Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6869—Methods for sequencing

Definitions

• the present invention relates to methods of nucleic acid sequencing and in particular to sequencing-by- synthesis methods, ie . those methods based on the detection of nucleotide incorporation during polymerase extension, rather than on analysis of the nucleotide sequence itself, and to the improvements derivable in such methods by the use of a single-stranded DNA binding protein.
• DNA sequencing is an essential tool in molecular genetic analysis.
• the ability to determine DNA nucleotide sequences has become increasingly important as efforts have commenced to determine the sequences of the large genomes of humans and other higher organisms.
• the two most commonly used methods for DNA sequencing are the enzymatic chain-termination method of Sanger and the chemical cleavage technique of Maxam and Gilbert. Both methods rely on gel electrophoresis to resolve, according to their size, DNA fragments produced from a larger DNA segment. Since the electrophoresis step as well as the subsequent detection of the separated DNA- fragments are cumbersome procedures, a great effort has been made to automate these steps.
• electrophoresis is not well suited for large-scale genome projects or clinical sequencing where relatively cost-effective units with high throughput are needed.
• the need for non- electrophoretic methods for sequencing is great and several alternative strategies have been described, such as scanning tunnel electron microscopy (Driscoll et al . , 1990, Nature, 346, 294-296), sequencing by hybridization (Bains et al .. 1988, J. Theo . Biol . 135, 308-307) and single molecule detection (Jeff et al . , 1989, Biomol . Struct. Dynamics, 7, 301-306), to overcome the disadvantages of electrophoresis.
• Sequencing-by-synthesis methods are useful ways of determining the sequence of a DNA molecule of up to a hundred or more bases or the identity of a single nucleotide within a sample DNA molecule.
• the four different nucleotides (adenine, thymine, guanine and cytosine) are conveniently added cyclically in a specific order; when the base which forms a pair (according to the normal rules of base pairing, A-T and C-G) with the next base in the single-strand target sequence is added, it will be incorporated into the growing complementary strand by a polymerase and this incorporation will trigger a detectable signal .
• the event of incorporation can be detected directly or indirectly.
• nucleotides are usually fluorescently labelled allowing analysis by a fluorometer.
• US Patent 48638449 US Patent 5302509, Metzker et al . Nucl . Acids Res. (1994) 22: 4259-4267, Rosenthal International Patent Application No. WO 93/213401, WO 91/06678, Canard et al . Gene (1994) 148: 1-6).
• One such strategy of sequencing- by-synthesis called base addition sequencing scheme (BASS) is based on nucleotide analogues that terminate DNA synthesis. BASS involves repetitive cycles of incorporation of each successive nucleotide, in si tu monitoring to identify the incorporated base, and deprotection to allow the next cycle of DNA synthesis.
• Indirect detection usually takes advantage of enzymatic detection, e.g. measuring the release of PPi (inorganic pyrophosphate) during a polymerization reaction (WO 93/23564 and WO 89/09283) . As each nucleotide is added to a growing nucleic acid strand during a polymerase reaction, a pyrophosphate molecule is released. It has been found that pyrophosphate released under these conditions can be detected enzymatically e.g. by the generation of light in the luciferase-luciferin reaction. Such methods enable a base to be identified in a target position and DNA to be sequenced simply and rapidly whilst avoiding the need for electrophoresis and the use of harmful radiolabels.
• PPi organic pyrophosphate
• PPi Pyrosequencing.
• the basic PPi -based sequencing methods have been improved by using a dATP analogue in place of dATP (WO 98/13523) and including a nucleotide-degrading enzyme such as apyrase during the polymerase reaction step, so that unincorporated nucleotides are degraded, as described in WO 98/28440.
• Figure 1 shows the trace obtained when a single- stranded PCR product is sequenced according to known sequencing-by-synthesis methods (in this case involving detection of PPi) .
• Figure 1 shows that known methods do not provide clear results when two or more adjacent bases in the sample molecule are the same.
• the peak height when the first set of three adenine residues are incorporated is almost the same as when four thymine residues are incorporated later; the set of three adenine residues incorporated around the middle of the sequence have the same peak height as previous doublets and the last pair of adenine residues to be incorporated have a peak height corresponding to single bases from the earlier part of the sequence.
• the present invention thus provides a method of identifying a base at a target position in a sample nucleic acid sequence wherein a primer, which hybridises to the sample nucleic acid immediately adjacent to the target position, is provided and the sample nucleic acid and primer are subjected to a polymerase reaction in the presence of a nucleotide whereby the nucleotide will only become incorporated if it is complementary to the base in the target position, and said incorporation is detected, characterised in that, a single-stranded nucleic acid binding protein is included in the polymerase reaction step.
• the nucleic acid to be sequenced may be any nucleotide sequence it is desirable to obtain sequence information about. Thus, it may be any polynucleotide, or indeed oligonucleotide sequence.
• the nucleic acid may be DNA or RNA, and may be natural, isolated or synthetic.
• the target DNA may be genomic DNA, or cDNA, or a PCR product or other amplicon etc.
• the target DNA may be synthetic, and genomic DNA, cDNA or a PCR product etc. may be used as primer.
• the target (sample) nucleic acid may be used in any convenient form, according to techniques known in the art e.g. isolated, cloned, amplified etc., and may be prepared for the sequencing reaction, as desired, according to techniques known in the art .
• the DNA may also be single or double-stranded - whilst a single-stranded DNA template has traditionally been used in sequencing reactions, or indeed in any primer-extension reaction, it is possible to use a double-stranded template; strand displacement, or a localised opening-up of the two DNA strands may take place to allow primer hybridisation and polymerase action to occur.
• sample nucleic acid acts as a template for possible polymerase based extension of the primer and thus may conveniently be referred to as “template” or “nucleic acid template” .
• any convenient polymerase enzyme may be used according to choice, as will be described in more detail below.
• a polymerase enzyme may be a reverse transcriptase enzyme.
• the nucleotide may be any nucleotide sutiable for a polymerase chain extension reaction e.g. a deoxynucleotide or a dideoxynucleotide .
• the nucleotide may optionally be labelled in order to aid or facilitate detection of nucleotide incorporation.
• One or more nucleotides may be used.
• Nucleotide incorporation by the action of the polymerase enzyme may be detected directly or indirectly, and methods for this are well known in the art. Representative methods are described for example in US-A-4, 863 , 879 of Melamede.
• detection of incorporation may be by means of labelled nucleotides, for example fluorescently labelled nucleotides, as is well known in sequencing procedures known in the art.
• the event of incorporation may be detected by other means e.g. indirectly.
• Detection of incorporation also includes the detection of absence of incorporation e.g. lack of a signal. Thus, it may be detected whether or not nucleotide incorporation takes place.
• the method of the invention thus has utility in a number of different sequencing methods and formats, including mini-sequencing procedures e.g. detection of single base changes (for example, in detecting point mutations, or polymorphisms, or allelic variations etc) .
• the method of the invention may thus be used in a "full" sequencing procedure, ie. the identification of the sequential order of the bases in a stretch of nucleotides, as well in single base detection procedures .
• different deoxynucleotides or dideoxynucleotides may be added either to separate aliquots of sample-primer mixture or successively to the same sample-primer mixture and subjected to the polymerase reaction to indicate which deoxynucleotide or dideoxynucleotide is incorporated.
• the procedure may be repeated one or more times i.e. cyclically, as is known in the art. In this way the identity of many bases in the sample nucleic acid may be identified, essentially in the same reaction.
• a sequencing protocol may involve annealing a primer as described above, performing a polymerase- catalysed primer extension step, detecting the presence or absence of incorporation, and repeating the nucleotide addition and primer extension steps etc. one or more times.
• nucleotides may be added singly or individually, or in a mixture, successively to the same primer-template mixture, or to separate aliquots of primer-template mixture, or to separate aliquots of primer-template mixture etc. according to choice, and the sequence information it is desired to obtain.
• single-stranded nucleic acid binding protein as used herein is intended to refer to the class of proteins collectively referred to by the term SSB (Ann. Rev. Biochem. [1986] 55 103-136 Chase et al . ) .
• SSB has the general property of preferential binding to single-stranded (ss) over double-stranded (ds) nucleic acid molecules.
• the class includes E.
• Eco SSB coli single- stranded binding protein
• T4 gene 32 protein T4 gp32
• T7 SSB T7 SSB
• coliophage N4 SSB T4 gene 44/62 protein
• AdDBP or AdSSB adenovirus DNA binding protein
• UPl calf thymus unwinding protein
• Any functionally equivalent or analogous protein for example derivatives or modifications of the above-mentioned proteins, may also be used.
• Eco SSB or derivatives thereof are particularly preferred for use in the methods of the present .invention .
• modified single-stranded nucleic acid binding proteins derived by isolation of mutants or by manipulation of cloned single-stranded nucleic acid binding proteins which maintain the advantageous properties described herein, are also contemplated for use in the methods of the invention.
• diotide as used herein includes all 2 ' -deoxynucleotides in which the 3 ' - hydroxyl group is absent or modified and thus, while able to be added to the primer in the presence of the polymerase, is unable to enter into a subsequent polymerisation reaction.
• the method of the invention may be performed in a number of ways, and has utility in a variety of sequencing protocols.
• the present invention can thus be seen to provide the use of a single-stranded nucleic acid binding protein in a nucleic acid sequencing-by-synthesis method.
• the single-stranded nucleic acid binding protein is used to bind to the nucleic acid template.
• DNA sequencing-by-synthesis method namely that sequence information is derived by detecting incorporation of a nucleotide in a primer extension reaction.
• sequencing-by-synthesis protocols include not only “full” sequencing methods, but also mini- sequencing methods etc., yielding more limited sequence information.
• Any sequencing-by-synthesis method, as described above, is suitable for use in the methods of the present invention but methods which rely on monitoring the release of inorganic pyrophosphate (PPi) are particularly preferred. In this case, incorporation of the nucleotide will be measured indirectly by enzymatic detection of released PPi.
• PPi inorganic pyrophosphate
• PPi can be determined by many different methods and a number of enzymatic methods have been described in the literature (Reeves et al . , (1969), Anal. Biochem. , 28, 282-287; Guillory e_t_al. , (1971), Anal. Biochem., 39, 170-180; Johnson et_al. , (1968), Anal. Biochem., 15, 273; Cook et al .. (1978), Anal. Biochem. 91, 557-565; and Drake et al . , (1979), Anal. Biochem. 94, 117-120).
• luciferase and luciferin in combination to identify the release of pyrophosphate since the amount of light generated is substantially proportional to the amount of pyrophosphate released which, in turn, is directly proportional to the amount of base incorporated.
• the amount of light can readily be estimated by a suitable light sensitive device such as a luminometer.
• Luciferin-luciferase reactions to detect the release of PPi are well known in the art.
• a method for continuous monitoring of PPi release based on the enzymes ATP sulphurylase and luciferase has been developed by Nyren and Lundin (Anal. Biochem., 151, 504-509, 1985) and termed ELIDA (Enzymatic Luminometric Inorganic Pyrophosphate Detection Assay) .
• the use of the ELIDA method to detect PPi is preferred according to the present invention.
• the method may however be modified, for example by the use of a more thermostable luciferase (Kaliyama et al . , 1994, Biosci. Biotech. Biochem., 58, 1170-1171). This method is based on the following reactions:
• the preferred detection enzymes involved in the PPi detection reaction are thus ATP sulphurylase and luciferase. Methods of detecting the light emitted are well known in the art.
• sample nucleic acid In order to repeat the method cyclically and thereby sequence the sample nucleic acid and, also to aid separation of a single-stranded sample DNA from its complementary strand, it may be desirable that sample nucleic acid (DNA) is immobilised or provided with means for immobilisation attachment to a solid support. Moreover, the amount of sample nucleic acid available may be small and it may therefore be desirable to amplify the sample nucleic acid before carrying out the method according to the invention.
• DNA sample nucleic acid
• the sample DNA may be amplified, for example in vi tro by PCR, Self Sustained Sequence Replication (3SR) , Rolling Circle Amplification or Replication (RCA or RCR) , or indeed any other in vi tro amplification technique, or in vivo using a vector and, if desired, in vi tro and in vivo amplification may be used in combination.
• Whichever method of amplification is used it may be convenient to adapt the method such that the amplified nucleic acid becomes immobilised or is provided with means for attachment to a solid support.
• a PCR primer may be immobilised or be provided with means for attachment to a solid support.
• a vector may comprise means for attachment to a solid support adjacent the site of insertion of the sample DNA such that the amplified sample DNA and the means for attachment may be excised together.
• Immobilisation of the amplified DNA may take place as part of the amplification itself, e.g. in PCR where one or more primers are attached to a support , or alternatively one or more of the primers may carry means for immobilisation e.g. a functional group permitting subsequent immobilisation, e.g. a biotin or thiol group. Immobilisation by the 5 ' end of a primer allows the strand of DNA emanating from that primer to be attached to a solid support and have its 3 ' end remote from the support and available for subsequent hybridisation with the extension primer and chain extension by polymerase.
• the solid support may conveniently take the form of microtitre wells, or dipsticks which may be made of polystyrene activated to bind the primer DNA (K Aimer, Doctoral Theses, Royal Institute of Technology, Sweden, 1988) .
• any solid support may conveniently be used, including any of the vast number described in the art, e.g. for separation/ immobilisation reactions or solid phase assays.
• the support may also comprise particles, fibres or capillaries made, for example, of any polymer, e.g. agarose, cellulose, alginate, Teflon or polystyrene.
• Glass solid supports can also be used, e.g. glass plates or capillaries. Magnetic particles e.g. the superparamagnetic beads produced by Dynal AS (Oslo, Norway) are a preferred support since they can be readily isolated from a reaction mixture yet have superior reaction kinetics over many other forms of support .
• the solid support may carry functional groups such as hydroxyl, carboxyl , aldehyde or amino groups, or other moieties such as avidin or streptavidin, for the attachment of primers or the target nucleic acid. These may in general be provided by treating the support to provide a surface coating of a polymer carrying one of such functional groups, e.g. polyurethane together with a polyglycol to provide hydroxyl groups, or a cellulose derivative to provide hydroxyl groups, a polymer or copolymer of acrylic acid or methacrylic acid to provide carboxyl groups or an aminoalkylated polymer to provide amino groups. Sulphur and epoxy-based functional groups may also be used. US Patent No. 4654267 describes the introduction of many such surface coatings.
• the assay technique is very simple and rapid, thus making it easy to automate by using a robot apparatus where a large number of samples may be rapidly analysed. Since the preferred detection and quantification is based on a luminometric reaction this can be easily followed spectrophotometrically .
• the use of luminometers is well known in the art and described in the literature.
• the sample nucleic acid ie . the target nucleic acid to be sequenced
• the target nucleic acid to be sequenced may be any nucleotide sequence, however obtained according to techniques known in the art, e.g. cloning, DNA isolation etc. It may for example be cDNA synthesised from RNA in the sample and the method of the invention is thus applicable to diagnosis on the basis of characteristic RNA.
• Such preliminary synthesis can be carried out by a preliminary treatment with a reverse transcriptase, conveniently in the same system of buffers and bases of subsequent amplification e.g. PCR steps, if used. Since the PCR procedure requires heating to effect strand separation, in the case of PCR the reverse transcriptase will be inactivated in the first PCR cycle.
• RNA is the sample nucleic acid
• a specific oligonucleotide sequence may be used to retrieve the RNA via a specific RNA sequence.
• the oligonucleotide can then serve as a primer for cDNA synthesis, as described in WO 89/0982.
• the primer for the polymerase chain extension step (ie. the extension primer) is sufficiently large to provide appropriate hybridisation with the sequence immediately 5 ' of the target position, yet still reasonably short in order to avoid unnecessary chemical synthesis.
• the size of the extension primer and the stability of hybridisation will be dependent to some degree on the ratio of A-T to C-G base pairings, since more hydrogen bonding is available in a C-G pairing.
• the skilled person will consider the degree of homology between the extension primer to other parts of the amplified sequence and choose the degree of stringency accordingly. Guidance for such routine experimentation can be found in the literature, for example, Molecular Cloning: a laboratory manual by Sambrook, J., Fritsch E.F.
• the primer is conveniently added before the sample is divided into (four) aliquots although it may be added separately to each aliquot.
• the extension primer may be identical with the PCR primer but advantageously it may be different, to introduce a further element of specificity into the system.
• the polymerase reaction is carried out using a polymerase which will incorporate deoxynucleotides and dideoxynucleotides, e.g. T7 polymerase, Klenow, ⁇ 29 DNA polymerase or Sequenase Ver. 2.0 (USB U.S.A.) .
• a polymerase which will incorporate deoxynucleotides and dideoxynucleotides
• Any suitable polymerase may be used and many are known in the art and reported in the literature. However, it is known that many polymerases have a proof-reading or error checking ability and that 3 ' ends available for chain extension are sometimes digested by one or more nucleotides. If such digestion occurs in the method according to the invention the level of background noise increases. In order to avoid this potential problem, a nonproof-reading polymerase, e.g. T7 polymerase or Sequenase may be used. Otherwise it is desirable to add to each aliquot fluoride ions or nucleotide mono
• a dATP analogue such as dATP ⁇ S in place of dATP is advantageous as it does not interfere with the detection reaction as it is capable of acting as a substrate for a polymerase but incapable of acting as a substrate for the PPi-detection enzyme luciferase.
• nucleotide degrading enzyme in the reaction mix is also advantageous as it means that it is not necessary to wash the template thoroughly between each nucleotide addition to remove all non-incorporated deoxynucleotides, which has the associated benefit that a template can be sequenced which is not bound to a solid support.
• the nucleotide-degrading enzyme apyrase is included during the polymerase reaction step and it has been found that the single-stranded binding proteins used in the methods of the present invention are able to stimulate the activity of apyrase. Whilst not wishing to be bound by theory, it is believed that the "SSB" may play a role in reducing the inhibition of apyrase which may be observed in the presence of DNA.
• the present invention provides a method of enhancing the activity of a nucleotide-degrading enzyme when used in a nucleic acid sequencing-by-synthesis method, which comprises the use of a single-stranded nucleic acid binding protein. More particularly, the methods comprise including or adding a single-stranded nucleic acid binding protein to the sequencing reaction mixture (i.e. the template, primer, polymerase and/or nucleotide (e.g.dNTP/ddNTP) mix).
• the sequencing reaction mixture i.e. the template, primer, polymerase and/or nucleotide (e.g.dNTP/ddNTP) mix).
• the present invention provides a method of enhancing the activity of luciferase when used as a detection enzyme in a nucleic acid sequencing-by-synthesis method which comprises the use of a single-stranded nucleic acid binding protein.
• a nucleic acid sequencing-by-synthesis method which comprises the use of a single-stranded nucleic acid binding protein.
• such methods involve including or adding a single-stranded nucleic acid binding protein to the sequencing reaction mixture.
• the single-stranded nucleic acid binding protein is added after hybridisation of the primer to the template nucleic acid molecule.
• the reaction mixture for the polymerase chain extension step may optionally include additional ingredients or components if desired.
• additional components can include other substances or molecules which bind to DNA.
• amines such as spermidine may be used. It was observed that improved results may be obtained using spermidine in run-off extension reactions.
• Alternative additional components include DNA binding proteins such as RecA.
• RecA DNA binding proteins
• Other DNA binding proteins involved in DNA replication, recombination, or structural organisation may also be used in similar manner.
• DMSO and formamide include DMSO and formamide, and other agents which may destabilise or assist in destabilising double-strand formation, for example accessory proteins involved in DNA replication such as helicase.
• the read-length i.e. the length of nucleic acid which can be successfully sequenced
• the methods of the invention are suitable for midi-sequencing, ie . the sequencing of nucleic acid molecules having 9-50 bases, mini-sequencing, the detection of single bases such as SNPs (single nucleotide polymorphisms) responsible for genetic diseases and the sequencing of nucleic acid molecules of 100 bases or more.
• the present invention may advantageously be used in the sequencing of 25 or more, advantageously 30 or more, 50 or more, or 60 or more bases .
• sequence information from e.g. a 50 base region within a template molecule of 400 or more bases can be obtained.
• Template molecules of 800 or more, even 1200 or 1500 or more bases can be used in the methods of the present invention.
• the amount of sequencing template accessible for the sequencing reaction may be reduced due to specific and/or unspecific interactions between the template and components of the reaction mixture and/or the surface of the vessel holding the reaction mixture. Such interaction may result in the reduction of the detected signal and/or generation of unspecific sequencing signal.
• SSB is believed to protect the template from such undesirable interactions and thus improve signal intensity and specificity.
• the protein may assist in "opening-up” and/or maintaining or stabilising the "open" structure of a double-stranded template.
• the sequencing reaction may advantageously be run bidirectionally to confirm the mutation.
• a further beneficial feature of the present invention is the stimulation of Klenow polymerase which is observable using the single-stranded nucleic acid binding protein according to the methods described herein.
• the present invention provides a method of maintaining a constant signal intensity during a method of nucleic acid sequencing-by- synthesis comprising the use of a single-stranded nucleic acid binding protein. More particularly, the methods comprise including or adding a single-stranded nucleic acid binding protein to the sequencing reaction mixture (i.e. the template, primer, polymerase and/or nucleotide (e.g.dNTP/ddNTP) mix) .
• the sequencing reaction mixture i.e. the template, primer, polymerase and/or nucleotide (e.g.dNTP/ddNTP) mix) .
• 'constant signal intensity' in this context means that the strength of the signal, however measured, which indicates incorporation of the correct base-pair nucleotide remains substantially the same throughout the sequencing reaction, whether it is the first nucleotide incorporated, the twentieth or the sixtieth etc. Similarly, the strength of signal indicating incorporation of two nucleotides (ie. two adjacent bases are the same in the molecule to be sequenced) remains constant throughout the whole sequencing reaction and so on for three bases, four bases etc.
• the single-stranded nucleic acid binding protein is present in the 'reaction mixture', i.e. together with the reagents, enzymes, buffers, primer, sample etc. which may include a solid support and is the site of polymerisation and also, where appropriate, detection.
• a further benefit of the use of a single-stranded nucleic acid binding protein in accordance with the present invention is the relatively small amount of sample nucleic acid which is required for generation of useful sequence information. Approximately 0.05 pmol DNA in a 50 ⁇ l reaction is sufficient to obtain sequence information which means the quantity of enzymes needed for carrying out the extension reactions is less per cycle of nucleotide additions and per full sequencing reaction.
• the present invention provides a kit for use in a method of sequencing-by-synthesis which comprises nucleotides for incorporation, a polymerase, means (e.g. any reagents and enzymes needed) for detection of incorporation and a single-stranded nucleic acid binding protein.
• Figure 1 shows a sequencing method of the prior art performed on a 130-base-long single-stranded PCR product hybridized to the sequencing primer. About 2 pmol of the template/primer was used in the assay. The reaction was started by the addition of 0.6 nmol of the indicated deoxynucleotide and the PPi released was detected. The DNA-sequence after the primer is indicated in the Figure .
• Figure 2 shows Pyrosequencing of a PCR product a) in the absence of a single-stranded DNA binding protein, b) in the presence of SSB from T4 phage (T4gp32) , and c) in the presence of SSB from E. coli .
• Lower quality of sequence data is obtained in the absence of SSB as indicated by arrows .
• Figure 3 shows a) the sequencing of mutated p53 template in the absence of a single strand DNA binding protein and b) sequencing of the same sequence when SSB is included.
• Figure 4 shows a run off extension signal obtained on a 1500bp long PCR fragment using Klenow DNA polymerase. A) in the presence of SSB and B) in the absence of a single-stranded DNA binding protein.
• Figure 5 shows the result of Pyrosequencing an 800bp long PCR template a) in the presence of SSB and b) in the absence of a single-stranded DNA binding protein.
• Figure 6 shows, schematically, inhibition of apyrase in the presence of DNA and the ability of SSB to reduce the interaction of apyrase with the DNA.
• Figure 7 shows the Pyrosequencing of a 450bp cDNA template A) in the absence of a single strand DNA binding protein and B) in the presence of SSB.
• the numbers underneath the peaks show the number of bases incorporated.
• the dashed line indicates how the strength of signal which results from the incorporation of one base decreases as the sequencing reaction progresses.
• the dashed lines indicate how the strength of signal as one or two bases are incorporated remains constant when the reaction is carried out in the presence of SSB.
• Pyrosequencing was performed on approximately 0.2 pmol of a 405-base-long single-stranded PCR product obtained from mitochondrial DNA hybridised to 2 pmol of sequencing primer pH3A (5 ' -GCTGTACTTGCTTGTAAGC) . Primed DNA template together with 2 ⁇ g of SSB from E.
• coli (Amersham Pharmacia Biotech, Uppsala, Sweden) or 2 ⁇ g of T4gp32 (Amersham Pharmacia Biotech) was added to a four- enzyme-mixture comprising 6 U DNA polymerase (exonuclease-deficient Klenow DNA polymerase) , 20 mU ATP sulfurylase, 200 ng firefly luciferase, and 50 mU apyrase .
• DNA polymerase exonuclease-deficient Klenow DNA polymerase
• 20 mU ATP sulfurylase 20 mU ATP sulfurylase
• 200 ng firefly luciferase 200 ng firefly luciferase
• 50 mU apyrase 50 mU apyrase .
• the sequencing procedure was carried out by stepwise elongation of the primer-strand upon sequential addition of the different deoxynucleoside triphosphates (Pharmacia Biotech) .
• the reaction was carried out at room temperature .
• Light was detected by a Pyrosequencer (Pyrosequencing AB, Uppsala, Sweden) as described by Ronaghi et al . (Science 1998, 281: 363-365). See Fig. 2. Unincorporated nucleotides were degraded by apyrase allowing sequential addition of the four different nucleotides in an iterative manner.
• the correct sequence is: 5 ' -AGCCCCACCCCCGGGGCAGCGCCAGG .
• a run off extension signal was obtained on a 1500 bp long PCR fragment using Klenow DNA polymerase in the presence of SSB and in the absence of SSB.
• PCR was performed on 16S rNA gene with ENVl (Ul universal primer E. coli positions 8-27) 5 ' -AGAGTTTGATIITGGCTCAG and ENV2B (U8 universal primer E. coli positions 1515-1493) 5' -B-CGGITACCTTGTTACGACTT.
• ENVl Ul universal primer E. coli positions 8-27
• ENV2B U8 universal primer E. coli positions 1515-1493
• the obtained single-stranded template (1/20 of a PCR product) was hybridised to 0.5 pmol of ENVl primer for a run off extension reaction.
• 0.5 ⁇ g of E. coli SSB was added before extension using a coupled enzymatic reaction as described by Nyren et al . (Anal. Biochem. 1997 244, 367
• Pyrosequencing was performed on an 800-base-long single- stranded PCR product hybridised to the sequencing primer FSS-SEQ-D0WN(5' -CTGCTCGGGCCCAGATCTG) .
• Two ⁇ g of SSB from E. coli was added to the template/primer (1/5 of a PCR product in which 5 pmol of primers have been used for in vi tro amplification) and the obtained complex was used in a Pyrosequencing reaction as described by Ronaghi et al . (Science 1998, 281: 363-365).
• the sequence obtained by Pyrosequencing using SSB is as follows : ATACCGGTCCGGAATTCCCGGTCGACCCACGCGCCGGGCCATCGCA CTTCGCCCACGTGTCGTTTTC) . See Fig. 5.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Analytical Chemistry (AREA)
• Physics & Mathematics (AREA)
• Immunology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Saccharide Compounds (AREA)

Priority Applications (6)

Applications Claiming Priority (2)

Publications (1)

Family

ID=10846383

Family Applications (1)

Country Status (8)

Cited By (37)

Families Citing this family (356)

Citations (5)

Family Cites Families (5)

• 1999
  • 1999-01-22 GB GBGB9901475.5A patent/GB9901475D0/en not_active Ceased
• 2000
  • 2000-01-20 WO PCT/GB2000/000146 patent/WO2000043540A1/en not_active Ceased
  • 2000-01-20 AT AT00900717T patent/ATE446380T1/de not_active IP Right Cessation
  • 2000-01-20 DE DE60043182T patent/DE60043182D1/de not_active Expired - Lifetime
  • 2000-01-20 EP EP00900717A patent/EP1147217B1/en not_active Expired - Lifetime
  • 2000-01-20 AU AU30642/00A patent/AU3064200A/en not_active Abandoned
  • 2000-01-20 US US09/889,812 patent/US6828100B1/en not_active Expired - Lifetime
  • 2000-01-20 JP JP2000594948A patent/JP4951170B2/ja not_active Expired - Lifetime

Patent Citations (5)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events