WO1999062942A2 - Tumor antigen useful in diagnosis and therapy of prostate and colon cancer - Google Patents
Tumor antigen useful in diagnosis and therapy of prostate and colon cancer Download PDFInfo
- Publication number
- WO1999062942A2 WO1999062942A2 PCT/US1999/012253 US9912253W WO9962942A2 WO 1999062942 A2 WO1999062942 A2 WO 1999062942A2 US 9912253 W US9912253 W US 9912253W WO 9962942 A2 WO9962942 A2 WO 9962942A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tmprss2
- protein
- prostate
- antibody
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- Prostate cancer is the most frequently diagnosed cancer and second leading cause of cancer death in men. Some 45,000 men die annually of this disease. Only lung cancer has a higher mortality. The chance of a man developing invasive prostate cancer during his lifetime is 1 in 6. At the age of 50, a man has a greater than 40% chance of developing prostate cancer and nearly a 3% chance of dying from this disease. While some advances in the treatment of locally confined tumors have been achieved, prostate cancer is incurable once it has metastasized. Patients with metastatic prostate cancer are treated by hormonal ablation therapy, but with only short-term success. Eventually, these patients develop an androgen-refractory state leading to disease progression and death.
- a continuing and fundamental problem in the management of prostate cancer is the absence of reliable diagnostic and prognostic markers capable of accurately detecting early-stage localized tumors and/or predicting disease susceptibility and progression.
- Early detection and diagnosis of prostate cancer currently relies on digital rectal examination (DRE), prostate specific antigen (PSA) measurements, transrectal ultrasonography (TRUS), and transrectal needle biopsy (TRNB).
- DRE digital rectal examination
- PSA prostate specific antigen
- TRUS transrectal ultrasonography
- TRNB transrectal needle biopsy
- Serum PSA measurements in combination with DRE represent the leading diagnostic approach at present.
- this approach has major limitations which have fueled intensive research into finding better diagnostic markers of this disease.
- a number of markers have been identified, and at least one, PSA, is in widespread clinical use.
- ideal prostate tumor markers have been extremely elusive and no marker has yet proven reliable for predicting progression of the disease.
- PSA is the most widely used tumor marker for screening, diagnosis, and monitoring prostate cancer today.
- RT-PCR reverse transcriptase- polymerase chain reaction
- PSA is not a disease-specific marker, as elevated levels of PSA are detectable in a large percentage of patients with BPH and prostatitis (25- 86%)(Gao et al., 1997, Prostate 31 : 264-281), as well as in other nonmalignant disorders and in some normal men, a factor which significantly limits the diagnostic specificity of this marker. For example, elevations in serum PSA of between 4 to 10 ng/ml are observed in BPH, and even higher values are observed in prostatitis, particularly acute prostatitis. BPH is an extremely common condition in men. Further confusing the situation is the fact that serum PSA elevations may be observed without any indication of disease from DRE, and vice-versa. Moreover, it is now recognized that PSA is not prostate-specific (Gao et al., supra, for review).
- PSA diagnostics have sensitivities of between 57-79% (Cupp & Osterling, 1993, Mayo Clin Proc 68:297-306), and thus miss identifying prostate cancer in a significant population of men with the disease.
- PSMA Prostate-Specific Membrane Antigen
- PSMA protein is highly expressed in most primary and metastatic prostate cancers, but is also expressed in most intraepithelial neopiasia specimens
- PSMA Prostate Stem Cell Antigen
- PSCA expression has been shown to be prostate specific and widely over- expressed across all stages of prostate cancer, including high grade prostatic intraepithelial neoplasia (PIN), androgen-dependent and androgen-independent prostate tumors.
- the PSCA gene has been mapped to chromosome 8q24.2, a region of allelic gain in more than 80% of prostate cancers.
- PSCA shows promise as a diagnostic and therapeutic target in view of its cell surface location, prostate specificity, and greatly upreguiated expression in prostate cancer cells.
- DU-145 and PC-3 cell lines have been shown to reproducibly give rise to osteoblastic lesions typical of prostate cancer.
- a further limitation of the DU-145 and PC-3 cell lines is that these cells do not express prostate specific antigen (PSA) or androgen receptor (AR) (Kaighn et al., 1979, Invest. Urol. 17: 16-23; Gleave et al., 1992, Cancer Res. 52: 1598-1605), questioning their relevance to clinical prostate cancer.
- PSA prostate specific antigen
- AR androgen receptor
- the LNCaP cell line is androgen responsive and expresses PSA, but contains a mutation in the androgen receptor which alters ligand specificity.
- LAPC Long et al., 1997, Nature Med. 3: 402
- LAPC-4 Long et al., 1997, supra
- LAPC-4 tumors regress in male mice after castration, but re-grow within 2-3 months as androgen independent tumors.
- LAPC-4 xenograft tumors express equal levels of the prostate specific markers PSA, PSMA (prostate specific membrane antigen) and PSCA (prostate stem cell antigen), which was identified using representational difference analysis of cDNAs derived from the AD and Al variants of the LAPC-4 xenograft.
- the present invention relates to methods and compositions for the diagnosis and therapy of prostate and colon cancer, derived from or based on a novel prostate- specific, androgen-regulated, cell surface serine protease termed 20P1 F12/TMPRSS2 and extensively described herein.
- a full length cDNA comprising the entire coding sequence of the 20P1F12/TMPRSS2 gene (also designated 20P1F12-GTC1 herein) is provided (FIG. 1).
- This cDNA encodes a protein which is highly related to, but structurally distinct from, the recently published TMPRSS2 (Paoloni-Giacobino et al., 1997, Genomics 44: 309-320).
- the 20P1F12/TMPRSS2 gene also shows a very different expression pattern relative to the expression profile of TMPRSS2.
- the invention provides polynucleotides corresponding or complementary to all or part of the 20P1 F12/TMPRSS2 gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding 20P1 F12/TMPRSS2 proteins and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to the 20P1F12/TMPRSS2 genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides which hybridize to the 20P1F12/TMPRSS2 genes, mRNAs, or to 20P1F12/TMPRSS2-encoding polynucleotides.
- Recombinant DNA molecules containing 20P1F12/TMPRSS2 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for the expression of 20P1 F12/TMPRSS2 gene products are also provided.
- the invention further provides 20P1 F12/TMPRSS2 proteins and polypeptide fragments thereof.
- Methods for detecting the presence of 20P1 F12/TMPRSS2 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 20P1 F12/TMPRSS2 are provided. Diagnostic imaging methods for the management of prostate and colon cancers are also provided.
- the invention further provides various therapeutic compositions and strategies for treating prostate cancer, including particularly, antibody therapy methods and compositions, cancer vaccines, and small molecule therapy.
- the invention provides antibodies that bind to 20P1F12/TMPRSS2 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker or toxin or therapeutic composition.
- Several monoclonal antibodies specifically reactive with 20P1 F12/TMPRSS2 are also described herein. These and other 20P1 F12/TMPRSS2 antibodies are useful in molecular diagnostic assays and diagnostic imaging methods for detecting, localizing and characterizing carcinomas of the prostate and colon and metastases thereof. Cancer vaccines are also provided.
- FIG. 1 Nucleotide and deduced amino acid sequences of cDNA clone 20P1F12-GTC1 (Example 3)(as deposited with the ATCC; Accession No. 207097).
- FIG. 2 Nucleotide and deduced amino acid sequences of TMPRSS2 gene sequence as published in Paoloni-Giacobino et al., 1997, Genomics 44: 309-320.
- FIG. 3 Amino acid sequence alignment comparing 20P1 F12-GTC1 cDNA (Example 3) with the previously published sequence of TMPRSS2 (Paoloni-Giacobino et al., 1997, Genomics 44: 309-320). Amino acid differences are shown in bold type.
- FIG. 4 Nucleotide sequence of initially isolated SSH clone 20P1 F12.
- FIG. 5 RT-PCR analysis of 20P1 F12/TMPRSS2 gene expression in prostate cancer xenografts, normal prostate, and other tissues and cell lines, showing approximately equal levels of expression in normal prostate and three prostate cancer xenografts (Panel A); and showing largely prostate specific expression in normal human tissues, with significantly lower expression levels detectable in colon, pancreas, kidney and lung (Panels B and C).
- FIG. 6 Northern blot analysis of 20P1 F12/TMPRSS2 gene expression in normal human tissues and prostate cancer xenografts using labeled clone 20P1 F12 cDNA probe.
- Panels A and B Expression in 16 normal tissues largely restricted to prostate; with kidney, pancreas and lung showing 10- to 20- fold lower expression levels.
- Panel C Expression in LAPC-4 prostate cancer xenografts and various cell lines showing high level expression in prostate cancer xenografts, some of the prostate cancer cell lines, and in a colon carcinoma cell line. Except for LAPC-9 Al, expression of 20P1F12/TMPRSS2 in the xenografts was comparable to levels observed in normal prostate samples. In addition, lower level expression in the epidermoid carcinoma line A431 was observed.
- Monoclonal antibodies towards 20P1F12/TMPRSS2 were generated using a purified GST-20P1F12/TMPRSS2 fusion protein as described in Example 5.
- Hybridoma supernatants were initially screened by ELISA against purified 20P1 F12 ⁇ " MPRSS2 protein cleaved from the GST-fusion.
- a secondary screen involved western blotting against lysates derived from 293T cells transfected with a retroviral vector encoding 20P1F12/TMPRSS2.
- Molecular weight standards are indicated on the side in kiiodaltons (KD).
- FIG. 9 Cell surface biotinylation of 20P1 F12/TMPRSS2.
- His-tagged 20P1 F12/TMPRSS2 or neo (as a control) were transfected into 293T cells. Intact cells were incubated with biotin to biotinylate all cell surface proteins. Cell lysates were either analyzed by western blotting directly (lanes 1 and 2, or they were incubated with streptavidin to affinity purify all labeled cell surface proteins). Streptavidin purified cell surface proteins were analyzed by western blotting using anti-His antibodies (lanes 3 and 4).
- Biotinylated protein was only detected in 20P1F12/TMPRSS2 transfected cells.
- Biotinylated PC-3 (lane 2) and LNCaP (Lane 4), and unlabelled PC-3 (lane 1 ) and LNCaP (lane 3) were incubated with streptavidin gel and then analyzed by western blotting using 1 F9 mAb.
- 20P1F12/TMPRSS2 was only detected in biotinylated samples.
- Molecular weight standards are indicated on the side in kiiodaltons (KD).
- FIG. 10 De-glycosylation of 20P1 F12/TMPRSS2 in transfected 293T cells. His-tagged 20P1F12/TMPRSS2 transfected into 293T cells was purified using Nickel-agarose. 20P1 F12tTMPRSS2 protein was then de-glycosylated using N-glycosidase F. Untreated 20P1F12/TMPRSS2 (lane 1 ) and de-glycosylated protein (lane 2) were analyzed by western blotting using anti-His antibodies. A shift in molecular weight is detected with de-glycosylation. Molecular weight standards are indicated on the side in kiiodaltons (KD). FIG. 11.
- Androgen regulation of 20P1 F12/TMPRSS2 cell surface protease LNCaP cells were deprived of androgen by growing cells in 2% charcoal-stripped fetal bovine serum for 1 week (lane 1), or 24 hours (lane 3). Androgen regulation was determined by stimulating 24 hour starved cells with 10 nM mibolerone (androgen analogue) for 9 hours (lane 4). Expression of 20P1 F12/TMPRSS2 was compared to 20P1 F12/TMPRSS2 levels in LNCaP cells growing in complete medium (lane 2) by northern blotting of 10 ⁇ g of RNA/lane probed with a 20P1 F12/TMPRSS2 probe.
- Equal RNA loading was determined by ethidium bromide staining and subsequent probing with a ⁇ -acting probe. PSA levels were determined as a control for androgen regulation. Molecular weight standards are indicated on the side in kilobases (kb).
- FIG. 12 Androgen regulation of 20P1 F12/TMPRSS2 in LNCaP.
- LNCaP cells were deprived of androgen by growing cells in 2% charcoal-stripped fetal bovine serum for
- RNA/lane probed with a 20P1F12/TMPRSS2 probe was determined by probing the northern blot with a ⁇ -acting probe.
- FIG. 13 Effect of 20P1 F12/TMPRSS2 expression in NIH 3T3 cells.
- NIH 3T3 cells were infected with retrovirus encoding either neo (as a control) or 20P1F12/TMPRSS2. Forty-eight hours after infection the cells were analyzed by light microscopy. Cells that appeared to accumulate high numbers of vacuoles are indicated with arrows.
- the present invention relates to methods and compositions for the diagnosis and therapy of prostate cancer which utilize isolated polynucleotides corresponding to the 20P1F12/TMPRSS2 gene, proteins encoded by the 20P1F12/TMPRSS2 gene and fragments thereof, and antibodies capable of specifically recognizing and binding to 20P1 F12/TMPRSS2 proteins.
- the 20P1F12/TMPRSS2 gene encodes a predicted 492 amino acid multimeric protein containing a serine protease domain, a scavenger receptor cysteine-rich domain, an LDL receptor class A domain, and a predicted transmembrane domain as has been described for TMPRSS2 (Paoloni-Giacobino et al., 1997, Genomics 44: 309-320).
- TMPRSS2 Panoloni-Giacobino et al. found that the TMPRSS2 gene is expressed strongly in small intestine and only weakly in several other tissues and have also mapped the TMPRSS2 gene to chromosome 21. The physiological role of TMPRSS2 is unknown.
- 20P1F12/TMPRSS2 has a completely different expression pattern in comparison to what has been known for the previously reported TMPRSS2.
- 20P1 F12 TMPRSS2 is a prostate specific protease, it is possible that it functions directly in the development and/or progression of prostate cancer, particularly in the development of metastatic disease.
- proteases are known to be involved in invasion and metastasis of cancer cells (Henriet et al., 1999, APMIS 107(1):111-9; Rochefort et al., 1999, APMIS 107(1):86-95; Webber et al., 1995, Clin Cancer Res 1(10):1089-94; Duffy, 1996, Clin Cancer Res 2(4):613-8; Webber and Waghray, 1995 Clin Cancer Res 1(7):755-61).
- urokinase-type plasminogen activator u-PA
- cathepsin D urokinase-type plasminogen activator
- PSA urokinase-type plasminogen activator
- 20P1F12/TMPRSS2 function in prostate cancer, and particularly in metastasis may be evaluated as described in Example 5.
- 20P1 F12/TMPRSS2 and TMPRSS2 primary structure contains protein-protein interaction domains and an extracellular protease domain.
- the function of 20P1F12/TMPRSS2 and TMPRSS2 is unclear. The function of
- 20P1 F12/TMPRSS2 and TMPRSS2 may involve binding to substrate proteins in the extracellular milieu through its SRCR and/ or LDLA domains.
- proteins that exhibit SRCR domains include: CD6, an adhesion molecule that binds to ALCAM (activated leukocyte cell adhesion molecule) and mediates thymocyte-thymic epithelium cell binding (Whitney et al., 1995, J Biol Chem 270:18187); CD5 (Ly-1) a T- cell protein that binds CD72 on B-celis and may be involved in T-B cell communication
- protease domain of 20P1F12/TMPRSS2 is most homologous to the protease domain of hepsin (TMPRSS1), a transmembrane serine protease that is highly expressed in liver and up-regulated in ovarian cancer Leyus et al., 1988, Biochemistry 27: 1067-74; Tanimoto et al., 1997, Cancer Res. 57: 2884-2887).
- TMPRSS1 hepsin
- the invention is based, in part, upon the isolation of a cDNA fragment corresponding to the 20P1 F12/TMPRSS2 gene by Suppression Subtraction Hybridization cloning and upon the detailed molecular and biochemical characterization studies described in the Examples.
- the initially isolated cDNA fragment, clone 20P1F12 showed identity in an overlapping part of the 3' untranslated sequence of the recently described full length cDNA encoding TMPRSS2.
- Primers designed to specifically amplify the gene corresponding to 20P1F12 were then used to characterize 20P1F12/TMPRSS2 expression in prostate cancer xenografts, normal prostate, and a variety of other normal tissues.
- a full length cDNA comprising the entire coding sequence of the 20P1F12 TMPRSS2 gene has been isolated and sequenced and is provided herein.
- the nucleotide and deduced amino acid sequences of the novel 20P1 F12/TMPRSS2 gene are shown in FIG. 1.
- the amino acid sequences encoded by the 20P1F12- GTC1tTMPRSS2 gene compared to the previously reported sequence of TMPRSS2 (see amino acid alignment in FIG. 3).
- four of the amino acid differences are in the protease domain, three of which are non-conservative amino acid differences and which could affect protease function and/or specificity.
- Applicants' novel 20P1F12/TMPRSS2 protein has been extensively characterized, as further described in the Examples sections herein.
- the 20P1F12/TMPRSS2 protein is a glycosylated type II transmembrane protein with an extracellular C-terminal protease domain.
- the 20P1F12/TMPRSS2 gene is androgen-regulated.
- the 20P1 F12/TMPRSS2 protein is expressed on the cell surface. Expression of the 20P1 F12/TMPRSS2 gene in normal tissues is prostate-specific. Expression of 20P1F12/TMPRSS2 is also observed in prostate cancer, including high level expression in advanced and metastatic disease. In addition, 20P1 F12 appears to be over-expressed in colon cancer and may also be expressed in other cancers.
- Expression analysis also shows high level expression of 20P1F12/TMPRSS2 in all prostate cancer xenografts tested, at approximately the same levels seen in normal prostate (FIG. 5, Panel A).
- Northern blot analysis shows similar results, with somewhat lower level expression detected in the LAPC-9 xenograft relative to the LAPC-4 xenografts and normal prostate; expression is also detected in some of the prostate cancer cell lines analyzed (FIG. 6, Panel C).
- the 20P1 F12/TMPRSS2 gene is also expressed in a number of prostate cancer cell lines (FIG. 7).
- Expression of 20P1F12/TMPRSS2 in colon cancer may provide a molecular basis for detecting, diagnosing, prognosing and/or treating colon cancer.
- the invention provides a unique and useful 20P1 F12/TMPRSS2 gene (and protein), having the nucleotide and encoded amino acid sequences as shown in FIG. 1.
- Nucleotide probes corresponding to all or part of the 20P1F12/TMPRSS2 cDNA sequences disclosed herein are provided and may be used to isolate or identify other cDNAs encoding all or part of the 20P1 F12/TMPRSS2 gene sequence.
- the invention further provided primers capable of specifically amplifying the 20P1 F12/TMPRSS2 gene or its RNA transcripts.
- the invention further provides isolated polynucleotides containing coding sequences of the 20P1F12/TMPRSS2 gene product(s).
- Such polynucleotides may be used to express 20P1F12/TMPRSS2 encoded proteins and peptides having a number of further uses.
- 20P1 F12/TMPRSS2 gene probes and primers may also be used to detect the presence or absence of 20P1 F12 TMPRSS2 mRNA in various biological samples, for detecting prostate cancer cells and other cells expressing 20P1 F12/TMPRSS2, for generating tumor vaccines, and in molecular diagnostic and prognostic assays for prostate cancer.
- Polynucleotides corresponding or complementary to the 20P1F12/TMPRSS2 gene may be useful in methods for treating prostate cancer, such as, for example, in modulating or inhibiting 20P1 F12/TMPRSS2 biological activity.
- a 20P1F12/TMPRSS2 polynucleotide useful in the practice of the invention may comprise a polynucleotide having the nucleotide sequence of human 20P1F12/TMPRSS2 as shown in FIG. 1 (SEQ ID NO. XX) or the nucleotide sequence of the previously reported TMPRSS2 as shown in FIG. 2 (SEQ ID NO: XX), a sequence complementary to either of the foregoing, or a polynucleotide fragment of any of the foregoing.
- Another embodiment comprises a polynucelotide which encodes the 20P1 F12 ⁇ " MPRSS2 protein amino acid sequence as shown in FIG. 1 (SEQ ID NO.
- Another embodiment comprises a polynucleotide which is capable of hybridizing under stringent hybridization conditions to the 20P1F12/TMPRSS2 cDNA shown in FIG. 1 (SEQ ID NO. XX) or to a polynucleotide fragment thereof.
- antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives, that specifically bind DNA or RNA in a base pair- dependent manner.
- PNAs peptide nucleic acids
- non-nucleic acid molecules such as phosphorothioate derivatives
- probes and primer pairs which allow the specific amplification of the polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof.
- Probes may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
- Such probes and primers can be used to detect the presence of a 20P1F12/TMPRSS2 polynucleotide in a sample and as a means for detecting a cell expressing a 20P1F12/TMPRSS2 protein.
- An example of such a probe is a polypeptide comprising all or part of the human 20P1F12/TMPRSS2 cDNA sequence shown in FIG. 1 (SEQ ID NO. XX).
- primer pairs capable of specifically amplifying 20P1 F12/TMPRSS2 mRNAs are also described in the Examples which follow.
- a great many different primers and probes may be prepared based on the sequences provided in herein and used effectively to amplify and/or detect a 20P1 F12/TMPRSS2 mRNA.
- the 20P1F12/TMPRSS2 polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the amplification and/or detection of the 20P1 F12 TMPRSS2 gene, mRNA, or fragments thereof; as reagents for the diagnosis and/or prognosis of prostate and colon cancer; as coding sequences capable of directing the expression of 20P1F12/TMPRSS2 polypeptides; as tools for modulating or inhibiting the expression of the 20P1 F12/TMPRSS2 gene and/or translation of the 20P1 F12/TMPRSS2 transcript; and as therapeutic agents.
- the invention also provides 20P1 F12/TMPRSS2 proteins and polypeptides which may be used, for example, to generate antibodies or for use as cancer vaccines.
- Antibodies capable of specifically binding to and identifying 20P1 F12/TMPRSS2 proteins or polypeptides may be used to detect the expression of 20P1 F12/TMPRSS2, determine its subcellular location, detect and image prostate cancer cells and prostate tumors, and modulate or inhibit 20P1F12/TMPRSS2 biological activity.
- Antibodies may also used therapeutically as described further below. Methods for the generation of polyclonal and monoclonal antibodies are well known in the art.
- the invention also provides recombinant DNA or RNA molecules containing a 20P1F12/TMPRSS2 polynucleotide, including but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules.
- a recombinant DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro. Methods for generating such molecules are well known (see, for example, Sambrook et al, 1989, supra).
- the invention further provides a host-vector system comprising a recombinant DNA molecule containing a 20P1F12/TMPRSS2 polynucleotide within a suitable prokaryotic or eukaryotic host cell.
- suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9 cell).
- suitable mammalian cells include various prostate cancer cell lines such LnCaP, PC-3, DU145, LAPC-4, TsuPrl , other transfectable or transducible prostate cancer cell lines, as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of a 20P1F12/TMPRSS2 may be used to generate 20P1F12/TMPRSS2 proteins or fragments thereof using any number of host-vector systems routinely used and widely known in the art.
- Preferred vectors for mammalian expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSR ⁇ tkneo (Muller et al., 1991 , MCB 11 :1785).
- 20P1 F12tTMPRSS2 may be preferably expressed in several prostate and non-prostate cancer cell lines, including for example 3T3, 293, 293TPC-3, LNCaP and TsuPrl .
- the host-vector systems of the invention are useful for the production of a 20P1F12/TMPRSS2 protein or fragment thereof. Such host-vector systems may be employed to study the functional properties of 20P1F12/TMPRSS2 and 20P1 F12/TMPRSS2 mutations.
- Proteins encoded by the 20P1F12/TMPRSS2 genes, or by fragments thereof, will have a variety of uses, including but not limited to generating antibodies and in methods for identifying Hgands and other agents and cellular constituents that bind to a
- 20P1F12/TMPRSS2 gene product Such proteins may also be used as cancer vaccines.
- Antibodies raised against a 20P1F12 TMPRSS2 protein or fragment thereof may be useful in diagnostic and prognostic assays, imaging methodologies (including, particularly, cancer imaging), and therapeutic methods in the management of human cancers characterized by expression of a 20P1 F12/TMPRSS2 protein, such as prostate and colon cancers.
- imaging methodologies including, particularly, cancer imaging
- therapeutic methods in the management of human cancers characterized by expression of a 20P1 F12/TMPRSS2 protein, such as prostate and colon cancers.
- 20P1F12/TMPRSS2 proteins are contemplated, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
- ELISA enzyme-linked immunosorbent assays
- ELIFA enzyme-linked immunofluorescent assays
- Such antibodies may be labeled and used as immunological imaging reagents capable of detecting prostate cells (e.g., in radioscintigraphic imaging methods).
- a novel 20P1F12/TMPRSS2 protein having the amino acid sequence of human 20P1F12/TMPRSS2 is provided in FIG. 1 (SEQ ID NO. XX). Fusion proteins which combine all or part of 20P1F12/TMPRSS2 with a heterologous polypeptide are also contemplated.
- the 20P1 F12/TMPRSS2 protein of the invention may be embodied in many forms, preferably in isolated form. As used herein, the protein is said to be "isolated" when physical, mechanical or chemical methods are employed to remove the 20P1F12/TMPRSS2 protein from cellular constituents that are normally associated with the protein.
- a skilled artisan can readily employ standard purification methods to obtain an isolated 20P1F12/TMPRSS2 protein.
- a purified 20P1F12/TMPRSS2 protein molecule will be substantially free of other proteins or molecules which impair the binding of 20P1F12/TMPRSS2 to antibody or other ligand. The nature and degree of isolation and purification will depend on the intended use.
- Embodiments of a 20P1 F12/TMPRSS2 protein include a purified 20P1 F12/TMPRSS2 protein and a functional, soluble 20P1 F12/TMPRSS2 protein. In one form, such functional, soluble 20P1F12/TMPRSS2 proteins or fragments thereof retain the ability to bind antibody or other ligand.
- Recombinant methods can be used to generate nucleic acid molecules that encode the 20P1F12/TMPRSS2 protein.
- the 20P1F12/TMPRSS2-encoding nucleic acid molecules described herein provide means for generating defined fragments of the 20P1F12/TMPRSS2 protein.
- Such 20P1F12/TMPRSS2 polypeptides are particularly useful in generating domain specific antibodies (e.g., antibodies recognizing an extracellular epitope of the 20P1F12/TMPRSS2 protein), identifying agents or cellular factors that bind to a particular 20P1F12/TMPRSS2 domain, and in various therapeutic contexts, including but not limited to cancer vaccines.
- 20P1F12/TMPRSS2 polypeptides containing particularly interesting structures can be predicted and/or identified using various analytical techniques well known in the art, including, for example, the methods of Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis, or on the basis of immunogenicity.
- Another aspect of the invention provides antibodies that immunospecifically bind to the 20P1F12/TMPRSS2 protein and polypeptide fragments thereof.
- the most preferred antibodies will selectively bind to a 20P1F12/TMPRSS2 protein and will not bind (or will bind weakly) to non-20P1F12/TMPRSS2 proteins and polypeptides.
- Anti- 20P1F12/TMPRSS2 antibodies that are particularly contemplated include monoclonal and polyclonal antibodies as well as fragments containing the antigen binding domain and/or one or more complementarity determining regions of these antibodies.
- an antibody fragment is defined as at least a portion of the variable region of the immunoglobulin molecule which binds to its target, i.e., the antigen binding region.
- antibodies which specifically react with a particular 20P1F12/TMPRSS2 protein and/or an epitope within a particular structural domain are those with react with an epitope in an extracellular region of the 20P1F12/TMPRSS2 protein as expressed in cancer cells.
- Such antibodies may be generated by using the 20P1F12/TMPRSS2 protein, or using peptides derived from predicted extracellular or other domains of 20P1F12/TMPRSS2, and used as an immunogen.
- the 20P1 F12/TMPRSS2 antibodies of the invention may be particularly useful in prostate and colon cancer diagnostic and prognostic assays, imaging methodologies, and therapeutic strategies.
- the invention provides various immunological assays useful for the detection and quantification of 20P1F12/TMPRSS2.
- Such assays generally comprise one or more 20P1F12/TMPRSS2 antibodies capable of recognizing and binding a 20P1F12/TMPRSS2, and may be performed within various immunological assay formats well known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), and the like.
- immunological imaging methods capable of detecting prostate cancer are also provided by the invention, including but limited to radioscintigraphic imaging methods using labeled 20P1F12/TMPRSS2 antibodies.
- Such assays may be clinically useful in the detection, monitoring, and prognosis of prostate cancer, particularly advanced prostate cancer.
- 20P1F12/TMPRSS2 antibodies may also be used in methods for purifying 20P1F12/TMPRSS2 proteins and polypeptides and for isolating 20P1F12/TMPRSS2 homologues and related molecules.
- the method of purifying a 20P1F12/TMPRSS2 protein comprises incubating a 20P1 F12fTMPRSS2 antibody, which has been coupled to a solid matrix, with a lysate or other solution containing 20P1F12/TMPRSS2 under conditions which permit the 20P1F12/TMPRSS2 antibody to bind to 20P1F12/TMPRSS2; washing the solid matrix to eliminate impurities; and eluting the 20P1F12/TMPRSS2 from the coupled antibody.
- Other uses of the 20P1 F12/TMPRSS2 antibodies of the invention include generating anti-idiotypic antibodies that mimic the 20P1 F12/TMPRSS2 protein.
- 20P1F12 TMPRSS2 antibodies may also be used therapeutically by, for example, modulating or inhibiting the biological activity of a 20P1F12/TMPRSS2 protein or targeting and destroying prostate cancer cells expressing a 20P1F12/TMPRSS2 protein.
- Antibody therapy of prostate and colon cancer is described in further detail below.
- antibodies may be prepared by immunizing a suitable mammalian host using a 20P1F12/TMPRSS2 protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane (1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
- fusion proteins of 20P1 F12/TMPRSS2 may also be used, such as a 20P1 F12/TMPRSS2 GST-fusion protein.
- a GST fusion protein comprising all or most of the open reading frame amino acid sequence of FIG. 1 may be produced and used as an immunogen to generate appropriate antibodies.
- Example 5 such a GST fusion was used to generate several monoclonal antibodies which immunospecifically react with 20P1F12/TMPRSS2.
- Cells expressing or overexpressing 20P1F12/TMPRSS2 may also be used for immunizations.
- any cell engineered to express 20P1F12 ⁇ TMPRSS2 may be used. This strategy may result in the production of monoclonal antibodies with enhanced capacities for recognizing endogenous 20P1F12/TMPRSS2. Additional strategies for generating 20P1F12/TMPRSS2 antibodies are described in Example 5 herein.
- amino acid sequence of 20P1F12/TMPRSS2 as shown in FIG. 1 may be used to select specific regions of the 20P1F12 ⁇ " MPRSS2 protein for generating antibodies.
- hydrophobicity and hydrophilicity analyses of the 20P1F12/TMPRSS2 amino acid sequence may be used to identify hydrophilic regions in the 20P1F12/TMPRSS2 structure.
- Regions of the 20P1F12/TMPRSS2 protein that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known in the art, such as Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis.
- Methods for preparing a protein or polypeptide for use as an immunogen and for preparing immunogenic conjugates of a protein with a carrier such as BSA, KLH, or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be used; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, may be effective.
- Administration of a 20P1F12/TMPRSS2 immunogen is conducted generally by injection over a suitable time period and with use of a suitable adjuvant, as is generally understood in the art. During the immunization schedule, titers of antibodies can be taken to determine adequacy of antibody formation.
- Anti-20P1F12fTMPRSS2 monoclonal antibodies are preferred and may be produced by various means well known in the art.
- immortalized cell lines which secrete a desired monoclonal antibody may be prepared using the standard method of Kohler and Milstein or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known.
- the immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the 20P1F12/TMPRSS2 protein or 20P1F12/TMPRSS2 fragment.
- the appropriate immortalized cell culture secreting the desired antibody is identified, the cells may be expanded and antibodies produced either from in vitro cultures or from ascites fluid.
- the antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of the 20P1F12/TMPRSS2 protein can also be produced in the context of chimeric or CDR grafted antibodies of multiple species origin. Humanized or human 20P1F12/TMPRSS2 antibodies may also be produced and are preferred. Various approaches for producing such humanized antibodies are known, and include chimeric and CDR grafting methods; methods for producing fully human monoclonal antibodies include phage display and transgenic methods (for review, see Vaughan et al., 1998, Nature Biotechnology 16: 535- 539).
- Fully human 20P1F12fTMPRSS2 monoclonal antibodies may be generated using cloning technologies employing large human Ig gene combinatorial libraries (i.e., phage display)(Griff ⁇ ths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display libraries.
- large human Ig gene combinatorial libraries i.e., phage display
- Human antibodies from phage display libraries In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applications in Man. Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries, id., pp 65-82).
- Fully human 20P1F12/TMPRSS2 monoclonal antibodies may also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent Application W098/24893, Jakobovits et al., published December 3, 1997 (see also, Kucherlapati and Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607-614). This method avoids the in vitro manipulation required with phage display technology and efficiently produces high affinity authentic human antibodies.
- Reactivity of 20P1F12/TMPRSS2 antibodies with a 20P1 F12/TMPRSS2 protein may be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, 20P1F12/TMPRSS2 proteins, peptides, 20P1F12/TMPRSS2-expressing cells or extracts thereof.
- a 20P1 F12/TMPRSS2 antibody or fragment thereof of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic or therapeutic agent, and used for targeting a 20P1 F12/TMPRSS2 positive cell (Vitetta, E.S. et al., 1993, Immunotoxin therapy, in DeVita, Jr., V.T. et al., eds, Cancer: Principles and Practice of Oncology, 4th ed., J.B. Lippincott Co., Philadelphia, 2624- 2636).
- Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme.
- the 20P1 F12/TMPRSS2 protein is a cell surface serine protease that may be involved in invasion and metastasis of prostate and colon cancer. Accordingly, 20P1 F12/TMPRSS2 may be ideal target for therapeutic intervention. Its extracellular protease domain may be a potential drug target, while the whole extracellular domain may be a potential therapeutic antibody target. Therefore, the invention provides various immunotherapeutic compositions and methods for treating prostate and colon cancer, including antibody therapy, in vivo vaccines, and ex vivo immunotherapy approaches, which utilize polynucleotides and polypeptides corresponding to 20P1F12/TMPRSS2 and anti-20P1 F12//TMPRSS2 antibodies.
- anti-20P1F12/TMPRSS2 antibodies may be used to treat prostate and colon cancer.
- unconjugated anti-20P1 F12/TMPRSS2 antibody may be introduced into a patient such that the antibody binds to 20P1 F12tTMPRSS2 on prostate or colon cancer cells and mediates the destruction of the cells and the tumor.
- the therapeutic mechanism of action may include complement-mediated cytolysis, antibody- dependent cellular cytotoxicity, altering the physiologic function of 20P1 F12/TMPRSS2, and/or the inhibition of ligand binding or signal transduction pathways.
- Anti- 20P1F12/TMPRSS2 antibodies conjugated to toxic agents such as ricin, or to therapeutic agents, may also be used therapeutically to deliver the toxic or therapeutic agent directly to 20P1F12 ⁇ " MPRSS2-bearing prostate tumor cells and thereby destroy the tumor.
- MPRSS2 antibodies may follow the teachings generated from various approaches which have been successfully employed with respect to other types of cancer, including but not limited to colon cancer (Arlen et al., 1998, Crit Rev Immunol 18: 133-138), multiple myeloma (Ozaki et al., 1997, Blood 90: 3179-3186; Tsunenari et al., 1997, Blood 90: 2437-2444), gastric cancer (Kasprzyk et al., 1992, Cancer Res 52: 2771-2776), B-cell lymphoma (Funakoshi et al., 1996, J Immunther Emphasis Tumor Immunol 19: 93-101), leukemia (Zhong et al., 1996, Leuk Res 20: 581-589), colorectal cancer (Moun et al., 1994, Cancer Res 54: 6160-6166); Velders et al., 1995, Cancer Res 55:
- 20P1F12/TMPRSS2 antibodies may be introduced into a patient such that the antibody binds to 20P1F12/TMPRSS2 on the cancer cells and mediates the destruction of the cells and the tumor and/or inhibits the growth of the cells or the tumor.
- Mechanisms by which such antibodies exert a therapeutic effect may include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, modulating the physiologic function of 20P1F12/TMPRSS2, inhibiting ligand binding or signal transduction pathways, modulating tumor cell differentiation, altering tumor angiogenesis factor profiles, and/or by inducing apoptosis.
- 20P F12/TMPRSS2 antibodies conjugated to toxic or therapeutic agents may also be used therapeutically to deliver the toxic or therapeutic agent directly to 20P1 F12/TMPRSS2-bearing tumor cells.
- 20P1F12/TMPRSS2 antibody therapy may be useful for all stages of the foregoing cancers, antibody therapy may be particularly appropriate in advanced or metastatic prostate and colon cancers.
- anti-20P1F12/TMPRSS2 antibody therapy may be used to treat patients undergoing androgen ablation therapy.
- Combining the antibody therapy method of the invention with a chemotherapeutic regimen may be preferred in patients who have not received chemotherapeutic treatment, whereas treatment with the antibody therapy of the invention may be indicated for patients who have received one or more chemotherapy.
- antibody therapy may also enable the use of reduced dosages of concomitant chemotherapy, particularly in patients that do not tolerate the toxicity of the chemotherapeutic agent very well.
- MPRSS2 It may be desirable for patients to be evaluated for the presence and level of 20P1F12 ⁇ " MPRSS2, preferably using immunohistochemical assessments of tumor tissue, quantitative 20P1F12/TMPRSS2 imaging, or other techniques capable of reliably indicating the presence and degree of expression. Immunohistochemical analysis of tumor biopsies or surgical specimens may be preferred for this purpose. Methods for immunohistochemical analysis of tumor tissues are well known in the art.
- Anti-20P1F12frMPRSS2 monoclonal antibodies useful in treating prostate and other cancers include those which are capable of initiating a potent immune response against the tumor and those which are capable of direct cytotoxicity.
- anti- 20P1F12/TMPRSS2 mAbs may elicit tumor cell lysis by either complement-mediated or antibody-dependent cell cytotoxicity (ADCC) mechanisms, both of which require an intact Fc portion of the immunoglobulin molecule for interaction with effector cell Fc receptor sites or complement proteins.
- ADCC antibody-dependent cell cytotoxicity
- anti-20P1 F12/TMPRSS2 mAbs which exert a direct biological effect on tumor growth are useful in the practice of the invention.
- cytotoxic mAbs may act include inhibition of cell growth, modulation of cellular differentiation, modulation of tumor angiogenesis factor profiles, and the induction of apoptosis.
- the mechanism by which a particular anti-20P1F12 ⁇ " MPRSS2 mAb exerts an anti-tumor effect may be evaluated using any number of in vitro assays designed to determine ADCC and complement- mediated cell lysis, as well as growth inhibition, modulation of apoptosis and inhibition of differentiation, and/or inhibition of angiogenesis, as is generally known in the art.
- the anti-tumor activity of a particular anti-20P1F12/TMPRSS2 mAb, or combination of anti-20P1F12/TMPRSS2 mAbs may be evaluated in vivo using a suitable animal model.
- a suitable animal model For example, xenogenic prostate cancer models wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice, are appropriate in relation to prostate cancer and have been described (Klein et al., 1997, Nature Medicine 3: 402-408).
- preferred monoclonal antibodies used in the practice of the therapeutic methods of the invention are those which are either fully human or humanized and which bind specifically to the target 20P1F12/TMPRSS2 antigen with high affinity but exhibit low or no antigenicity in the patient.
- the method of the invention contemplate the administration of single anti- 20P1F12/TMPRSS2 mAbs as well as combinations, or "cocktails, of different mAbs.
- Such mAb cocktails may have certain advantages inasmuch as they contain mAbs which exploit different epitope specificity, different effector mechanisms, or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionality. Such mAbs in combination may exhibit synergistic therapeutic effects.
- the administration of anti-20P1F12/TMPRSS2 mAbs may be combined with other therapeutic agents or radiation therapy, including but not limited to various chemotherapeutic agents, androgen-blockers, and immune modulators (e.g., IL-2, GM-CSF).
- the anti- 20P1F12/TMPRSS2 mAbs may be administered in their "naked” or unconjugated form, or may have therapeutic or toxic agents conjugated to them.
- the anti-20P1F12/TMPRSS2 monoclonal antibodies used in the practice of the method of the invention may be formulated into pharmaceutical compositions comprising a carrier suitable for the desired delivery method.
- Suitable carriers include any material which when combined with the anti-20P1 F12/TMPRSS2 mAbs retains the specificity and anti- tumor function of the antibody and is non-reactive with the subject's immune systems. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like.
- the anti-20P1F12fi " MPRSS2 antibody formulations may be administered via any route capable of delivering the antibodies to the tumor site.
- Potentially effective routes of administration include, but are not limited to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and the like.
- the preferred route of administration is by intravenous injection.
- a preferred formulation for intravenous injection comprises the anti-20P1 F12ATMPRSS2 mAbs in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or diluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
- the anti-20P1 F12 ⁇ " MPRSS2 mAb preparation may be lyophilized and stored as a sterile powder, preferably under vacuum, and then reconstituted in bacteriostatic water containing, for example, benzyl alcohol preservative, or in sterile water prior to injection.
- Treatment will generally involve the repeated administration of the anti- 20P1F12ATMPRSS2 antibody preparation via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg/kg body weight. Doses in the range of 10-500 mg mAb per week may be effective and well tolerated. Based on clinical experience with the Herceptin mAb in the treatment of metastatic breast cancer, an initial loading dose of approximately 4 mg/kg patient body weight IV followed by weekly doses of about 2 mg/kg IV of the anti- 20P1F12/TMPRSS2 mAb preparation may represent an acceptable dosing regimen. Preferably, the initial loading dose is administered as a 90 minute or longer infusion.
- IV intravenous injection
- the periodic maintenance dose may be administered as a 30 minute or longer infusion, provided the initial dose was well tolerated.
- factors may include, for example, the binding affinity and half life of the mAb or mAbs used, the degree of 20P1 F12/TMPRSS2 overexpression in the patient, the extent of circulating shed 20P1 F12/TMPRSS2 antigen, the desired steady-state antibody concentration level, frequency of treatment, and the influence of chemotherapeutic agents used in combination with the treatment method of the invention.
- patients should be evaluated for the level of circulating shed 20P1F12/TMPRSS2 antigen in serum in order to assist in the determination of the most effective dosing regimen and related factors.
- evaluations may also be used for monitoring purposes throughout therapy, and may be useful to gauge therapeutic success in combination with evaluating other parameters (such as serum PSA levels in prostate cancer therapy).
- the invention further provides prostate cancer vaccines comprising a 20P1 F12/TMPRSS2 protein or fragment thereof.
- a tumor antigen in a vaccine for generating humoral and cell-mediated immunity for use in anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al., 1995, Int. J. Cancer 63: 231-237; Fong et al., 1997, J. Immunol. 159: 3113-3117).
- Such methods can be readily practiced by employing a 20P1 F12/TMPRSS2 protein, or fragment thereof, or a 20P1F12/TMPRSS2 - encoding nucleic acid molecule and recombinant vectors capable of expressing and appropriately presenting the 20P1F12/TMPRSS2 immunogen.
- viral gene delivery systems may be used to deliver a 20P1 F12/TMPRSS2 - encoding nucleic acid molecule.
- Various viral gene delivery systems which can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus, adeno-associated virus, lentivirus, and Sindbus virus (Restifo, 1996, Curr. Opin. Immunol. 8: 658-663).
- Non-viral delivery systems may also be employed by using naked DNA encoding a 20P1 F12/TMPRSS2 protein or fragment thereof introduced into the patient (e.g., intramuscularly) to induce an anti-tumor response.
- the full-length human 20P1F12/TMPRSS2 cDNA may be employed.
- 20P1F12/TMPRSS2 nucleic acid molecules encoding specific cytotoxic T lymphocyte (CTL) epitopes may be employed.
- CTL epitopes can be determined using specific algorithms (e.g., Epimer, Brown University) to identify peptides within a 20P1F12/TMPRSS2 protein which are capable of optimally binding to specified HLA alleles.
- Dendritic cells express MHC class I and II, B7 costimulator, and IL-12, and are thus highly specialized antigen presenting cells.
- PSMA prostate-specific membrane antigen
- Dendritic cells can be used to present 20P1F12/TMPRSS2 peptides to T cells in the context of MHC class I and II molecules.
- autologous dendritic cells are pulsed with 20P1 F12/TMPRSS2 peptides capable of binding to MHC molecules.
- dendritic cells are pulsed with the complete 20P1 F12/TMPRSS2 protein.
- Yet another embodiment involves engineering the overexpression of the 20P1F12 ⁇ " MPRSS2 gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur et al., 1997, Cancer Gene Ther. 4: 17-25), retrovirus (Henderson et al., 1996, Cancer Res.
- Anti-idiotypic anti-20P1 F12/TMPRSS2 antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a 20P1 F12/TMPRSS2 protein.
- the generation of anti-idiotypic antibodies is well known in the art and can readily be adapted to generate anti-idiotypic anti- 20P1F12n " MPRSS2 antibodies that mimic an epitope on a 20P1 F12/TMPRSS2 protein (see, for example, Wagner et al., 1997, Hybridoma 16: 33-40; Foon et al., 1995, J Clin Invest 96: 334-342; Herlyn et al., 1996, Cancer Immunol Immunother 43: 65-76).
- Such an anti-idiotypic antibody can be used in anti-idiotypic therapy as presently practiced with other anti-idiotypic antibodies directed against tumor antigens.
- Genetic immunization methods may be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing 20P1F12/TMPRSS2, particularly colon and prostate cancer cells.
- Constructs comprising DNA encoding a 20P1F12/TMPRSS2 protein/immunogen and appropriate regulatory sequences may be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construct and express the encoded 20P1 F12/TMPRSS2 protein/immunogen.
- the 20P1 F12/TMPRSS2 protein/immunogen may be expressed as a cell surface protein or be secreted.
- Another aspect of the invention is directed to molecular diagnostic and diagnostic imaging methods which utilize the 20P1F12/TMPRSS2 polynucleotides and antibodies described herein.
- the expression profile and cell surface localization of 20P1F12/TMPRSS2 makes it a potential imaging reagent for metastasized disease.
- 20P1 F12/TMPRSS2 is expressed in various prostate cancer xenograft tissues and cell lines, and is also expressed in some colon cancer cell lines.
- the expression status of 20P1F12/TMPRSS2 may provide information useful for localizing tumors, predicting susceptibility to advanced stage disease, and/or gauging tumor aggressiveness.
- 20P1 F12/TMPRSS2 expression status in patient samples may be analyzed by, for example: (i) immunohistochemical analysis, (ii) in situ hybridization, (iii) RT-PCR analysis on laser capture micro-dissected samples, (iv) western blot analysis of clinical samples and cell lines, (v) tissue array analysis, (vi) in vivo imaging.
- immunological assays useful for the detection of 20P1F12/TMPRSS2 proteins are contemplated, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
- 20P1F12/TMPRSS2 antibodies may be labeled and used as immunological imaging reagents capable of detecting prostate and colon cancer cells (e.g., in radioscintigraphic imaging methods).
- radiolabeled 20P1 F12/TMPRSS2 antibodies specifically reactive with extracellular epitopes of 20P1F12 TMPRSS2 are preferred.
- Assays for identifying prostate, prostate cancer or colon cancer cells comprise detecting polynucleotides corresponding to the 20P1 F12/TMPRSS2 gene in a biological sample, such as serum, bone, prostate, colon and other tissues, urine, semen, cell preparations, and the like.
- Detectable 20P1F12/TMPRSS2 polynucleotides include, for example, a 20P1F12/TMPRSS2 gene or fragments thereof, 20P1F12/TMPRSS2 mRNA, alternative splice variant 20P1 F12/TMPRSS2 mRNAs, and recombinant DNA or RNA molecules containing a 20P1F12 TMPRSS2 polynucleotide.
- a number of methods for amplifying and/or detecting the presence of 20P1 F12/TMPRSS2 polynucleotides are well known in the art and may be employed in the practice of this aspect of the invention.
- a method for detecting a 20P1F12tTMPRSS2 mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced using a 20P1 F12/TMPRSS2 polynucleotides as sense and antisense primers to amplify 20P1F12/TMPRSS2 cDNAs therein; and detecting the presence of the amplified 20P1 F12/TMPRSS2 cDNA.
- a method of detecting a 20P1 F12/TMPRSS2 gene in a biological sample comprises first isolating genomic DNA from the sample; amplifying the isolated genomic DNA using 20P1 F12/TMPRSS2 polynucleotides as sense and antisense primers to amplify the 20P1F12/TMPRSS2 gene therein; and detecting the presence of the amplified 20P1 F 2/TMPRSS2 gene.
- Any number of appropriate sense and antisense probe combinations may be designed from the nucleotide sequence provided for 20P1 F12/TMPRSS2 (FIG. 1 ; SEQ ID NO. XX) and used for this purpose.
- a method of detecting the presence of a 20P1F12/TMPRSS2 protein in a biological sample comprises first contacting the sample with a 20P1F12/TMPRSS2 antibody, a 20P1F12/TMPRSS2-reactive fragment thereof, or a recombinant protein containing an antigen binding region of a 20P1 F12/TMPRSS2 antibody; and then detecting the binding of 20P1F12/TMPRSS2 protein in the sample thereto.
- Methods for identifying a cell which expresses 20P1F12/TMPRSS2 are also provided.
- an assay for identifying a cell which expresses a 20P1F12/TMPRSS2 gene comprises detecting the presence of 20P1F12/TMPRSS2 mRNA in the cell.
- Methods for the detection of particular mRNAs in cells are well known and include, for example, hybridization assays using complementary DNA probes (such as in situ hybridization using labeled 20P1F12/TMPRSS2 riboprobes, Northern blot and related techniques) and various nucleic acid amplification assays (such as RT-PCR using complementary primers specific for 20P1F12/TMPRSS2, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).
- an assay for identifying a cell which expresses a 20P1F12/TMPRSS2 gene comprises detecting the presence of 20P1F12/TMPRSS2 protein in the cell or secreted by the cell.
- Various methods for the detection of proteins are well known in the art and may be employed for the detection of 20P1F12/TMPRSS2 proteins and 20P1F12 TMPRSS2 expressing cells.
- Determining the status of 20P1F12/TMPRSS2 expression patterns in an individual may be used to diagnose cancer and may provide prognostic information useful in defining appropriate therapeutic options.
- the expression status of 20P1F12/TMPRSS2 may provide information useful for predicting susceptibility to particular disease stages, progression, and/or tumor aggressiveness. Therefore, another aspect of the invention provides methods and assays for determining 20P1F12/TMPRSS2 expression status and diagnosing cancers which express 20P1F12 TMPRSS2.
- an assay useful in determining the presence of cancer in an individual comprises detecting a significant increase in 20P1F12tTMPRSS2 mRNA or protein expression in a test ceil or tissue sample relative to expression levels in the corresponding normal cell or tissue.
- the presence of 20P1F12/TMPRSS2 mRNA in a colon sample may indicate the emergence, presence and/or severity of colon cancer, since normal colon does not express 20P1F12/TMPRSS2.
- 20P1F12/TMPRSS2 expression status may be determined at the protein level rather than at the nucleic acid level.
- such a method or assay would comprise determining the level of 20P1F12/TMPRSS2 protein expressed by cells in a test tissue sample and comparing the level so determined to the level of 20P1F12/TMPRSS2 expressed in a corresponding normal sample.
- the presence of 20P1F12/TMPRSS2 protein may be evaluated, for example, using immunohistochemical methods.
- 20P1F12/TMPRSS2 antibodies or binding partners capable of detecting 20P1F12/TMPRSS2 protein expression may be used in a variety of assay formats well known in the art for this purpose.
- Peripheral blood may be conveniently assayed for the presence of prostate or colon cancer cells, using RT-PCR to detect 20P1F12/TMPRSS2 expression therein.
- RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors. In the prostate cancer field, these include RT-PCR assays for the detection of cells expressing PSA and PSM (Verkaik et al., 1997, Urol. Res. 25: 373-384; Ghossein et al., 1995, J. Clin. Oncol. 13: 1195-2000; Heston et al., 1995, Clin. Chem. 41 : 1687-1688). RT-PCR assays are well known in the art.
- a recently described sensitive assay for detecting and characterizing carcinoma cells in blood may be used (Racila et al., 1998, Proc. Natl. Acad. Sci. USA 95: 4589-4594).
- This assay combines immunomagnetic enrichment with multiparameter flow cytometric and immunohistochemical analyses, and is highly sensitive for the detection of cancer cells in blood, reportedly capable of detecting one epithelial cell in 1 ml of peripheral blood.
- Standard methods for the detection and quantification of 20P1F12/TMPRSS2 mRNA include in situ hybridization using labeled 20P1F12/TMPRSS2 riboprobes, Northern blot and related techniques using 20P1F12/TMPRSS2 polynucleotide probes, RT-PCR analysis using primers specific for 20P1F12/TMPRSS2, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like.
- semi- quantitative RT-PCR may be used to detect and quantify 20P1F12/TMPRSS2 mRNA expression as described in the Examples which follow.
- Any number of primers capable of amplifying 20P1F12/TMPRSS2 may be used for this purpose, including but not limited to the various primer sets specifically described herein. Standard methods for the detection and quantification of protein may be used for this purpose.
- polyclonal or monoclonal antibodies specifically reactive with the 20P1F12/TMPRSS2 protein may be used in an immunohistochemical assay of biopsied tissue.
- kits for the diagnostic and therapeutic applications described or suggested above may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method.
- container means such as vials, tubes, and the like
- each of the container means comprising one of the separate elements to be used in the method.
- one of the container means may comprise a probe which is or can be detectably labeled.
- probe may be an antibody or polynucleotide specific for 20P1F12/TMPRSS2 protein or gene/mRNA, respectively.
- the kit may also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radionucleotide label.
- a reporter-means such as a biotin-binding protein, such as avidin or streptavidin
- EXAMPLE 1 ISOLATION OF cDNA CORRESPONDING TO 20P1 F12/TMPRSS2 GENE BY SSH HYBRIDIZATION CLONING AND EXPRESSION ANALYSIS
- LAPC-4 AD and LAPC-9 AD xenografts were routinely passaged as small tissue chunks in recipient SCID males.
- LAPC-4 Al and LAPC-9 Al xenografts were derived as described previously (Klein et al., 1997) and were passaged in castrated males or in female SCID mice.
- RNA and protein analyses were obtained from the Human Tissue Resource Center (HTRC) at the UCLA (Los Angeles, CA) and from QualTek, Inc. (Santa Barbara, CA). A benign prostatic hyperplasia tissue sample was patient-derived.
- HTRC Human Tissue Resource Center
- Tumor tissue and cell lines were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/ g tissue or 10 ml/ 10 8 cells to isolate total RNA.
- Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by spectrophotometric analysis (O.D. 260/280 nm) and analyzed by gel electrophoresis.
- Oligonucleotides The following HPLC purified oligonucleotides were used.
- RSACDN (cDNA synthesis prime ⁇ : 5TTTTGTACAAGCTT 30 3'
- Adaptor 2 5*GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT3'
- Nested primer (NP)2 5 ⁇ GCGTGGTCGCGGCCGAGGT3'
- SSH Suppression Subtractive Hybridization
- Double stranded cDNAs corresponding to the LAPC-4 AD xenograft (tester) and the BPH tissue (driver) were synthesized from 2 ⁇ g of poly(A) + RNA isolated from xenograft and BPH tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oiigonucleotide RSACDN as primer.
- First- and second- strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1 , Catalog No. K1804-1).
- the resulting cDNA was digested with Rsa I for 3 hrs. at 37°C.
- Digested cDNA was extracted with phenol/chloroform (1 :1) and ethanol precipitated.
- Driver cDNA was generated by combining in a 4 to 1 ratio Rsa I digested BPH cDNA with digested cDNA from mouse liver, in order to ensure that murine genes were subtracted from the tester cDNA (LAPC-4 AD).
- Tester cDNA (LAPC-4 AD) was generated by diluting 1 ⁇ l of Rsa I digested LAPC-4 AD cDNA (400 ng) in 5 ⁇ l of water. The diluted cDNA (2 ⁇ l, 160 ng) was then Hgated to 2 ⁇ l of adaptor 1 and adaptor 2 (10 ⁇ M), in separate ligation reactions, in a total volume of 10 ⁇ l at 16°C overnight, using 400 u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 ⁇ l of 0.2 M EDTA and heating at 72°C for 5 min.
- the first hybridization was performed by adding 1.5 ⁇ l (600 ng) of driver cDNA to each of two tubes containing 1.5 ⁇ l (20 ng) adaptor 1- and adaptor 2- Hgated tester cDNA. In a final volume of 4 ⁇ l, the samples were overlayed with mineral oil, denatured in an MJ Research thermal cycler at 98°C for 1.5 minutes, and then were allowed to hybridize for 8 hrs at 68°C. The two hybridizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were allowed to hybridize overnight at 68°C. The second hybridization was then diluted in 200 ⁇ l of 20 mM Hepes, pH 8.3, 50 mM NaCI, 0.2 mM EDTA, heated at 70°C for 7 min. and stored at -20°C.
- PCR 1 was conducted using the following conditions: 75°C for 5 min., 94°C for 25 sec, then 27 cycles of 94°C for 10 sec, 66°C for 30 sec, 72°C for 1.5 min. Five separate primary PCR reactions were performed for each experiment.
- the products were pooled and diluted 1 :10 with water.
- 1 ⁇ l from the pooled and diluted primary PCR reaction was added to the same reaction mix as used for PCR 1 , except that primers NP1 and NP2 (10 ⁇ M) were used instead of PCR primer 1.
- PCR 2 was performed using 10-12 cycles of 94°C for 10 sec, 68°C for 30 sec, 72°C for 1.5 minutes.
- the PCR products were analyzed using 2% agarose gel electrophoresis.
- the PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invitrogen). Transformed E. coli were subjected to blue/white and ampicillin selection.
- PCR amplification was performed on 1 ml of bacterial culture using the conditions of PCR1 and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.
- Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.
- First strand cDNAs were generated from 1 ⁇ g of mRNA with oligo (dT)12-18 priming using the Gibco-BRL Superscript Preamplification system. The manufacturers protocol was used and included an incubation for 50 min at 42°C with reverse transcriptase followed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume was increased to 200 ⁇ l with water prior to normalization. First strand cDNAs from 16 different normal human tissues were obtained from Clontech.
- First strand cDNA (5 ⁇ l) was amplified in a total volume of 50 ⁇ l containing 0.4 ⁇ M primers, 0.2 ⁇ M each dNTPs, 1XPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCI 2 , 50 mM KCI, pH8.3) and 1X Klentaq DNA polymerase (Clontech).
- PCR Five ⁇ l of the PCR reaction was removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis.
- PCR was performed using an MJ Research thermal cycler under the following conditions: initial denaturation was at 94°C for 15 sec, followed by a 18, 20, and 22 cycles of 94°C for 15, 65°C for 2 min, 72°C for 5 sec. A final extension at 72°C was carried out for 2 min.
- the band intensities of the 283 bp ⁇ -actin bands from multiple tissues were compared by visual inspection. Dilution factors for the first strand cDNAs were calculated to result in equal ⁇ -actin band intensities in all tissues after 22 cycles of PCR. Three rounds of normalization were required to achieve equal band intensities in all tissues after 22 cycles of PCR.
- One of the cDNA clones designated 20P1F12, showed identity to a recently described serine protease TMPRSS2 (Paoloni-Giacobino et al., 1997, Genomics 44: 309-320).
- the isolated 20P1F12 cDNA fragment is 388 bp in length and has the nucleotide sequence shown in FIG. 4.
- Differential expression analysis by RT-PCR showed that the 20P1F12 gene is expressed at approximately equal levels in normal prostate and the LAPC-4 and LAPC-9 xenografts (FIG. 5, panel A).
- Further RT-PCR expression analysis of first strand cDNAs from 16 normal tissues showed greatest levels of 20P1 F12 expression in prostate. Substantially lower level expression was observed in several other normal tissues (i.e., colon, pancreas, kidney, liver and lung) (FIG. 5, panels B and C).
- a full length cDNA encoding the 20P1 F12/TMPRSS2 gene was isolated from a human prostate library and designated 20P1 F12-GTC1.
- the nucleotide and amino acid sequences of 20P1F12-GTC1 are shown in FIG 1. Plasmid p20P1 F12-GTC1 (carrying the 20P1F12-GTC1 cDNA) was deposited with the ATCC (Manassas, Virginia) on February 12, 1999 and has been accorded ATCC Designation Number 207097.
- the approximately 3.5 kb 20P1 F12-GTC1 cDNA encodes a protein of 492 amino acids which is almost, but not completely, identical to the sequence previously described (FIG. 2).
- TMPRSS2 represents a potential therapeutic target for prostate and colon cancers. As a cell surface antigen, it may be a particularly good target for antibody therapy.
- the immunogen comprised an approximately 8 kD region within the protease domain, specifically amino acid residues 362 through 440 (see FIG. 1). Mice were immunized with purified GST-TMPRSS2 and hybridomas were generated. Hybridoma supernatants were screened for specific antibodies by western blotting using lysates from 293T cells transfected with 20P1 F12/TMPRSS2. A total of 6 hybridomas were identified that specifically recognize 20P1 F12/TMPRSS2 by Western blotting (FIG. 8a).
- 20P1 F12/TMPRSS2 mAbs may be generated by cell-based immunization using LAPC-9 cells and PC-3 cells expressing 20P1F12/TMPRSS2 as a screening agent for cell-based ELISAs.
- 20P1 F12/TMPRSS2 mAbs may be generated using purified 20P1 F12/TMPRSS2 protein as immunogen.
- recombinant 20P1F12/TMPRSS2 having an amino-terminal His-tag may be expressed in a baculovirus system using pBlueBac4.5 (Invitrogen). His-tagged 20P1 F12/TMPRSS2 may then be purified using a Nickel column, quantified and used as immunogen. Screening of monoclonal may be performed using cell-based ELISAs with, for example, LNCaP and PC-3/TMPRSS2 cells.
- 20P1F12 cDNA (FIG. 1) was cloned into pcDNA 3.1 Myc-His (Invitrogen), which provides a 6-His tag at the carboxyl-terminus.
- the construct was transfected into 293T cells and was analyzed by cell-surface biotinylation. Biotinylated cell surface proteins were affinity purified using streptavidin-sepharose. Western blot analysis of streptavidin affinity purified proteins using an anti-His antibody demonstrated the presence of 20P1F12/TMPRSS2 protein (FIG. 9a). Therefore, as predicted from sequence analysis, 20P1F12/TMPRSS2 is expressed at the cell surface of transfected cells.
- 293T cells transfected with a carboxyl-terminal His-tagged 20P1F12/TMPRSS2 express primarily the 70 kD protein (FIG. 9a). Since the 20P1 F12/TMPRSS2 protease domain is located at the carboxyl-terminus, it is possible that the 32 kD fragment is a result of auto-catalytic cleavage, which is inhibited by the His tag.
- the related molecule, hepsin (TMPRSS1) appears to be capable of autoactivation in a concentration dependent manner (Vu et al., 1997, J. Biol. Chem. 272: 31315-31320).
- This auto-catalytic cleavage may be exploited to identify small molecules that inhibit 20P1F12/TMPRSS2 activity.
- Cells may be grown in the presence or absence of small molecule inhibitors to specifically look for inhibition of cleavage. Such small molecules may be tested as prostate cancer therapeutics.
- the predicted MW of 20P1 F12/TMPRSS2 is significantly smaller than the apparent MW detected by Western blotting. This suggests that 20P1F12/TMPRSS2 may be glycosylated.
- the GTC1 sequence indicates that there are three potential glycosylation sites with the consensus sequence of NXS/T (residues 128, 213, 249).
- NXS/T consensus sequence of NXS/T
- Affinity purified protein was eluted with 50 mM EDTA, pH 8.0, and was de-glycosylated using N-glycosidase F (Boehringer Mannheim) according to the manufacturers protocol. Untreated and de-glycosylated protein were analyzed by western blotting using anti-His antibodies. The results show a 5-8 kD MW shift of 20P1F12/TMPRSS2 with N-glycosidase F treatment (FIG 10), indicating that 20P1F12 TMPRSS2 is indeed a glycosylated protein.
- De-glycosylated 20P1F12/TMPRSS2 still exhibited a MW of at least 5-10 kD larger than the predicted size, indicating that either the de-glycosylation reaction was not complete (or that glycosylation is O-linked), or that 20P1 F12/TMPRSS2 may exhibit additional post- translational modifications (such as phosphorylation, sulfation).
- FIG. 11 shows a clear reduction of 20P1F12/TMPRSS2 expression during androgen deprivation (FIG. 11).
- PSA prostate-specific antigen
- 20P1F12/TMPRSS2 expression is still detectable, but visibly reduced when compared to androgen stimulated cells.
- the first time point of induced expression appears after 9 hours of stimulation, indicating that protein expression of 20P1F12/TMPRSS2 lags behind RNA induction (FIG. 12).
- 20P1 F12/TMPRSS2 exhibits prostate specific expression and seems to be regulated by androgen.
- 20P1F12/TMPRSS2 retrovirus was used to infect NIH 3T3 cells.
- the morphology of cells infected with 20P1 F12/TMPRSS2 retrovirus was compared to the morphology of control (neo) virus infected cells.
- a population of infected cells exhibited a distinct vacuolar appearance compared to control cells (FIG. 13), which seem to correlate with high levels of expression. Upon passaging this infected cell population, vacuole-bearing cells gradually disappeared with apparently reduced expression of 20P1 F12/TMPRSS2.
- 20P1 F12 TMPRSS2 function may be being assessed in mammalian cells engineered to express 20P1 F12/TMPRSS2.
- 20P1F12/TMPRSS2 is conveniently cloned into several vectors, including pcDNA 3.1 myc-His-tag (Invitrogen), the retroviral vector pSR tkneo (Muller et al., 1991 , MCB 11 :1785), and plND (Invitrogen) an ecdysone-inducible expression system.
- 20P1F12/TMPRSS2 is expressed in several cell lines, including PC-3, NIH 3T3, mouse L cell fibroblasts and 293T. Expression of 20P1F12/TMPRSS2 is monitored using anti- 20P1 F12TMPRSS2 antibodies by Western and FACS analysis. Purified TMPRSS2 may used to identify the substrate.
- Such mammalian cell lines expressing 20P1 F12/TMPRSS2 are then tested in several in vitro, including cell proliferation, cell adhesion, cell invasion using a membrane invasion culture system (MICS) (Welch et al. ,lnt. J. Cancer 43: 449-457) in tissue culture, and in vivo assays, including tumor formation in SCID mice.
- the 20P1F12/TMPRSS2 cell phenotype is compared to the phenotype of cells which do not express 20P1F12/TMPRSS2.
- deletion mutants and point mutants are generated: (i) ⁇ SRCR (93 a. a. deletion); (ii) ⁇ LDLRA (35 a.a. deletion); and (iii) mutant of the catalytic triad: H296Q, D345N, S441A (single point mutants).
- 20P1F12/TMPRSS2 mutants are cloned into the retroviral vectors psR ⁇ tkneo for expression in mammalian cells. The resulting mutants are useful for elucidating the importance of the different domains and residues.
- Dominant negative activity may be manifested in cells that express endogenous 20P1 F12/TMPRSS2, such as LNCaP. Dominant negative activity may be due to interactions with substrates via protease domain, or via the protein-protein interaction domains.
- the mutant 20P1 F12/TMPRSS2 molecules are tested in the same in vitro and in vivo assays as wild-type 20P1 F12/TMPRSS2 (see above).
- Such dominant negative 20P1F12/TMPRSS2 molecules may be useful therapeutically.
- a dominant negative 20P1F12/TMPRSS2 may introduced into prostate cancer cells via gene therapy vectors capable of delivering and expressing the corresponding coding sequence into prostate tumor cells. Similarly, such methods may be useful in the treatment of colon cancer.
- Determining the characteristics of 20P1 F12tTMPRSS2 expression in normal mouse tissues and in transgenic mice provides further information about the function of 20P1F12/TMPRSS2.
- Northern blot analysis using probes designed from the 20P1 F12/TMPRSS2 sequences provided herein may be used to define the expression pattern of murine 20P1F12/TMPRSS2.
- 20P1F12/TMPRSS2 expression during development in the mouse embryo can be analyzed. The resulting data will identify a tissue source for cloning the mouse gene and predict which tissues would be affected in a transgenic mouse knock-out study.
- transgenic mouse may be generated and used to define the biological role of 20P1F12/TMPRSS2 in an in-vivo setting.
- the human or mouse 20P1F12/TMPRSS2 genes are used to generate transgenic mice. Over-expression of spontaneous tumor formation in mice may be studies using transgenic mice.
- 20P1F12/TMPRSS2 gene knock-outs are generated in mice. Such mice may also be crossed with other prostate cancer mouse models, such as the TRAMP model (Greenberg et al., 1995, PNAS 92:3439) to study the influence on prostate cancer aggressiveness and metastasis and to observe changes in disease progression.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Urology & Nephrology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU44136/99A AU773187B2 (en) | 1998-06-01 | 1999-06-01 | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
| IL13998899A IL139988A0 (en) | 1998-06-01 | 1999-06-01 | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
| EP99927164A EP1082341B1 (en) | 1998-06-01 | 1999-06-01 | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
| AT99927164T ATE490977T1 (de) | 1998-06-01 | 1999-06-01 | Tumorantigen verwendbar in der diagnose und therapie von prostata und dickdarm-krebs |
| DK99927164.6T DK1082341T3 (da) | 1998-06-01 | 1999-06-01 | Anvendeligt tumorantigen i diagnose og behandling af prostata- og koloncancer |
| CA2329137A CA2329137C (en) | 1998-06-01 | 1999-06-01 | Novel tumor antigen useful in diagnosis and therapy of prostrate and colon cancer |
| JP2000552152A JP2002517185A (ja) | 1998-06-01 | 1999-06-01 | 前立腺癌および結腸癌の診断および治療に有用な腫瘍抗原 |
| DE69943020T DE69943020D1 (de) | 1998-06-01 | 1999-06-01 | Tumorantigen verwendbar in der diagnose und therapie von prostata und dickdarm-krebs |
| AU2004202306A AU2004202306C1 (en) | 1998-06-01 | 2004-05-25 | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US8759898P | 1998-06-01 | 1998-06-01 | |
| US60/087,598 | 1998-06-01 | ||
| US9147498P | 1998-06-29 | 1998-06-29 | |
| US60/091,474 | 1998-06-29 | ||
| US12952199P | 1999-04-14 | 1999-04-14 | |
| US60/129,521 | 1999-04-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO1999062942A2 true WO1999062942A2 (en) | 1999-12-09 |
| WO1999062942A3 WO1999062942A3 (en) | 2000-06-02 |
Family
ID=27375711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/012253 Ceased WO1999062942A2 (en) | 1998-06-01 | 1999-06-01 | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
Country Status (12)
| Country | Link |
|---|---|
| US (1) | US20060275304A1 (enExample) |
| EP (1) | EP1082341B1 (enExample) |
| JP (2) | JP2002517185A (enExample) |
| AT (1) | ATE490977T1 (enExample) |
| AU (2) | AU773187B2 (enExample) |
| CA (1) | CA2329137C (enExample) |
| CY (1) | CY1111906T1 (enExample) |
| DE (1) | DE69943020D1 (enExample) |
| DK (1) | DK1082341T3 (enExample) |
| IL (1) | IL139988A0 (enExample) |
| PT (1) | PT1082341E (enExample) |
| WO (1) | WO1999062942A2 (enExample) |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000020584A3 (en) * | 1998-10-02 | 2000-07-06 | Urogenesys Inc | Human gene expressed in cancers of prostate, bladder, pancreas and colon, 36p1a6 |
| WO2000065067A3 (en) * | 1999-04-23 | 2001-08-02 | Univ Washington | Prostate-specific polynucleotides, polypeptides and their methods of use |
| WO2001096538A3 (en) * | 2000-06-13 | 2002-06-06 | Bayer Ag | Regulation of human transmembrane serine protease |
| WO2001096390A3 (en) * | 2000-06-09 | 2002-12-27 | Corixa Corp | Compositions and methods for the therapy and diagnosis of colon cancer |
| EP1131095A4 (en) * | 1998-10-19 | 2003-04-23 | Diadexus Inc | METHOD FOR DIAGNOSING, MONITORING, CLASSIFYING STAGES, VISUALIZING AND TREATING PROSTATE CANCER |
| JP2004506880A (ja) * | 2000-07-25 | 2004-03-04 | ザ トラスティーズ オブ ザ ユニバーシティー オブ ペンシルヴァニア | エピトープの免疫検出のための方法 |
| WO2004092397A3 (en) * | 2003-04-15 | 2005-02-10 | Novartis Ag | Tmprss2 regulatory sequences and uses thereof |
| WO2004097358A3 (en) * | 2003-05-02 | 2005-02-10 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with human transmembrane serine protease 2 (tmprss2) |
| US6902892B1 (en) | 1998-10-19 | 2005-06-07 | Diadexus, Inc. | Method of diagnosing, monitoring, staging, imaging and treating prostate cancer |
| US7037667B1 (en) | 1998-06-01 | 2006-05-02 | Agensys, Inc. | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
| US7189823B2 (en) | 2002-01-25 | 2007-03-13 | University Of Pittsburgh | Antibody against illfdyfnr |
| EP1992695A2 (en) | 1999-08-12 | 2008-11-19 | Agensys, Inc. | C-type lectin transmembrane antigen expressed in human prostate cancer and uses thereof |
| WO2008119767A3 (en) * | 2007-03-30 | 2009-01-15 | Oryzon Genomics Sa | Method of nucleic acid analysis. |
| JP2009148264A (ja) * | 2000-07-12 | 2009-07-09 | Agensys Inc | 膀胱癌、卵巣癌、肺癌、および腎臓癌の診断および治療に有用な腫瘍抗原 |
| US7718369B2 (en) | 2005-09-12 | 2010-05-18 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US8106037B2 (en) | 2007-08-03 | 2012-01-31 | The Brigham And Women's Hospital, Inc. | Identification and treatment of estrogen responsive prostate tumors |
| US8945556B2 (en) | 2010-11-19 | 2015-02-03 | The Regents Of The University Of Michigan | RAF gene fusions |
| US9303291B2 (en) | 2007-07-06 | 2016-04-05 | The Regents Of The University Of Michigan | MIPOL1-ETV1 gene rearrangements |
| US9926602B2 (en) | 2009-09-17 | 2018-03-27 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US9957569B2 (en) | 2005-09-12 | 2018-05-01 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US10683368B2 (en) | 2014-11-06 | 2020-06-16 | Hoffmann-La Roche Inc. | Fc-region variants with modified FcRn-binding and methods of use |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104125852B9 (zh) * | 2012-02-15 | 2017-05-17 | 弗·哈夫曼-拉罗切有限公司 | 基于Fc‑受体的亲和色谱 |
Family Cites Families (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1989006692A1 (en) * | 1988-01-12 | 1989-07-27 | Genentech, Inc. | Method of treating tumor cells by inhibiting growth factor receptor function |
| US5288612A (en) * | 1991-07-03 | 1994-02-22 | The Scripps Research Institute | Assay methods for detecting serum proteases, particularly activated protein C |
| ATE242330T1 (de) * | 1993-01-15 | 2003-06-15 | Inst Genetics Llc | Klonierung von enterokinase und verfahren zu deren verwendung |
| CA2281954A1 (en) * | 1997-02-25 | 1998-08-27 | Corixa Corporation | Compounds for immunodiagnosis of prostate cancer and methods for their use |
| US6657056B2 (en) * | 1997-02-25 | 2003-12-02 | Corixa Corporation | Compounds for immunotherapy of prostate cancer and methods for their use |
| US6800746B2 (en) * | 1997-02-25 | 2004-10-05 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
| BR9808881A (pt) * | 1997-02-25 | 2001-09-11 | Corixa Corp | Compostos para imunoterapia de câncer de próstata e métodos para seu uso |
| US6043033A (en) * | 1997-02-27 | 2000-03-28 | Incyte Pharmaceuticals, Inc. | Human prostate-associated protease |
| US20030103981A1 (en) * | 1997-02-27 | 2003-06-05 | Incyte Genomics, Inc. | Methods of use of a prostate-associated protease in the diagnosis and treatment of prostate cancer |
| US20020119531A1 (en) * | 1997-02-27 | 2002-08-29 | Olga Bandman | Prostate-associated protease antibody |
| US6500938B1 (en) * | 1998-01-30 | 2002-12-31 | Incyte Genomics, Inc. | Composition for the detection of signaling pathway gene expression |
| US6166194A (en) * | 1998-06-29 | 2000-12-26 | Myriad Genetics, Inc. | TMPRSS2 is a tumor suppressor |
| US6291663B1 (en) * | 1999-03-03 | 2001-09-18 | Board Of Trustees Of The University Of Arkansas | TADG-12: a novel transmembrane serine protease overexpressed in a ovarian carcinoma |
| US6331427B1 (en) * | 1999-03-26 | 2001-12-18 | Millennium Pharmaceuticals, Inc. | Protease homologs |
| US20020192763A1 (en) * | 2000-04-17 | 2002-12-19 | Jiangchun Xu | Compositions and methods for the therapy and diagnosis of prostate cancer |
| US20020160382A1 (en) * | 2000-10-11 | 2002-10-31 | Lasek Amy W. | Genes expressed in colon cancer |
| US20030065157A1 (en) * | 2001-04-04 | 2003-04-03 | Lasek Amy W. | Genes expressed in lung cancer |
-
1999
- 1999-06-01 JP JP2000552152A patent/JP2002517185A/ja not_active Withdrawn
- 1999-06-01 PT PT99927164T patent/PT1082341E/pt unknown
- 1999-06-01 IL IL13998899A patent/IL139988A0/xx not_active IP Right Cessation
- 1999-06-01 AT AT99927164T patent/ATE490977T1/de active
- 1999-06-01 DE DE69943020T patent/DE69943020D1/de not_active Expired - Lifetime
- 1999-06-01 CA CA2329137A patent/CA2329137C/en not_active Expired - Fee Related
- 1999-06-01 AU AU44136/99A patent/AU773187B2/en not_active Ceased
- 1999-06-01 WO PCT/US1999/012253 patent/WO1999062942A2/en not_active Ceased
- 1999-06-01 DK DK99927164.6T patent/DK1082341T3/da active
- 1999-06-01 EP EP99927164A patent/EP1082341B1/en not_active Expired - Lifetime
-
2004
- 2004-05-25 AU AU2004202306A patent/AU2004202306C1/en not_active Ceased
-
2005
- 2005-08-09 US US11/200,973 patent/US20060275304A1/en not_active Abandoned
-
2008
- 2008-12-25 JP JP2008330218A patent/JP2009148265A/ja active Pending
-
2011
- 2011-03-08 CY CY20111100264T patent/CY1111906T1/el unknown
Non-Patent Citations (1)
| Title |
|---|
| PAOLONI-GIACOBINO ET AL., GENOMICS, vol. 44, 1997, pages 309 - 320 |
Cited By (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7981624B2 (en) | 1998-06-01 | 2011-07-19 | Agensys, Inc. | Methods to detect tumors using 20P1F12/TMPRSS2 expression |
| US7037667B1 (en) | 1998-06-01 | 2006-05-02 | Agensys, Inc. | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer |
| WO2000020584A3 (en) * | 1998-10-02 | 2000-07-06 | Urogenesys Inc | Human gene expressed in cancers of prostate, bladder, pancreas and colon, 36p1a6 |
| US6902892B1 (en) | 1998-10-19 | 2005-06-07 | Diadexus, Inc. | Method of diagnosing, monitoring, staging, imaging and treating prostate cancer |
| EP1131095A4 (en) * | 1998-10-19 | 2003-04-23 | Diadexus Inc | METHOD FOR DIAGNOSING, MONITORING, CLASSIFYING STAGES, VISUALIZING AND TREATING PROSTATE CANCER |
| US7432064B2 (en) | 1998-10-19 | 2008-10-07 | Diadexus, Inc. | Method of diagnosing, monitoring, staging, imaging and treating prostate cancer |
| WO2000065067A3 (en) * | 1999-04-23 | 2001-08-02 | Univ Washington | Prostate-specific polynucleotides, polypeptides and their methods of use |
| EP1992695A2 (en) | 1999-08-12 | 2008-11-19 | Agensys, Inc. | C-type lectin transmembrane antigen expressed in human prostate cancer and uses thereof |
| WO2001096390A3 (en) * | 2000-06-09 | 2002-12-27 | Corixa Corp | Compositions and methods for the therapy and diagnosis of colon cancer |
| WO2001096538A3 (en) * | 2000-06-13 | 2002-06-06 | Bayer Ag | Regulation of human transmembrane serine protease |
| US6734006B2 (en) | 2000-06-13 | 2004-05-11 | Bayer Aktiengesellschaft | Regulation of human transmembrane serine protease |
| US7622292B2 (en) | 2000-06-13 | 2009-11-24 | Bayer Schering Pharma Ag | Regulation of human transmembrane serine protease |
| US7314730B2 (en) | 2000-06-13 | 2008-01-01 | Bayer Aktiensegellschaft | Regulation of human transmembrane serine protease |
| EP2075582A3 (en) * | 2000-07-12 | 2010-01-06 | Agensys, Inc. | Novel tumor antigen useful in diagnosis and therapy of bladder, ovary, lung and kidney cancers |
| JP2009148264A (ja) * | 2000-07-12 | 2009-07-09 | Agensys Inc | 膀胱癌、卵巣癌、肺癌、および腎臓癌の診断および治療に有用な腫瘍抗原 |
| JP2004506880A (ja) * | 2000-07-25 | 2004-03-04 | ザ トラスティーズ オブ ザ ユニバーシティー オブ ペンシルヴァニア | エピトープの免疫検出のための方法 |
| US7838251B2 (en) | 2002-01-25 | 2010-11-23 | University Of Pittsburgh | Nuclear matrix protein alterations associated with colon cancer and colon metastasis to the liver, and uses thereof |
| EP1527098A4 (en) * | 2002-01-25 | 2007-04-18 | Univ Pittsburgh | CORE MATRIX PROTEIN CHANGES ASSOCIATED WITH CANCER AND CARDIAC MUSCLES OF LIVER AND USES THEREOF |
| US7189823B2 (en) | 2002-01-25 | 2007-03-13 | University Of Pittsburgh | Antibody against illfdyfnr |
| WO2004092397A3 (en) * | 2003-04-15 | 2005-02-10 | Novartis Ag | Tmprss2 regulatory sequences and uses thereof |
| WO2004097358A3 (en) * | 2003-05-02 | 2005-02-10 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with human transmembrane serine protease 2 (tmprss2) |
| US7718369B2 (en) | 2005-09-12 | 2010-05-18 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US9745635B2 (en) | 2005-09-12 | 2017-08-29 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US10190173B2 (en) | 2005-09-12 | 2019-01-29 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US8211645B2 (en) | 2005-09-12 | 2012-07-03 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US8580509B2 (en) | 2005-09-12 | 2013-11-12 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US10041123B2 (en) | 2005-09-12 | 2018-08-07 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US8969527B2 (en) | 2005-09-12 | 2015-03-03 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US9284609B2 (en) | 2005-09-12 | 2016-03-15 | The Brigham And Women's Hospital, Inc. | Recurrent gene fusions in prostate cancer |
| US9957569B2 (en) | 2005-09-12 | 2018-05-01 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| WO2008119767A3 (en) * | 2007-03-30 | 2009-01-15 | Oryzon Genomics Sa | Method of nucleic acid analysis. |
| US9719143B2 (en) | 2007-07-06 | 2017-08-01 | The Regents Of The University Of Michigan | MIPOL1-ETV1 gene rearrangements |
| US9303291B2 (en) | 2007-07-06 | 2016-04-05 | The Regents Of The University Of Michigan | MIPOL1-ETV1 gene rearrangements |
| US10167517B2 (en) | 2007-07-06 | 2019-01-01 | The Regents Of The University Of Michigan | MIPOL1-ETV1 gene rearrangements |
| US8106037B2 (en) | 2007-08-03 | 2012-01-31 | The Brigham And Women's Hospital, Inc. | Identification and treatment of estrogen responsive prostate tumors |
| US9926602B2 (en) | 2009-09-17 | 2018-03-27 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US9938582B2 (en) | 2009-09-17 | 2018-04-10 | The Regents Of The University Of Michigan | Recurrent gene fusions in prostate cancer |
| US9567644B2 (en) | 2010-11-19 | 2017-02-14 | The Regents Of The University Of Michigan | RAF gene fusions |
| US8945556B2 (en) | 2010-11-19 | 2015-02-03 | The Regents Of The University Of Michigan | RAF gene fusions |
| US11015224B2 (en) | 2010-11-19 | 2021-05-25 | The Regents Of The University Of Michigan | RAF gene fusions |
| US10683368B2 (en) | 2014-11-06 | 2020-06-16 | Hoffmann-La Roche Inc. | Fc-region variants with modified FcRn-binding and methods of use |
| US11440971B2 (en) | 2014-11-06 | 2022-09-13 | Hoffmann-La Roche Inc. | Fc-region variants with modified FcRn-binding and methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2004202306C1 (en) | 2008-05-01 |
| US20060275304A1 (en) | 2006-12-07 |
| JP2002517185A (ja) | 2002-06-18 |
| DK1082341T3 (da) | 2011-03-28 |
| WO1999062942A3 (en) | 2000-06-02 |
| JP2009148265A (ja) | 2009-07-09 |
| DE69943020D1 (de) | 2011-01-20 |
| AU2004202306B2 (en) | 2007-05-24 |
| ATE490977T1 (de) | 2010-12-15 |
| AU773187B2 (en) | 2004-05-20 |
| AU4413699A (en) | 1999-12-20 |
| EP1082341A2 (en) | 2001-03-14 |
| CY1111906T1 (el) | 2015-11-04 |
| AU2004202306A1 (en) | 2004-06-24 |
| EP1082341B1 (en) | 2010-12-08 |
| PT1082341E (pt) | 2011-02-15 |
| IL139988A0 (en) | 2002-02-10 |
| CA2329137C (en) | 2011-09-20 |
| CA2329137A1 (en) | 1999-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1082341B1 (en) | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer | |
| US7981624B2 (en) | Methods to detect tumors using 20P1F12/TMPRSS2 expression | |
| US8003758B2 (en) | BPC-1: a secreted brain-specific protein expressed and secreted by prostate and bladder cancer cells | |
| AU764096B2 (en) | Gene expressed in prostate cancer | |
| CA2415923C (en) | Novel tumor antigen useful in diagnosis and therapy of bladder, ovary, lung and kidney cancers | |
| AU2007209794B2 (en) | Tumor antigen useful in diagnosis and therapy of prostate and colon cancer | |
| ES2356117T3 (es) | Antígeno tumoral útil en el diagnóstico y la terapia de cáncer de colon y de próstata. | |
| AU2003268577A1 (en) | PHELIX: a testis-specific protein expressed in cancer | |
| AU2006201736B2 (en) | BPC-1: a secreted brain specific protein expressed and secreted by prostate and bladder cancer cells | |
| AU2003203703B2 (en) | BPC-1:a secreted brain specific protein expressed and secreted by prostate and bladder cancer cells | |
| WO1999058560A2 (en) | Prostapin gene and protein and uses thereof | |
| AU6502499A (en) | Methods and compositions for the diagnosis and therapy of prostate cancer | |
| CA2344552A1 (en) | Human gene expressed in cancers of prostate, bladder, pancreas and colon, 36p1a6 | |
| AU2004205174A1 (en) | 36P6D5: Secreted tumor antigen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AT AT AU BR CA CH CN DE DE DK DK ES FI FI GB IL JP KR MX NO NZ RU SE SG |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AT AT AU BR CA CH CN DE DE DK DK ES FI FI GB IL JP KR MX NO NZ RU SE SG |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 139988 Country of ref document: IL Ref document number: 44136/99 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2329137 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2000 552152 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999927164 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999927164 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 44136/99 Country of ref document: AU |