WO2000020572A2 - Gewebebindende peptide, ihre identifizierung, herstellung und verwendung - Google Patents

Gewebebindende peptide, ihre identifizierung, herstellung und verwendung Download PDF

Info

Publication number
WO2000020572A2
WO2000020572A2 PCT/EP1999/007296 EP9907296W WO0020572A2 WO 2000020572 A2 WO2000020572 A2 WO 2000020572A2 EP 9907296 W EP9907296 W EP 9907296W WO 0020572 A2 WO0020572 A2 WO 0020572A2
Authority
WO
WIPO (PCT)
Prior art keywords
tissue
peptide
peptides
binding
nucleic acid
Prior art date
Application number
PCT/EP1999/007296
Other languages
English (en)
French (fr)
Other versions
WO2000020572A3 (de
Inventor
Jürgen Schrader
Andreas Herrmann
Original Assignee
Schrader Juergen
Andreas Herrmann
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Schrader Juergen, Andreas Herrmann filed Critical Schrader Juergen
Priority to CA002345214A priority Critical patent/CA2345214A1/en
Priority to EP99948916A priority patent/EP1117775A2/de
Publication of WO2000020572A2 publication Critical patent/WO2000020572A2/de
Publication of WO2000020572A3 publication Critical patent/WO2000020572A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/02—Libraries contained in or displayed by microorganisms, e.g. bacteria or animal cells; Libraries contained in or displayed by vectors, e.g. plasmids; Libraries containing only microorganisms or vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to tissue-binding peptides, their identification with the aid of tissues, their production and use as medicaments or diagnostic agents.
  • arteriosclerosis The pathogenesis of arteriosclerosis is increasingly attributed to damage to the endothelium, which results in endothelial dysfunction. Endothelial dysfunction is mainly reflected in a changed expression pattern of surface proteins (selectins, adhesion molecules) but also in a change in the synthesis rates of growth hormones. So z. B. in the early stage of arteriosclerosis an increased expression of the E- and P-selectins and the cellular adhesion molecules VCAM and ICAM for the immigration of monocytes into the vessel wall. The conversion of the monocytes into macrophages leads to an altered synthesis of growth factors, which in particular stimulate smooth muscle cells to proliferate and to release mediators which have an inflammatory effect.
  • Drug therapy for arteriosclerosis tries to reduce the causes at an early stage, if possible before the manifestation.
  • a main goal is to increase the plasma cholesterol level by increasing the excretion of cholesterol metabolites (bile acids) or by reducing cholesterol biosynthesis. Due to the counter-regulation initiated by the organism, drug therapy can only lower the total cholesterol level by approx. 30%. Since this method is also not suitable for inducing regression of an existing arteriosclerosis, percutaneous, transluminal angioplasty (PTA), ie widening of the stenosed section of the vessel using a balloon catheter, is the therapy today of choice.
  • PTA percutaneous, transluminal angioplasty
  • restenosis ie reclosure
  • surgical treatment is therefore carried out by placing a bypass. However, this therapy also causes restenosis of the bypass vessel in about 50% of the patients within 3-6 months after the treatment.
  • a number of gene therapy methods have therefore been developed, in which a second catheter is used, via which a vector with a gene therapy effect is applied locally to the affected vessel section (see, for example, WO95 / 27070).
  • the transfection efficiency could be increased, for example, by using HVJ liposomes (Morishita, R. et al. (1994) Gene 149, 13).
  • Inactivated Sendai viruses hemagglutinating virus of Japan, HVJ
  • F and HN protein the viral fusion and binding proteins
  • the genetic material can be efficiently introduced directly into the cell's cytoplasm bypassing the lysosomes.
  • cell-specific antibodies to liposomal (Vingerhoeds, H. et al. (1994) Immunometh. 4, 259) or viral (Wickha, TJ et al. (1996) J. Virol. 70, 6831) vectors, under the control of a strong viral promoter to be able to target the therapeutic gene only into the desired cell type.
  • tissue-specific expression is of great medical importance in particular for the therapy of vascular diseases. This not only opens up opportunities for direct vascular diseases, such as B. to treat arteriosclerosis and its complications (stenosis, restenosis, heart attack), but also all organs and tumors that can be reached via the bloodstream.
  • tissue-oriented gene transfer into vascular cells can also be used to express therapeutic proteins which are not or are no longer present in sufficient amounts in the target organism due to pathological or genetic changes, e.g. B. Factor VIII deficiency, insulin deficiency etc.
  • An essential goal of somatic gene therapy is therefore to introduce a therapeutic gene into the target cells of the organism as specifically as possible after systemic or local administration and to express the therapeutic gene essentially only in these cells.
  • the therapeutic gene should on the one hand be packaged in such a way that it is essentially not degraded by nucleases during transport through the blood vessel system, and on the other hand it should be in a form which enables cell-specific gene expression in the target cells.
  • the specific recognition of cells is also referred to as "targeting".
  • targeting There are basically two possibilities for this targeting: on the one hand, antibodies against receptors on the Use cell surface, which are integrated into viral or liposomal vector systems (Vingerhoeds, H. et al (1994) supra; Wickham, TJ (1996) supra), and on the other hand peptides with high binding affinity for receptors on the cell surface can be used.
  • antibodies for example, certain tumor cells could be recognized and even detected in the intact tissue association using a suitable label.
  • a major disadvantage of antibodies is that for technical reasons they are usually produced in the mouse and often lead to serious side effects on patients due to an immune reaction. Even so-called humanized antibodies are not free from this problem. In individual cases, such pronounced immune complexes can occur, which drastically restrict the blood flow to the kidneys and thus lead to fatal kidney failure.
  • Peptide presenting libraries that are chemically produced have been developed e.g. B. von Geysen, H.M. et al. (1996) Mol. Immunol. 23, 709 or de Koster, H.S. (1995) J. Immunol. Methods 187, 179-188.
  • amino acid mixtures were used on the solid phase, so that the amino acid sequence of the resulting peptides is statistical, i. H. was randomly distributed.
  • the peptide banks could also be used in resin-bound form (de Koster, H.S. et al. (1995) supra).
  • peptide-presenting banks which are based, for example, on the presentation of the peptides on the surface of phages
  • at the N-terminus of the pIII coat protein of filamentous phages see, for example, Kay, BK et al. (1993) Gene 128, 59 or Jellis, CL et al. (1993) Gene 137, 63-68) presented peptides varied from 6 to 38 amino acids were used, among other things, for epitope screening of antibodies (Cortese, R. et al. (1994) Trends Biotechnol.
  • peptide-presenting bacterial banks are known.
  • An example of this are fusions of a combinatorial peptide library with thioredoxin, which led to the identification of peptide aptamers which recognize the cyclin-dependent kinase 2 (Colas, P. et al. (1996) Nature, 380, 548-550).
  • Browsing a combinatorial peptide library was e.g. B. also with fusions to the C-terminus of the alpha subunit of G, (340-350) to identify rhodopsin-binding sequences (Martin, EL et al. (1996) J. Biol. Chem. 271, 361-366 , No. 1).
  • Another example is peptide insertions in a thioredoxin-flagellin fusion protein, which is presented on the E. coli cell surface, with which protein-protein interactions can be investigated (Lu, Z. et al. (1995) Bio / Technology 13, 366- 372; U.S. Pat. No. 5,635,182).
  • One object of the present invention is therefore a tissue-binding peptide selected from a peptide with the amino acid sequence
  • GEGRTVVLSF AWCRGGILGDAM, ' GNLVDLVVGFDD, RVSPPKKSGGGV, GSSKWGLTXKCG, RGGVRQRSRGRR, GEGRTVVCRS or SQRWTALWQWIG and variants thereof.
  • variants are understood to mean deletions, additions or substitutions of one or more amino acids, the tissue-specific binding of the peptide essentially not being changed, i. H. the peptide has retained its ability to bind better to one tissue than another.
  • deletion preferably no more than 4 amino acids, especially no more than 2 amino acids, are deleted.
  • the deletion is preferably carried out at the N- or C-terminus of the peptide, in particular at the N-terminus.
  • the term addition means not only the addition of one or more amino acids, for example 1-25 amino acids, but also fusion proteins of the peptide according to the invention with another C- and / or N-terminal peptide or protein.
  • a fusion of a tissue-specific peptide with a peptide that contains several histidines leads not only to tissue-specific binding, but also to permeabilization of the cell membrane at a slightly acidic pH (see, e.g., Midoux, P. et al (1998) Bioconjugate Chem. 9, 260-267).
  • a fusion protein consists, for example, of the peptide according to the invention and several lysines, for example 16 lysines in succession or the nucleocapsid protein (NCp) 7 derived from HIV-1 or NCp7 Peptides, a nucleic acid, for example a DNA containing a therapeutic gene, can be complexed to the peptide according to the invention in a particularly simple manner (see, for example, Harbottle, RP et al. (1998) Human Gene Therapy 9, 1037-1047 or Bachmann, AS et al. (1998) J. Mol. Med. 76, 126-132).
  • a fusion protein which contains a tissue-specific peptide, a peptide which brings about permeabilization of the cell membrane and a nucleic acid-binding peptide, which is particularly advantageous.
  • substitutions in which, for example, one or more amino acids with a hydrophobic side chain are replaced by one or more other amino acids with another hydrophobic side chain.
  • amino acids with hydrophobic side chains are glycine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan or proline.
  • Amino acids with a polar neutral residue can also be interchanged. Examples include serine, threonine, cysteine, tyrosine, asparagine or glutamine.
  • amino acids with a polar acidic residue can be interchanged. For example, this includes aspartic acid or glutamic acid.
  • Amino acids with a polar basic residue can also be interchanged, such as. B. lysine, arginine or histidine.
  • amino acid means not only the amino acids naturally occurring in proteins, but also other amino acids which can be incorporated into a peptide chain, such as, for. As hydroxylysine, hydroxyproline, ornithine, citrulline or homocysteine.
  • the individual amino acids of the peptide according to the invention can also be modified.
  • the peptide can be marked and / or modified to be protected.
  • a suitable label is, for example, the exchange of the hydroxyl group of threonine or serine with the isotope 18 F, which has a half-life of 2 hours and can therefore be used well in clinical practice.
  • the peptide can also be labeled with 18 F at the carboxy terminus via a fluoroethyl amide bond .
  • the C-terminal fluoramidation takes place, for example, with fluoroethylamine and a urea derivative (e.g. TBU) for activation.
  • Another suitable label is the labeling of cysteine or methionine with the sulfur isotope 35 S.
  • the isotope 35 S has the advantage over the isotope 18 F that it has a longer half-life.
  • the peptide according to the invention can also be labeled with other compounds, for example with ⁇ -galactosidase or biotin or avidin / streptavidin.
  • radioactive labeling with in particular short-lived isotopes has the advantage that the structure of the peptide remains essentially unchanged and the distribution of the peptide in the organism can be analyzed in an advantageous manner, for example with the help of positron emission tomography (PET).
  • PET positron emission tomography
  • the functional side chains of the amino acids are protected beforehand.
  • the peptide on the solid phase is removed from the C- to the N-terminus using an acid-labile resin (e.g. SASRIN, a 2-methoxy-4-alkoxybenzyl alcohol resin, Frechet, JMJ et al. (1979) Polymer 20, 675) using the FastMoc ⁇ method (Merrifield, RB (1963) J. Am. Chem. Soc. 95, 1328; Wang, SS (1973) J. Am. Chem. Soc. 95, 1328; Perkin-Elmer Applied Biosystems, Foster City , CA) synthesized.
  • an acid-labile resin e.g. SASRIN, a 2-methoxy-4-alkoxybenzyl alcohol resin, Frechet, JMJ et al. (1979) Polymer 20, 675
  • Another object of the present invention is a nucleic acid coding for a tissue-binding peptide according to the invention.
  • a nucleic acid is particularly preferably selected from a nucleic acid with the nucleotide sequence
  • variants is understood in particular to mean variants which code for the same peptide due to the degeneracy of the genetic code.
  • variants also means the ribonucleic acids (RNA) corresponding to the deoxyribonucleic acids (DNA) listed.
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • the DNA or RNA can also be modified to e.g. B. to be better protected against nuclease degradation. Suitable modifications can be found e.g. B. Uhlmann, E. & Peyman A. (1990) Chemical Reviews 90, 543-584 No. 4th
  • a vector can, for example, be an expression vector for the production of the peptides according to the invention in prokaryotic or eukaryotic cells.
  • prokaryotic expression vectors are for expression in E. coli z.
  • Baculovirus vectors as disclosed in EP-B1-0 127 839 or EP-B1-0 549 721, and for expression in mammalian cells, for.
  • the expression vectors also contain suitable promoters for the respective host cell, e.g. B. the trp promoter for expression in E. coli (see, for example, EP-B1-0 154 133), the ADH2 promoter for expression in yeast (Radorel et al. (1983), J. Biol. Chem. 258, 2674-2682), the baculovirus polyhedrin promoter for expression in insect cells (see e.g. EP-B1-0 127 839) or the early SV40 promoter or LTR promoters e.g. B. from MMTV (mouse mammary tumor virus; Lee et al. (1981) Nature 214, 228-232).
  • suitable promoters for the respective host cell e.g. B. the trp promoter for expression in E. coli (see, for example, EP-B1-0 154 133), the ADH2 promoter for expression in yeast (Radorel et al. (1983), J. Biol. Chem. 258,
  • virus vectors preferably adenovirus vectors, in particular replication-deficient adenovirus vectors, or adeno-associated virus vectors, e.g. B. an adeno-associated virus vector, which consists exclusively of two inverted terminal repeat sequences (ITR).
  • ITR inverted terminal repeat sequences
  • the El gene region is generally replaced by a foreign gene with its own Promoter or replaced by the nucleic acid of the invention.
  • a non-replication-capable adenovirus is created. These viruses can then only multiply in a cell line that replaces the missing El genes.
  • Replication-deficient adenoviruses are therefore generally formed by homologous recombination in the so-called 293 cell line (human embryonic kidney cell line), which has a copy of the El region stably integrated in the genome.
  • the nucleic acid according to the invention is cloned into recombinant adenoviral plasmids under the control of a suitable promoter.
  • This is followed by homologous recombination with an El-deficient adenoviral genome, such as, for example, dl327 or dell324 (adenovirus 5), in the Helper cell line 293.
  • an El-deficient adenoviral genome such as, for example, dl327 or dell324 (adenovirus 5)
  • helper cell line 293 If recombination is successful, viral plaques are harvested.
  • the replication-deficient viruses produced in this way are used in high titers (for example 10 ° to 10 "" plaque-forming units or
  • the exact insertion site of the nucleic acid according to the invention into the adenoviral genome is not critical. It is e.g. It is also possible to clone the nucleic acid according to the invention in the place of the deleted E3 gene (Karlsson, S. et al. EMBO J. 5, 1986, 2377-2385). However, preferably the El region or parts thereof, e.g. the EIA or EIB region (see e.g. WO 95/00655) is replaced by the nucleic acid according to the invention, especially if the E3 region is also deleted. Also suitable are third generation adenoviral vectors, i. H.
  • Vectors which, apart from the ITR and the packaging signal, contain no further sequences coding for viral proteins (Kochanek, S. (1996) Proc. Natl. Acad. Sci. USA 93, 5731).
  • the recombination in the helper cell line takes place e.g. B. with the help of a helper plasmid.
  • the present invention is not limited to the adenoviral vector system, but adeno-associated virus vectors are also particularly suitable in combination with the nucleic acid according to the invention, since the transfer of the nucleic acid according to the invention into resting, differentiated cells can be carried out by AAV, which is for the treatment of vascular diseases is particularly advantageous.
  • AAV vascular diseases
  • the two approximately 145 bp long inverted terminal repeat sequences are generally sufficient for the vector functions. They carry the signals necessary for replication, packaging and integration into the host cell genome. The ability to integrate ensures long-lasting gene expression in vivo, which in turn is particularly advantageous.
  • AAV AAV vectors or parts thereof by methods known to the person skilled in the art, as described, for example, in WO 95/23867, by Chiorini, JA et al. (1995), Human Gene Therapy 6, 1531-1541 or Kotin, RM (1994), Human Gene Therapy 5, 793-801.
  • Vectors with gene therapy effects can also be obtained by complexing the nucleic acid according to the invention with liposomes (neutral or cationic), i.e. the nucleic acid is essentially included in the liposome, since it enables a very high transfection efficiency, in particular of cardiac muscle cells, to be achieved (see, for example, WO95 / 27070) and the nucleic acid is essentially protected against DNases.
  • liposomes neutral or cationic
  • the nucleic acid is essentially included in the liposome, since it enables a very high transfection efficiency, in particular of cardiac muscle cells, to be achieved (see, for example, WO95 / 27070) and the nucleic acid is essentially protected against DNases.
  • Transfection with nucleic acid-liposome complexes with the aid of Sendai viruses in the form of so-called HVJ liposomes (virosomes) is particularly advantageous, since this can further increase the transfection rate.
  • small unilamellar vesicles are made from cationic lipids by ultrasound treatment of the liposome suspension.
  • the nucleic acid is bound ionically on the surface of the liposomes in such a ratio that a positive net charge remains and the nucleic acid is 100% complexed by the liposomes.
  • Feigner et al. Feigner, PL et al. (1987) Proc. Natl. Acad.
  • lipid mixtures DOTMA 1,2-dioleyloxypropyl-3-trimefhylammonium bromide
  • DOPE dioleoylphosphatidylethanolamine
  • new lipid formulations synthesized and tested for the efficiency of transfection of various cell lines (Behr, JP et al. (1989), Proc. Natl. Acad. Sci. USA 86, 6982-6986; Feigner, JH et al. (1994) J. Biol. Chem . 269, 2550-2561; Gao, X. & Huang, L. (1991), Biochim. Biophys. Acta 1189, 195-203).
  • the new lipid formulations are DOTAP N- [l- (2,3-dioleoyloxy) propyl] -N, N, N-trimethylammonium ethyl sulfate or DOGS
  • nucleic acid-liposome complex contains nucleic acid binding proteins, for example chromosomal proteins, preferably HMG proteins (high mobility group proteins), in particular HMG-1 or HMG-2, or nucleosomal histones such as H2A, H2B, H3 or H4 , since this can increase the expression of the desired nucleic acid at least 3-10 times.
  • nucleic acid binding proteins for example chromosomal proteins, preferably HMG proteins (high mobility group proteins), in particular HMG-1 or HMG-2, or nucleosomal histones such as H2A, H2B, H3 or H4 , since this can increase the expression of the desired nucleic acid at least 3-10 times.
  • the chromosomal proteins can be isolated, for example, from calf thymus or rat liver by generally known methods or can be produced by genetic engineering.
  • Human HMG-1 can be genetically engineered using the human cDNA sequence from Wen, L. et al. (1989) Nucleic Acids Res., 17 (3), 1197-1214.
  • Another object of the present invention is therefore also a method for producing a peptide according to the invention, in which the peptide is either chemically synthesized or, as already explained above, produced by genetic engineering.
  • the chemical synthesis takes place, for example, with the aid of the generally known Merrifield technique.
  • tissue-binding peptides can also be obtained according to the present invention by bringing one or more peptides into contact with a tissue and then isolating the bound peptide (s).
  • Another object of the present invention is therefore a method for finding a tissue-binding peptide comprising the following steps:
  • non-bound peptides are preferably, for example, by Wash the tissue with a suitable buffer solution.
  • peptide is preferably understood to mean peptides with a length of approximately 5 to approximately 40 amino acids, in particular with a length of approximately 5 to approximately 20 amino acids, especially with a length of approximately 10 to approximately 20 , particularly preferably with a length of about 10 to about 15 amino acids.
  • tissue is understood to mean cell dressings, in particular cell dressings including their intercellular substance, for example epithelial tissue, connective tissue, supporting tissue, muscle tissue or nerve tissue.
  • tissue also includes whole organs or parts thereof and vessels. The organs or vessels are preferably still "living" organs or vessels.
  • the intercellular substance is a substance embedded in the intercellular spaces, which contains a structure substance that appears to be without structure and fibrous connective tissue fibers. It was therefore completely surprising that tissue-binding peptides were found by bringing tissue into contact with one or more peptides, which peptides were essentially specific for the tissue used and were not predominantly based on non-specific structures, such as, for example. B. the intercellular substance were bound.
  • the specificity of the tissue-binding peptides can preferably be increased by repeatedly bringing the peptides isolated according to step (b) into contact with the tissue one or more times. After their respective isolation, the peptides are preferably brought into contact with the corresponding tissue up to 10 times. In this way, cross-specific peptides, which are specific for several tissue types, can also be found if the peptides are brought into contact with different tissues in succession. If, for example, the peptides are brought into contact in portions with both healthy and diseased tissue, a subtractive comparison can be used to find the peptides required for healthy or diseased tissue are specific. Peptides that are essentially only specific for diseased tissue are particularly advantageous, for example, for diagnosis, for example in the context of a PET examination.
  • tissue can be pathologically changed. So change e.g. smooth muscle cells in restenotic vascular areas their entire phenotype and change from the resting, secretory to the proliferative phenotype.
  • tissue-binding peptides can consequently also be found which can recognize tissue which is specifically pathologically altered under in vivo conditions. It is also advantageously possible to characterize pathological cell types in the tissue structure, which have not yet been adequately characterized, using the peptides selected according to the method of the invention, and to treat them, for example, with gene therapy.
  • a peptide bank for example a combinatorial peptide bank (see eg Colas, P. et al. (1996) supra), is used.
  • a peptide bank according to the present invention is understood to be a collection of several different peptides, which are present free or in bound form.
  • a peptide bank of free peptides contains a collection of chemically synthesized peptides. (see e.g. Geysen, H.M. et al. (1996) supra). Amino acid mixtures were used on the solid phase in peptide synthesis so that the amino acid sequence of the resulting peptides was statistically distributed. The peptide banks could also be used in resin-bound form (de Koster, H.S. et al. (1995) supra).
  • Peptides in bound form are also so-called, for example peptide presenting banks, e.g. B. a peptide-presenting phage bank or preferably a peptide-presenting bacterial bank, as already described in more detail above.
  • the peptides are presented in the form of a fusion protein on the surface of, for example, phages or bacteria.
  • Preferred fusions are insertions, preferably fusions with thioredoxin, with thioredoxin (TrxA) -flagellin (FliC), with the alpha subunit of G t , as already described in more detail above, or z. B. with LamB (Charbit, A. et al. (1988) Gene 70, 181-189) or Lpp-OmpA (Francisco, JA et al. (1993) Proc. Natl. Acad. Sci. USA 90, 10444-10448 ).
  • LamB Charge, A. et al. (19
  • peptide-presenting bacterial banks and in particular those with a thioredoxin fusion protein are particularly preferred especially for selection in an in vivo approximate perfusion model of isolated vessels and organs for the following reasons:
  • the peptides are presented as fusion proteins together with a protein, for example thioredoxin, the three-dimensional structure of which is generally known.
  • the randomized peptides are generally presented in a very accessible domain, which is on the surface of the total protein, such as the so-called "Cys-Cys active site loop" of thioredoxin. Because the peptide is generally sufficiently far from the bacterium and thus is presented in an easily accessible manner, a good interaction with the desired binding partner is generally made possible.
  • the peptides can also develop their effect in the form of fusion proteins with a protein having a therapeutic effect without essentially losing their binding capacity.
  • Peptides fused to the terminus of a protein and presented in this way in phage libraries generally lose their binding capacity as soon as they are expressed as fusion proteins together with a therapeutically active protein, which is for use in gene therapy is disadvantageous.
  • An important reason for this is that the peptides themselves have a free N or C terminus during the presentation which is available for binding. For this reason, it is particularly advantageous if the peptides are presented in the form of inserts into selected surface proteins by a peptide-presenting bank.
  • the E.coli thioredoxin is stable against proteases. Consequently, a protease-resistant protein in the form of a fusion protein with the peptide is particularly preferred, for example, for selection in the organ model perfused ex vivo, in particular since proteases can be located on the cells in the vessels. Especially organs, e.g. isolated perfused liver, but also tumors, release a high level of proteases that could cleave the fusion protein in the event of protease sensitivity.
  • the term “living” means organs or vessels that are still functional. To maintain functionality over a longer period of time, it is therefore advantageous if the organ or vessel is adequately supplied with oxygen and nutrient substrates
  • a nutrient solution which contains Ca 2+ , Mg 2+ and a protein, for example an albumin such as BSA (bovine serum albumin) is preferably suitable for this purpose, preferably the concentration of calcium ions 2.5 mM and magnesium ions 1.1 raM is preferably present in the nutrient solution in a concentration of 1% for the perfusion of isolated
  • BSA bovine serum albumin
  • the so-called Krebs-Henseleit solution which is composed as follows (data in raM), is particularly suitable for vessels and isolated organs: NaCl 116; KC1 4.6; MgSO 4 1.1; NaHCO 3 24.9; CaCl 2 2.5; KH 2 PO 4 1.2; Glucose 8.3; Pyruvate 2.0 and 1% BSA equilibrated with 95% O 2
  • a peptide-presenting bacterial bank was used in an in-vitro vascular perfusion model after a restenosis had previously been induced in a vessel on the whole animal (rat) by denuding the endothelium by means of a balloon catheter.
  • This method has the decisive advantages that the changes in the expression patterns of membrane-associated or membrane-bound proteins which occur as a result of pathological vascular processes are retained, the cell polarity does not change and all cells remain in their natural tissue structure.
  • the peptides found with the aid of the method according to the invention can, as already described in more detail above, be modified.
  • a suitable modification is, for example, a radioactive or non-radioactive label for use in a test system or diagnostic.
  • tissue-specific peptides that can be found using the method according to the invention, for example the tissue-specific transfer of substances, in particular pharmaceutically active compounds, especially for tissue-specific gene transfer.
  • Tissue-specific gene transfer is used, for example, for diagnosis and / or therapy of vascular and / or organ diseases with the aid of, for example, viral and / or non-viral vectors, preferably with the aid of liposomes, as already described in more detail above.
  • the peptide can be physically, chemically or be genetically linked to the desired nucleic acid (see above).
  • the peptide can either be combined with a therapeutic protein, e.g. B. nitric oxide synthase (see e.g. WO95 / 27020), insulin (see e.g. EP-B1-0 001 929), erythropoietin (see e.g. EP-B1-0 148 605), or blood coagulation factors , such as B. factor VIII, interferons, cytokines, hormones, growth factors, etc.
  • a therapeutic protein e.g. B. nitric oxide synthase (see e.g. WO95 / 27020), insulin (see e.g. EP-B1-0 001 929), erythropoietin (see e.g. EP-B1-0 148 605), or blood coagulation factors , such as B. factor VIII, interferons, cytokines,
  • Suitable coupling methods are e.g. B. about lysine residues or nucleocapsid proteins, as already explained in more detail above (see, for example, Harbottle, RP et al. (1998) supra or Bachmann, AS et a 1. (1998) supra). It when one or more tissue-binding peptides via a positively charged domain, for. B. polylysine, are bound to one or more nucleic acids.
  • a peptide which increases membrane permeation is also suitable for increasing membrane permeation during gene transfer, e.g. B. a hisitidine-containing polypeptide (see above).
  • a so-called polyfection solution containing a nucleic acid with the desired therapeutic gene, a fusion protein of tissue-specific peptide and a DNA-binding part, e.g. B. a positively charged domain, and a peptide that increases membrane permeation.
  • a suitable polyfection solution is described, for example, by Midoux, P. (1998) supra.
  • a coupling of the peptide to the liposomes via, for example, a C-terminal cysteine introduced to an activated lipid component, e.g. B. via MPB-PE,
  • the peptides according to the invention can also be used to change the tropism of viruses, preferably adenoviruses, for example for tissue-specific gene transfer. This is done, for example, by attaching the peptide via a suitable linker to the C-terminus of the Knob domain (see, e.g., Douglas, JT & Curiel, DT (1997) Neuromuscular Disorders 7, 284-298) or by exchanging the region responsible for binding in the knob domain of the fiber protein.
  • viruses preferably adenoviruses
  • the RGD motif in the hypervariable region of the penton base can be replaced by a cell-specific peptide analogous to the experiments carried out by Wickham with the FLAG epitope, preferably also the natural one Tropism can be switched off (see Wickham et al. (1996) J. Virol. 70, 6831).
  • the tropism can be changed, for example, via a shuttle plasmid which codes for the corresponding construct.
  • tissue-binding peptides Another possible use of the tissue-binding peptides is the use for the diagnosis of pathologically altered tissue, especially in a pathologically altered vessel, for inflammation, arteriosclerosis, vessels that supply tumor tissue, and tissue with proliferating smooth muscle cells of the vascular system, as well as the representation of different sections of the Vascular system, such as. B. small / large vessels, veins, organ-specific endothelium.
  • the diagnosis can either indirectly via z. B. Peptide-recognizing antibodies, for example, in a generally known ELISA test (see, for example, Voller, A. et al. (1976) Bull. World Health Organ., 53, 55-63) or directly by the tissue-binding Peptide is additionally marked.
  • the label can be a non-radioactive label, e.g. B. about biotin or avidin / streptavidin, or a radioactive label (see above).
  • a radioactive label is particularly useful for a whole-body examination of the patient using imaging methods such as e.g. B. PET (positron emission tomography) or SPECT (single photon emission computer tomography) for the diagnosis of, for example, inflammation, vascular changes or tumors, advantageous.
  • imaging methods such as e.g. B. PET (positron emission tomography) or SPECT (single photon emission computer tomography) for the diagnosis of, for example, inflammation, vascular changes or tumors, advantageous.
  • the labeled peptide is administered intravenously to the patient and the distribution of the peptide in the organism is analyzed, for example, using “whole-body PET”.
  • the present invention therefore furthermore relates to a medicament and / or test system, for example in the form of a diagnostic agent, comprising one or more peptides according to the invention or one or more peptides found by the method according to the invention, or one or more nucleic acids according to the invention, and, if appropriate, suitable ones Auxiliaries and / or additives.
  • a diagnostic agent comprising one or more peptides according to the invention or one or more peptides found by the method according to the invention, or one or more nucleic acids according to the invention, and, if appropriate, suitable ones Auxiliaries and / or additives.
  • Another object of the present invention also relates to a composition, for example in the form of a transfection or polyfection system, containing one or more peptides according to the invention or one or more peptides found by the method according to the invention, or one or more nucleic acids according to the invention and one further substance, preferably a pharmaceutically active compound, as already described in more detail above, and, if appropriate, suitable auxiliaries and / or additives.
  • a composition for example in the form of a transfection or polyfection system, containing one or more peptides according to the invention or one or more peptides found by the method according to the invention, or one or more nucleic acids according to the invention and one further substance, preferably a pharmaceutically active compound, as already described in more detail above, and, if appropriate, suitable auxiliaries and / or additives.
  • auxiliaries and / or additives are, for example, generally known protease or nuclease inhibitors.
  • Fig. 1 shows the carotid model from Clowes. After ligating the internal and external carotid arteries, a balloon catheter is inserted through the external carotid artery into the common carotid artery, dilated and the vessel denuded over a distance of 1 - 1.5 cm. The catheter is then removed again, the external carotid artery ligated and the internal carotid artery reopened.
  • Fig. 2 shows the selection of the peptides in the ex vivo perfused rat carotid.
  • 3 shows the relative binding strength of the peptide P36 to a dilated rat carotid, which was removed on the 8th postoperative day, in comparison to the untreated control carotid.
  • Figure 4 shows the binding constants of peptide P36 to primary aortic porcine endothelial cells (PAEC), primary porcine smooth muscle cells (VSMC) and monkey kidney cells (COS).
  • PAEC primary aortic porcine endothelial cells
  • VSMC primary porcine smooth muscle cells
  • COS monkey kidney cells
  • the endothelial cells were stimulated by LPS and TNF ⁇ (PAEC stimulated).
  • Tab. 1 shows the DNA sequences and peptide sequences derived therefrom of the isolated clones.
  • IMC medium contains (lxM9 salts, 0.2% (casamino acids, 0.5%
  • the bacteria contain an expression cassette which codes for a fusion protein of flagellin and thioredoxin.
  • the flagellin serves to anchor the fusion protein in the bacterial membrane, while the thioredoxin presents a foreign 12 amino acid long peptide in an exposed domain, the coding 36 base pair long oligonucleotide of which was cloned at the appropriate position in the coding sequence of the thioredoxin.
  • the oligonucleotide used for cloning was synthesized at random, so that the bacterial bank represents a total of 10 9 different peptides.
  • the expression cassette is under the control of the tryptophan promoter, so that the expression of the fusion protein can be switched on by the administration of tryptophan at the time of an exponentially growing bacterial culture. Since each bacterium only takes up one plasmid, only one type of peptide with a defined amino acid sequence is expressed from each bacterium and presented on the surface.
  • IMC medium 50 ml of IMC medium were mixed with 10 9 bacteria and incubated overnight at +25 ° C for 15 hours. The cell number was then determined by measuring the OD ⁇ , 10 ° cells were incubated in 50 ml IMC medium with 100 ⁇ g / ml ampicillin and the expression of the bacterial bank was induced by adding 100 ⁇ g / ⁇ l tryptophan. The cells were incubated for another 6 hours at 25 ° C before being used for selection.
  • Restenosis was induced in an established restenosis model in the rat (see, for example, Clowes, AW et al. (1983) Lab. Invest. 49, 327).
  • the common carotid artery in an anesthetized rat was freed from the endothelial cells by introducing a balloon catheter (denudation). This procedure stimulates the smooth vascular muscle cells to proliferate and changes their phenotype from the resting, secretory smooth muscle cell to the proliferating smooth muscle cell.
  • the vascular segment marked in FIG. 1 was dissected out and perfused in a special ex vivo perfusion system with a saline medium with the addition of glucose and gassing with oxygen. After an equilibration time of 10 min, which was used to wash out any blood cells and blood components, this vascular segment with a total of 10 10 peptide-presenting bacteria in oxygen-gassed saline medium with a flow of 0.2 ml / min. Recirculated perfused for 60 min. The non-binding bacteria were detached by treatment with saline medium and the specifically binding bacteria were eluted by perfusion for ten minutes under stringent conditions with 0.1 M glycine pH 2.0. The eluted bacteria were cultivated again and subjected to a further five selection cycles (see FIG. 2) in order to increase the specificity.
  • Rats weighing approximately 500 g were anesthetized by administering 100 ⁇ l / 100 g body weight Dormicum and 100 ⁇ l / 100 g body weight Hypnorm.
  • the carotid artery was then dissected cranially to the bifurcation, the internal carotid artery and all branches branching from it were ligated and the carotid communis was denuded starting from the external carotid about 2 cm along the common carotid with a 2F balloon catheter at 1 bar.
  • the internal carotid artery ligature was reopened postoperatively.
  • the denuded common carotid artery was dissected and ex vivo with 0.1 ml / min PBS perfused with 0.1 M glucose. Meanwhile, 10 ml of the tryptophan-induced bacterial suspension was centrifuged at 1000 rpm for 3 min, washed in PBS, centrifuged again and the sediment in 6 ml total volume of PBS, 0.1 M glucose, 0.1% BSA, 1 mM CaCl 2 , 10 mM MgCl 2 suspended. The carotid was then perfused recirculating with this suspension with gassing of oxygen at 0.2 ml / min for 1 h.
  • the suspension was then washed out by perfusion with 2-3 ml of PBS at 0.2 ml / min before the bound bacteria were eluted by elution with 3 ml of 0.1 M HCl (pH 2.2 adjusted with glycine) and in 50 ml of IMC Medium, 100 ⁇ g / ml ampicillin were grown overnight at +25 ° C.
  • bacteria were obtained which express peptides on their surface which bind specifically to proliferating smooth muscle cells.
  • the bacteria obtained after six selections were then plated on nutrient medium and cultures were grown from 60 individual colonies. From these cultured bacteria, the plasmid DNA was isolated and sequenced.
  • specifically binding peptides could be detected using a method closest to the in vivo situation (organ culture model).
  • the sequence of peptide 36 shows homologies to the ⁇ 4 integrin, which is expressed on leukocytes and is responsible for the attachment of the leukocytes to activated vascular cells. The recognition is mediated by the vascular cellular adhesion molecule VCAM-1. The homology is not in the area that is characterized as the binding area of the integrin (RGD-Motif). 6. Attachment studies
  • the peptide from clone 36 (peptide 36) used for the binding studies was produced using the Fast-Moc solid-phase synthesis on a fully automatic peptide synthesizer from Applied Biosystems on a 0.1 mmol scale.
  • the peptide was radioactively labeled to determine the binding affinities to the desired cell type.
  • the N-terminal amino acid (glycine) was used for the radioactive labeling.
  • 14 C-gycin was protected with activated N-fluorenyl-methoxycarbonyl-succinimide, purified and coupled covalently N-terminally to the peptide located on the resin and protected in the side chains by means of dicyclohexyl-carbodiimide.
  • the peptide was then cleaved from the resin, purified by HPLC and examined for binding to the target cells in the perfused vessel model and in the cell culture.
  • the mixture was then left to stand at room temperature overnight, the aqueous phase was acidified by adding 2 M HCl and extracted twice with 10 ml of ethyl acetate each time.
  • the combined ethyl acetate phases were washed neutral with water several times, dried with MgSO 4 and the product was precipitated by adding petroleum ether and filtered off.
  • the product was dissolved in ethyl acetate and slowly precipitated by adding small amounts of petroleum ether.
  • the labeled Fmoc-Glycine was used for the synthesis of a total of 0.4 mmol peptide, so that each peptide was labeled 75%.
  • the appropriate amount of the resin / peptide mixture (0.1 mmol) was weighed out and placed in a glass frit with a stopper and a tap. 25 mg of the I4 C-Fmoc glycine (0.075 mmol) were dissolved in 1 ml of NMP, 155 ⁇ l of 0.45M HBTU / HOBt and 750 ⁇ l of 2 M DIEA in NMP were added to the resin / peptide mixture and added for one hour incubated with gentle shaking at room temperature.
  • Fmoc-glycine 150 mg were then dissolved in 2 ml of NMP, 2 ml of 0.45M HBTU / HOBt and 1 ml of 2M DIEA were added and the mixture was added to the reaction mixture. The mixture was 30 min. incubated at room temperature, the unreacted Fmoc-glycine filtered off and the mixture washed four times with 6-10 ml of NMP each. The protective group was split off by incubation for 30 minutes with 22% piperidine in NMP with stirring. The piperidine was filtered off, and the resin / peptide mixture was then washed four times with NMP and DCM.
  • the mixture was ice-cooled and treated with a solution of 0.75 g phenol, 0.25 ml EDT, 0.5 ml thioanisole, 0.5 ml water and 10 ml of TFA are added with stirring.
  • the mixture was then incubated for two hours at room temperature with stirring, the peptide released was filtered off and precipitated by adding five times the volume of ice-cooled diethyl ether. After centrifugation, the peptide in the sediment was washed several times with dieethyl ether and centrifuged again.
  • the peptides were chromatographed using an ⁇ kta Purifier 100 over an RPC resource column (3 ml, Pharmacia) with a 20 minute gradient of water, 0.1% TFA to 95% acetonitrile, 0.07% TFA at a flow rate of 2 ml / min cleaned and then lyophilized.
  • the vessels or the cells were incubated for different time intervals with different concentrations of the peptides to be examined and the amount of bound peptide per cm vessel or per cell number was determined.
  • the peptide 36 binds approximately four times more strongly to the dilated carotid than to the untreated control in the ex vivo perfusion.
  • PAEC porcine endothelial cells
  • LPS lipopolysaccharides
  • TNF ⁇ tumor necrosis factor
  • the peptide was able to bind specifically to smooth muscle cells (VSMCs) as well as to activated PAECs. Surprisingly, the peptide binds even more strongly to activated PAECs than to VSMCs. In addition, the binding constants of the peptide differ from activated and non-activated PAECs by almost 3 orders of magnitude (FIG. 4). The peptide practically does not bind to control cells (COS).
  • COS control cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Vascular Medicine (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Cardiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Urology & Nephrology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die vorliegende Erfindung bezieht sich auf gewebebindende Peptide mit der Aminosäuresequenz GEGRTVVLSF, AWCRGGILGDAM, GNLVDLVVGFDD, RVSPPKKSGGGV, GSSKWGLTXKCG, RGGVRQRSRGRR, GEGRTVVCRS oder SQRWTALWQWIG sowie Varianten davon, ihre Identifizierung mit Hilfe von Geweben, ihre Herstellung und Verwendung als Arzneimittel oder Diagnostikum.

Description

Gewebebindende Peptide, ihre Identifizierung, Herstellung und Verwendung
Die vorliegende Erfindung bezieht sich auf gewebebindende Peptide, ihre Identifizierung mit Hilfe von Geweben, ihre Herstellung und Verwendung als Arzneimittel oder Diagnostikum.
Die Pathogenese der Arteriosklerose wird zunehmend zunehmend auf eine Schädigung des Endothels, die in einer endothelialen Dysfunktion resultiert, zurückgeführt. Eine endotheliale Dysfunktion spiegelt sich vor allem in einem veränderten Expressionsmuster von Oberflächenproteinen (Selektinen, Adhäsionsmoleküle) aber auch in veränderten Syntheseraten von Wachstumshormonen wieder. So führt z. B. im frühen Stadium der Arteriosklerose eine erhöhte Expression der E- und P-Selektine und der zellulären Adhäsionsmoleküle VCAM und ICAM zur Einwanderung von Monocyten in die Gefäßwand. Die Umwandlung der Monocyten in Makrophagen führt zu einer veränderten Synthese von Wachstumsfaktoren, die insbesondere glatte Muskelzellen zur Proliferation und zur Freisetzung von Mediatoren, die inflammatorisch wirken, anregen.
Die medikamentöse Therapie der Arteriosklerose versucht die Ursachen frühzeitig, möglichst vor der Manifestation zu verringern. Ein Hauptziel ist dabei, durch eine Erhöhung der Ausscheidung der Cholesterinmetabolite (Gallensäuren) oder durch eine Verminderung der Cholesterinbiosynthese den erhöhten Plasmacholesterinspiegel zu reduzieren. Aufgrund der vom Organismus eingeleiteten Gegenregulation läßt sich mit einer medikamentösen Therapie der Gesamtcholesterinspiegel nur um ca. 30% senken. Da dieses Verfahren außerdem nicht geeignet ist, eine Regression einer bestehenden Arteriosklerose zu induzieren, ist die perkutane, transluminale Angioplastie (PTA), d. h. die Aufweitung des stenosierten Gefäßabschnittes mittels eines Ballonkatheters, heutzutage die Therapie der Wahl. Nachteil dieser Therapieform ist jedoch, daß es in 30-50% der behandelten Patienten zu einer Restenose, d. h. zu einem Wiederverschluß kommt. Alternativ erfolgt daher eine chirurgische Behandlung, indem ein Bypass gelegt wird. Aber auch bei dieser Therapie tritt bei ca. 50% der Patienten innerhalb von 3- 6 Monaten nach der Behandlung eine Restenosierung des Bypass-Gefäßes auf.
Es wurden daher eine Reihe von gentherapeutischen Verfahren entwickelt, bei denen ein zweiter Katheter verwendet wird, über den ein gentherapeutisch wirkender Vektor lokal an den betroffenen Gefäßabschnitt appliziert wird (siehe z. B. WO95/27070).
Für die lokale Applikation des therapeutischen Gens wurden verschiedene Strategien auf der Basis von modifizierten Ballonkathetern entwickelt, die eine direkte Applikation einer Substanz bzw. des Gens in die Gefäßwand erlauben sollen. Nach einer lokalen Applikation mit einem Doppelballonkatheter konnten z. B. Nabel, E. R. et al. (1990) Science 249, 1285 eine transiente Expression des ß- Galactosidasegens in transfizierten Zellen der Femoralarterie des Schweines durch liposomale und retrovirale Transfektion nachweisen. Eine langandauernde Expression (bis zu 5 Monaten) konnten sie jedoch nur nach retroviraler Transfektion erzielen, während eine Expression in liposomal transfizierten Zellen nur bis zu 4 Wochen nachweisbar war. Neben der Transfektionsdauer ist vor allem die geringe Transfektionseffizienz ein limitierender Faktor des liposomalen Transfers. Die Transfektionseffizienz konnte beispielsweise durch die Verwendung von HVJ-Liposomen gesteigert werden (Morishita, R. et al. (1994) Gene 149, 13). In diesem System werden inaktivierte Sendaiviren (hemagglutinating virus of Japan, HVJ) mit DNA-haltigen Liposomen fusioniert. Aufgrund der viralen Fusions- und Bindeproteine (F- und HN-Protein) kann das genetische Material unter Umgehung der Lysosomen direkt ins Cytoplasma der Zelle effizient eingeschleust werden. Schließlich gibt es die Möglichkeit zellspezifische Antikörper an liposomale (Vingerhoeds, H. et al. (1994) Immunmeth. 4, 259) oder virale (Wickha , T. J. et al. (1996) J. Virol. 70, 6831) Vektoren zu koppeln, um das unter der Kontrolle eines starken, viralen Promoters stehende therapeutische Gen gezielt nur in den gewünschten Zelltyp einschleusen zu können.
Nachteil dieser Verfahren ist jedoch, daß zum einen ein zusätzlicher Eingriff notwendig ist und zum anderen die Effizienz des lokalen Gentransfers im Organismus im allgemeinen nicht sehr hoch ist. Schließlich werden mit einem Katheter nicht alle Gefäße erreicht, insbesondere nicht die kleinkalibrigen Arterien und Kapillaren. Dies ist insofern von Bedeutung, da arteriosklerotische Wandveränderungen nicht nur die großen Gefäße betreffen, sondern auch in kleineren Arterien vorkommen.
Die Optimierung einer gewebespezifischen Expression ist insbesondere für die Therapie von vaskulären Erkrankungen von großer medizinischer Bedeutung. Dabei eröffnen sich nicht nur Möglichkeiten direkte Gefäßerkrankungen, wie z. B. Arteriosklerose und deren Folgeerkrankungen (Stenose, Restenose, Herzinfarkt) zu therapieren, sondern auch alle über die Blutbahn zu erreichenden Organe sowie Tumore. Letztendlich kann über einen gewebegerichteten Gentransfer in vaskuläre Zellen auch die Expression von therapeutischen Proteinen erfolgen, die aufgrund pathologischer oder genetischer Veränderungen im Zielorganismus nicht oder nicht mehr im ausreichenden Maße vorhanden sind, z. B. Faktor VIII-Mangel, Insulinmangel etc.
Ein wesentliches Ziel der somatischen Gentherapie ist es daher, ein therapeutisches Gen nach systemischer oder lokaler Administration so spezifisch wie möglich in die Zielzellen des Organismus einzuschleusen und das therapeutische Gen im wesentlichen nur in diesen Zellen zu exprimieren. Hierzu sollte das therapeutische Gen einerseits so verpackt sein, daß es beim Transport durch das Blutgefäßsystem durch Nukleasen im wesentlichen nicht abgebaut wird, und andererseits sollte es in eine Form vorliegen, die eine zellspezifische Genexpression in den Zielzellen ermöglicht. Das spezifische Erkennen von Zellen bezeichnet man auch als „Targeting". Für dieses Targeting stehen grundsätzlich zwei Möglichkeiten zur Verfügung: zum einen kann man Antikörper gegen Rezeptoren an der Zelloberfläche verwenden, die in virale oder liposomale Vektorsysteme integriert sind (Vingerhoeds, H. et al (1994) supra; Wickham, T. J. (1996) supra), und zum anderen kann man Peptide mit hoher Bindungsaffinität für Rezeptoren auf der Zelloberfläche verwenden.
Mit bestimmten Antikörpern konnten beispielsweise bestimmte Tumorzellen erkannt und mittels einer geeigneten Markierung sogar im intakten Gewebeverband nachgewiesen werden. Ein wesentlicher Nachteil von Antikörpern ist jedoch, daß sie aus technischen Gründen meist in der Maus hergestellt werden und an Patienten oft zu schwerwiegenden Nebenwirkungen aufgrund einer Immunreaktion führen. Selbst sogenannte humanisierte Antikörper sind nicht frei von diesem Problem. In Einzelfällen kann es zu solch ausgeprägten Immunkomplexen kommen, die die Durchblutung der Niere drastisch einschränken und so zu einer tödlich verlaufenden Niereninsuffizienz führen.
Mit peptidpräsentierenden Banken konnten beispielsweise Interaktionen von Proteinen mit anderen Makromolekülen wie Zuckern, Antikörper, Lipiden oder Proteinen in vitro studiert werden. Peptidpräsentierende Banken, die chemisch hergestellt werden, wurden z. B. von Geysen, H. M. et al. (1996) Mol. Immunol. 23, 709 oder de Koster, H. S. (1995) J. Immunol. Methods 187, 179-188 beschrieben. Bei der Peptidsynthese wurden an der Festphase Aminosäuregemische verwendet, so daß die Aminosäurenabfolge der sich ergebenden Peptide statistisch, d. h. zufallsmäßig verteilt war. Die Peptidbanken konnten hierbei auch in Harzgebundener Form verwendet werden (de Koster, H. S. et al. (1995) supra).
Mit der Verwendung von peptidpräsentierenden Banken, die beispielsweise auf der Präsentation der Peptide auf der Oberfläche von Phagen beruhen, wurde es möglich, eine Vielzahl verschiedener Peptide (bis zu ca. 10" Peptide) gleichzeitig zu präsentieren. Dabei werden die Peptide z. B. am N-Terminus des pIII Hüllproteins filamentöser Phagen präsentiert (siehe z. B. Kay, B. K. et al. (1993) Gene 128, 59 oder Jellis, C. L. et al. (1993) Gene 137, 63-68). Die Länge der präsentierten Peptide variierten von 6 bis 38 Aminosäuren. Die Phagenbanken wurden unter anderem zum Epitopscreening von Antikörpern (Cortese, R. et al. (1994) Trends Biotechnol. 12, 262; Grihalde, N. D. et al. (1995) Gene 166, 187), zur Charakterisierung von protein- bzw. peptidbindenden Domänen (Adey, N. B. & Kay, B. K. (1996) Gene 169, 133; Blond-Elguindi, S. et al. (1993) Cell 75, 717- 728; Balass, M. et al. (1993) Proc. Natl. Acad. Sei. USA 90, 10638-10642), zur Entdeckung von DNA-bindenden Motifen (Wang, B. et al. (1995) J. Biol. Chem. 270, 23239), zur Identifizierung von unbekannten Rezeptoren, die z. B. an virale Bindungsproteine binden (Hong, S. S. & Boulanger, P. (1995) EMBO J. 14, 4714), zur Identifizierung von proteinbindenden Peptiden (Daniels, D. A. & Lane, D. P. (1994) J. Mol. Biol. 243, 639-652; Hong, S. S. & Boulanger, P. (1995) EMBO J. 14, 4714-4727, No. 19) oder antigenbindenden Einzelketten-Fv(scFv)-Fragmenten (Vaughan, T. J. et al. (1996) Nature Biotechnology 14, 309-314) verwendet und zum Targeting von Zellen (Barry, M. A. et al. (1996) Nature Medicine 2, 299-305, No. 3) vorgeschlagen.
Neben peptidpräsentierenden Phagenbanken sind peptidpräsentierende Bakterienbanken bekannt. Ein Beispiel hierzu sind Fusionen einer kombinatorischen Peptidbank mit Thioredoxin, was zur Identifizierung von Peptidaptameren führte, die die Cyclin-abhängige Kinase 2 erkennen (Colas, P. et al. (1996) Nature, 380, 548-550). Das Durchsuchen einer kombinatorischen Peptidbank wurde z. B. auch mit Fusionen an den C-Terminus der alpha-Untereinheit von G, (340-350) zur Identifizierung von Rhodopsin-bindenden Sequenzen (Martin, E. L. et al. (1996) J. Biol. Chem. 271, 361-366, No. 1) durchgeführt. Ein anderes Beispiel sind Peptidinsertionen in einem Thioredoxin-Flagellin-Fusionsprotein, welches auf der E. coli Zelloberfläche präsentiert wird, womit Protein-Protein-Wechselwirkungen untersucht werden können (Lu, Z. et al. (1995) Bio/Technology 13, 366-372; U.S. Pat. No. 5,635,182).
Die oben beschriebenen Anwendungen der peptidpräsentierenden Banken beschränkten sich jedoch auf in vitro Untersuchungen mit isolierten und gereinigten Komponenten (Zucker, Proteine, Antikörper). Aufgabe der vorliegenden Erfindung war es daher, ein Mittel zu finden, das eine gezielte und möglichst schonende Behandlung und Diagnose von erkrankten Organen ermöglicht.
Ein Gegenstand der vorliegenden Erfindung ist daher ein gewebebindendes Peptid ausgewählt aus einem Peptid mit der Aminosäuresequenz
GEGRTVVLSF, AWCRGGILGDAM, ' GNLVDLVVGFDD, RVSPPKKSGGGV, GSSKWGLTXKCG, RGGVRQRSRGRR, GEGRTVVCRS oder SQRWTALWQWIG sowie Varianten davon.
Unter Varianten versteht man gemäß der vorliegenden Erfindung Deletionen, Additionen oder Substitutionen von einer oder mehreren Aminosäuren, wobei die gewebespezifische Bindung des Peptids im wesentlichen nicht verändert wird, d. h. das Peptid hat nach wie vor seine Fähigkeit behalten, an ein bestimmtes Gewebe besser zu binden als an ein anderes.
Im Falle einer Deletion werden vorzugsweise nicht mehr als 4 Aminosäuren, vor allem nicht mehr als 2 Aminosäuren deletiert. Die Deletion erfolgt vorzugsweise am N- oder am C-Terminus des Peptids, insbesondere am N-Terminus.
Unter dem Begriff Addition versteht man gemäß der vorliegenden Erfindung nicht nur die Addition von einer oder mehreren Aminosäuren, beispielsweise von 1-25 Aminosäuren, sondern auch Fusionsproteine von dem erfindungsgemäßen Peptid mit einem anderen C- und/oder N-terminalen Peptid oder Protein. Beispielsweise führt eine Fusion eines gewebespezifischen Peptids mit einem Peptid, das mehrere Histidine enthält, beispielsweise das Peptid GLFHAIAHFIHGGWHGLIHGWYG nicht nur zur einer gewebespezifischen Bindung, sondern auch zu einer Permeabilisierung der Zellmembran bei leicht saurem pH (siehe z. B. Midoux, P. et al. (1998) Bioconjugate Chem. 9, 260-267). Besteht ein Fusionsprotein beispielsweise aus dem erfindungsgemäßen Peptid und mehreren Lysinen, beispielsweise 16 Lysinen in Abfolge oder dem Nucleocapsidprotein (NCp) 7 von HIV-1 oder NCp7-abgeleitete Peptide, so kann an das erfindungsgemäße Peptid besonders einfach eine Nukleinsäure, beispielsweise eine DNA enthaltend ein therapeutisches Gen, komplexiert werden (siehe z. B. Harbottle, R. P. et al. (1998) Human Gene Therapy 9, 1037-1047 oder Bachmann, A. S. et al. (1998) J. Mol. Med. 76, 126- 132). Gemäß der vorliegenden Erfindung kann somit beispielsweise auch ein Fusionsprotein hergestellt werden, das ein gewebespezifisches Peptid, ein die Permeabilisierung der Zellmembran bewirkendes Peptid und ein Nukleinsäure- bindendes Peptid enthält, was besonders vorteilhaft ist.
Im Falle von Substitutionen werden vorzugsweise konservative Substitutionen verstanden, d. h. Substitutionen, bei denen beispielsweise eine oder mehrere Aminosäuren mit einer hydrophoben Seitenkette durch eine oder mehrere andere Aminosäure mit einer anderen hydrophoben Seitenkette ausgetauscht werden. Beispiele von Aminosäuren mit hydrophoben Seitenketten sind Glycin, Valin, Leucin, Isoleucin, Methionin, Phenylalanin, Tryptophan oder Prolin. Ebenso können Aminosäuren mit einem polaren neutralen Rest untereinander ausgetauscht werden. Beispiele hierzu sind Serin, Threonin, Cystein, Tyrosin, Asparagin oder Glutamin. Ferner können Aminosäuren mit einem polaren sauren Rest untereinander ausgetauscht werden. Beispielsweise fallen hierunter Asparaginsäure oder Glutaminsäure. Auch können Aminosäuren mit einem polaren basischen Rest untereinander ausgetauscht werden, wie z. B. Lysin, Arginin oder Histidin. Vorzugsweise werden nicht mehr als bis zu 4 Aminosäuren, insbesondere nicht mehr als bis zu 2 Aminosäuren, vor allem nicht mehr als eine Aminosäure substituiert.
Unter dem Begriff Aminosäure versteht man gemäß der vorliegenden Erfindung nicht nur die in Proteinen natürlich vorkommenden Aminosäuren, sondern auch andere in eine Peptidkette einbaubaren Aminosäuren, wie z. B. Hydroxylysin, Hydroxyprolin, Ornithin, Citrullin oder Homocystein.
Die einzelnen Aminosäuren des erfindungsgemäßen Peptids können auch modifiziert sein. Beispielsweise kann durch eine Modifizierung das Peptid markiert und/oder geschützt werden. Eine geeignete Markierung ist beispielsweise der Austausch der Hydroxylgruppe von Threonin oder Serin mit dem Isotop 18F, das eine Halbwertszeit von 2 Stunden besitzt, und daher gut im Klinikbetrieb verwendet werden kann. Alternativ kann das Peptid auch am Carboxyterminus über eine Fluorethylamidbindung mit l8F markiert werden. Die C-terminale Fluoramidierung erfolgt beispielsweise mit Fluorethylamin und einem Harnstoffderivat (z. B. TBU) zur Aktivierung.
Eine andere geeignete Markierung ist die Markierung von Cystein oder Methionin mit dem Schwefelisotop 35S. Das Isotop 35S hat gegenüber dem Isotop 18F den Vorteil, daß es eine längere Halbwertszeit besitzt.
Das erfindungsgemäße Peptid kann auch mit anderen Verbindungen markiert werden, beispielsweise mit ß-Galaktosidase oder Biotin bzw. Avidin/Streptavidin. Eine radioaktive Markierung mit insbesondere kurzlebigen Isotopen hat jedoch den Vorteil, daß die Struktur des Peptids im wesentlichen unverändert bleibt und die Verteilung des Peptids im Organismus beispielsweise mit Hilfe der Positronen- Emissions-Tomographie (PET) auf vorteilhafte Weise analysiert werden kann.
Für eine Markierung ist es im allgemeinen vorteilhaft, wenn die funktionellen Seitenketten der Aminosäuren vorher geschützt werden. Beispielsweise wird hierzu das Peptid an der Festphase mit Hilfe eines säurelabilen Harzes (z. B. SASRIN, ein 2-Methoxy-4-alkoxybenzylalkoholharz, Frechet, J.M.J. et al. (1979) Polymer 20, 675) vom C- zum N-Terminus mittels der FastMocΘ-Methode (Merrifield, R.B. (1963) J. Am. Chem. Soc. 95, 1328; Wang, S.S. (1973) J. Am. Chem. Soc. 95, 1328; Perkin-Elmer Applied Biosystems, Foster City, CA) synthetisiert. Auf diese Weise kann das Peptid vom Harz unter Bedingungen abgespalten werden, bei denen sowohl die Seitenkettenschutzgruppen als auch die N-terminale Schutzgruppe (Fmoc, N-Fluorenylmethoxycarbonyl) stabil bleiben. Anschließend kann die Markierung beispielsweise mit 18F erfolgen. Danach erfolgt im allgemeinen die Abspaltung der Schutzgruppen und die Reinigung über HPLC. Ein anderer Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure kodierend für ein erfindungsgemäßes gewebebindendes Peptid. Besonders bevorzugt ist eine Nukleinsäure ausgewählt aus einer Nukleinsäure mit der Nukleotidsequenz
GGCGAGGGGCGAACAGTCGTATTGTCGTTCG,
GCCTGGTGTCGGGGGGGTATCCTGGGCGACGCTATG, GGAAACCTGGTGGATCTAGTTGTGGGTTTTGACGAC, CGGGTGAGTCCGCCAAAGAAGTCGGGGGGCGGCGTG, GGGAGTAGCAAGTGGGGATTGACTTAAAAATGTGGG, CGCGGGGGAGTCCGCCAAAGAAGTCGGGGGCGGCGT,
GGCGAGGGGCGAACAGTCGTATGTCGTTCG oder TCCCAGAGGTGGACTGCACTCTGGCAATGGATCGGG sowie Varianten davon.
Unter dem Begriff Varianten versteht man gemäß der vorliegenden Erfindung insbesondere Varianten, die aufgrund der Degenerierung des genetischen Codes für dasselbe Peptid kodieren. Unter dem Begriff Varianten versteht man jedoch auch die zu den aufgeführten Desoxyribonukleinsäuren (DNA) korrespondierenden Ribonukleinsäuren (RNA). Auch kann die DNA bzw. RNA modifiziert sein, um z. B. besser gegenüber Nukleasenabbau geschützt zu sein. Geeignete Modifikationen finden sich z. B. bei Uhlmann, E. & Peyman A. (1990) Chemical Reviews 90, 543- 584 No. 4.
Eine weitere Ausführungsform der vorliegenden Erfindung betrifft einen Vektor enthaltend eine oder mehrere erfindungsgemäße Nukleinsäuren. Ein Vektor kann beispielsweise ein Expressionsvektor zur Herstellung der erfindungsgemäßen Peptide in prokaryotischen oder eukaryotischen Zellen sein. Beispiele für prokaryotische Expressionsvektoren sind für die Expression in E. coli z. B. die Vektoren pGEM oder pUC -Derivate und für eukaryotische Expressionsvektoren für die Expression in Saccharomyces cerevisiae z. B. die Vektoren p426Met25 oder p426GALl, für die Expression in Insektenzellen z. B. Baculovirus- Vektoren wie in EP-B1-0 127 839 oder EP-B1-0 549 721 offenbart, und für die Expression in Säugerzellen z. B. die Vektoren Rc/CMV und Rc/RSV oder SV40- Vektoren, welche alle allgemein erhältlich sind.
Im allgemeinen enthalten die Express ionsvektoren auch für die jeweilige Wirtszelle geeignete Promotoren, wie z. B. den trp-Promotor für die Expression in E. coli (siehe z. B. EP-B1-0 154 133), den ADH2-Promotor für die Expression in Hefen (Rüssel et al. (1983), J. Biol. Chem. 258, 2674-2682), den Baculovirus-Polyhedrin- Promotor für die Expression in Insektenzellen (siehe z. B. EP-B1-0 127 839) oder den frühen SV40 Promotor oder LTR-Promotoren z. B. von MMTV (mouse mammary tumour virus; Lee et al. (1981) Nature 214, 228-232).
Beispiele von gentherapeutisch wirksamen Vektoren sind Virusvektoren, vorzugsweise Adenovirusvektoren, insbesondere replikationsdefiziente Adenovi- rusvektoren, oder Adenoassoziierte Virusvektoren, z. B. ein Adenoassoziierter Virusvektor, der ausschließlich aus zwei invertierten terminalen Wiederho- lungssequenzen (ITR) besteht.
Beispielsweise wird in adenoviralen Vektoren, insbesondere vom Typ 5 (Sequenz siehe Chroboczek, J. et al. (1992) Virol. 186, 280 - 285) und vor allem von der Untergruppe C, im allgemeinen die El-Genregion durch ein Fremdgen mit eigenem Promotor bzw. durch die erfindungsgemäße Nukleinsäure ersetzt. Durch den Austausch der El-Genregion, welche für die Expression der nachgeschalteten adenoviralen Gene Voraussetzung ist, entsteht ein nicht replikationsfähiges Adenovirus. Diese Viren können sich dann nur in einer Zellinie vermehren, welche die fehlenden El-Gene ersetzt.
Replikationsdefiziente Adenoviren werden daher im allgemeinen durch homologe Rekombination in der sogenannten 293-Zellinie (humane embryonale Nierenzellinie), die eine Kopie der El-Region stabil im Genom integriert hat, gebildet. Hierzu werden unter Kontrolle eines geeigneten Promotors die erfindungsgemäße Nukleinsäure in rekombinante adenovirale Plasmide kloniert. Anschließend erfolgt die homologe Rekombination mit einem El-defizienten adenoviralen Genom, wie z.B. dl327 oder dell324 (Adenovirus 5), in der Helferzellinie 293. Bei erfolgreicher Rekombination werden virale Plaques geerntet. Die so erzeugten replikationsdefizienten Viren werden in hohen Titern (beispielsweise 10° bis 10" "plaque forming units" oder plaquebildenden Einheiten) zur Infektion der Zellkultur oder für die somatische Gentherapie eingesetzt.
Im allgemeinen ist die genaue Insertionsstelle der erfindungsgemäßen Nukleinsäure in das adenovirale Genom nicht kritisch. Es ist z.B. auch möglich, die erfindungsgemäße Nukleinsäure an die Stelle des deletierten E3-Gens zu klonieren (Karlsson, S. et al. EMBO J. 5, 1986, 2377 - 2385). Vorzugsweise wird jedoch die El-Region oder Teile davon, z.B. die EIA- oder EIB-Region (siehe z.B. WO 95/00655) durch die erfindungsgemäße Nukleinsäure ersetzt, vor allem, wenn auch die E3-Region deletiert ist. Desweiteren eignen sich adenovirale Vektoren der dritten Generation, d. h. Vektoren, die außer dem ITR und dem Verpackungssignal keine weiteren für virale Proteine kodierenden Sequenzen enthalten (Kochanek, S. (1996) Proc. Natl. Acad. Sei. USA 93, 5731). Die Rekombination in der Helferzellinie erfolgt z. B. mit Hilfe eines Helferplasmids.
Die vorliegende Erfindung ist jedoch nicht auf das adenovirale Vektorsystem beschränkt, sondern auch Adeno-assoziierte Virusvektoren eignen sich in Kombination mit der erfindungsgemäßen Nukleinsäure in besonderer Weise, da der Transfer der erfindungsgemäßen Nukleinsäure in ruhende, differenzierte Zellen durch AAV erfolgen kann, was für die Behandlung von Gefäßerkrankungen besonders vorteilhaft ist. Für die Vektorfunktionen genügen im allgemeinen die beiden ca. 145 bp langen invertierten terminalen Wiederholungssequenzen (ITR: inverted terminal repeats; siehe z.B. WO 95/23867). Sie tragen die in "eis" notwendigen Signale für Replikation, Verpackung und Integration in das Wirtszellgenom. Durch die Integrationsfähigkeit kann eine lang anhaltende Genexpression in vivo gewährleistet werden, was wiederum besonders vorteilhaft ist. Ein weiterer Vorteil von AAV ist, daß das Virus nicht pathogen für den Menschen und relativ stabil in vivo ist. Die Klonierung der erfindungsgemäßen Nukleinsäure in den AAV- Vektor oder Teilen davon erfolgt nach dem Fachmann bekannten Methoden, wie sie z.B. in der WO 95/23867, bei Chiorini, J.A. et al. (1995), Human Gene Therapy 6, 1531 - 1541 oder Kotin, R.M. (1994), Human Gene Therapy 5, 793 - 801 beschrieben sind.
Gentherapeutisch wirksame Vektoren lassen sich auch dadurch erhalten, daß man die erfindungsgemäße Nukleinsäure mit Liposomen (neutral oder kationisch) komplexiert, d.h. die Nukleinsäure ist im wesentlichen in das Liposom eingeschlossen, da damit eine sehr hohe Transfektionseffizienz, insbesondere von Herzmuskelzellen, erreicht werden kann (siehe z. B. WO95/27070) und die Nukleinsäure im wesentlichen vor DNasen geschützt ist. Besonders vorteilhaft ist die Transfektion mit Nukleinsäure-Liposomen-Komplexen mit Hilfe von Sendai Viren in Form sogenannter HVJ-Liposomen (Virosomen), da hierdurch die Transfektionsrate noch weiter gesteigert werden kann.
Bei der Lipofektion werden kleine unilamellare Vesikel aus kationischen Lipiden durch Ultraschallbehandlung der Liposomensuspension hergestellt. Die Nukleinsäure wird ionisch auf der Oberfläche der Liposomen gebunden, und zwar in einem solchen Verhältnis, daß eine positive Nettoladung verbleibt und die Nukleinsäure zu 100% von den Liposomen komplexiert wird. Neben den von Feigner et al. ( Feigner, P. L. et al. (1987) Proc. Natl. Acad. Sei USA 84, 7413- 7414) eingesetzten Lipidmischungen DOTMA (l,2-Dioleyloxypropyl-3-trimefhyl- ammoniumbromid) und DOPE (Dioleoylphosphatidylethanolamin) wurden inzwischen zahlreiche neue Lipidformulierungen synthetisiert und auf ihre Effizienz der Transfektion verschiedener Zellinien getestet (Behr, J.P. et al. (1989), Proc. Natl. Acad. Sei. USA 86, 6982 - 6986; Feigner, J.H. et al. (1994) J. Biol. Chem. 269, 2550 - 2561; Gao, X. & Huang, L. (1991), Biochim. Biophys. Acta 1189, 195 - 203). Beispiele der neuen Lipidformulierungen sind DOTAP N-[l-(2,3-Dioleoy- loxy)propyl]-N,N,N-trimethylammoniumethylsulfat oder DOGS
(TRANSFECTAM; Dioctadecylamidoglycylspermin). Ein Beispiel für die Herstellung von DNA-Liposomenkomplexen aus Phosphatidylcholin, Phosphatidylserin und Cholesterin und deren erfolgreiche Anwendung in der Transfektion von Gefäßwänden mit Hilfe von Sendai- Viren ist in der WO95/27070 beschrieben. Besonders vorteilhaft ist es, wenn der Nukleinsäure-Liposomenkomplex Nukleinsäure-Bindeproteine, beispielsweise chromosomale Proteine, vorzugsweise HMG-Proteine (High Mobility Group Proteine), insbesondere HMG-1 oder HMG- 2, oder nukleosomale Histone wie H2A, H2B, H3 oder H4 enthält, da hierdurch die Expression der gewünschten Nukleinsäure mindestens 3-10fach gesteigert werden kann. Die chromosomalen Proteine können beispielsweise aus Kalbsthymus oder Rattenleber nach allgemein bekannten Verfahren isoliert oder gentechnisch hergestellt werden. Humanes HMG-1 kann beispielsweise nach dem Fachmann bekannten Methoden besonders einfach gentechnisch unter Verwendung der humanen cDNA-Sequenz aus Wen, L. et al. (1989) Nucleic Acids Res., 17(3), 1197-1214, hergestellt werden.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher auch ein Verfahren zur Herstellung eines erfindungsgemäßen Peptids, bei dem das Peptid entweder chemisch synthetisiert oder, wie oben bereits erläutert, gentechnisch hergestellt wird. Die chemische Synthese erfolgt beispielsweise mit Hilfe der allgemein bekannten Merrifield-Technik.
Gewebebindende Peptide können jedoch auch gemäß der vorliegenden Erfindung dadurch gewonnen werden, daß ein oder mehrere Peptide mit einem Gewebe in Kontakt gebracht und anschließend das bzw. die gebundenen Peptide isoliert werden.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher ein Verfahren zum Auffinden eines gewebebindenden Peptids enthaltend folgende Schritte:
(a) In-Kontakt-bringen eines Gewebes mit einem oder mehreren Peptiden, und
(b) Isolieren eines oder mehrerer gewebebindender Peptide.
Vorzugsweise werden nach dem In-Kontakt-bringen eines Gewebes mit einem oder mehreren Peptiden gemäß Schritt (a) nicht-gebundene Peptide beispielsweise durch Waschen des Gewebes mit einer geeigneten Pufferlösung entfernt.
Unter Peptid versteht man gemäß der vorliegenden Erfindung vorzugsweise Peptide mit einer Länge von ca. 5 bis ca. 40 Aminosäuren, insbesondere mit einer Länge von ca. 5 bis ca. 20 Aminosäuren, vor allem mit einer Länge von ca. 10 bis ca. 20, besonders bevorzugt mit einer Länge von ca. 10 bis ca. 15 Aminosäuren.
Unter Gewebe versteht man gemäß der vorliegenden Erfindung Zeil verbände, insbesondere Zellverbände einschließlich ihrer Interzellularsubstanz, beispielsweise Epithelgewebe, Bindegewebe, Stützgewebe, Muskelgewebe oder Nervengewebe. Der Begriff Gewebe schließt gemäß der vorliegenden Erfindung auch ganze Organe oder Teile davon sowie Gefäße ein. Vorzugsweise handelt es sich bei den Organen bzw. Gefäßen noch um „lebende" Organe bzw. Gefäße.
Die Interzellularsubstanz ist eine in die Zwischenzellräume eingelagerte Substanz, die eine strukturlos erscheinende Grundsubstanz und faserige Bindegewebsfasern enthält. Es war daher völlig überraschend, daß durch In-Kontakt-bringen von Gewebe mit einem oder mehreren Peptiden gewebebindende Peptide aufgefunden wurden, die im wesentlichen für das verwendete Gewebe spezifisch waren und nicht vorwiegend an unspezifische Strukturen, wie z. B. die Interzellularsubstanz, gebunden wurden.
Die Spezifität der gewebebindenden Peptide läßt sich vorzugsweise dadurch erhöhen, daß die gemäß Schritt (b) isolierten Peptide wiederholt ein oder mehrmals mit dem Gewebe in Kontakt gebracht werden. Vorzugsweise werden die Peptide nach ihrer jeweiligen Isolierung bis zu lOmal mit dem entsprechenden Gewebe in Kontakt gebracht. Auf diese Weise können auch kreuzspezifische Peptide, die für mehrere Gewebearten spezifisch sind, gefunden werden, wenn die Peptide nacheinander mit verschiedenen Geweben in Kontakt gebracht werden. Werden beispielsweise die Peptide portionsweise sowohl mit gesundem als auch mit krankem Gewebe in Kontakt gebracht, so können durch einen subtraktiven Vergleich die Peptide aufgefunden werden, die für gesundes bzw. krankes Gewebe spezifisch sind. Peptide, die im wesentlichen nur für krankes Gewebe spezifisch sind, eignen sich beispielsweise besonders vorteilhaft für die Diagnose, beispielsweise im Rahmen einer PET-Untersuchung.
Es ist auch bekannt, daß durch äußere Umstände, wie z. B. Stress oder Entzündungen, Gewebe pathologisch verändert werden können. So verändern z.B. glatte Muskelzellen in restenotischen Gefäßarealen ihren gesamten Phänotyp und gehen vom ruhenden, sekretorischen in den proliferativen Phänotyp über. Mit Hilfe der vorliegenden Erfindung können folglich auch gewebebindende Peptide gefunden werden, die unter in vivo Bedingungen spezifisch pathologisch verändertes Gewebe erkennen können. Auch ist es auf vorteilhafte Weise möglich, pathologische Zelltypen im Gewebeverband, die bisher noch nicht ausreichend charakterisiert werden konnten, spezifisch durch Verwendung der gemäß dem erfindungsgemäßen Verfahren selektionierten Peptiden zu charakterisieren, zu identifizieren und beispielsweise gentherapeutisch zu therapieren.
Zum Auffinden gewebebindender Peptide gemäß dem erfindungsgemäßen Verfahren ist es vorteilhaft, wenn eine Peptidbank, beispielsweise eine kombinatorische Peptidbank (siehe z. B. Colas, P. et al. (1996) supra), verwendet wird. Unter Peptidbank gemäß der vorliegenden Erfindung versteht man eine Ansammlung von mehreren verschiedenen Peptiden, die frei oder in gebundener Form vorhanden sind.
Eine Peptidbank aus freien Peptiden enthält beispielsweise eine Ansammlung von chemisch synthetisierten Peptiden. (siehe z. B. Geysen, H. M. et al. (1996) supra). Bei der Peptidsynthese wurden an der Festphase Aminosäuregemische verwendet, so daß die Aminosäurenabfolge der sich ergebenden Peptide statistisch verteilt war. Die Peptidbanken konnten hierbei auch in Harz-gebundener Form verwendet werden (de Koster, H. S. et al. (1995) supra).
Peptide in gebundener Form sind beispielsweise auch sogenannte peptidpräsentierende Banken, z. B. eine peptidpräsentierende Phagenbank oder vorzugsweise eine peptidpräsentierende Bakterienbank, wie oben bereits näher beschrieben. Bei den peptidpräsentierenden Banken werden die Peptide in Form eines Fusionsproteins an der Oberfläche von beispielsweise Phagen oder Bakterien präsentiert. Bevorzugte Fusionen sind Insertionen, vorzugsweise Fusionen mit Thioredoxin, mit Thioredoxin(TrxA)-Flagellin(FliC), mit der alpha-Untereinheit von Gt, wie oben bereits näher beschrieben, oder z. B. mit LamB (Charbit, A. et al. (1988) Gene 70, 181-189) oder Lpp-OmpA (Francisco, J. A. et al. (1993) Proc. Natl. Acad. Sei. USA 90, 10444-10448).
Für die vorliegende Erfindung sind peptidpräsentierende Bakterienbanken und insbesondere solche mit einem Thioredoxin-Fusionsprotein vor allem für eine Selektion in einem in vivo angenäherten Perfusionsmodell von isolierten Gefäßen und Organen aus folgenden Gründen besonders bevorzugt:
1. Die Peptide werden als Fusionsproteine zusammen mit einem Protein, beispielsweise Thioredoxin, präsentiert, dessen dreidimensionale Struktur im allgemeinen bekannt ist. Die randomisierten Peptide werden im allgemeinen in einer sehr gut zugänglichen, auf der Oberfläche des Gesamtproteins nach außen liegenden Domäne, beispielsweise der sogenannten „Cys-Cys active site loop" des Thioredoxins, präsentiert. Dadurch daß das Peptid im allgemeinen genügend weit vom Bakterium und somit gut zugänglich präsentiert wird, wird im allgemeinen eine gute Interaktion mit dem gewünschten Bindungspartner ermöglicht.
Folglich kann im allgemeinen gewährleistet werden, daß beispielsweise beim viralen Gentransfer in vaskuläre Zellen die Peptide auch in Form von Fusionsproteinen mit einem therapeutisch wirkenden Protein ihre Wirkung entfalten können, ohne daß sie ihre Bindungsfähigkeit im wesentlichen verlieren. Peptide die an den Terminus eines Proteins fusioniert und auf diese Weise in Phagenbanken präsentiert werden, verlieren im allgemeinen ihre Bindungsfähigkeit sobald sie als Fusionsproteine zusammen mit einem therapeutisch wirkenden Protein exprimiert werden, was für die Verwendung in der Gentherapie nachteilig ist. Ein wesentlicher Grund hierfür ist, daß die Peptide während der Präsentation selbst einen freien N-oder C-Terminus aufweisen, der für eine Bindung zur Verfügung steht. Aus diesem Grund ist es besonders vorteilhaft, wenn die Peptide in Form von Insertionen in ausgewählte Oberflächenproteine von einer peptidpräsentierenden Bank präsentiert werden.
2. Beispielsweise ist das E.coli Thioredoxin stabil gegen Proteasen. Folglich ist ein proteaseresistentes Protein in Form eines Fusionsproteins mit dem Peptid beispielsweise für eine Selektion im ex-vivo perfundierten Organmodell besonders bevorzugt, insbesondere da Proteasen sich in den Gefäßen an den Zellen befinden können. Vor allem Organe, z.B. isolierte perfundierte Leber, aber auch Tumore, setzen eine hohes Maß an Proteasen frei, die das Fusionsprotein im Falle einer Proteaseempfindlichkeit spalten könnten.
3. Bakterien können aufgrund ihrer Größe nicht so schnell wie Phagen in den extravasalen Raum gelangen und damit beispielsweise im perfundierten Organ an Zellen gelangen, die für eine spätere Therapie nicht zugänglich sind. Im Gegensatz zu Phagen können entsprechende Bakterienbanken auch bei Körpertemperatur inkubiert werden, ohne daß die Ergebnisse durch Endozytose im wesentlichen verfälscht werden. Hierdurch können die in vivo Bedingungen auch ex vivo im wesentlichen eingehalten werden, was beispielsweise bei „lebenden" Organen bzw. Gefäßen besonders vorteilhaft ist.
Unter dem Begriff „lebend" versteht man gemäß der vorliegenden Erfindung Organe bzw. Gefäße, die noch funktionsfähig sind. Für den Erhalt der Funktionsfähigkeit über einen längeren Zeitraum ist es daher vorteilhaft, wenn das Organ bzw. das Gefäß ausreichend mit Sauerstoff und Nährsubstraten versorgt werden. Hierzu eignet sich vorzugsweise eine Nährlösung, die Ca2+, Mg2+ sowie ein Protein, beispielsweise ein Albumin wie BSA (bovines Serumalbumin) enthält. Vorzugsweise sind die Konzentration an Calciumionen 2,5 mM und an Magnesiumionen 1,1 raM. Albumin ist vorzugsweise in einer Konzentration von 1 % in der Nährlösung vorhanden. Zur Perfusion von isolierten Gefäßen und isolierten Organen eignet sich besonders die sogenannte Krebs- Henseleit-Lösung, die wie folgt zusammengesetzt ist (Angaben in raM): NaCl 116; KC1 4,6; MgSO4 1,1 ; NaHCO3 24,9; CaCl2 2,5; KH2PO4 1,2; Glukose 8,3; Pyruvat 2,0 sowie 1 % BSA äquilibriert mit 95% O2 und 6% CO2 (pH 7,4; 37 °) (siehe z. B. Decking , U. K. M. et al. (1997) Circulation Research 81 , 154-164, No. 2)
In einer bevorzugten Ausführungsform wurde beispielsweise eine peptidpräsentierende Bakterienbank in einem in-vitro Gefäßperfusionsmodell eingesetzt, nachdem zuvor in-vivo am Gesamttier (Ratte) an einem Gefäß eine Restenose durch Denudierung des Endothels mittels eines Ballonkatheters induziert worden war. Dieses Verfahren hat die entscheidenden Vorteile, daß die als Folge pathologischer Gefäßprozesse auftretenden Veränderungen der Expressionsmuster von membranassozierten bzw. membrangebundenen Proteinen erhalten bleiben, die Zellpolarität sich nicht verändert und alle Zellen in ihrem natürlichen Gewebeverband verbleiben.
Die mit Hilfe des erfindungsgemäßen Verfahrens aufgefundenen Peptide können, wie oben bereits näher beschrieben, modifiziert werden. Eine geeignete Modifikation ist beispielsweise eine radioaktive oder nicht-radioaktive Markierung für die Verwendung in einem Testsystem bzw. Diagnostikum.
Für die gemäß dem erfindungsgemäßen Verfahren auffindbaren gewebespezifischen Peptide gibt es zahlreiche Anwendungen, beispielsweise den gewebespezifischen Transfer von Substanzen, insbesondere von pharmazeutisch aktiven Verbindungen, vor allem für den gewebespezifischen Gentransfer. Der gewebespezifische Gentransfer dient beispielsweise zur Diagnose und/oder Therapie von Gefäß- und/oder Organerkrankungen mit Hilfe beispielsweise viraler und/oder nicht-viraler Vektoren, vorzugsweise mit Hilfe von Liposomen, wie oben bereits näher beschrieben.
Für den gewebespezifischen Gentransfer kann das Peptid physikalisch, chemisch oder gentechnisch an die gewünschte Nukleinsäure gekoppelt werden (s. o.). Beispielsweise kann das Peptid entweder zusammen mit einem therapeutischen Protein, z. B. Stickstoffmonoxid-Synthase (siehe z. B. WO95/27020), Insulin (siehe z. B. EP-B1-0 001 929), Erythropoietin (siehe z. B. EP-B1-0 148 605), oder Blutgerinnungsfaktoren, wie z. B. Faktor VIII, Interferone, Cytokine, Hormone, Wachstumsfaktoren usw. exprimiert werden, oder an eine Nukleinsäure, welche ein therapeutisches Gen, beispielsweise ein Gen kodierend für die beispielhaft genannten therapeutischen Proteine oder für eine antisense-Nukleinsäure zum gezielten Ausschalten von Expressionsprodukten, gekoppelt werden. Geeignete Kopplungsmethoden sind z. B. über Lysinreste oder Nucleocapsidproteine, wie oben bereits näher erläutert (siehe z. B. Harbottle, R. P. et al. (1998) supra oder Bachmann, A. S. et a 1. (1998) supra). Besonders vorteilhaft ist es, wenn ein oder mehrere gewebebindende Peptide über eine positiv geladene Domäne, z. B. Polylysin, an eine oder mehrere Nukleinsäuren gebunden sind.
Zur Erhöhung der Membranpermeation beim Gentransfer eignet sich auch ein Peptid, das die Membranpermeation erhöht, z. B. ein Hisitidin-enthaltendes Polypeptid (s.o.). Vorzugsweise wird eine sogenannte Polyfektionslösung enthaltend eine Nukleinsäure mit dem gewünschten therapeutischen Gen, ein Fusionsprotein aus gewebespezifischem Peptid und einem DNA-bindenden Anteil, z. B. eine positiv geladenen Domäne, und einem Peptid, das die Membranpermeation erhöht, eingesetzt. Eine geeignete Polyfektionslösung ist beispielsweise bei Midoux, P. (1998) supra, beschrieben. Desweiteren ist eine Kopplung des Peptids an die Liposomen über ein beispielsweise eingebrachtes C-terminales Cystein an eine aktivierte Lipidkomponente, z. B. über MPB-PE,
Maleinimidophenylbutyroylphosphatidylethanolamin, (Zuidam, N.J. et al. (1995) Biochim. Biophys. Acta 1240, 101).
Die erfindungsgemäßen Peptide können auch zur Änderung des Tropismus von Viren, vorzugsweise von Adenoviren, beispielsweise für den gewebespezifischen Gentransfer, eingesetzt werden. Dies erfolgt beispielsweise durch Anheften des Peptids über einen geeigneten Linker an den C-Terminus der Knob-Domäne (siehe z. B. Douglas, J. T. & Curiel, D. T. (1997) Neuromuscular Disorders 7, 284-298) oder durch den Austausch der für die Bindung verantwortlichen Region in der Knob-Domäne des Fiberproteins. Alternativ kann auch das RGD-Motiv in der hypervariablen Region der Penton-Base (z.B. Adl2 19AS, Ad2,5 82 AS) durch ein zellspezifische Peptid ersetzt werden analog zu den von Wickham durchgeführten Versuchen mit dem FLAG-Epitop, wobei vorzugsweise ebenfalls der natürliche Tropismus ausgeschaltet werden kann (siehe Wickham et al. (1996) J. Virol. 70, 6831). Die Änderung des Tropismus kann beispielsweise über ein Shuttleplasmid erfolgen, das für das entsprechende Konstrukt kodiert.
Eine andere Verwendungsmöglichkeit der gewebebindenden Peptide ist die Verwendung zur Diagnose von krankhaft verändertem Gewebe, vor allem in einem pathologisch veränderten Gefäß, bei Entzündungen, Arteriosklerose, Gefäßen, die Tumorgewebe versorgen, und Gewebe mit proliferierenden glatten Muskelzellen des Gefäßsystems, sowie die Darstellung verschiedener Abschnitte des Gefäßsystems, wie z. B. kleine/große Gefäße, Venen, organspezifisches Endothel.
Die Diagnose kann hierbei entweder indirekt über z. B. Peptid-erkennende Antikörper beispielsweise in einem allgemein bekannten ELISA-Test erfolgen (siehe z. B. Voller, A. et al. (1976) Bull. World Health Organ., 53, 55-63) oder direkt, indem das gewebebindende Peptid zusätzlich markiert ist. Die Markierung kann hierbei eine nicht-radioaktive Markierung, z. B. über Biotin bzw. Avidin/Streptavidin, sein oder auch eine radioaktive Markierung (s. o.).
Eine radioaktive Markierung ist insbesondere bei einer Ganzkörperuntersuchung des Patienten mit bildgebenden Verfahren, wie z. B. PET (positron emission tomography) oder SPECT (single photon emission Computer tomography) zur Diagnose von beispielsweise Entzündungen, Gefäßveränderungen oder Tumoren, vorteilhaft. Hierzu wird dem Patienten das markierte Peptid intravenös appliziert und die Verteilung des Peptids im Organismus beispielsweise mittels „Ganzkörper- PET" analysiert. Ein weiterer Gegenstand der vorliegenden Erfindung ist daher ein Arzneimittel und/oder Testsystem beispielsweise in Form eines Diagnostikums enthaltend ein oder mehrere erfindungsgemäße Peptide bzw. ein oder mehrere Peptide, die nach dem erfindungsgemäßen Verfahren aufgefunden wurden, oder ein oder mehrere erfindungsgemäße Nukleinsäuren, und gegebenenfalls geeignete Hilfs- und/oder Zusatzstoffe.
Ein anderer Gegenstand der vorliegenden Erfindung bezieht sich auch auf eine Zusammensetzung beispielsweise in Form eines Transfektions- oder Polyfektionssy stems enthaltend ein oder mehrere erfindungsgemäße Peptide bzw. ein oder mehrere Peptide, die nach dem erfindungsgemäßen Verfahren aufgefunden wurden, oder ein oder mehrere erfindungsgemäße Nukleinsäuren und eine weitere Substanz, vorzugsweise eine pharmazeutisch aktive Verbindung, wie oben bereits näher beschrieben, und gegebenenfalls geeignete Hilfs- und/oder Zusatzstoffe.
Als Hilfs- und/oder Zusatzstoffe eignen sich beispielsweise allgemein bekannte Protease- bzw. Nukleaseinhibitoren.
Die folgenden Figuren, Tabellen und Beispiele sollen die Erfindung näher beschreiben, ohne sie zu beschränken:
FIGUREN UND TABELLEN
Fig. l zeigt das Carotismodell von Clowes. Nach Ligaturen der A. Carotis interna und externa wird ein Ballonkatheter über die A. Carotis externa in die A. carotis communis eingeführt, dilatiert und das Gefäß über eine Strecke von 1 - 1,5 cm denudiert. Anschließend wird der Katheter wieder entfernt, die A. Carotis externa ligiert und die A. Carotis interna wiedereröffnet.
Fig. 2 zeigt die Selektion der Peptide in der ex-vivo perfundierten Rattencarotis. Fig. 3 zeigt die relative Bindungsstärke des Peptids P36 an eine dilatierte Rattencarotis, die am 8. postoperativen Tag entnommen wurde, im Vergleich zur unbehandelten Kontroll-Carotis.
Fig. 4 zeigt die Bindungskonstanten des Peptids P36 an primäre, aortale Schweine -endothelzellen (PAEC), primäre Schweine glatte Muskelzellen (VSMC) und Affennierenzellen (COS). Die Stimulation der Endothelzellen erfolgte durch LPS und TNFα (PAEC stimuliert).
Tab. 1 zeigt die DNA-Sequenzen und davon abgeleitete Peptidsequenzen der isolierten Klone.
ABKÜRZUNGEN
BSA bovines Serumalbumin
DCM Dichlormethan, synonym: Methylenchlorid
DIEA Diisoethylamin EDT Ethandithiol
HBTU/HOBt Hydroxybenzotriazol
IMC Medium, enthält (lxM9 Salze, 0,2% (Casaminosäuren, 0,5 %
Glucose, 1 mM MgCl2) 10xM9 Salze: 0,42 M Na2HPO4, 0,22 M KH2PO4, 85 mM NaCl, 187 mM NH4C1, pH7,4) NMP N-Methyl-2-pyrrolidon
PBS Phosphatpuffer
SASRIN „super acid sensitive resin"
TFA Trifluoressigsäure
BEISPIELE
1. Herstellen einer peptidpräsentierenden Bakterienbank
Es wurde eine peptidpräsentierende Bakterienbank verwendet, die über die Firma Invitrogen BV, Niederlande kommerziell erhältlich ist (FliTrx™ Random Peptide
Display Library, Katalog No. Kl 125-01; Z. Lu, et al. (1995) Biotech. 13, 366). Bei dieser Bakterienbank enthalten die Bakterien eine Expressionskassette, die für ein Fusionsprotein aus Flagellin und Thioredoxin codiert. Das Flagellin dient zur Verankerung des Fusionsproteins in der Bakterienmembran, während das Thioredoxin in einer exponierten Domäne ein fremdes 12 Aminosäuren langes Peptid präsentiert, dessen codierendes 36 Basenpaar langes Oligonukleotid an der entsprechenden Stelle in die codierenden Sequenz des Thioredoxins kloniert wurde. Das zur Klonierung verwendete Oligonukleotid wurde nach dem Zufallsprinzip synthetisiert, so daß die Bakterienbank insgesamt 109 verschiedene Peptide repräsentiert. Die Expressionskassette befindet sich unter der Kontrolle des Tryptophan-Promoters, so daß die Expression des Fusionsproteins zum Zeitpunkt einer exponentiell wachsenden Bakterienkultur durch die Gabe von Tryptophan angeschaltet werden kann. Da jedes Bakterium nur ein Plasmid aufnimmt, wird von jedem Bakterium nur eine Sorte Peptid mit definierter Aminosäure-Sequenz exprimiert und auf der Oberfläche präsentiert.
2. Anzüchten der Bakterienkultur
50 ml IMC Medium wurden mit 109 Bakterien versetzt und über Nacht 15 Stunden bei +25 °C inkubiert. Anschließend wurde die Zellzahl durch Messung der OD^ bestimmt, 10'° Zellen in 50 ml IMC Medium mit lOOμg/ml Ampicillin inkubiert und die Expression der Bakterienbank durch Zugabe von 100 μg/μl Tryptophan induziert. Die Zellen wurden weitere 6 Stunden bei 25 °C inkubiert, bevor sie zur Selektionierung verwendet wurden.
3. In vitro Gefäßperfusionsmodell
Die Induktion einer Restenose erfolgte in einem etablierten Restenosemodell in der Ratte (siehe z. B. Clowes, A. W. et al. (1983) Lab. Invest. 49, 327). Wie in Fig. 1 dargestellt, wurde beispielsweise in einer narkosierten Ratte die Arteria carotis communis durch Einführung eines Ballonkatheters von den Endothelzellen befreit (Denudation). Durch diesen Eingriff werden die glatten Gefäßmuskelzellen zur Proliferation angeregt und ändern ihren Phänotyp vom ruhenden, sekretorischen glatten Muskelzelle zur proliferierenden glatten Muskelzelle.
Am Tage der stärksten Proliferation der glatten Muskelzellen (10. postoperativer Tag) wurde das in Fig. 1 gekennzeichnete Gefäßsegment herauspräpariert und in einem speziellen ex-vivo Perfusionssystem mit einem salinen Medium unter Zusatz von Glucose und Sauerstoffbegasung perfundiert. Nach einer Äquilibrationszeit von 10 min, die zum Auswaschen jeglicher Blutzellen und Blutbestandteile diente, wurde dieses Gefäßsegment mit insgesamt 1010 peptidpräsentierenden Bakterien in sauerstoffbegastem salinen Medium mit einem Flow von 0,2 ml/min. 60 min rezirkulierend perfundiert. Die nicht bindenden Bakterien wurden durch Behandlung mit salinem Medium abgelöst und die spezisch bindenden Bakterien durch zehnminütige Perfusion unter stringenten Bedingungen mit 0,1 M Glycin pH 2,0 eluiert. Die eluierten Baktieren wurden erneut kultiviert und zur Erhöung der Spezifität weiteren fünf Selektionszyklen (siehe Fig. 2) unterworfen.
4. Versuchsprotokoll für die perfundierten Ratten-Carotis
Ca 500g schwere Ratten wurden durch Gabe von 100μl/100 g Körpergewicht Dormicum und 100 μl/lOOg Körpergewicht Hypnorm narkotisiert. Anschließend wurde die Arteria Carotis kranial der Bifurkation freipräpariert, die A. Carotis interna sowie alle davon abzweigenden Abgänge ligiert und ausgehend von der Carotis externa ca 2 cm entlang der Carotis Communis mit einem 2F Ballonkatheter bei 1 bar die Carotis Communis denudiert. Die Ligatur der A. Carotis interna wurde postoperativ wieder eröffnet. Am 10. postoperativen Tag wurde die denudierte A. Carotis communis freipräpariert und ex vivo mit 0, 1 ml/min PBS mit 0, 1 M Glucose perfundiert. Währenddessen wurden 10 ml der mit Tryptophan induzierten Bakteriensuspension bei 1000 rpm 3 min abzentrifugiert, in PBS gewaschen, erneut zentrifugiert und das Sediment in 6 ml Gesamtvolumen PBS, 0,1 M Glucose, 0,1 % BSA, 1 mM CaCl2, 10 mM MgCl2 suspendiert. Die Carotis wurde anschließend rezirkulierend mit dieser Suspension unter Sauerstoffbegasung 1 h mit 0,2 ml/min perfundiert. Anschließend wurde die Suspension durch Perfusion mit 2-3 ml PBS bei 0,2 ml/min ausgewaschen, bevor die gebundenen Bakterien durch Elution mit 3 ml 0,1 M HC1 (pH 2,2 mit Glycin eingestellt) eluiert und in 50 ml IMC Medium, 100 μg/ml Ampicillin über Nacht bei +25 °C vermehrt wurden.
5. Ergebnis der Selektionsversuche
Gemäß den oben beschriebenen Versuchen wurden Bakterien erhalten, die auf ihrer Oberfläche Peptide exprimieren, die spezifisch an proliferierende glatte Muskelzellen binden. Die nach sechs Selektionen erhaltenen Bakterien wurden anschließend auf Nährmedium ausplattiert und ausgehend von 60 Einzelkolonien wurden Kulturen angezüchtet. Von diesen kultivierten Bakterien, wurde die Plasmid-DNA isoliert und sequenziert. Mit diesem Modell konnten überraschenderweise spezifisch bindenden Peptide mit einer der in vivo Situation am nächsten stehende Methode (Organkulturmodell) detektiert werden.
Nach Sequenzierung der DNA der isolierten Bakterien wurden die DNA-Sequenzen und davon abgeleitete Peptidsequenzen erhalten (siehe Tabelle 1). Das Peptid 36 zeigt in seiner Sequenz Homologien zum α4-Integrin, das auf Leukocyten exprimiert wird und für die Anheftung der Leukocyten an aktiviert vaskuläre Zellen verantwortlich ist. Die Erkennung wird dabei durch das vaskuläre zelluläre Adäsionsmolekül VCAM-1 mediiert. Die Homologie liegt nicht in dem Bereich, der als bindender Bereich des Integrins (RGD-Motif) charakterisiert ist. 6. Bindungsstudien
Das für die Bindungsstudien eingesetzte Peptid aus Klon 36 (Peptid 36) wurden mit der Fast-Moc Festphasensynthese an einem vollautomatischen Peptidsynthesizer der Firma Applied Biosystems im 0.1 mmol Maßstab hergestellt. Zur Bestimmung der Bindungsaffinitäten an den gewünschten Zelltyp wurde das Peptid radioaktiv markiert.
7. Radioaktive Markierung eines gewebespezifischen Peptids
Da die zur Selektion eingesetzten Bakterien die Peptide auf ihrer Oberfläche im Kontext eines Fusionsproteins (Thioredoxin) präsentierten, wurde die N-terminal auftretende Aminosäure (Glycin) für die radioaktive Markierung verwendet. Dazu wurde l4C-Gycin mit aktiviertem N-Fluorenyl-Methoxycarbonyl-Succinimid geschützt, gereinigt und an das am Harz befindliche, in den Seitenketten geschützte Peptid mittels Dicyclohexyl-carbodiimid kovalent N-terminal gekoppelt. Anschließend wurde das Peptid vom Harz abgespalten, mittels HPLC gereinigt und im perfundierten Gefäßmodell sowie in der Zellkultur auf Bindung an die Zielzellen hin untersucht.
8. Versuchsprotokoll zur Synthese des radioaktiv markierten C-Fmoc-Glycins
20 μmol des sich in 5 ml Wasser befindenden, radioaktiv markierten 14C-Glycins (entsprechend 1 mCi; DuPont) wurden zusammen mit 38 mg Glycin (0,5 mmol) und 53 mg Na2CO3 (0,5 mmol) in einem 25 ml Rundkolben vorgelegt und tropfenweise unter Rühren mit 165 mg (0,49 mmol) in 5 ml Aceton gelöstem N- Fluorenylmethoxycarbonyl-Carbonat (Fmoc-Carbonat) versetzt. Während des Zutropfens (60 min) wurde der pH-Wert durch Zugabe von 1 M Na2CO3 konstant gehalten. Anschließend wurde das Gemisch über Nacht bei Raumtemperatur stehen gelassen, die wäßrige Phase durch Zugabe von 2 M HC1 angesäuert und zweimal mit je 10 ml Ethylacetat extrahiert. Die vereinigten Ethylacetatphasen wurden mehrmals mit Wasser neutral gewaschen, mit MgSO4 getrocknet und das Produkt durch Zugabe von Petrolether gefällt und abfiltriert. Zur Reinigung wurde das Produkt in Ethylacetat gelöst und durch Zugabe kleiner Mengen Petrolether langsam ausgefällt.
Ausbeute: 95 mg (entsprechend 68 % der Theorie)
0,32 mmol spezifische Aktivität: 0,0064 MBq/μmol
9. Versuchsprotokoll zur Synthese radioaktiv markierter Peptide
Das markierte Fmoc-Glycin wurde für die Synthese von insgesamt 0,4 mmol Peptid eingesetzt, so daß jedes Peptid zu 75% markiert wurde.
Die entsprechende Menge des Harz/Peptid-Gemischs (0.1 mmol) wurde eingewogen und in eine Glasfritte mit Schliffstopfen und Hahn gegeben. 25 mg des I4C-Fmoc-Glycins (0,075 mmol) wurden in 1 ml NMP gelöst, mit 155 μl 0,45M HBTU/HOBt und 750 μl 2 M DIEA in NMP versetzt, zum Harz/Peptid- Gemisch gegeben und eine Stunde unter leichtem Schütteln bei Raumtemperatur inkubiert. Anschließend wurden zur Vervollständigung der Kopplung 150 mg Fmoc-Glycin (0,5 mmol) in 2 ml NMP gelöst, mit 2 ml 0,45M HBTU/HOBt und 1 ml 2M DIEA versetzt und zum Reaktionsgemisch zugegeben. Das Gemisch wurde 30 min. bei Raumtemperatur inkubiert, das nicht reagierte Fmoc-Glycin abfiltriert und das Gemisch viermal mit je 6-10 ml NMP gewaschen. Die Abspaltung der Schutzgruppe erfolgte durch 30minütige Inkubation mit 22% Piperidin in NMP unter Rühren. Das Piperidin wurde abfiltriert, und das Harz/Peptid-Gemisch anschließend je viermal mit NMP und DCM gewaschen.
10. Versuchsprotokoll zur Abspaltung der Schutzgruppen
Zur Abspaltung der Schutzgruppen wurde das Gemisch eisgekühlt und mit einer Lösung aus 0,75 g Phenol, 0,25 ml EDT, 0,5 ml Thioanisol, 0,5 ml Wasser und 10 ml TFA unter Rühren versetzt. Anschließend wurde zwei Stunden bei Raumtemperatur unter Rühren inkubiert, das frei gewordene Peptid abfiltriert und durch Zugabe des fünffachen Volumens eisgekühltem Diethy lether gefällt. Nach der Zentrifugation wurde das im Sediment befindliche Peptid mehrmals mit Dieethylether gewaschen und erneut zentrifugiert.
Die Peptide wurden chromatographisch mittels eines Äkta-Purifiers 100 über eine RPC-Resource-Säule (3 ml, Pharmacia) mit einem 20minütigem Gradienten von Wasser, 0,1 % TFA bis 95 % Acetonitril, 0,07 % TFA bei einer Fließgeschwindigkeit von 2 ml/min gereinigt und anschließend lyophylisiert.
Ausbeuten: 65,6 und 70,8 % (je nach Peptid) spezifische Aktivität: 0,0165 bis 0,0182 MBq/μmol
11. Bindungsstudien
Für die Bindungsstudien im perfundierten Gefäßmodell sowie in der Zellkultur auf Bindung an die Zielzellen wurden die Gefäße bzw. die Zellen für verschiedene Zeitintervalle mit unterschiedlichen Konzentrationen der zu untersuchenden Peptide inkubiert und die Menge an gebundenen Peptid pro cm Gefäß bzw. pro Zellzahl bestimmt.
11.1 Bindung an die perfundierte Carotis
Aus Fig. 3 ist zu entnehmen, daß das Peptid 36 in der ex-vivo Perfusion annähernd vierfach stärker an die dilatierte Carotis bindet, als an die unbehandelte Kontrolle.
11.2 Bindung an Endothelzellen des Schweins in Zellkultur
Da das Peptid 36 auch Homologien zur porcinen α4-Intergrinsequenz aufweist, wurden desweiteren Zellkulturuntersuchungen an porcinen Endothelzellen durchgeführt (PAEC), die durch Behandlung mit Lipopolysacchariden (LPS) und dem Tumor-Nekrose Faktor (TNFα) stimuliert wurden. Diese Stimulation entspricht einer in-vivo Aktivierung von Zellen, die bei Streß oder inflammatorischen Reizen ausgesetzten Gefäßarealen und damit auch in restenotischen Gefäßarealen lokalisiert sind.
Das Peptide konnte dabei sowohl spezifisch an glatte Muskelzellen (VSMCs) als auch an aktivierte PAECs binden. Überraschenderweise bindet das Peptid sogar stärker an aktivierte PAECs als an VSMCs. Darüberhinaus unterscheiden sich die Bindungskonstanten des Peptids gegenüber aktivierten und nicht-aktivierten PAECs um fast 3 Zehnerpotenzen (Fig. 4). An Kontrollzellen (COS) bindet das Peptid praktisch nicht.

Claims

Patentansprüche
1. Gewebebindendes Peptid ausgewählt aus einem Peptid mit der Aminosäuresequenz GEGRTVVLSF, AWCRGGILGDAM, GNLVDLVVGFDD,
RVS PPKKSGGGV, GSSKWGLTXKCG, RGGVRQRSRGRR,
GEGRTVVCRS oder SQRWTALWQWIG sowie Varianten davon.
2. Nukleinsäure kodierend für ein gewebebindendes Peptid gemäß Anpruch 1.
3. Nukleinsäure nach Anspruch 2 ausgewählt aus einer Nukleinsäure mit der Nukleotidsequenz
GGCGAGGGGCGAACAGTCGTATTGTCGTTCG, GCCTGGTGTCGGGGGGGTATCCTGGGCGACGCTATG, GGAAACCTGGTGGATCTAGTTGTGGGTTTTGACGAC, CGGGTGAGTCCGCCAAAGAAGTCGGGGGGCGGCGTG, GGGAGTAGCAAGTGGGGATTGACTTAAAAATGTGGG, CGCGGGGGAGTCCGCCAAAGAAGTCGGGGGCGGCGT, GGCGAGGGGCGAACAGTCGTATGTCGTTCG oder
TCCCAGAGGTGGACTGCACTCTGGCAATGGATCGGG sowie Varianten davon.
4. Vektor enthaltend eine Nukleinsäure gemäß Anspruch 2 oder 3.
5. Verfahren zur Herstellung eines gewebebindenden Peptids gemäß Anspruch 1, dadurch gekennzeichnet, daß das Peptid entweder chemisch synthetisiert oder gentechnisch hergestellt wird.
6. Verfahren zum Auffinden eines gewebebindenden Peptids enthaltend folgende Schritte:
(a) In-Kontakt-bringen eines Gewebes mit einem oder mehreren Peptiden, und (b) Isolieren eines oder mehrerer gewebebindender Peptide.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, daß die gemäß Schritt (b) isolierten Peptide wiederholt ein oder mehrmals mit demselben oder mit einem anderen Gewebe in Kontakt gebracht werden.
8. Verfahren nach Anspruch 6 oder 7, dadurch gekennzeichnet, daß das Gewebe ein krankhaftes Gewebe ist.
9. Verfahren nach einem der Ansprüche 6-8, dadurch gekennzeichnet, daß das oder die Peptide in einer Peptidbank enthalten sind.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, daß die Peptidbank eine peptidpräsentierende Bank, vorzugsweise eine peptidpräsentierende Bakterienbank ist.
11. Verwendung eines gewebebindenden Peptids gemäß Anspruch 1 oder erhalten nach dem Verfahren gemäß einem der Ansprüche 6-10 für den gewebespezifischen Transfer von Substanzen, insbesondere von pharmazeutisch aktiven Verbindungen, vor allem für den gewebespezifischen Gentransfer.
12. Verwendung nach Anspruch 11, dadurch gekennzeichnet, daß der Gentransfer viral und/oder nicht-viral, vorzugsweise mit Hilfe von Liposomen abläuft.
13. Verwendung nach Anspruch 11 oder 12, dadurch gekennzeichnet, daß ein oder mehrere gewebebindende Peptide über eine positiv geladene Domäne an eine oder mehrere Nukleinsäuren gebunden sind.
14. Verwendung eines gewebebindenden Peptids gemäß Anspruch 1 oder erhalten nach dem Verfahren gemäß einem der Ansprüche 6-10 zur Änderung des Tropismus von Viren, insbesondere von Adenoviren.
15. Verwendung eines gewebebindenden Peptids gemäß Anspruch 1 oder erhalten nach dem Verfahren gemäß einem der Ansprüche 6-10 zur Diagnose von krankhaft verändertem Gewebe und/oder zur Darstellung verschiedener Abschnitte des Gefäßsystems, vorzugsweise kleine/große Gefäße, Venen oder organspezifisches Endothel.
16. Verwendung nach Anspruch 15, dadurch gekennzeichnet, daß das krankhaft veränderte Gewebe ausgewählt ist aus einem pathologisch verändertem Gefäß; bei Entzündungen; Arteriosklerose; Gefäßen, die Tumorgewebe versorgen; Gewebe mit proliferierenden glatten Muskelzellen des Gefäßsystems.
17. Verwendung nach Anspruch 15 oder 16, dadurch gekennzeichnet, daß das gewebebindende Peptid markiert, vorzugsweise radioaktiv markiert ist.
18. Arzneimittel und/oder Diagnostikum enthaltend ein oder mehrere gewebebindende Peptide gemäß Anspruch 1 , eine oder mehrere Nukleinsäuren gemäß einem der Ansprüche 2-4 oder ein oder mehrere gewebebindende Peptide erhalten nach dem Verfahren gemäß einem der Ansprüche 6-10, und gegebenenfalls geeignete Hilfs- und/oder Zusatzstoffe.
19. Zusammensetzung enthaltend ein oder mehrere gewebebindende Peptide gemäß Anspruch 1, ein oder mehrere Nukleinsäuren gemäß einem der Ansprüche 2-4 oder ein oder mehrere gewebebindende Peptide erhalten nach dem Verfahren gemäß einem der Ansprüche 6-10, und eine weitere Substanz, vorzugsweise eine pharmazeutisch aktive Verbindung, und gegebenenfalls geeignete Hilfs- und/oder Zusatzstoffe.
PCT/EP1999/007296 1998-10-02 1999-10-01 Gewebebindende peptide, ihre identifizierung, herstellung und verwendung WO2000020572A2 (de)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA002345214A CA2345214A1 (en) 1998-10-02 1999-10-01 Tissue binding peptides, identification, production and utilization thereof
EP99948916A EP1117775A2 (de) 1998-10-02 1999-10-01 Gewebebindende peptide, ihre identifizierung, herstellung und verwendung

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19845434A DE19845434C1 (de) 1998-10-02 1998-10-02 Gewebebindende Peptide, ihre Identifizierung, Herstellung und Verwendung
DE19845434.1 1998-10-02

Publications (2)

Publication Number Publication Date
WO2000020572A2 true WO2000020572A2 (de) 2000-04-13
WO2000020572A3 WO2000020572A3 (de) 2000-07-20

Family

ID=7883204

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1999/007296 WO2000020572A2 (de) 1998-10-02 1999-10-01 Gewebebindende peptide, ihre identifizierung, herstellung und verwendung

Country Status (4)

Country Link
EP (1) EP1117775A2 (de)
CA (1) CA2345214A1 (de)
DE (1) DE19845434C1 (de)
WO (1) WO2000020572A2 (de)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997035022A1 (de) * 1996-03-15 1997-09-25 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V., Berlin Exportsysteme für rekombinante proteine
WO1998040508A1 (en) * 1997-03-14 1998-09-17 Selective Genetics, Inc. Adenoviral vectors with modified tropism

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4411402A1 (de) * 1994-03-31 1995-10-05 Juergen Schrader DNA-Expressionsvektoren zur Verwendung in der gentherapeutischen Behandlung von Gefäßerkrankungen

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997035022A1 (de) * 1996-03-15 1997-09-25 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V., Berlin Exportsysteme für rekombinante proteine
WO1998040508A1 (en) * 1997-03-14 1998-09-17 Selective Genetics, Inc. Adenoviral vectors with modified tropism

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BARRY M.A. ET AL.: "Toward cell-targeting gene therapy vectors: selection of cell-binding peptides from random peptide-presenting phage libraries" NATURE MEDICINE, Bd. 2, Nr. 3, M{rz 1996 (1996-03), Seiten 299-305, XP002128875 *
DATABASE GENBANK [Online] Accession No. AA370946, 21. April 1997 (1997-04-21) ADAMS M.D.: "EST82673; Prostate gland H. sapiens cDNA" XP002129127 *
MOGFORD J.E. ET AL.: "RGDN peptide interaction with endothelial alpha5-beta1 integrin causes sustained endothelin-dependent vasoconstriction of rat skeletal muscle arterioles." J. CLIN. INVEST., Bd. 100, Nr. 6, September 1997 (1997-09), Seiten 1647-1653, XP002128876 *
MOGFORD J.E. ET AL.: "Vascular Smooth Muscle alpha5-beta3 integrin mediates artetiolar vasodilation in response to RGD peptides" CIRCULATION RES., [Online] Bd. 79, Nr. 4, 1996, Seiten 821-826, XP002129122 Retrieved from the Internet: <URL:http://circres.ahajournals.org> [retrieved on 2000-01-28] *
PASQUALINI R. & RUOSLAHTI E.: "Organ targeting in vivo using display peptide libraries" NATURE, Bd. 380, Nr. 6572, 28. M{rz 1996 (1996-03-28), Seiten 364-366, XP002128874 *
RAJOTTE D. ET AL.: "Molecular heterogeneity of the vacular endothelium revealed by in vivo phage display." J. CLIN. INVEST., Bd. 102, Nr. 2, Juli 1998 (1998-07), Seiten 430-437, XP002128873 *

Also Published As

Publication number Publication date
CA2345214A1 (en) 2000-04-13
EP1117775A2 (de) 2001-07-25
DE19845434C1 (de) 2000-03-16
WO2000020572A3 (de) 2000-07-20

Similar Documents

Publication Publication Date Title
DE69726741T2 (de) Verwendungen von angiogenischer factor vegf145 in der behandlung von kardiovaskulaeren krankheiten
AU722700B2 (en) Lipophilic peptides for macromolecule delivery
AU2008296733B2 (en) VEGFR-1/NRP-1 targeting peptides
DE60219611T2 (de) Modifizierte annexin-proteine und verhinderung und behandlung von thrombose
EP0693939A1 (de) Nukleinsäure-transferpeptide und deren verwendung zur einschleusung von nukleinsäuren in eukaryontische zellen
AU2012257774C1 (en) High-affinity, dimeric inhibitors of PSD-95 as efficient neuroprotectants against ischemic brain damage and for treatment of pain
DE69838544T2 (de) Isolierung von gewebespezifischen peptidliganden und ihre verwendung zur ausrichtung von pharmazeutika auf zielorgane
JP2000516579A (ja) 腸栄養性ｇｌｐ―２ペプチドのアンタゴニスト
DE19605175A1 (de) Lipidverbindungen und deren Verwendung
JP2005506340A5 (de)
EA027336B1 (ru) Ингибирующие апоптоз фрагменты белка daxx, их пептидомиметики, конъюгаты и композиции и их применение
JP2004517039A (ja) 両親媒性線状ペプチド及びこれらを含有する化合物
EP1196433A2 (de) CYCLISCHE PEPTIDDERIVATE ALS INHIBITOREN DES INTEGRINS ALPHA v BETA 6
DE19915485A1 (de) Therapie der Herzinsuffizienz
DE69931140T2 (de) Hemmung der angiogenese durch peptidanaloge der kininogen domäne 5mit hohem molekulargewicht
JP2018526987A (ja) 腫瘍抑制ペプチド
DE19845434C1 (de) Gewebebindende Peptide, ihre Identifizierung, Herstellung und Verwendung
JP4689664B2 (ja) 生物学的に活性なペプチドｖａｐｅｅｈｐｔｌｌｔｅａｐｌｎｐｋ誘導体
AU677379B2 (en) Arteriosclerosis remedy
KR101109163B1 (ko) 타이로신-세린-발린(ｙｓｖ)을 포함하는 생물학적 활성펩티드
EP1189930A1 (de) Inhibitoren des integrins alpha v beta 6
DE69513788T2 (de) Peptid Derivate mit bindendes Aktivität zu modifiziertem Lipoprotein mit niedriger Dichte (LDL)
JP2003089700A (ja) ペプチド
DE4412629A1 (de) Nukleinsäure-transferpeptide und deren Verwendung zur Einschleusung von Nukleinsäuren in eukaryontische Zellen
JP2023547405A (ja) Ｃａｓ９－ＲＮＰ及び他の核タンパク質カーゴの形質導入のために適合された最小長のシャトル剤ペプチド及びそのバリアント

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase

Ref document number: 2345214

Country of ref document: CA

Ref country code: CA

Ref document number: 2345214

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999948916

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09806555

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999948916

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999948916

Country of ref document: EP