WO1999067422A1 - Procede pour detecter, analyser et cartographier les transcrits d'arn - Google Patents

Procede pour detecter, analyser et cartographier les transcrits d'arn Download PDF

Info

Publication number
WO1999067422A1
WO1999067422A1 PCT/US1999/013813 US9913813W WO9967422A1 WO 1999067422 A1 WO1999067422 A1 WO 1999067422A1 US 9913813 W US9913813 W US 9913813W WO 9967422 A1 WO9967422 A1 WO 9967422A1
Authority
WO
WIPO (PCT)
Prior art keywords
genomic
transcripts
genomic sequence
viral
subfragments
Prior art date
Application number
PCT/US1999/013813
Other languages
English (en)
Inventor
Jeffrey J. Leary
Ruth Tal-Singer
Original Assignee
Smithkline Beecham Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Smithkline Beecham Corporation filed Critical Smithkline Beecham Corporation
Priority to JP2000556062A priority Critical patent/JP2002518064A/ja
Priority to EP99930404A priority patent/EP1090144A1/fr
Priority to CA002330731A priority patent/CA2330731A1/fr
Publication of WO1999067422A1 publication Critical patent/WO1999067422A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6841In situ hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Definitions

  • This invention relates to a novel genetic analysis method, fine array transcript mapping, or "FAT Mapping", which is a method useful for detecting, measuring, and characterizing RNA molecules which are transcribed from a genome.
  • the method is especially useful for determining the differential expression of RNAs between two samples and for accurately determining the ends of the RNA molecules (mapping) with respect to a template, genomic sequence.
  • RT- PCR reverse transcriptase-polymerase chain reaction
  • DDRT-PCR Differential display RT-PCR
  • RDA representational difference analysis
  • a third method, called suppression subtractive hybridization (SSH) uses RT-PCR to selectively amplify mRNAs from differentially expressed genes while suppressing amplification of abundant cDNA's (2).
  • SSH suppression subtractive hybridization
  • the present inventors employed DDRT-PCR to isolate 32 differentially-displayed mouse cDNAs representing transcripts whose levels were altered within the first 4 hours following explanation of latently HSV-1 -infected murine trigeminal ganglia. It was found that four cDNAs were identical to murine TIS7, whose sequence has been shown to be related to interferons (IFNs) (15). The processing of this experiment took approximately one year to accomplish. The acrylamide gel purification, re-amplification, confirmation, and sequencing of each differentially expressed fragment produced by DDRT-PCR was a very labor-intensive process.
  • RNA sequence Once a portion of an mRNA sequence is identified by DDRT-PCR, RDA or SSH, the protein encoding portion of the RNA can be determined only after the true ends of the transcript are mapped. Sophisticated methods for accomplishing the mapping of the ends of a few mRNA's sharing a known sequence in one batch have also been developed. Preeminent among these is the method known as "rapid amplification of cDNA ends" (RACE) or "one-sided amplification", which is applied to 3' ends or 5' ends separately (18,19,20,21).
  • RACE rapid amplification of cDNA ends
  • This procedure uses one oligonucleotide primer comprising a sequence known to be expressed in an mRNA and a second generic oligonucleotide primer characteristic of the ends of mRNAs. Only a small set of RNA molecules, all originating from the genomic region containing the sequence represented by the first oligonucleotide primer, can be detected or analyzed in one experiment.
  • FAT Mapping involves probing a test grid containing an array of hundreds to thousands of overlapping genomic clones or DNA fragments with probes consisting of labeled cDNAs representing the RNA transcripts from test populations (1, 11, 12).
  • this potentially high capacity system allows quantitative measurements of the expression of rare transcripts from probe mixtures derived from microgram amounts of total cellular mRNA, and enables the analysis of hundreds of genes within a genomic sequence in a single run.
  • ORFs novel open reading frames
  • the ends of labeled probes can be predicted with a high degree of accuracy.
  • the accuracy of the prediction is proportional to the number and distribution of the clones in the array. The accuracy can be predicted by computer simulation.
  • FAT Mapping is a technique capable of accomplishing the goals of DDRT-PCR, SSH, RDA and RACE in a very rapid, labor saving manner.
  • the FAT Mapping process can also be used to complement and confirm studies which utilize art-recognized methods to identify differentially expressed gene sequences and to map transcripts.
  • FAT Mapping allows the generation of a database of induced, differentially expressed genes from a single experiment which will facilitate the identification of previously unknown regulatory elements in transcriptional promoters common to those expressed genes.
  • Previously unidentified genes may also be located within a given genomic sequence using the FAT Mapping method.
  • the genomes of viruses, particularly herpes viruses represent one example of genomic sequences to which the present FAT Mapping method can be advantageously applied.
  • HSV-1 herpes simplex virus type 1
  • herpes viruses express different proteins from transcripts which have common 3' ends but different 5' ends.
  • the present invention provides a method of mapping the position of an individual transcript from a genomic sequence, comprising the steps of: a) generating overlapping subfragments of the genomic sequence, wherein at least a portion the nucleotide sequence of each genomic subfragment has been determined; b) placing each overlapping genomic subfragment in a separate ordered (known) position on a high density grid; c) preparing a composition comprising test transcripts which have been transcribed from said genomic sequence; d) labeling the test transcripts in said composition in a detectable manner; e) placing the composition comprising the labeled test transcripts in contact with the high density grid containing the genomic subfragments, whereby the labeled test transcripts are allowed to hybridize to the genomic subfragments; f) removing unhybridized test transcripts from the surface of the high density grid; g) detecting on the high density grid the ordered positions which contain a hybridized labeled test transcript; and h) analyzing the pattern in which the labeled test transcripts have hybrid
  • the invention also provides a method of measuring the differential expression of transcripts between two or more different tissue or cell populations which share a common genomic sequence, comprising conducting the above described steps a. and b. on said common genomic sequence; separately performing the above described steps c. through h. on each different tissue or cell population; and comparing the pattern in which the test transcripts from each different cell or tissue population have been mapped to the common genomic sequence, whereby differences in the expression of transcripts between the different tissue or cell populations is determined.
  • the present invention further provides a method of determining whether a particular open reading frame of known position within a genomic sequence is expressed under particular conditions, comprising the steps of conducting above described steps a. and b. on a genomic sequence, whereby the ordered position on the high density grid of genomic subfragments corresponding to said particular open reading frame is determined; subjecting a population of cells or tissues containing said genomic sequence to a particular condition; conducting above described steps c. through h.
  • Figure 1 illustrates the fine array transcript mapping, or "FAT Mapping" process applied to a single genome, the genome of herpes simplex virus type 2 (HSV-2).
  • HSV- 2 genome is an example of a large, transcriptionally complex genomic region. Over 2,000 random, overlapping clones of the HSV-2 DNA genome were generated and the cloned DNA fragments were sequenced at each end. Each individual cloned fragment is placed on an individual spot in an array on a gridding medium, for example nylon membrane or a glass slide. On average, every nucleotide in the HSV-2 genome is represented in several of the clones on the array.
  • Figure 2 depicts a complexity of transcripts from the internal repeat region of
  • HSV-1 as mapped by conventional methods.
  • Figure 3A depicts the results of hybridizing FATMap arrays with cDNA probes prepared from MRC-5 cells infected for 0, 2, 6 and 17 hours.
  • the genomic location of the left end of all subfragment clones from between HSV-2 genome nucleotides 87000 and 91000 is used as the X-coordinate, while the height of each symbol on the Y-axis is the light intensity of the grid spot that the subfragment occupied.
  • Figure 3B depicts the HSV-2 ORFs located between genome nucleotides 87000 and 91000 predicted from the genbank entry for HSV2HG52, described in the features section of the genbank entry and drawn with the software package MapDraw (DNASTAR, Inc.).
  • MapDraw DNASTAR, Inc.
  • UL39 ICP6 is the only known ORF in this genomic region.
  • Figure 4 depicts the grid hybridization results for PCR products generated specifically for testing the expression of the UL39 ORF alone after hybridization with cDNA probes prepared from HSV-2 infected MRC-5 cells at 0, 2, 6, and 17 hours PI. This represents the conventional approach to microarray analysis as opposed to FAT Mapping. The product was spotted onto 5 separate locations on each grid, resulting in data from spots l to 5.
  • Figure 5A represents the results of conventional semi-quantitative RT-PCR analysis of ICP6 mRNA amounts by comparison with the amounts of mRNA for the housekeeping gene beta-actin. The ratios of the amount ICP6 gene-specific PCR product to that for beta-actin calculated from RT-PCR reactions on RNA from HSV-2 infected MRC-5 cells at 0, 1, 2, 4, and 6 hours PI are shown.
  • Figure 5B depicts the relative amount (copy number) of mRNA molecules detected by quantitative TaqMan PCR in RNA samples from HSV-2 infected MRC-5 cells at 0, 1, 2, 4, and 6 hours PI. Transcripts for HSV-2 genes gC (UL44), D?C6 (UL39) and ICP27 were measured and are shown in the bar graph.
  • Figure 6A depicts the results of hybridizing FATMap arrays with cDNA probes prepared from MRC-5 cells infected for 0, 2, 6 and 17 hours.
  • the genomic location of the left end of all subfragment clones from between HSV-2 genome nucleotides 96000 and 101000 is used as the X-coordinate, while the height of each symbol on the Y-axis is the light intensity of the grid spot that the subfragment occupied.
  • the signal intensity of all clones in the region of UL44 (gC) between 97000 and 98000 increases from 0 to 2 and from 2 to 6 hours PI, and then decreases slightly at 17 hours PI.
  • Figure 6B depicts the HSV-2 ORFs located between genome nucleotides 96000 and 101000 predicted from the genbank entry for HSV2HG52, described in the features section of the genbank entry and drawn with the software package MapDraw (DNASTAR, Inc.).
  • UL44 (gC), UL45 and portions of UL43 and UL46 are the known ORFs in this genomic region.
  • Figure 7 depicts the results of conventional microarray gene-specific PCR product spots for the UL44 open reading frame hybridized to cDNA probes prepared from MRC-5 cells infected for 0, 2, 6 and 17 hours. The gene-specific DNA was put on 8 replicate spots in the microarray.
  • Figure 8 depicts both the results of hybridizing FATMap arrays with cDNA probes prepared from MRC-5 cells infected for 0, 2, 6 and 17 hours and known ORFs drawn from the HSV2HG52 genbank entry with MapDraw.
  • the genomic locations of the left end (filled symbols) and right end (open symbols) of all subfragment clones from between HSV-2 genome nucleotides 58000 and 64000 are used as the X-coordinate, while the height of each symbol on the Y-axis is the light intensity of the grid spot that the subfragment occupied.
  • UL29 is the only known gene predicted from the HSV2HG52 sequence entry between genome nucleotide numbers 58000 and 64000.
  • Figure 9 depicts both the results of hybridizing FATMap arrays with cDNA probes prepared from MRC-5 cells infected for 0, 2, 6 and 17 hours and known ORFs drawn from the HSV2HG52 genbank entry with MapDraw.
  • the genomic locations of the left end (filled symbols) and right end (open symbols) of all subfragment clones from between HSV-2 genome nucleotides 22000 and 28000 are used as the X-coordinate, while the height of each symbol on the Y-axis is the light intensity of the grid spot that the subfragment occupied.
  • Signal intensity in this genome region correlates well with known ORFs, where UL9 and UL13 are for instance expressed only at low levels while UL10 and 11 are rather highly expressed in contrast to the pattern seen with the UL29 region depicted in Figure 8.
  • the present FAT Mapping invention provides a convenient method of mapping the position within a given genomic sequence of any individual transcript which has been expressed from that genomic sequence.
  • the general method comprises the steps of first generating overlapping subfragments of the genomic sequence, wherein the nucleotide sequence of each subfragment has been determined or is known.
  • sequenced does not necessarily entail determining the entire nucleotide sequence across each genomic subfragment. Specifically it is often sufficient to know only enough of the sequence, for example, at each end of the fragment (5' and 3' ends) to be able to determine the position within the genomic sequence from which that subfragment has been derived.
  • the degree of overlap of the subfragments is extensive, it may be sufficient to sequence only a substantial portion from one of the ends (5 ' or 3 of each subfragment.
  • the purpose of determining all or some of the sequence of the subfragments is simply to be able to determine the correct order of those subfragments across the genomic sequence.
  • Sequencing of the genomic subfragments may be accomplished by any convenient methodology, of which several are well known in this art. Also, in a particularly preferred embodiment of this step, the individual subfragments are amplified using, for example the polymerase chain reaction, prior to sequencing or prior to placement of the subfragments onto the high density grid.
  • genomic subfragments of known sequence Once the genomic subfragments of known sequence have been generated, aliquots of each subfragment are placed individually in an ordered (known) position onto a high density grid. Since the position of each fragment on the grid is known, and the location of each fragment's sequence in the whole genomic sequence is known, then the data resulting from any grid position can be assigned to the small region of the genomic sequence represented by the subfragment.
  • grid or high density grid, refers to any surface which is suitable for receiving ordered spots or aliquots of genomic subfragments.
  • Nucleic acid grid materials include, for example, nylon filter membranes, derivatized glass, silicon chips or other polymeric solid supports. Many such grids are commercially available.
  • test transcripts which have been transcribed from cells or tissues containing the genomic sequence.
  • the test transcripts have been prepared to be labeled in a detectable manner.
  • Methods of detectably labeling test transcripts include, for example, reverse transcription and polymerase chain reaction in the presence of labeled nucleotide triphosphates.
  • Preferred labels include fluorophores such as flourescein, rhodamine and pyrenes, haptens, P32, P33 .terbium, europium, and electrically active moieties.
  • the labeled test transcripts are placed in contact with the high density grid containing the genomic subfragments and are allowed to hybridize to the genomic subfragments.
  • Preferred hybridization conditions include salt concentrations of 0.01 to 1.0M, temperatures of about 35 to 70 degree C, and times of approximately 0.5 to several hours. Preferred conditions are easily determined empirically by those skilled in this art and differ, for example, based upon the average G+C content of the arrayed nucleotides. Unhybridized test transcripts are removed from the surface of the high density grid by any convenient method known in this art. Generally useful methods known in this art for preparing arrays, labeled probes and hybridization conditions are provided, for example, in references 11 and 12.
  • each ordered position of the high density grid having a labeled test transcript is detected and the pattern in which the labeled test transcripts appear on the high density grid is analyzed, whereby by comparing the position of the labeled transcripts on the high density grid to the ordered position of the overlapping genomic subfragments on said grid, the position of the individual test transcript within the genomic sequence is mapped.
  • RNAs may possibly contain ORFs which were previously not expected to be actual genes (new genes), and the invention is further capable of associating these ORFs with expression in response to particular conditions or stimuli, and thus information about the function of novel genes is also provided by the invention. It is also possible that information about expression of known ORFs in response to particular conditions or stimuli provided by the method of the invention may lead to identification of a new function or activity for known ORFs.
  • the identification of new genes may include wholly new genes whose sequence and expression has never been characterized, and also new ORFs within known gene sequences wherein transcription initiation takes place at a newly recognized place.
  • the template genomic sequence of interest can be single-stranded or double-stranded DNA or in some cases RNA, derived from any living organism including animal, microbial, viral or plant.
  • Preferred embodiments of this method include wherein the genomic sequence is derived from an animal, particularly a mammal, most particularly a human animal.
  • Further preferred genomic sequences are derived from viruses or bacteria, most particularly herpes simplex viruses type 1 and type 2, hepatitis B virus, hepatitis C virus, human herpes viruses 6,7, and 8 and other complex genomes such as human cytomegalo virus.
  • genomic sequences can be derived from, for example, Pseudomonas artificial chromosomes (BACs) containing genomic regions of other prokaryotic or eukaryotic pathogens or animals, or even complete genomes of Streptococcus sp., Staphylococcus sp., Mycobacterium sp. and other similar organisms which present pathogenic risk to mammals including humans.
  • BACs Pseudomonas artificial chromosomes
  • overlapping subfragments are generated by shotgun cloning techniques wherein the DNA of interest is either sheared or digested enzymatically and enough random fragments are cloned such that all sequences of the region are represented by multiple clones.
  • the total population of clones thus represents a library for the genomic region.
  • the cloned fragments may be individually amplified and separated from the cloning vector by using the polymerase chain reaction prior to placing them onto the high density grid.
  • the fragments are preferably prepared so as to be offset in sequence by few bases, preferably one.
  • the fragment series will contain fragments of polynucleotides having the sequence base #1 to 200, 2 to 201, 3 to 202, etc.... (n-199) to n.
  • Further preferred embodiments of the general FAT Mapping method include employing computer-assisted methods to analyze the positioning of the genomic subfragments over the length of the genomic sequence based upon sequencing data of the genomic subfragments. Further, computer-assisted methods are useful to detect and compare the pattern of the labeled test transcripts on the high density grid to the ordered position of the overlapping genomic subfragments, and also to predict characteristics of the mRNAs and genes they represent through such analysis.
  • Automated steps may be employed at any point of the method to improve efficiency of the method, particularly at steps involving, for example, sequencing of the subfragments, amplification of the subfragments, placement of aliquots of the subfragments or labeled test transcripts onto the high density grid, and in the hybridization and washing steps.
  • FAT Mapping invention is a method of measuring the differential expression and relative concentrations of transcripts between two or more different tissues, cell populations or viral-infected cell populations which share a common genomic sequence.
  • This method first comprises, as described above, preparing a high density grid of sequenced, overlapping subfragments of the common genomic sequence.
  • Compositions of test transcripts are then prepared from the common genomic sequence, wherein each test composition represents expression of the common genomic sequence from a different tissue or cell population, or from the same tissue or cell population at a different time point, or from the same tissue or cell population which has been exposed to a specific stimulus or condition.
  • test transcripts expressed from the common genomic sequence in each instance is compared, whereby differences in the expression of transcripts between different tissue or cell populations, or between the same tissue or cell population at different time points, or between the same tissue or cell populations subjected to different stimuli or condition, are determined.
  • the common genomic sequence is derived from a mammal, most particularly a human. Also preferred would be from a bacterial species, most particularly a human pathogen such as Streptococcus, Staphylococcus, Mycobacterium, or a fungus, most particularly a human pathogen fungal type such as Cryptococcus; or a parasitic animal, particularly a eukaryotic human pathogen such as Plasmodium. Especially preferred would be genomic sequences derived from a virus, most particularly a herpes simplex type 1 or herpes simplex type 2 virus.
  • test transcript compositions are derived from different tissue types within the same organism, for example when samples are taken from different organs or cell types within an individual animal, particularly a mammal, particularly a human.
  • test transcript compositions are derived from different tissue types within the same organism, for example when samples are taken from different organs or cell types within an individual animal, particularly a mammal, particularly a human.
  • the invention provides a convenient mechanism for investigating regulation of tissue and cell specific function.
  • the general method further provides a way to investigate expression of the same tissue type at different time points of genomic expression; for example, genomic expression could be measured at different stages of tissue, cellular or viral development, or at different time points after exposure to a particular stimulus or condition.
  • time point analyses might include investigation of cellular development and differentiation of higher animals, for example in humans, analysis of fetal tissues compared to the same tissues throughout the aging process.
  • Further particularly useful aspects include analysis of a viral genome within viral-infected cells at different stages of viral genomic expression, for example the viral genome is sampled throughout latency and at intervals during virulence cycles. Accordingly, analysis of a cellular genome could also be performed to investigate the expression of cellular factors in tissues which harbor viruses at various time points associated with viral latency and infection.
  • the method is also applicable to time point analysis in various tissue and cell types after exposure to a particular stimulus or condition, whereby the effect of that stimulus or condition upon cellular or viral expression is studied.
  • Examples of possible stimuli to different genomic samples are limitless, and include, for example, temperature, light, pressure, or any other physical, environmental or chemical stimuli including particularly chemical compounds, most preferably potential drug candidate compounds which can be exposed to any viral, cell or tissue type in a state of infection or disease.
  • the present invention provides a useful analytical method of investigating the effect of potential drug candidate compounds on disease states, including classical noninfectious diseases such as cancer tissues, and also including infectious disease states such as viral infection.
  • the FAT Mapping invention can further be described in yet another aspect, as a method of determining whether a particular open reading frame of known position within a genomic sequence is expressed under any particular time point or condition.
  • the general method comprises the steps of generating overlapping subfragments of a genomic sequence, sequencing these subfragments, and placing an aliquot of each sequenced subfragment onto a high density grid in ordered positions. Then, a population of cells or tissue containing this genomic sequence is subjected to a particular condition or sampled at a particular time point, and a composition comprising test transcripts expressed while the viral, cell or tissue population was subjected to the particular condition or time point is prepared.
  • test transcripts in this composition are detectably labeled and placed in contact with the high density grid, whereby the labeled test transcripts are allowed to hybridize to the genomic subfragments on the grid. Unhybridized test transcripts are washed from the grid, and positions on the grid containing labeled test transcripts are identified. The pattern in which the test transcripts have hybridized to the genomic subfragments on the grid is analyzed, preferably by computer assisted methods. This analysis maps the position(s) on the genomic sequence from which test transcripts have been transcribed, and it is conveniently determined whether a particular transcript from a known open reading frame has been expressed.
  • a particularly preferred aspect comprises subjecting a tissue or cell population to a particular stress or to a potential drug compound, and determining whether the exposure to the stress or potential drug has stimulated or inhibited transcription from a particular open reading frame of interest.
  • HSV-2 Cloned DNA Specimens for Making the Array Single bacterial colonies from HSV-2 SB5 (ATCC VR 2546) genomic libraries were selected to ensure unique plasmid insert. Colonies were grown overnight in 175 ul LB broth containing ampicillin in microtiter plates without shaking at 37C. 1 ul culture was used per triplicate PCR amplification wells in 50 ul containing M13 universal primers (Gibco Life Technologies) and AmpliTaq Gold PE. Amplification proceeded for 40 cycles at 55 degrees C. Products were analyzed by agarose electrophoresis, purified using AGTC columns. DNA was quantitaed, sequenced with M13 universal primer (ABI sequencer) and precipitated for gridding. Bacterial cultures were frozen in triplicates. Gene specific PCR products for controls were generated from genomicHSV-2 SB5 DNA as described below (primer sensitivity).
  • Microarray Preparation from HSV-2 Cloned DNA DNA template products from the above step were used to prepare arrays of DNA spots for hybridization. Arrays were spotted on silane treated glass (Molecular Dynamics, Sunnyvale, CA) using the Molecular Dynamics Microarray spotter. The protocols used for spotting and hybridization were essentially those described elsewhere (in A Systems Approach To Fabricating And Analyzing DNA Microarrays (1999). Jennifer Worley, Kate Bechtol, Sharron Penn, David Roach, David Hancel, Mary Trounstine, and David Barker. DNA Microarrays: Biology and Technology. Biotechniques Books. Editor Mark Schena). All resulting microarrays were scanned with the Molecular Dynamics microarray scanner after hybridization of cDNA probes prepared as described below. Images were analyzed using Array Vision (Imaging Research, St. Catherine's, Ontario, Canada).
  • Complementary DNA (50 ul) was generated from 2-3 ug of total RNA using Superscript Preamplification kit (Life Technologies-Gibco BRL, Grand Island, NY) priming with oligo (dT) and random hexamers as described previously (Tal-Singer R., T.M. Lasner, W. Podrzucki, A. Skokotas, J.J. Leary, S.L. Berger, and N.W. Fraser. 1997. Gene expression during reactivation of herpes simplex virus type 1 from latency in the peripheral nervous system is different from that during lytic infection of tissue cultures. J Virol 71 :5268-5276).
  • PCR amplification ofcDNAfor Semi-quantitative Analysis Reactions were performed in 25 ul volumes containing appropriate amounts of cDNA. Primer pairs used to detect SB5 transcripts are described in Table 1. Primers for GAPDH were obtained from Clonetech. Primers for beta actin and cyclophilin were described previously (Tal-Singer R., T.M. Lasner, W. Podrzucki, A. Skokotas, J.J. Leary, S.L. Berger, and N.W. Fraser. 1997. Gene expression during reactivation of herpes simplex virus type 1 from latency in the peripheral nervous system is different from that during lytic infection of tissue cultures. J Virol 71 :5268-5276, Tal-Singer R., W.
  • the relative amount of PCR product was determined in arbitrary numbers as the ratio between the PCR product band intensity and that of a cellular housekeeping gene, encoding cyclophilin, beta-actin or GAPDH Bloom, D.C., G.B. Devi-Rao, J.M. Hill, J.G. Stevens, and E.K. Wagner. 1994. Molecular analysis of herpes simplex virus type 1 during epinephrine-induced reactivation of latently infected rabbits in vivo. J.Virol. 68:1283-1292.
  • RNA Analysis by TaqMan Reactions were performed in 50 ul volumes containing 2X TaqMan Universal PCR Master mix (Perkin-Elmer, Norwalk, Conn.) and appropriate amounts of cDNA. Reactions also contained 200 nM of TaqMan primers and 400 nM of TaqMan probe. Primer pairs and probes described in Table 2 were designed using Primer Express software (Perkin-Elmer, Norwalk, Conn.) and analyzed in 96-well optical plate. Probes were labeled at the 5' end with the fluorescent reporter dye Fam and at the 3' end with fluorescent quencher dye Tamra by Synthegen (Houston, Tx) to allow direct detection of the PCR product.
  • the TaqMan probe hybridizes to a target sequence within the PCR product and cleaves to separate the reporter and quencher dye. The separation of these two dyes increases the fluorescence of the reporter. The resulting fluorescence was measured using ABI 7700 Sequence detector (Perkin-Elmer, Norwalk, Conn.). Relative copy numbers were calculated using a standard curve generated using PCR standards described above.
  • LAT 120 100 100 CCAGAAAGGGCAGGCAGGTCAG SEQ ID NO: l
  • ICP22 405 1 1000 CGUCUTGCGGGTGTGUTiTrC SEQ ID NO:7
  • ICP6 220 10 100 CCTCACAGATGCTTGACGACGG SEQ ID NO: 13
  • ICP6 F 67 CCTCTGGATGCCGGACC SEQ ID NO:33
  • Genomic viral DNA is prepared from MRC-5 cells infected with strain HSV-2 SB5
  • the DNA is sheared into fragments with an average size of 1 to 2 kb by nebulization and the fragments cloned into pUC19 and Bluescript vectors. Randomly selected, cloned fragments are sequenced from over 2000 individual clones and the sequences are assembled into contiguous DNA sequences representing the HSV-2 genome using Sequencer and PHRAP software.
  • the HSV-2 DNA insert in each clone is amplified by PCR using M13 forward and reverse primers. Five nanograms of each of the PCR product DNA's are then printed as dots onto hundreds of glass slides in duplicate arrays of 25 blocks of 8 rows of dots by 12 columns of dots.
  • Control DNA samples for example from the cellular gene clones from beta-actin, cyclophylin and IRF-1 can be included in the array slides.
  • Tissues from mice infected with HSV 30 days previously are removed before and after induction of reactivation by hypothermia.
  • Tissues collected include brain and trigeminal ganglia.
  • the RNA is purified from the tissues as described in reference 15. Labeled cDNA from latently infected and reactivating tissues will be prepared and hybridized to individual slide arrays of DNA fragments described above. The labeled pattern of dots obtained by hybridizing arrays with cDNA from latently infected animals are compared to the pattern obtained by hybridizing arrays with cDNA from reactivating animals using computer assisted image analysis.
  • the resulting pattern of clones is translated using computer assisted calculations into a linear array of genomic HSV-2 sequences which are hybridized to the RNA's from reactivating tissues. These linear arrays delineate the HSV-2 coding sequences expressed during the reactivation process, and the genes are defined by the first (or in some cases second) ATG 5' from the end of each RNA predicted from the contiguous linear array.
  • important genes expressed during reactivation but not during latent infection include the TK gene UL23 and the DNA polymerase gene UL30.
  • the immediate early genes ICPO, ICP4, and ICP22 are not expressed before the UL23 and UL30 genes as they are during primary infection in vitro, suggesting that a cellular function induced by the hypothermia overcomes or substitutes for transcriptional regulation of UL23 and UL30 by ICPO, ICP4 and ICP22 genes.
  • antiviral drugs which interfere with ICPO, 4 or 22 would not be expected to interfere with latency as much as inhibitors of UL23 or UL30.
  • Example 2 Identification of the temporal regulation of gene expression in HSV-2 during primary in vitro infection. The kinetics of the temporal cascade of expression all of the genes in HSV-2 is determined at one time in an experiment employing RNA samples from MRC-5 cells infected with HSV-2 SB5 in vitro for 0, 2, 6, 12 and 18 hours. To more finely determine the end location of RNA transcripts from the internal repeat L to the internal repeat S region, PCR products 1000 bp long starting at every 10 nucleotides between 116,100 to 132, 600 are produced and added to the array to supplement the random clones prepared as in
  • Example 1 These new additions guarantee a minimum accuracy of mapping the end of a transcript to within 10 nucleotides of the actual end.
  • Labeled cDNA probes are prepared from the RNA samples prepared 0, 2, 6, 12, and 18 hours after infection with HSV-2. All 5 cDNA probe samples are hybridized to the array grids on glass slides and the pattern of labeled probe binding to spots is again translated into a linear array (or map) of the RNA molecules' template sequence on the HSV-2 genome.
  • no RNA transcripts are detected in the 0 time point, the immediate-early genes including ICPO, ICP4 and ICP22 are detected at the 2 hour time point, and in the 6 hour time point hybridization the early genes including UL23 and UL30 are also detected.
  • transcripts representing the structural genes such as glycoprotein D and glycoprotein B are detected.
  • genes detected in each kinetic class are some that are novel, previously unidentified transcripts and transcripts whose HSV-1 homologs are temporally regulated differently than their HSV-2 counterparts.
  • Example 3 Identification of the stage in the HSV life cycle at which a potential antiviral compound acts, and clarification of the mechanism of action of the compound.
  • the disruption of that cascade can also be determined by fine array transcript mapping through the use of cDNA probes prepared identically except that the infected cells are treated with compound "X".
  • those genes whose expression is completely dependent upon HSV DNA replication would be identified by hybridizing the arrays to cDNA probes from cultures at 12 to 18 hours after infection in the presence or absence of the DNA synthesis inhibitor aphidicolin.
  • those genes strictly dependent upon DNA synthesis for their expression would be mapped by the probe from untreated cultures but absent from the mapped transcripts detected through the use of the probe from treated cultures.
  • any compound of unknown activity could be suspected to inhibit HSV DNA synthesis if the same pattern of hybridized dots were detected using cDNA probes from cells 12 to 18 hr after infection in the presence of the unknown compound.
  • the compounds mechanism of action would involve and earlier step in the replication cycle, for example the transactivation of gene expression by ICP4.
  • Example 4 Identification of novel genes encoded by the HSV genome.
  • the temporally-regulated cascade of gene expression from HSV-2 can be characterized as in Example 2 above. Since it is known that there are transcripts from the HSV genomic region around open reading frames UL8, UL9, and UL10 that are of different size than those encoding UL8, UL8.5, UL9, UL9.5 and UL10 (17) and that FAT Mapping will predict the location of the ends of these mRNAs, novel encoded proteins can be predicted.
  • RNAs may be expressed rapidly after infection and others later during infection, assisting in separating the signals generated on the cloned DNA spots.
  • the predicted novel proteins may represent a portion of the amino acid sequence of the known UL8, UL8.5, UL9, UL9.5, or UL10 genes (i.e. contain a subsection of those open reading frames), or may represent a new amino acid sequence, by occurring in a different open reading frame.
  • genomic sequence subjected to FAT Mapping represents a portion of an animal genome, for example a section of the human genome encoding chemokines
  • probes prepared from cells or tissues treated with experimental compounds may be used to identify compounds which effect the expression of the subject chemokines.
  • human peripheral blood lymphocytes transcribe mRNA's for proinflammatory RANTES, MlPlb and other chemokines upon appropriate stimulation. If the stimulation is then performed in vitro or in vivo in the presence of test compounds, labeled cDNA probes can be prepared from mRNA extracted from those lymphocytes and used to probe the FAT Map array.
  • Probes prepared from cells treated with compounds which inhibit or enhance the production of RANTES or MlPlb mRNAs can be identified by the corresponding decrease or increase in the FAT Map signals. Those compounds which inhibit transcription of RANTES would be potential anti-inflammatory drugs, while those which enhance the production of RANTES would be potential pro-inflammatory drugs.
  • FAT Mapping may be used to characterize the constellation of genes from a given genomic region which are differentially expressed in specific disease situations, e.g. psoriatic skin. If drugs are known or can be identified through FAT Mapping or another transcriptional analysis to differentially affect the expression of those same genes but in the opposite direction (e.g. down rather than up), then a new disease indication for those known drugs may be discovered through FAT Mapping.
  • Example 6 Further embodiments to Example 2
  • the FATMap technique was used to identify the temporal regulation of HSV-2 gene expression during primary infection of cell cultures.
  • the same RNA samples were assessed in three additional ways, a) semi-quantitative PCR where amounts of gene-specific products were compared to housekeeping gene products, b) TaqMan real-time quantitative PCR analysis, and c) hybridization signals generated on the same array by multiple spots of DNA from specific genes of HSV-2.
  • the results for HSV-2 genes ICP6 (UL39) and gC (UL44) by all techniques are shown. FATMap array hybridization demonstrated a gradual increase of signal for ICP6
  • the FATMap data were consistent with the array signals from gene-specific PCR products on the same grid shown in Fig. 4.
  • Conventional semi-quantitative RT-PCR results for the UL39 gene (ICP6) are consistent both with the FATMap array kinetics of expression and the specific gene microarray results, that is an increasing expression up to 6 hr post- infection.
  • Data for conventional RT-PCR with RNA from a similar HSV-2 experiment are shown below in Fig. 5A.
  • the results from the TaqMan quantitative PCR analysis also agreed with the FATMap array in the kinetics of expression of ICP6 (UL39) as shown in Figure 5B.
  • HSV-2 gene is included in this example, that being the gene for glycoprotein C, also known as gC, the product of the UL44 open reading frame.
  • gC glycoprotein C
  • Figure 6 A and 6B the FATMap data for the UL44 genomic region and the gene map from the HSV-2 HG52 genbank entry are shown.
  • the pattern of expression by FATMap clones above is similar again to the pattern of microarray hybridization done for gene-specific DNA spots for the gC open reading frame (UL44) as shown in Figure 7. Reproducibility between each of the eight replicate spots of the same UL44 DNA is also good, as shown below.
  • Example 7 An embodiment of example 4
  • the FATMap technique was used to identify areas of HSV-2 gene expression where the level of expression appears to be different within one open reading frame identified by the HSV-2 HG52 genbank entry. These are cases where it is probably that another RNA exists which does not correlate with the reported genes, and therefore may indicate a new gene.
  • Figure 8 below, one can see that the clones spanning the left half of the coding region for UL29 have a much higher signal intensity than those on the right half of the UL29 gene. This suggests a separate, highly expressed RNA, spanning the 3' half of the gene which conceivably represents expression of a novel gene which uses part of the UL29 open reading frame and one terminus in the UL29 open reading frame.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé d'analyse génétique baptisé 'cartographie de transcrits à réseau fin' qui s'utilise pour détecter et mesurer les molécules d'ARN qui ont été transcrites à partir d'un génome. Le procédé peut être utilisé pour explorer l'expression différentielle d'un génome matrice et pour cartographier les extrémités 5' des transcrits exprimés. En outre, la présence ou l'absence dans des conditions biologiques particulières d'un transcrit donné et sa concentration relative peuvent définir les fonctions d'un gène ou les capacités de codage. Par conséquent, ce procédé a trait à la cartographie et à l'identification des produits géniques nouveaux ou connus et aux recherches en matière de fonctions et de régulation des gènes.
PCT/US1999/013813 1998-06-24 1999-06-18 Procede pour detecter, analyser et cartographier les transcrits d'arn WO1999067422A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2000556062A JP2002518064A (ja) 1998-06-24 1999-06-18 Rna転写産物の検出、分析およびマッピング方法
EP99930404A EP1090144A1 (fr) 1998-06-24 1999-06-18 Procede pour detecter, analyser et cartographier les transcrits d'arn
CA002330731A CA2330731A1 (fr) 1998-06-24 1999-06-18 Procede pour detecter, analyser et cartographier les transcrits d'arn

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9046498P 1998-06-24 1998-06-24
US60/090,464 1998-06-24

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09719714 A-371-Of-International 2000-12-15
US10/388,281 Continuation US20030175784A1 (en) 1998-06-24 2003-03-13 Method for detecting, analyzing, and mapping RNA transcripts

Publications (1)

Publication Number Publication Date
WO1999067422A1 true WO1999067422A1 (fr) 1999-12-29

Family

ID=22222880

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/013813 WO1999067422A1 (fr) 1998-06-24 1999-06-18 Procede pour detecter, analyser et cartographier les transcrits d'arn

Country Status (4)

Country Link
EP (1) EP1090144A1 (fr)
JP (1) JP2002518064A (fr)
CA (1) CA2330731A1 (fr)
WO (1) WO1999067422A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001057275A2 (fr) * 2000-02-04 2001-08-09 Aeomica, Inc. Sondes d'acide nucleique a un seul exon derivees du genome humain utiles pour analyser l'expression genique dans le cerveau humain
EP1272841A1 (fr) * 2000-05-19 2003-01-08 Affymetrix, Inc. Procedes et produits logiciels d'ordinateur pour annotation transcriptionnelle

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5019506A (en) * 1986-05-21 1991-05-28 University College, Cork Plasmid and uses thereof
US5138033A (en) * 1990-08-24 1992-08-11 Board Of Trustees Operating Michigan State University Marek's disease herpesvirus glycoproteins GE
US5525464A (en) * 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5837832A (en) * 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5019506A (en) * 1986-05-21 1991-05-28 University College, Cork Plasmid and uses thereof
US5525464A (en) * 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5138033A (en) * 1990-08-24 1992-08-11 Board Of Trustees Operating Michigan State University Marek's disease herpesvirus glycoproteins GE
US5837832A (en) * 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SCHENA M: "GENOME ANALYSIS WITH GENE EXPRESSION MICROARRAYS", BIOESSAYS, JOHN WILEY & SONS LTD., GB, vol. 18, no. 05, 1 January 1996 (1996-01-01), GB, pages 427 - 431, XP002924469, ISSN: 0265-9247, DOI: 10.1002/bies.950180513 *
TSOU P, ET AL.: "PARALLEL HYBRIDIZATION ANALYSIS OF MULTIPLE PROTEIN KINASE GENES: IDENTIFICATION OF GENE EXPRESSION PATTERNS CHARACTERISTIC OF HUMAN HEPATOCELLULAR CARCINOMA", GENOMICS, ACADEMIC PRESS, SAN DIEGO., US, vol. 50, 1 January 1998 (1998-01-01), US, pages 331 - 340, XP002924468, ISSN: 0888-7543, DOI: 10.1006/geno.1998.5338 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001057275A2 (fr) * 2000-02-04 2001-08-09 Aeomica, Inc. Sondes d'acide nucleique a un seul exon derivees du genome humain utiles pour analyser l'expression genique dans le cerveau humain
WO2001086003A2 (fr) * 2000-02-04 2001-11-15 Aeomica, Inc. Sondes d'acide nucleique a un seul exon derivees du genome humain utiles pour analyser l'expression genique dans le poumon humain
WO2001057275A3 (fr) * 2000-02-04 2003-04-17 Aeomica Inc Sondes d'acide nucleique a un seul exon derivees du genome humain utiles pour analyser l'expression genique dans le cerveau humain
WO2001086003A3 (fr) * 2000-02-04 2003-05-22 Aeomica Inc Sondes d'acide nucleique a un seul exon derivees du genome humain utiles pour analyser l'expression genique dans le poumon humain
GB2383043B (en) * 2000-02-04 2005-07-27 Aeomica Inc Human genome-derived single exon nucleic acid probes useful for analysis of gene expression in human brain
EP1272841A1 (fr) * 2000-05-19 2003-01-08 Affymetrix, Inc. Procedes et produits logiciels d'ordinateur pour annotation transcriptionnelle
EP1272841A4 (fr) * 2000-05-19 2006-07-26 Affymetrix Inc Procedes et produits logiciels d'ordinateur pour annotation transcriptionnelle

Also Published As

Publication number Publication date
CA2330731A1 (fr) 1999-12-29
JP2002518064A (ja) 2002-06-25
EP1090144A1 (fr) 2001-04-11

Similar Documents

Publication Publication Date Title
Saizieu et al. Bacterial transcript imaging by hybridization of total RNA to oligonucleotide arrays
US6638717B2 (en) Microarray-based subtractive hybridzation
US6271002B1 (en) RNA amplification method
Chambers et al. DNA microarrays of the complex human cytomegalovirus genome: profiling kinetic class with drug sensitivity of viral gene expression
EP0853679B1 (fr) Mesure de l'expression par l'hybridation avec des systemes tres denses d'oligonucleotides
CA2179605A1 (fr) Agencement de sequences d'acides nucleiques et son utilisation
WO2008084405A2 (fr) 4c
US20060003321A1 (en) Expression monitoring for human cytomegalovirus (HCMV) infection
Sergeev et al. New mosaic subgenotype of varicella-zoster virus in the USA: VZV detection and genotyping by oligonucleotide-microarray
US20060228714A1 (en) Nucleic acid representations utilizing type IIB restriction endonuclease cleavage products
Obara et al. Distribution of herpes simplex virus types 1 and 2 genomes in human spinal ganglia studied by PCR and in situ hybridization
WO1999067422A1 (fr) Procede pour detecter, analyser et cartographier les transcrits d'arn
US20030175784A1 (en) Method for detecting, analyzing, and mapping RNA transcripts
WO1991002091A1 (fr) Procede d'identification d'herpes virus et oligonucleotides utilises dans le procede
WO1997018326A1 (fr) Hybridation comparative d'acides nucleiques a ultra haute resolution appliquee a des fibres d'adn peignees
RU2402771C2 (ru) Способ скрининга сердечно-сосудистых заболеваний и биочип для осуществления этого способа
CA2566395A1 (fr) Selection informatisee de sondes pour localisation des points de rupture des chromosomes
Zhang et al. Chromosomal location of the 28S ribosomal RNA gene of channel catfish by in situ polymerase chain reaction
US20090143238A1 (en) Oligonucleotide matrix and methods of use
JP3536934B2 (ja) ヒトヘルペスウイルス検出用オリゴヌクレオチドおよびその用途
Sirivatanauksorn et al. [25] DNA fingerprinting from cells captured by laser microdissection
Hozier et al. Chromosome microdissection-based techniques for genome analysis
JP3279702B2 (ja) ウイルス検査用試薬及びそれを用いた検査方法
CA2342903A1 (fr) Technique de representation de differentiels genetiques et vecteur
JP2004194612A (ja) ゴキブリのミトコンドリアdna16sリボソームrna遺伝子塩基配列およびゴキブリの種を同定する方法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09719714

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2330731

Country of ref document: CA

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 556062

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999930404

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999930404

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999930404

Country of ref document: EP