtcac cggtttggac 120 ttcattcctg ggctccacaa catcacgacc ttatecaaga tggaccagac actggcagtc 180 taccaacaga tcctcaccag tatgaattec acaaacgtga tecaaatate caacgacctg 240 gagaacctcc gggatcttct tcacgtgctg gccttctcta agagctgcca cttgccctgg 300 gccagtggcc tggagacctt ggacagcctg gggggtgtcc tggaagcttc aggctactcc 360 acagaggtgg tggccctgag caggctgcag gggtctctgc aggacatgct gtggcagctg 420 gacctaagcc ctgggtgc 438 < 210 > 26 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: protein leptin 2, 47, 69 < 400 > 26 Val Asn He Thr Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Asn He 35 40 45 Thr Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Asn Ser Thr Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Phe Ser Lys Ser Cys 85 90 95 His Leu Pro Trp Wing Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120 125 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 130 135 140 Gly Cys 145 < 210 > 27 < 211 > 438 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Leptin DNA 2, 47, 69, 92 < 400 > 27 gtgaacatca caaaagtcca agatgacacc aaaaccctca tcaagacaat tgtcaccagg 60 atcaatgaca tttcacacac gcagtcagtc tcctccaaac agaaagtcac cggtttggac 120 ttcattcctg ggctccacaa catcacgacc ttatccaaga tggaccagac actggcagtc 180 taccaacaga tcctcaccag tatgaattcc acaaacgtga tccaaatatc caacgacctg 240 gagaacctcc gggatcttct tcacgtgctg gccaactcta ccagctgcca cttgccctgg 300 gccagtggcc tggagacctt ggacagcctg gggggtgtcc tggaagcttc aggctactcc 360 acagaggtgg tggccctgag caggctgcag gggtctctgc aggacatgct gtggcagctg 420 gacctcagcc ctgggtgc 438 < 210 > 28 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: protein leptin 2, 47, 69, 92 < 400 > 28 Val Asn He Thr Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Asn He 35 40 45 Thr Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Asn Ser Thr Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Asn Ser Thr Ser Cys 85 90 95 His Leu Pro Trp Wing Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120 125 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 130 135 140 Gly Cys 145 < 210 > 29 < 211 > 438 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Leptin DNA 2, 47, 69, 102 < 400 > 29 gtgaacatca caaaagtcca agatgacacc aaaaccctca tcaagacaat tgtcaccagg 60 atcaatgaca tttcacacac gcagtcagtc tcctccaaac agaaagtcac cggtttggac 120 ttcattcctg ggctccacaa catcacgacc ttatccaaga tggaccagac actggcagtc 180 taccaacaga tcctcaccag tatgaattcc acaaacgtga tccaaatatc caacgacctg 240 gagaacctcc gggatcttct tcacgtgctg gccttctcta agagctgcca cttgccctgg 300 gccaatggca cggagacctt ggacagcctg gggggtgtcc tggaagcttc aggctactcc 360 acagaggtgg tggccctgag caggctgcag gggtctctgc aggacatgct gtggcagctg 420 gacctcagcc ctgggtgc 438 < 210 > 30 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: protein leptin 2, 47, 69, 102 < 400 > 30 Val Asn He Thr Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Asn He 35 40 45 Thr Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Asn Ser Thr Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Phe Ser Lys Ser Cys 85 90 95 His Leu Pro Trp Wing Asn Gly Thr Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120 125 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 130 135 140 Gly Cys 145 < 210 > 31 < 211 > 438 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Leptin DNA 47, 69, 102 < 400 > 31 gtgcccatcc aaaaagtcca agatgacacc aaaaccctca tcaagacaat tgtcaccagg 60 atcaatgaca tttcacacac gcagtcagtc tcctccaaac agaaagtcac cggtttggac 120 ttcattcctg ggctccacaa catcacgacc ttatccaaga tggaccagac actggcagtc 180 taccaacaga tcctcaccag tatgaattcc acaaacgtga tccaaatatc caacgacctg 240 gagaacctcc gggatcttct tcacgtgctg gccttctcta agagctgcca cttgccctgg 300 gccaatggca cggagacctt ggacagcctg gggggtgtcc tggaagcttc aggctactcc 360 acagaggtgg tggccctgag caggctgcag gggtctctgc aggacatgct gtggcagctg 420 gacctcagcc ctgggtgc 438 < 210 > 32 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: protexna leptin 47, 69, 102 < 400 > 32 Val Pro He Gln Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Asn He 35 40 45 Thr Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Asn Ser Thr Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Phe Ser Lys Ser Cys 85 90 95 His Leu Pro Trp Wing Asn Gly Thr Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120 125 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 130 135 140 Gly Cys 145 < 210 > 33 < 211 > 438 < 212 > DNA < 213 > Artificial sequence < 220 > < 223 > Description of Artificial Sequence: Leptin DNA 2, 47, 69, 92, 102 < 400 > 33 gtgaacatca caaaagtcca agatgacacc aaaaccctca tcaagacaat tgtcaccagg 60 atcaatgaca tttcacacac gcagtcagtc tcctccaaac agaaagtcac cggtttggac 120 ttcattcctg ggctccacaa catcacgacc ttatccaaga tggaccagac actggcagtc 180 taccaacaga tcctcaccag tatgaattcc acaaacgtga tccaaatatc caacgacctg 240 gagaacctcc gggatcttct tcacgtgctg gccaactcta ccagctgcca cttgccctgg 300 gccaatggca cggagacctt ggacagcctg gggggtgtcc tggaagcttc aggctactcc 360 acagaggtgg tggccctgag caggctgcag gggtctctgc aggacatgct gtggcagctg 420 gacctcagcc ctgggtgc 438 < 210 > 34 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > ,. < 223 > Description of Artificial Sequence: protexna leptin 2, 47, 69, 92, 102 < 400 > 34 Val Asn He Thr Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Asn He 35 40 45 Thr Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Asn Ser Thr Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Asn Ser Thr Ser Cys 21 85 90 95 His Leu Pro Trp Wing Asn Gly Thr Glu Thr Leu Asp Ser Leu Gly Gly 100 105 110 Val Leu Glu Wing Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 115 120 125 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 130 135 140 Gly Cys 145 < 210 > 35 < 211 > 438 < 212 > DNA < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: Leptin DNA 47, 69, 92, 102 < 400 > 35 gtgcccatcc aaaaagtcca agatgacacc aaaaccctca tcaagacaat tgtcaccagg 60 atcaatgaca tttcacacac gcagtcagtc tcctccaaac agaaagtcac cggtttggac 120 ttcattcctg ggctccacaa catcacgacc ttatccaaga tggaccagac actggcagtc 180 taccaacaga tcctcaccag tatgaattcc acaaacgtga tccaaatatc caacgacctg 240 gagaacctcc gggatcttct tcacgtgctg gccaactcta ccagctgcca cttgccctgg 300 gccaatggca cggagacctt ggacagcctg gggggtgtcc tggaagcttc aggctactcc 360 acagaggtgg tggccctgag caggctgcag gggtctctgc aggacatgct gtggcagctg 420 gacctcagcc ctgggtgc 438 < 210 > 36 < 211 > 146 < 212 > PRT < 213 > Artificial Sequence < 220 > < 223 > Description of Artificial Sequence: protexna leptin 47, 69, 92, 102 < 400 > 36 Val Pro He Gln Lys Val Gln Asp Asp Thr Lys Thr Leu He Lys Thr 1 5 10 15 He Val Thr Arg He Asn Asp He Ser His Thr Gln Ser Val Ser Ser 20 25 30 Lys Gln Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Asn He 35 40 45 Thr Thr Leu Ser Lys Met Asp Gln Thr Leu Wing Val Tyr Gln Gln He 50 55 60 Leu Thr Ser Met Asn Ser Thr Asn Val He Gln He Ser As Asp Leu 65 70 75 80 Glu Asn Leu Arg Asp Leu Leu His Val Leu Wing Asn Ser Thr Ser Cys 85 90 95 His Leu Pro Trp Wing Asn Gly Thr Glu Thr Leu Asp Ser Leu Gly Gly It is noted that in relation to this date, the best method known by The applicant for carrying out said invention is the one that is clear from the present description of the invention.

Claims (52)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. A glycosylated leptin protein, characterized in that it has a Stokes radius greater than that of the naturally occurring glycosylated human leptin of SEQ ID NO. 2 (rHu-leptin 1-145).

2. A glycosylated leptin protein, characterized in that it has a Stokes radius equal to or greater than 30 Á, as determined by gel filtration.

3. A glycosylated leptin protein preparation, characterized in that each glycosylated leptin protein molecule in said preparation has five or more portions of sialic acid.

4. A glycosylated leptin protein preparation according to claim 3, characterized in that each glycosylated leptin protein molecule in the preparation has 8 to 20 sialic acid residues.

5. A glycosylated leptin protein, characterized in that it comprises the human leptin of SEQ ID NOs. : 1 or 2, modified to contain at least one additional site for glycosylation.

6. A glycosylated leptin protein, characterized in that it comprises SEQ ID NO. 1 having one or more sequential alterations such as a glycosylation site selected from (where "T / S" denotes threonine or serine): a) 01V- > ? 02P- »X (where X is any amino acid except proline) 03I-T / S b) 02P-»? 031 04Q? T / S c) 23D- * N 241 25S? T / S d) 47P? N 481 49L- »T / S e) 48I? N 49L 50T / S f) 69P-»? 70S 71R? T / S g) 92F-HM 93S 94K? T / S h) ÍOIA ?? 102S 103GT / S i) 102S ?? 103G 104L? T / S j) 103G- »104L 105E-» T / S

7. A glycosylated leptin protein, characterized in that it comprises the amino acid sequence 1-146 of the SEQ ID? O. 1, which has a glycosylation site located at a position selected from (with respect to the numbering of SEQ ID? O. 1): 4, 8, 23, 44, 47, 48, 69, 70, 92, 93 , 97, 100, 101, 102, 103, 118 and 141.

8. A glycosylated leptin protein, characterized in that it comprises the sequence of amino acids 1-146 of SEQ ID NO. 1, which has two glycosylation sites, the two sites selected from (with respect to the numbering of SEQ ID No. 1): 47 + 69; 48 + 69; 69 + 101, 69 + 102, 69 + 103 69 + 118; and 100 + 102.

9. A glycosylated leptin protein, characterized in that it comprises amino acid sequence 1-146 of SEQ ID NO. 1, which has three glycosylation sites, the three sites selected from (with respect to the numbering of SEQ ID No. 1): 2 + 47 + 69; 23 + 47 + 69; 47 + 69 + 100, 47 + 69 + 102, 48 + 69 + 118, 69 + 102 + 118; and 69 + 103 + 118.

10. A glycosylated leptin protein, characterized in that it comprises the sequence of amino acids 1-146 of SEQ ID NO. 1, which has four glycosylation sites, the four sites selected from (with respect to the numbering of SEQ ID No. 1): 2 + 47 + 69 + 92; 2 + 47 + 69 + 102; 23 + 47 + 69 + 92; 23 + 47 + 69 + 102; and 47 + 69 + 100 + 102.

11. A glycosylated leptin protein, characterized in that it comprises the sequence of amino acids 1-146 of SEQ ID NO. 1, which has five glycosylation sites, the five sites selected from (with respect to the numbering of SEQ ID No. 1): 2 + 23 + 47 + 69 + 92; 2 + 47 + 69 + 92 + 102; 23 + 47 + 69 + 92 + 102.

12. The glycosylated leptin 2, 47, 69, characterized in that it comprises the amino acid sequence (SEQ ID NO: 26): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL AFSKSCHLPW 101 ASGLETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC

13. The glycosylated leptin 2, 47, 69, 92, characterized in that it comprises the amino acid sequence (SEQ ID NO: 28): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL ANSTSCHLPW 101 ASGLETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC

14. The glycosylated leptin 2, 47, 69, 102, characterized in that it comprises the amino acid sequence (SEQ ID NO 30): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL AFSKSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC

15. Glycosylated leptin 47, 69, 102, characterized in that it comprises the amino acid sequence (SEQ ID NO: 32): 1 VPIQKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL AFSKSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC

16. Glycosylated leptin 2, 47, 69, 92 , 102 characterized in that it comprises the amino acid sequence (SEQ ID NO: 34): 1 VNITKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL ANSTSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC

17. The glycosilated leptin 47, 69, 92, 102, characterized in that it comprises the amino acid sequence (SEQ ID NO 36): 1 VPIQKVQDDT KTLIKTIVTR INDISHTQSV SSKQKVTGLD FIPGLHNITT 51 LSKMDQTLAV YQQILTSMNS TNVIQISNDL ENLRDLLHVL ANSTSCHLPW 101 ANGTETLDSL GGVLEASGYS TEWALSRLQ GSLQDMLWQL DLSPGC

18. A glycosylated leptin protein according to any of claims 1-6, characterized in that it has a selected N-terminal residue sequence. from: a serine, arginine, proline or alanine residue in position -1, a serine in position -1 and a proline in position -2, a serine-proline-serine sequence in positions -1, -2 , and -3, a serine in position -1 and an arginine in position -2, a serine in position -1, an arginine in position -2 and a serine in the -3 position, an arginine in the -1 position and a serine in the -2 position; and an alanine in position -1 and a proline in position -2.

19. A nucleic acid, characterized in that it encodes a glycosylated leptin protein according to any of claims 1-6.

20. A nucleic acid encoding glycosylated leptin 2, 47, 69, characterized in that it comprises the nucleic acid sequence (SEQ ID NO: 25): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCTTCTCTA AGAGCTGCCA CTTGCCCTGG 301 GCCAGTGGCC TGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTAAGCC CTGGGTGC

21. A nucleic acid encoding glycosylated leptin 2, 47, 69, 92, characterized in that it comprises the nucleic acid sequence (SEQ ID NO. ): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCAACTCTA CCAGCTGCCA CTTGCCCTGG 301 GCCAGTGGCC TGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC

22. A nucleic acid encoding glycosylated leptin 2, 47, 69, 102, characterized in that it comprises the nucleic acid sequence (SEQ ID NO: 29): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCTT CTCTA AGAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC

23. A nucleic acid encoding glycosylated leptin for 47, 69, 102, comprising the nucleic acid sequence (SEQ ID NO. 31): 1 GTGCCCATCC AAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCTTCTCTA AGAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC

24 A nucleic acid encoding glycosylated leptin 2, 47, 69, 92, 102, characterized in that it comprises the nucleic acid sequence (SEQ ID NO: 33): 1 GTGAACATCA CAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCAACTCTA CCAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC

25. A nucleic acid encoding glycosylated leptin 47, 69, 92, 102, characterized in that it comprises the nucleic acid sequence (SEQ ID NO: 35): 1 GTGCCCATCC AAAAAGTCCA AGATGACACC AAAACCCTCA TCAAGACAAT 51 TGTCACCAGG ATCAATGACA TTTCACACAC GCAGTCAGTC TCCTCCAAAC 101 AGAAAGTCAC CGGTTTGGAC TTCATTCCTG GGCTCCACAA CATCACGACC 151 TTATCCAAGA TGGACCAGAC ACTGGCAGTC TACCAACAGA TCCTCACCAG 201 TATGAATTCC ACAAACGTGA TCCAAATATC CAACGACCTG GAGAACCTCC 251 GGGATCTTCT TCACGTGCTG GCCAACTCTA CCAGCTGCCA CTTGCCCTGG 301 GCCAATGGCA CGGAGACCTT GGACAGCCTG GGGGGTGTCC TGGAAGCTTC 351 AGGCTACTCC ACAGAGGTGG TGGCCCTGAG CAGGCTGCAG GGGTCTCTGC 401 AGGACATGCT GTGGCAGCTG GACCTCAGCC CTGGGTGC

26. A vector, characterized in that it contains a nucleic acid encoding a glycosylated leptin protein according to any of claims 19-25.

27. A vector, according to claim 26, characterized in that it is an expression vector.

28. A host cell, characterized in that it contains a nucleic acid encoding a glycosylated leptin protein according to any of claims 1-6.

29. A host cell according to claim 28, characterized in that it is selected from prokaryotic and eukaryotic cells.

30. A prokaryotic host cell according to claim 29, characterized in that it is a bacterial cell.

31. A eukaryotic host cell according to claim 29, characterized in that it is selected from mammalian cells, yeast cells, and insect cells.

32. A mammalian host cell according to claim 31, characterized in that it is selected from human cells, monkey cells, BHK cells and CHO cells.

33. A method for the preparation of a protein according to any of claims 1-6, characterized in that it is comprised of: a) the culture of a cell containing a nucleic acid encoding the glycosylated leptin protein under conditions suitable for expression; and b) obtaining the protein.

34. A pharmaceutical composition for parenteral injection, intravenous injection, subcutaneous injection, intrathecal administration, nasal administration, pulmonary administration and administration by osmotic pump, characterized in that it comprises a glycosylated leptin protein according to any of claims 1-18 in a carrier. pharmaceutically acceptable.

35. A method of treating a human for a condition selected from obesity, diabetes and the effects of high blood lipid content; The method is characterized in that it comprises administering an effective amount of a glycosylated human leptin according to any of claims 1-6.

36. A method of treatment according to claim 35, characterized in that the effective amount of the glycosylated human leptin is administered by gene therapy.

37. A selective binding molecule, characterized in that it is selective for a glycosylated leptin protein according to any of claims 1-6.

38. A selective binding molecule according to claim 37, characterized in that it is selected from a polyclonal antibody, a monoclonal antibody and a recombinant antibody.

39. A method of manufacturing a glycosylated leptin protein, characterized in that it comprises: a) the cultivation, under conditions suitable for expression, of a host cell containing a DNA sequence encoding, in the 5 'to 3' direction ( i) a signal peptide, and (ii) a DNA encoding a glycosylated leptin protein; and b) obtaining the glycosylated leptin protein.

40. A method according to claim 39, characterized in that the signal peptide is selected from: a) (SEQ ID NO: 3) (native human leptin signal peptide) MHWGTLCGFLWLWPYLFYVQA b) (SEQ ID NO. ) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSPS c) (SEQ ID NO: 5) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSP d) (SEQ ID NO: 6) (modified human leptin signal peptide) ) MHWGTLCGFLWLWPYLFYVSPA e) (SEQ ID No. SEQ ID No. 7) (modified human leptin signal peptide) MHWGTLCGFLWLWPYLFYVSNS f) (SEQ ID No. 8) (native human tPA signal peptide) MDAMKRGLCCVLLLCGAVFVSPS g) (SEQ ID NO. NO.9). (native human tPA signal peptide) MDAMKRGLCCVLLLCGAVFVSP h) (SEQ ID NO: 10) (modified tPA signal peptide) MDAMKRGLCCVLLLCGAVFVSNS i) (SEQ ID NO.11) (modified tPA signal peptide) MDAMKRGLCCVLLLCGAVFVSPA j) SEQ ID DO NOT. 12) (leptin / tPA signal peptide) MHWGTLCCVLLLCGAVFVSPS k) (SEQ ID NO: 13) (leptin / tPA signal peptide) MHWGTLCCVLLLCGAVFVSP

41. A method according to claim 39, characterized in that the signal peptide is selected from between the signal peptide for: erythropoietin, Factor VIII, beta-interferon, serum albumin, insulin, von Willebrand factor, CDlla, IgG, follistatin, intrinsic factor, G-CSF, ceruloplasmin, and LAMP-1.

42. An improved method of manufacturing a glycosylated protein, characterized in that it comprises: a) the cultivation, under conditions suitable for expression and glycosylation, of a host cell containing a DNA sequence encoding, in the 5 'to 3' direction ( i) a signal peptide, and (ii) a DNA encoding a glycosylated protein; and b) obtaining the glycosylated protein; wherein the improvement comprises the use of a signal peptide having a peptidase cleavage site optimized for the efficiency of glycosylation.

43. An improved method according to claim 42, characterized in that the peptidase cleavage site is selected from SPS, SP, SNS and SPA.

44. A method according to claim 39 or 42, characterized in that it optionally includes the use of a prosequence.

45. A nucleic acid, characterized in that it encodes a signal peptide having a peptidase cleavage site of non-natural origin.

46. A vector, characterized in that it contains a nucleic acid encoding a signal peptide having a peptidase cleavage site of non-natural origin.

47. A vector according to claim 46, characterized in that it is an expression vector.

48. A host cell, characterized in that it contains a nucleic acid encoding a signal peptide having a peptidase cleavage site of non-natural origin.

49. A host cell according to claim 48, characterized in that it is selected from prokaryotic and eukaryotic cells.

50. A prokaryotic host cell according to claim 49, characterized in that it is a bacterial cell.

51. A eukaryotic host cell according to claim 49, characterized in that it is selected from mammalian cells, yeast cells and insect cells.

52. A mammalian host cell according to claim 51, characterized in that it is selected from human cells, monkey cells, BHK cells and CHO cells.