WO1999042077A2 - Compositions and methods for regulating lymphocyte activation - Google Patents

Compositions and methods for regulating lymphocyte activation Download PDF

Info

Publication number
WO1999042077A2
WO1999042077A2 PCT/US1999/003309 US9903309W WO9942077A2 WO 1999042077 A2 WO1999042077 A2 WO 1999042077A2 US 9903309 W US9903309 W US 9903309W WO 9942077 A2 WO9942077 A2 WO 9942077A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
antibodies
llama
binding
Prior art date
Application number
PCT/US1999/003309
Other languages
English (en)
French (fr)
Other versions
WO1999042077A3 (en
Inventor
Jeffrey A. Ledbetter
Martha Hayden Ledbetter
William A. Brady
Laura S. Grosmaire
Che-Leung Law
Raj Dua
Original Assignee
Xcyte Therapies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU32952/99A priority Critical patent/AU3295299A/en
Priority to BR9907950-0A priority patent/BR9907950A/pt
Priority to JP2000532094A priority patent/JP2003525016A/ja
Priority to KR1020007009178A priority patent/KR20010034512A/ko
Priority to CA002321199A priority patent/CA2321199A1/en
Priority to NZ506453A priority patent/NZ506453A/xx
Application filed by Xcyte Therapies, Inc. filed Critical Xcyte Therapies, Inc.
Priority to EP19990934239 priority patent/EP1469883A2/en
Priority to IL13796399A priority patent/IL137963A0/xx
Publication of WO1999042077A2 publication Critical patent/WO1999042077A2/en
Priority to NO20004095A priority patent/NO20004095L/no
Priority to HK02102629.3A priority patent/HK1041210A1/zh
Publication of WO1999042077A3 publication Critical patent/WO1999042077A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2806—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/74—Inducing cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to regulation of lymphocyte activation.
  • it relates to compositions and methods for regulating lymphocyte activation by selectively binding multiple cell surface antigens expressed by the same lymphocyte.
  • Antigen aggregation can be achieved in vitro by incubating lymphocytes with immobilized ligands or antibodies or antibody fragments specific for the target antigens.
  • multispecific molecules that contain multiple binding specificities in a single soluble molecule are particularly useful in aggregating multiple antigens in vivo resulting in lymphocyte activation.
  • Multispecific molecules may also be constructed to inhibit lymphocyte activation by blocking the delivery of activation signals to the cells. Therefore, the invention is useful in regulating T and B cell immune responses in vitro and in vivo.
  • T cells recognize antigens by the T cell antigen receptor (TCR) complex.
  • TCR T cell antigen receptor
  • each TCR/CD3 complex consists of six subunits including the clonotypic disulfide-linked TCR ⁇ / ⁇ or TCR ⁇ / ⁇ heterodimers and the invariant CD3 complex (M. M. Davis, Annu. Rev. Biochem., 59: 475, A. C. Chan et al., Annu. Rev. Immunol., 10: 555).
  • the TCR , ⁇ , ⁇ , and ⁇ chains are 40 to 50 kDa glycoproteins encoded by T cell specific genes that contain antibody-like variable (V), joining (J), and constant (C) regions (S. M.
  • TCR heterodimers are the antigen binding subunits and they determine the specificity of individual T cells, ⁇ / ⁇ heteroexpressing cells constitute more than 90% of peripheral T cells in both humans and mice, and they are responsible for the classical helper or cytotoxic T cell responses (M. M. Davis, Annu. Rev. Biochem., 59: 475; A. C. Chan et al., Annu. Rev. Immunol., 10: 555).
  • TCR ⁇ / ⁇ ligands are peptide antigens presented by the major histocompatibility complex (MHC) Class I or Class II molecules.
  • MHC major histocompatibility complex
  • the nature of TCR ⁇ / ⁇ ligands is not as well defined, and may not involve presentation by the MHC proteins (Y.-H. Chien et al., Annu. Rev. Immunol., 15: 511).
  • the invariant CD3 complex is made up of four relatively small polypeptides, CD3 ⁇ (20kDa), CD3e (20kDa), CD3 ⁇ (25 kDa) and CD3 ⁇ (16kDa).
  • CD3 ⁇ , e, and ⁇ chains show a significant degree of similarity to each other in their amino acid sequences. They are members of the immunoglobulin (Ig) supergene family, each of them possesses a single extracellular Ig-like domain.
  • Ig immunoglobulin
  • CD3 ⁇ only has a nine amino acid extracellular domain and a longer cytoplasmic domain when compared to CD3 ⁇ , e, and ⁇ .
  • the cytoplasmic domains of the CD3 chains contain one to three copies of a conserved motif termed an immunoreceptor tyrosine-based activation motif (ITAM) that can mediate cellular activation.
  • ITAM immunoreceptor tyrosine-based activation motif
  • One consequence of TCR/CD3 complex ligation by peptide-MHC ligands is the recruitment of a variety of signaling factors to the ITAMs of the CD3 chains. This initiates the activation of multiple signal transduction pathways, eventually resulting in gene expression, cellular proliferation and generation of effector T cell functions (A. Weiss and D. R. Liftman, Cell, 76: 263; R. Wange and L. E. Samelson, Immunity, 5: 197).
  • TCR complex The assembly and expression of the TCR complex are complex and tightly regulated processes; exactly how different chains of the receptor complex contribute to these remain to be fully elucidated. Nevertheless, it is well established that surface expression of a TCR complex requires the presence of TCR ⁇ / ⁇ or TCR ⁇ / ⁇ plus CD3 ⁇ CD3e, CD3 ⁇ , and CD3 ⁇ chains (Y. Minami et al, Proc. Natl. Acad. Sci. USA., 84: 2688; B. Alaracon et al, J. Biol. Chem., 263: 2953). Absence of any one chain renders the complex trapped in the cytoplasm and subjects them to rapid proteolytic degradation (C. Chen et al., J. Cell Biol. 107: 2149; J.
  • TCR/CD3 complex may contain two copies of the TCR heterodimer, a CD3e/ ⁇ heterodimer, a CD3e/ ⁇ heterodimer and a CD3 ⁇ homodimer to constitute a decameric complex (R. S. Blumberg et al., Proc. Natl. Acad. Sci. USA., 87: 7220; M. Exley et al., Moi. Immunol., 32: 829).
  • the TCR heterodimers and CD3 ⁇ homodimers are covalently linked by disulfide bonds, while the CD3e/ ⁇ and CD3e/ ⁇ heterodimers are not covalently linked. Furthermore, the interaction among CD3e/ ⁇ , CD3e/ ⁇ , CD3 ⁇ , and TCR ⁇ / ⁇ or TCR ⁇ / ⁇ chains has been shown to be non- covalent.
  • TCR/CD3 complex begins with pairwise interactions between individual TCR ⁇ , TCR ⁇ chains with the CD3 chains in the endoplastmic reticulum (ER) leading to the formation of intermediates consisting of a single TCR chain in association with the CD3 chains (B. Alarcon et al, J. Biol. Chem., 263: 2953; N. Manolios et al., EMBO J., 10: 1643).
  • Transfection studies conducted in non-lymphoid cells shows that TCR ⁇ can associate with CD3 ⁇ and CD3e but not CD3 ⁇ whereas TCR ⁇ can associate with CD3 ⁇ , e, and ⁇ but no CD3 ⁇ (N.
  • TCR ⁇ / ⁇ , CD3 ⁇ , e, and ⁇ chains are strictly required to be present in the ER before CD3 ⁇ can assemble with the partial TCR/CD3 complex to form the final product for surface expression (Y. Minami et al., Proc. Natl. Acad. Sci. USA., 84: 26880. Association between the TCR and CD3 chains seems to depend largely on the charged amino acid residues in their transmembrane domains.
  • Positively charged amino acid residues are present in the transmembrane domains of the TCR ⁇ / ⁇ chains, an arginine and a lysine for TCR ⁇ and a lysine for TCR ⁇ .
  • Negatively charged amino acids are found in the transmembrane domains of the CD3 chains, a glutamic acid for CD3 ⁇ and an aspartic acid for each of CD3e, ⁇ and ⁇ . Formation of salt bridges due to these charged amino acid is believed to be the main force driving the association between the TCR ⁇ / ⁇ chains and the CD3 chains (C. Hall et al., Int. Immunol., 3:359; P. Cosson et al., Nature, 351:414).
  • TCR ⁇ and TCR ⁇ chains may pair with CD3 ⁇ , e or ⁇ .
  • the disulfide-linked CD3 ⁇ may preferentially pair with TCR ⁇ due to the additional negatively charged amino acid in the transmembrane domain of TCR ⁇ .
  • lymphocyte surface antigens have been used to classify T and B cells into specific functional subpopulations and different differentiation stages. More recently, certain of these surface antigens have been recognized as capable of mediating activation signals. Most notably, antibodies directed to CD3 have been used to activate T cells in the absence of antigen (Leo et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:1374). In addition, studies of T cell activation have shown that ligand binding to specific coreceptors modifies T cell proliferation and cytokine production initiated by stimulation of the TCR/CD3 complex.
  • Receptor-coreceptor interactions have been demonstrated by using soluble ligands crosslinked together on the cell surface with second step reagents, soluble bispecific molecules such as heteroconjugated antibodies, or combinations of ligands immobilized on a solid surface. Although multiple coreceptors are known, the functional interactions of three or more receptors on B cells have not been reported.
  • the present invention relates to compositions and methods for regulating lymphocyte activation.
  • the invention relates to compositions and methods for activating T and/or B cells by aggregating three or more cell surface antigens.
  • the activation signals may result in either immune enhancement or immunosuppression.
  • the invention also relates to inhibition of lymphocyte activation by simultaneous binding to multiple surface receptors and blocking or inhibiting their ability to transmit activation signals and/or by preventing their ability to bind and activate receptors on other cells.
  • T and/or B cells are used in adoptive immunotherapy of cancer and infectious diseases such as acquired immunodeficiency syndrome (AIDS).
  • a preferred method for aggregating multiple cell surface antigens in vitro is by adso ⁇ tion of ligands that bind cell surface antigens and/or antibodies specific for the antigens or their antigen-binding derivatives such as variable domains and complementarity-determining regions (CDRs) of variable domains, onto a solid substrate such as a culture dish or suspendable beads.
  • CDRs complementarity-determining regions
  • ligands, antibodies or their antigen-binding derivatives may be adsorbed on a biodegradable substrate for in vivo administration, it is preferred that these molecules be combined to form a single soluble multivalent molecule by chemical conjugation or recombinant expression methods. Therefore, it is also an object of the invention to construct a multispecific molecule that simultaneously binds to multiple cell surface antigens. Such multispecific molecule may be immobilized for in vitro lymphocyte activation, or it may be administered as a pharmaceutical composition to a subject for the regulation of lymphocyte activation in vivo.
  • a multispecific molecule may activate lymphocytes by aggregating multiple surface receptors or inhibit lymphocyte activation by interfering with ligand/receptor interactions between T and B cells or between lymphocytes and antigen-presenting cells.
  • a wide variety of uses are encompassed by this aspect of the invention, including but not limited to, treatment of immunodeficiency, infectious diseases and cancer as well as suppression of auto immunity, hypersensitivity, vascular diseases and transplantation rejection.
  • the present invention is based, in part, on Applicants' discovery that stimulation of human T cells with immobilized antibodies specific for three T cell surface antigens resulted in enhanced proliferation when compared with stimulation by two immobilized antibodies. Therefore, aggregation of three T cell surface antigens enhanced T cell proliferation.
  • the invention is also based, in part, on Applicants' discovery that llamas immunized with human T cell surface antigens produced antibodies devoid of light chains that bound to such antigens. Since these heavy chain-only antibodies can be generated in llamas against human cell surface antigens, these antibodies and their antigen-binding derivatives are preferred in the construction of multispecific molecules because the lack of light chain participation in antigen binding eliminates the need to include light chains or light chain variable regions.
  • heavy chain-only antibodies in the construction of multispecific molecules makes the formation of their binding sites less complex.
  • such antibodies contain longer CDRs, especially CDR3, than antibodies composed of heavy and light chains, indicating that CDR peptides derived from heavy chain-only antibodies may be of higher affinity and stability for use in the construction of multispecific molecules.
  • V HH variable domains
  • Such multispecific molecules are useful for immunoregulation, based on either stimulation or inhibition of lymphocyte activation.
  • llama B cells express a human CD40 epitope cross-reactive with an anti-human CD40 antibody, and a subpopulation of CD40 + llama cells express heavy chain-only antibodies.
  • the CD40 + cells could be activated to proliferate by an anti-CD40 antibody.
  • V HH domains A novel subclass of such V HH from L. llama are shown in the working examples as lacking a CHI domain, and their CDR1, CDR2 and CDR3 are not linked by disulfide linkages.
  • the llamalized antibody retains its original antibody binding specificity without pairing with a light chain.
  • Figure 1 A schematic description of the isolation of llama V HH polypeptides that bind to cell surface antigens.
  • Figure 2. Immobilized mAbs specific for three T cell surface antigens induced enhanced proliferation of human blood T cells.
  • Figure 3. Immobilized anti-CD3, anti-CD28 and anti-CD40 mAbs induced enhanced proliferation of T cells.
  • Figure 4. Synergy between CD2, CD3 and CD28 activation of purified CD4 + T cells as compared to activation of CD8 + T cells.
  • Figure 6. Synergistic effects of mAbs against CD3, CD2 and
  • CD28 co-immobilized on "DYNAL" beads.
  • Figure 7A & 7B Comparison of co-immobilized and separately immobilized mAbs on T cell proliferation.
  • CD3 x CD28 anti-CD3 and anti-CD28 mAbs co- immobilized on same beads.
  • CD3 x CD2 anti-CD3 and anti-CD2 mAbs co-immobilized on same beads.
  • CD3 + CD28 a mixture of beads coated with anti- CD3 or anti-CD28 mAb.
  • CD3 + CD2 a mixture of beads coated with anti-CD3 or anti-CD2 mAb.
  • Figure 9A-9F Selective growth of T cells expressing V ⁇ TCR chains.
  • Llama B cells express CD40 and surface immunoglobulin (Ig), and certain CD40 + cells express Ig that do not contain light chain.
  • Llama peripheral blood lymphocytes were unstained (10A), or stained with antibodies: anti-CD40 (10B), anti-CD40 and anti-light chain (IOC), anti- light chain (10D), anti-CD40 and anti-Ig (10E) and anti-Ig (lOF).
  • Figure 11 Llama B cells proliferated in response to stimulation with an anti-CD40 antibody and CD86 (or B7.2)- expressing transfected CHO cells plus PMA. Results from two different llamas are shown.
  • Lane 1 contains IgGl D (DEAE flowthrough)
  • lane 2 contains IgGl G (Protein G-bound antibodies eluted at pH 2.7)
  • lane 3 contains IgG2 and IgG3 (Protein G- bound antibodies eluted at pH 3.5)
  • lane 4 contains IgG3 (Protein G flow through). Lanes 3 and 4 show antibody heavy chain without light chain.
  • FIG. 13A-13H Llama heavy chain-only antibodies (IgG2 and IgG3) bound human T cell surface antigens.
  • Jurkat T cells were stained with IgGl G (13A), IgGl D (13C), IgG2 + IgG3 (13E) or IgG3 (13G) followed by a second step anti-Ig reagent.
  • Jurkat T cells were also stained with the same antibody fractions (13B, 13D, 13F and 13H), followed by a second step anti-light chain reagent.
  • Figure 14 Camelid V HH phage display vector.
  • FIGS. 16A-16B Amino acid sequence alignment of Llama V HH polypeptides. 16A shows alignment of several unique hybrid sequences (SEQ ID NOS: 1-9). 16B shows alignment of several complete sequences (SEQ ID NOS: 10-15) which are similar to previously reported camel variable regions.
  • Figure 20 Binding activity of various CD3-Ig fusion proteins to anti-CD3 mAbs, G 19-4.
  • lymphocytes Multiple antigens (or receptors) expressed by lymphocytes work together to regulate cellular activation. In many cases, receptors work together by coming into close proximity or make contact with each other to collectively mediate an activation signal. Under physiological conditions, this process may be controlled by cell-cell contact, where ligands expressed by one cell contact receptors expressed by a second cell, and the receptors are crosslinked and clustered at the site of cell-cell contact. The precise array and order of the receptor contacts may be controlled by the spatial orientation of the ligands and by the inherent ability of the receptors to contact each other at specific sites and in a specific order.
  • the activation signals that are mediated by clustered receptors depend upon intrinsic enzymatic activity of the receptors or of molecules that are directly or indirectly (through linker molecules) associated with each receptor.
  • the clustered receptors allow signaling complexes to form at the cell membrane that result in composite signals dependent upon the precise makeup and orientation of the clustered receptors. Changes in the pattern of receptor clustering result in altered activation states of the resident cell.
  • compositions and methods for mimicking receptor clustering by aggregating lymphocyte antigens to generate an activation signal are also encompassed by the invention.
  • an "activation signal” as used herein refers to a molecular event which is manifested in a measurable cellular activity such as proliferation, differentiation, cytotoxicity and apoptosis, as well as secretion of cytokines, changes in cytokine profiles, alteration of expression levels or distribution of cell surface receptors, antibodies production and antibody class switching.
  • an “activation signal” can be assayed by detecting intracellular calcium mobilization and tyrosine phosphorylation of receptors (Ledbetter et al., 1991, Blood 77:1271).
  • T cells which mediate an activation signal
  • T cells include but are not limited to, CD2, CD4, CD5, CD6, CD8, CD18, CD25, CD27, CD28, CD40, CD43, CD45, CD45RA, CD45RO, CDwl50, CD152 (CTLA-4), CD154, MHC class I, MHC class II, CDwl37 (4- IBB), (The Leucocyte Antigen Facts Book, 1993, Barclay et al., Academic Press; Leucocyte Typing, 1984, Bernard et al. (eds.), Springer-Verlag; Leukocyte Typing II, 1986, Reinherz et al.
  • T cell surface antigens include antigen-binding antibody derivatives such as variable domains, peptides, superantigens, and their natural ligands or ligand fusion proteins such as CD58 (LFA-3) for CD2, HIV gpl20 for CD4, CD27L for CD27, CD80 or CD86 for CD28 or CD152, ICAM1, ICAM2 and ICAM3 for CDl la/CD18, 4-1BBL for CDwl37.
  • binding partners may be used to deliver or inhibit an activation signal to T cells.
  • B7.1 CD80
  • B7.2 CD86
  • B7.3 is a recently identified member of the CD80/CD86 family (GenBank Database Accession No. Y07827). Alignment of the amino acid sequence of B7.3 with those of other family members shows that it is as similar to B7.1 and B7.2 as B7.1 is similar to B7.2.
  • Activation molecules expressed by B cells include but are not limited to, surface Ig, CD18, CD19, CD20, CD21, CD22, CD23, CD40, CD45, CD80, CD86 and ICAM1.
  • natural ligands of these molecules, antibodies directed to them as well as antibody derivatives may be used to deliver or inhibit an activation signal to B cells.
  • the present invention demonstrates that aggregation of CD2 and CD3 plus CD28 or CD4 or CD5 enhanced T cell proliferation.
  • any three or more up to ten of the aforementioned T and B cell antigens may be bound and aggregated to induce T and B cell activation.
  • the preferred antigen combinations include CD2 and CD3 with a third antigen being variable, including CD4, CD5, CD6, CD8, CD18, CD27, CD28, CD45RA, CD45RO, CD45, CDwl37, CDwl50, CD 152 or CD 154.
  • CD2 and CD3 are aggregated with two or three of these surface antigens in any combinations. Examples of these combinations include CD2 and CD3 plus CD4 and CD5 or CD4 and CD28 or CD5 and CD28 or CD8 and CD28 or CDwl37 and CD28 or CD4 and CD5 and CD28.
  • the preferred combinations include CD80 and CD86 with a third antigen being variable, including CD40 or CD56.
  • CD40 may be aggregated with CD45 and CD86 or with CD 19 and CD20.
  • the antigen combination includes CD3 or TCR and CD28 plus a third antigen described above. 5.2. METHODS FOR AGGREGATING MULTIPLE LYMPHOCYTE SURFACE ANTIGENS
  • One aspect of the present invention relates to methods of aggregating a specific set of three or more antigen combinations to induce lymphocyte activation.
  • a convenient method for aggregating multiple cell surface antigens is by immobilizing "binding partners" of the antigens on a solid substrate such as adsorption on a culture dish, on beads, or on a biodegradable matrix by covalent or non-covalent linkages.
  • the binding partners are coated on beads, which can be readily separated from cells by size filtration or a magnetic field.
  • binding partners include natural ligands, binding domains of ligands, and ligand fusion proteins
  • the preferred embodiments for the practice of this aspect of the invention are antibodies and their antigen-binding derivatives such as Fab, (Fab') 2 , F v , single chain antibodies, heavy chain-only antibodies, V HH and CDRs (Harlow and Lane, 1988, Antibodies, Cold Spring Harbor Press; WO 94/04678).
  • Fab fragment antigen-binding derivatives
  • F v single chain antibodies
  • V HH and CDRs Harlow and Lane, 1988, Antibodies, Cold Spring Harbor Press; WO 94/04678
  • An alternative method to immobilization is cross-linking of three or more antibodies or their antigen-binding derivatives with a secondary antibody that binds a commonly shared epitope.
  • avidin or streptavidin may be used as a second step cross-linking reagent.
  • the molecules are suspended in a saline such as PBS at a concentration of 1-100 ⁇ g/ml. It is preferred that the concentrations are adjusted to 10 ⁇ g/ml. After incubation upon a solid surface at 4-37 °C for 1-24 hours, extensive washing is performed to remove the free molecules prior to the addition of cells.
  • a saline such as PBS
  • aggregation orders of CD2-CD4-CD3 or CD4 ⁇ CD2-CD3 are expected to be less optimal because in these orders, aggregation of CD2 with CD4 can prevent them from interacting with CD3.
  • the ratios, order and spatial orientation of the binding partners may be adjusted in accordance with a desired outcome.
  • This aspect of the invention is particularly useful for expansion of lymphocytes in cultures.
  • peripheral blood mononuclear cells are isolated according to standard procedures and added to the culture dishes containing immobilized antibodies.
  • T or B cell preparations may be enriched prior to stimulation, using methods well known in the art, including but not limited to, affinity methods such as cell sorting and panning, complement cytotoxicity and plastic adherence.
  • distinct T and B cell subsets may be purified using these procedures.
  • the cells are stimulated for a period of several days to a week followed by a brief resting period and restimulation.
  • the expanded cells may be restimulated every three to fourteen days.
  • growth factors such as IL-2 and IL-4 may be added to the cultures.
  • stimulatory cytokines may also be similarly attached to the same solid support.
  • the antibodies and their antigen-binding derivatives may be adsorbed onto a biodegradable substrate made of natural material such as cat gut suture or synthetic material such as polyglycolic acid.
  • a biodegradable substrate made of natural material such as cat gut suture or synthetic material such as polyglycolic acid.
  • soluble multispecific molecules are also preferred for in vitro lymphocyte activation when they are immobilized. The following section describes the construction of such molecules. 5.3. MULTISPECIFIC MOLECULES THAT AGGREGATE MULTIPLE LYMPHOCYTE SURFACE ANTIGENS
  • Soluble molecules that bind to multiple cellular target antigens have advantages over molecules immobilized on a particulate matrix for in vivo regulation of the immune system. These advantages include the ability of soluble molecules to rapidly diffuse throughout the immune system, and the formulation of a pharmaceutical composition without an immobilization matrix. Soluble multispecific molecules have advantages over combinations of monospecific molecules in specificity and avidity, resulting in increased potency and effectiveness. A multispecific molecule also possesses an increased target cell specificity even though individual components lack specificity for a particular cell type. Several low affinity ( ⁇ 50 nm) binding sites specific for distinct target antigens may be fused in tandem to form a multispecific protein with increased binding avidity for the cells expressing all target antigens.
  • a multispecific molecule composed of a CD 18- binding partner may still exhibit lymphocyte subset specificity because a lymphocyte subset expressing CD 18 and not the other target antigens of the multispecific molecule would not bind the molecule with high avidity.
  • T cells may be activated to become "TH 2 "-like cells and induced to secrete TGF ⁇ and IL-10 which suppress immune responses by IL-4 production plus a signal to TCR CD3.
  • Cytokines such as IL-4 may be covalently attached to a solid support or otherwise immobilized with antibodies or ligands to induce TH 2 T cell differentiation.
  • a multispecific molecule may be constructed between a low affinity ( ⁇ 100 nm) CD3 binding site and binding sites for CD2 and CD4 for that pu ⁇ ose.
  • a preferred multispecific molecule is composed of binding partners that aggregate CD2, CD3 and CD28.
  • Other T cell activation multispecific molecules are composed of binding partners that aggregate CD2 and CD3 or CD3 and CD28 with a third variable antigen such as those described in Section 5.1., supra.
  • soluble multispecific molecules that inhibit T and B cell activation.
  • Such inhibitory molecules can bind two, three and up to ten antigens on the same surface simultaneously and inhibit the delivery of an activation signal through these antigens.
  • An example of one such multispecific molecule binds to CD80, CD86, and CD40 on antigen presenting cells and B cells, and interferes with activation of the CD28 pathway and the CD40 pathway simultaneously.
  • a bispecific inhibitor of the CD28 and CD40 pathways binds to CD28 and CD 154 (the CD40 ligand) on T cells, blocking activation of CD28 and preventing CD 154 from activating CD40.
  • T cell inhibitory bispecific molecules target CD20 and CD40 or CD2 and CD4 or CD28 and CD45 or CD2 and CD 154.
  • Trispecific inhibitory molecules target CD2 and CD28 and CD45 or CD2 and CD4 and CD45 or CD2 and CD4 and CD28 or CD2 and CD27 and CD28.
  • Soluble multispecific molecules that bind to multiple B cell receptors and enhance activation signals are particularly advantageous for induction of apoptosis of malignant B cells.
  • Such multispecific molecules also have advantages in specific targeting since they are expected to bind more strongly to a cell that expresses all of the receptors and bind less well to any cell that expresses only one or a subset of the receptors recognized by the multispecific molecules.
  • a preferred multispecific molecule binds to CD 19, CD20, and CD40 receptors simultaneously, and generates activating signals through these receptors to result in apoptosis of malignant B cells.
  • Bispecific and multispecific B cell inhibitory molecules may target CD80 and CD40 or CD86 and CD40 or CD80 and CD86 or CD80 and CD86 and B7-3 on B cells or antigen presenting cells.
  • a multispecific molecule may be produced by chemical conjugation of multiple binding partners that bind cell surface antigens or by recombinant expression of polynucleotides that encode these polypeptides.
  • single chain polypeptides of low molecule weight be used as binding partners to construct multispecific molecules.
  • camels secrete antibodies devoid of light chains.
  • the variable domain of such heavy chain-only antibodies referred to as V HH are fused directly to a hinge region which is linked to the CH2 and CH3 domains. The absence of a CHI domain in the heavy chains prevents formation of disulfide linkages with light chains.
  • Heavy chain-only antibodies are particularly suitable for use in the construction of multispecific molecules because there is no participation in antigen binding by light chains.
  • V HH domains of these antibodies are even more suitable because the removal of their constant domains reduces non-specific binding to Fc receptors.
  • Section 8, infra demonstrates that V HH domains of L. llama contain CDR3 that are longer than CDRs in conventional antibodies, and the CDRs of a particular subclass (hybrid subclass) of these V HH sequences do not form disulfide linkages with other CDRs in the same variable domain. Therefore, these CDRs may be more stable and independent in antigen binding, and can be readily expressed to result in proper folding.
  • CDRs in these antibodies can be determined by methods well known in the art (U.S. Patent No. 5,637,677), and used for the production of multispecific molecules.
  • Variable region sequences from L. llama are similar to sequences in the human VH 3 family of variable domains (Schroeder et al., 1989, Int. Immunol. 2:41-50).
  • amino acids in non-CDR or exposed framework sites may be altered on the basis of their differences from human VH 3 residues.
  • Crystal structure of a camel V HH can be used as a guide to prioritize residue changes based on the extent of exposure (Desmyter et al., 1996, Nat. Struct. Biol. 3:803-811).
  • Other methods of predicting immunogenicity of residues may also be used (i.e.
  • animals belonging to the Camelidae family are used as hosts for immunization with a purified antigen, fusion protein between a human cell surface antigen and llama antibody constant region, or cells expressing an antigen of interest.
  • These hosts include but are not limited to, old world camelids such as Camelus bactrianus and C. dromaderius, and new world camelids such as Llama paccos, L. glama, L. vicugna and L. llama.
  • peripheral blood leukocytes or mononuclear cells from other lymphoid tissues such as lymph nodes and spleens are isolated by density gradient centrifugation and their cDNA obtained by reverse transcription/polymerase chain reaction as described in Section 8.1.2., infra.
  • Phage display technology may be used to express the isolated V HH fragments for the selection of antigen-specific binding V HH (U.S. Patent Nos. 5,223,409; 5,403,484 and 5,571,698). Examples of a number of isolated V HH sequences from L. llama are shown in Section 8 infra.
  • Heavy chain-only antibodies may also be produced by conventional hybridoma technology originally described by Koehler and Milstein, 1975, Nature 256:495-497. Monoclonal heavy chain-only antibodies may be proteolytically cleaved to produce V HH domains.
  • Isolated V HH domains or multispecific molecules composed of V HH domains may be fused with a second molecule with biologic effector functions.
  • they may be fused with a toxin such as pseudomonas exotoxin 40 (PE40) for specific delivery to kill unwanted cells such as cancer cells or autoreactive T cells.
  • PE40 pseudomonas exotoxin 40
  • cytokines to deliver signals to specific cell types, or with extracellular domains of receptors or receptor binding domains to combine receptor specificity with the specificity of V HH .
  • they may be fused with Ig Fc domains, Ig Fc domains containing specific mutations (U.S. Patent No. 5,624,821), or portions of Fc domains to construct chimeric antibody derivatives.
  • the multispecific molecules may be expressed as genes to improve and/or simplify gene therapy vectors.
  • a preferred method of making soluble multispecific molecules is the fusion of multiple camelid V HH variable regions, each specific for a chosen cellular target antigen.
  • Llamas are a preferred camelid species as a source of such variable regions because they are readily available.
  • the functional activity of a multispecific molecule depends upon the composition, spacing, and ordering of the binding sites of the variable regions. Composition of the binding sites would depend upon the specificity of the individual V HH used and the number of each V HH in the molecule.
  • V HH target specificity may include one or more V HH binding domains against a single receptor fused to other V HH domains targeted to a second or a third receptor. Molecules that target two or more epitopes on only one receptor are within the scope of the invention.
  • V HH domains and receptor epitopes may be important for driving intra- or inter-receptor binding patterns.
  • the spacing of the binding sites would depend upon the choices of linkers used between V HH domains. Linker length and flexibility are both factors that would control spacing between binding domains. Ordering of the binding sites would be controlled by ordering the V HH domains within the fusion protein construct.
  • Camelid V HH domains with binding specificity for lymphocyte antigens or CDRs derived from them could be linked together in tandem arrays, either genetically or chemically. If the arrays are genetically linked, fusion proteins are created with multiple antigen binding specificities in a single molecule. In the preferred multispecific structure, the linked molecules should result in the same spectrum of activity, so that blocking, inhibitory molecules are linked to create a more potent immunosuppressive agent. Similarly, agonists that aggregate and stimulate the bound receptors would be linked in order to achieve more potent activation of the lymphocytes bound through their receptors for potential ex vivo cell therapy applications with soluble or immobilized molecules.
  • linkers used in either the suppressive or activator molecules might take one of several forms, with the preferred linkers containing repeated arrays of the amino acids glycine and serine.
  • (gly 4 ser) 3 or (gly 3 ser 2 ) 3 are two preferred choices of linker between antigen binding domains. This linker might need to be lengthened in order to achieve optimal binding of the flanking V HH domains, depending on the size and spacing of the target antigens on the cell surface.
  • V HH domains might be altered in successive embodiments to determine which structures give the optimal biological effect.
  • the V HH domain in the center of the molecule might be most constrained and therefore might have an apparent decrease in avidity for its target relative to the two flanking domains.
  • some V HH domains might be more sensitive to amino versus carboxy terminal fusions.
  • the suppressive effects of a CD80-CD86-CD40 structure might therefore differ from a CD80-CD40-CD86, CD40-CD80-CD86, CD40-CD86- CD80, or a CD86-CD40-CD80 type molecule.
  • a multispecific molecule may be constructed by chemical conjugation of three or more individual molecules. Glennie & Trutt (1990, Bispecific Antibodies and Targeted
  • trispecific F(ab') 3 can be constructed by first preparing a bispecific F(ab') 2 derivative containing the two
  • F(ab') 2 from two antibodies are first reduced to yield Fab'(SH) and all the available sulfhydryl groups on one antibody Fab'(SH) are maleimidated with a bifunctional cross-linker o-phenylenedimaleimide (o-PDM) followed by reacting Fab' (mal) with the Fab' (SH) under conditions which favor a reaction between SH and maleimide groups while minimizing the reoxidation of SH- groups.
  • o-PDM bifunctional cross-linker o-phenylenedimaleimide
  • All derivatives are reduced and alkylated to safeguard against any minor untoward products which may form by disulfide exchange or oxidation of SH-groups during an overnight incubation.
  • All multispecific Fab' derivatives are passed through a highly specific anti-mouse Fc ⁇ immunosorbent to remove any trace amounts of parent monoclonal IgG which may have escaped with the parent F(ab') 2 fragments following fractionation of the digest mixture.
  • the aforementioned protocol was originally designed for linking Fab fragments from mouse IgG to form trispecific (Fab') 3 through tandem thioether linkages of the hinge-region sulfhydryl groups using the cross-linker o-PDM.
  • this method may be adjusted for linking any three or more molecules for the construction of multispecific molecules, including, but not limited to, ligands, binding domains of ligands, antibodies, Fv, V HH and CDR.
  • V HH domains will show improvements in expression levels in many cell systems, including bacterial expression, yeast expression, insect expression and mammalian expression systems.
  • the characteristic changes in V HH domains allow expression without requiring pairing with a light chain variable region through a strong hydrophobic interaction.
  • Conventional variable regions are not secreted or expressed on the cell surface without pairing with a second variable region to mask the hydrophobic variable region interface. Therefore the expression of variable regions is linked to the hydrophobic interface that mandates pairing with a second variable region.
  • V HH domains are expressed individually and should be expressed at much higher levels because of the alterations in hydrophobic residues that restrict expression.
  • the multispecific molecules containing V HH domains also will express better because they can be folded into their active conformations more easily. This will be a significant advantage in bacterial expression where active molecules may be expressed without requiring refolding procedures in vitro after expression of denatured protein. Improved folding may also help improve expression in mammalian cells. Improvements in expression levels will meet an important need for production of antibody -based therapeutics. High costs of goods have been a significant limitation for commercialization of products based on antibody binding sites where molecules may be active in vivo but require high levels of protein for therapeutic efficacy (sometimes exceeding 1 gram per patient). In fact, it is likely that high costs associated with expression currently represent the greatest barrier to success with antibody based products.
  • a contiguous polynucleotide sequence containing coding sequences of multiple binding partners is inserted into an appropriate expression vehicle, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
  • an appropriate expression vehicle i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
  • the expression vehicle is then transfected into a suitable target cell which will express the encoded product.
  • the expressed product is then isolated by procedures well-established in the art.
  • Multispecific V HH molecules are constructed by linking the cDNAs encoding one V HH to a second V HH through a spacer cDNA encoding an amino acid linker molecule. Adding another V HH and linker to this bispecific, and continuing this process to gradually build an array of binding sites, results in a multispecific molecule.
  • the molecules can be assembled in any plasmid vector with the appropriate restriction site polylinker for such sequential insertions.
  • a new polylinker may be constructed in an existing plasmid that encodes several restriction sites interspersed with DNA encoding the amino acid linkers for at least two of the junctions between V HH molecules.
  • linkers include (gly 4 ser) 3 , (gly 3 ser 2 ) 3 , other types of combinations of glycine and serine (gly x ser y ) z , hinge like linkers similar to those attached to the llama V HH domains (including some or all portion of the region between amino acids 146-170) which include sequences encoding varying lengths of alternating PQ motifs (usually 4-6) as part of the linker, linkers with more charged residues to improve hydrophilicity of the multispecific molecule, or linkers encoding small epitopes such as molecular tags for detection, identification, and purification of the molecules.
  • a preferred embodiment of the present invention includes PCR amplification of V HH molecules targeted to CD80, CD86, and CD40, each with unique, rare restriction sites at the ends of the cDNAs.
  • An expression plasmid is created with a polylinker into which complementary oligonucleotides encoding two or more of the amino acid linkers outlined above have been inserted and annealed. At each end of the inserted oligonucleotides, the restriction site matches that found on the amino or carboxy terminus (5' or 3' end) of one of the V HH cassettes. Multispecific molecules can then be assembled by successive digestion and ligation of the oligonucleotide-poly linker plasmid with the individual V HH cassettes.
  • a variety of host-expression vector systems may be utilized to express a multispecific molecule. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage DNA or plasmid DNA expression vectors containing an appropriate coding sequence; yeast or filamentous fungi transformed with recombinant yeast or fungi expression vectors containing an appropriate coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing an appropriate coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus or tobacco mosaic virus) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing an appropriate coding sequence; or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacteriophage DNA or plasmid DNA expression vectors containing an appropriate coding sequence; yeast or filamentous fungi transformed with re
  • the expression elements of the expression systems vary in their strength and specificities.
  • any of a number of suitable transcription and translation elements may be used in the expression vector.
  • inducible promoters such as pL of bacteriophage ⁇ , plac, pt ⁇ , ptac (pt ⁇ -lac hybrid promoter) and the like may be used;
  • promoters such as the baculovirus polyhedron promoter may be used;
  • promoters derived from the genome of plant cells e.g., heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein
  • plant viruses e.g., the 35S RNA promoter of CaMV; the coat protein promoter of TMV
  • sequences encoding a multispecific molecule may be driven by any of a number of promoters.
  • viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al., 1984, Nature 310:511-514), or the coat protein promoter of TMV (Takamatsu et ai, 1987, EMBO J. 3:17-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J.
  • Autographa calif ornica nuclear polyhidrosis virus (AcNPV) is used as a vector to express the foreign genes.
  • the virus grows in Spodoptera frugiperda cells.
  • a coding sequence may be cloned into non-essential regions (for example the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of a coding sequence will result in inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedron gene).
  • a number of viral based expression systems may be utilized.
  • a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing peptide in infected hosts.
  • a non-essential region of the viral genome e.g., region El or E3
  • the vaccinia 7.5 K promoter may be used, (see, e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci. (USA) 79:7415-7419; Mackett et ai, 1984, J. Virol. 49:857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. 79:4927-4931).
  • a multispecific molecule can be purified by art-known techniques such as high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, affinity chromatography and the like.
  • the actual conditions used to purify a particular molecule will depend, in part, on factors such as net charge, hydrophobicity, hydrophilicity, etc., and will be apparent to those having skill in the art.
  • any antibody which specifically binds the molecule may be used.
  • various host animals including but not limited to rabbits, mice, rats, etc., may be immunized by injection with a multispecific molecule or a portion thereof.
  • the molecule or a peptide thereof may be attached to a suitable carrier, such as BSA, by means of a side chain functional group or linkers attached to a side chain functional group.
  • adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum bacilli Calmette-Guerin
  • Lymphocytes are activated in culture by aggregation of multiple surface antigens in accordance with the method of the invention.
  • the activated cells may be used in adoptive therapy of infectious diseases, particularly viral infections such as AIDS, and cancer.
  • Activated cells may secrete cytokines or have other effector mechanisms that suppress responses to autoantigens or transplants, and may therefore be useful for treatment of autoimmune diseases and transplant rejection.
  • multispecific molecules that aggregate multiple antigens may be administered directly into a subject to augment immune responses against an infectious agent such as a virus or against tumor cells.
  • such molecules may deliver an apoptotic signal to T and B cell tumors to directly induce tumor destruction.
  • multispecific molecules may be used as inhibitors of immune responses by interfering with antigen presentation or T cell/B cell interactions. These molecules are useful for treatment of autoimmunity, and hypersensitivity as well as prevention of transplantation rejections.
  • a multispecific molecule of the invention may be administered to a subject er se or in the form of a pharmaceutical composition.
  • Pharmaceutical compositions comprising a multispecific molecule of the invention may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the active ingredient into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • a multispecific molecule of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
  • Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, oral or pulmonary administration such as aerosol, inhaler and nebulizer.
  • a multispecific molecule of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • the solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • a multispecific molecule may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile pyrogen-free water
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • a multispecific molecule can be readily formulated by combining with pharmaceutically acceptable carriers well known in the art. Such carriers enable a multispecific molecule of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
  • suitable excipients include fillers such as sugars, such as lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents.
  • disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • solid dosage forms may be sugar-coated or enteric-coated using standard techniques.
  • suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added.
  • a multispecific molecule may take the form of tablets, lozenges, etc. formulated in conventional manner.
  • a multispecific molecule for use according to the present invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • a multispecific molecule may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g, containing conventional suppository bases such as cocoa butter or other glycerides.
  • a multispecific molecule may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • a multispecific molecule may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Liposomes and emulsions are well known examples of delivery vehicles that may be used to deliver a multispecific molecule of the invention.
  • Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity.
  • a multispecific molecule may be delivered using a sustained- release system, such as semipermeable matrices of solid polymers containing the therapeutic agent.
  • sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release a multispecific molecule for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
  • a multispecific molecule of the invention may contain charged side chains or termini, they may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts.
  • Pharmaceutically acceptable salts are those salts which substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.
  • a multispecific molecule of the invention will generally be used in an amount effective to achieve the intended pu ⁇ ose.
  • a multispecific molecule of the invention, or pharmaceutical compositions thereof are administered or applied in a therapeutically effective amount.
  • therapeutically effective amount is meant an amount effective to ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • a therapeutically effective dose can be estimated initially from in vitro assays.
  • a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC 50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
  • Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.
  • Dosage amount and interval may be adjusted individually to provide plasma levels of a multispecific molecule which are sufficient to maintain therapeutic effect.
  • Usual patient dosages for administration by injection range from about 0.1 to 5 mg/kg/day, preferably from about 0.5 to 1 mg/kg/day.
  • Therapeutically effective serum levels may be achieved by administering multiple doses each day.
  • the effective local concentration of a multispecific molecule may not be related to plasma concentration.
  • One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.
  • the amount of a molecule administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
  • the therapy may be repeated intermittently while symptoms are detectable or even when they are not detectable.
  • the therapy may be provided alone or in combination with other drugs.
  • a therapeutically effective dose of a multispecific molecule described herein will provide therapeutic benefit without causing substantial toxicity.
  • Toxicity of a multispecific molecule described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD 50 (the dose lethal to 50% of the population) or the LD 100 (the dose lethal to 100% of the population).
  • the dose ratio between toxic and therapeutic effect is the therapeutic index. Molecules which exhibit high therapeutic indices are preferred.
  • the data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human.
  • the dosage of a multispecific molecule described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • V HH gene sequences isolated by the methods disclosed herein can be expressed in animals by transgenic technology to create founder animals that express llama V HH (United States Patent No. 5,545,806; WO98/24893).
  • Animals of any species including, but not limited to, mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, sheep, and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate llama V HH -expressing transgenic animals.
  • transgenic refers to animals expressing coding sequences from a different species (e.g., mice expressing llama gene sequences).
  • V HH transgenes may be used to introduce V HH transgenes into animals to produce the founder lines of transgenic animals.
  • Such techniques include, but are not limited to, pronuclear micro injection (Hoppe and Wagner, 1989, U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ lines (Van der Putten, et al, 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); gene targeting in embryonic stem cells (Thompson, et ai, 1989, Cell 56:313-321); electroporation of embryos (Lo, 1983, Moi. Cell. Biol.
  • transgenic animal clones containing V HH transgenes for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal or adult cells induced to quiescence (Campbell, et ai, 1996, Nature 380:64-66; Wilmut, et ai, Nature 385:810-813).
  • the present invention provides for transgenic animals that carry the V HH transgenes in all their cells, as well as animals that carry the transgenes in some, but not all their cells, i.e., mosaic animals.
  • the V HH may be integrated as individual gene segments or in concatamers, e.g., head-to-head tandems or head-to-tail tandems.
  • the V HH transgenes may also be selectively introduced into a particular cell type such as lymphocytes by following, for example, the teaching of Lasko et al. (1992, Proc. Natl. Acad. Sci. USA 89:6232-6236).
  • JZ specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.
  • gene targeting is preferred. Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenous genes are designed for the pu ⁇ ose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequences of the endogenous genes.
  • the transgenes may also be selectively introduced into a particular cell type, thus inactivating the endogenous genes in only that cell type, by following, for example, the teaching of Gu, et al. (1994, Science 265: 103-106).
  • the regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.
  • the expression of the llama V HH may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to assay whether integration of the V HH has taken place. The level of mRNA expression of the V HH in the tissues of the transgenic animals following immunization of an antigen may also be assessed using techniques that include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and RT-PCR. Samples of V HH -expressing tissue, may also be evaluated immunocytochemically using antibodies specific for llama variable region epitopes.
  • V m V m
  • Any antigen by immunizing transgenic animals with an antigen Mice are preferred because of ease of handling and the availability of reagents.
  • Such antibodies include, but are not limited, to polyclonal, monoclonal, chimeric, humanized, single chain, anti- idiotypic, antigen-binding antibody fragments and fragments produced by a variable region expression library.
  • adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum bacilli Calmette-Guerin
  • MAbs may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256:495-497). Such antibodies may be heavy chain-only antibodies and of any immunoglobulin class including, but not limited to, IgG, IgM, IgE, IgA, IgD and any subclass thereof.
  • Mononuclear cells were isolated from human peripheral blood by centrifugation on "FICOLL". Monocytes were depleted by two rounds of adherence to plastic. The mononuclear cells were then stimulated in 96-well Costar flat-bottom microtiter plates at 50,000 cells per well containing immobilized antibodies. The antibodies were immobilized by incubating purified antibody mixtures in phosphate buffered saline (PBS) in the wells at 100 ⁇ l/well for 3 hr at 37°C, followed by washing away of the unbound antibodies from the wells prior to addition of cells. Antibody concentrations were 10 ⁇ g/ml of anti-CD3, 10 ⁇ g/ml of anti-CD2, and varying concentrations of a third antibody as indicated.
  • PBS phosphate buffered saline
  • MAb anti-CD3, OKT3, was obtained from ATCC (ATCC CRL-8001).
  • MAb anti-CD28, B-T3, was purchased from Diaclone (Besancon, France).
  • MAb anti-CD2, 9.6, and anti-CD28 antibody, 9.3, were provided by John Hansen (FHCRC, Seattle, WA).
  • Anti-CD4 , OKT4, was obtained from the ATCC (ATCC CRL-8002).
  • Control mAb was L6.
  • Anti-CD40 mAb is described by Clark and Ledbetter (1986, Proc. Natl. Acad. Sci. U.S.A. 83:4494-4498).
  • Anti-CD18 mAb is described by Beatly et al. (1983, J. Immunol. 131 :2913-2918).
  • T cells were isolated from peripheral blood by centrifugation on "FICOLL", followed by separation into CD4 + or CD8 + subsets by depletion of monocytes, B cells, NK cells, and either CD4 or CD8 cells.
  • Cell depletion was performed using mAbs to CD14, CD20, CD1 lb, and CD8 or CD4 followed by removal of antibody-bound cells using magnetic beads coated with anti-mouse IgG.
  • CD4 + or CD8 + T cells were >95% pure after the depletion step when analyzed by flow cytometry.
  • Cells were cultured in antibody-coated microtiter plates at 5 X 10 4 for 4 days, and proliferation was measured by inco ⁇ oration of 3 H-thymidine for the final 12 hours of culture.
  • Microtiter plates contained immobilized antibodies as indicated, including the control, nonbinding L20 antibody in some wells to equalize the total protein concentration for immobilization. Antibodies were immobilized by incubation at 10 ⁇ g/md each for 18 hr at 37 °C, followed by removal of unbound protein by extensive washing.
  • TCR V ⁇ 8 (Pharmingen 3313 1A), V ⁇ 9 (Pharmingen 3313 IB), V ⁇ l4 (Coulter Im. 1557), and V ⁇ 20 (Coulter Im. 1561) were immobilized on culture plates using a two-step procedure.
  • Purified goat anti-mouse (Capel) antibody was immobilized first, followed by washing and blocking before addition of the anti-V ⁇ mAb plus anti-CD28. Cell growth was observed, and after 9 days, the proliferating cells were transferred to new culture plates containing 5 U/mL interleukin-2 (R&D, Inc., Minneapolis, MN). Five days later, on day 14, the cells were analyzed by flow cytometry for expression of TCR V ⁇ specificity using a secondary fluorescein-conjugated anti- mouse IgG reagent (Biosource).
  • the antibodies were allowed to react with the beads for approximately 20 hr at 37 °C on a rotator. This was followed by removal of unreacted antibody with a magnet.
  • the bead preparations were then washed three times with 1 mf PBS containing 0.1% (w vol) sodium azide and three times with PBS containing 3% (vokvol) human serum, 5 mM EDTA, and 0.1% (wt.vol) sodium azide (storage buffer). The last of the three washes in storage buffer was done for 30 minutes at ambient temperature on a rotator. All the bead preparations were then incubated with storage buffer for approximately 31 hr at 4°C on a rotator. This was followed by re-suspension of each of the preparations in 1.0 md storage buffer.
  • Peripheral blood lymphocytes were isolated by density centrifugation. The lymphocytes were adhered to plastic in RPMI with 2% FCS. Cells were pelleted and plated in 96-well flat-bottom plates at a density of 2.5 x 10 5 /ml. Dynal beads conjugated with mAbs were then plated with the cells at a ratio of 3 beads: 1 cell. Cells were incubated at 37°C and 5% CO 2 for 5 days. One ⁇ Ci/well of 3 H-thymidine was then added to the wells and incubated overnight. Cultures were harvested on a glass filter mat and cpm measured. 6.2. RESULTS
  • Human T cells were isolated from peripheral blood of normal donors and stimulated in vitro with immobilized mAbs directed to three T cell surface antigens.
  • Antibodies specific for CD2 and CD3 plus a third antibody, such as anti-CD28, anti-CD4 or anti-CD5, were co-immobilized by adso ⁇ tion on the surface of culture plates, followed by incubation with T cells in culture media.
  • T cell proliferation was assayed as a measure of T cell activation.
  • the combination of three immobilized antibodies enhanced T cell proliferation when compared with the combined use of immobilized anti-CD2, anti-CD3 antibodies and a third control antibody, L6, specific for an antigen not expressed by T cells (Figure 2).
  • the combination of anti-CD2, anti-CD3 and anti-CD28 produced the highest level of T cell proliferation at all concentrations tested.
  • Three immobilized antibodies induced greater cellular proliferation than the same antibodies presented in solution or two immobilized antibodies plus a third antibody in solution.
  • Co-immobilized anti-CD3 and anti-CD28 plus anti-CD18 mAbs also induced greater T cell proliferation than the combination of two of the three antibodies.
  • co-immobilized anti-CD3, anti-CD28 and anti-CD40 mAbs enhanced proliferation of purified T cells (Figure 3). It is noted that CD40 is expressed by activated T cells as well as antigen presenting cells. Therefore, aggregation of three T cell surface antigens by co-immobilized antibodies enhanced T cell activation.
  • Immobilized antibodies may be used to expand T cell and B cell numbers in culture as well as inducing cellular differentiation.
  • the activated cells can be separated from the immobilized antibodies more easily than from antibodies added in solution so that injection of antibodies bound to cells into a recipient can be minimized when the cells are harvested for use in adoptive therapy.
  • co-immobilized anti-CD2 mAb and anti-CD3 mAb increased the proliferation of CD4 + and CD8 + T cells above the level induced by anti- CD3 alone.
  • anti-CD2 and anti-CD28 were added to anti-CD3 during the antibody immobilization step, there was a further dramatic increase in proliferation of CD4 + T cells, whereas proliferation of CD8 + cells was not enhanced above that induced by anti-CD3 plus anti-CD28 or by anti-CD3 plus anti-CD2 ( Figure 4).
  • co-immobilized anti-CD3, anti-CD28 and anti-CD2 antibodies enhanced proliferation of CD4 + T cells over the combination of co- immobilized anti-CD3 and anti-CD28 or the combination of anti-CD3 and anti-CD2.
  • anti-CD3, anti-CD28 and anti-CD2 combination is expected to induce greater amounts of lymphokine production by CD4 + T cells, which in turn stimulate greater CD8 + T cell activation.
  • co-immobilized antibodies stimulate distinct cytokine profiles by activated T cells, depending on which specific combination of three or more antibodies is used.
  • Such activated T cells may be co- cultured with other cell types in vitro such as monocytes or dendritic cells to promote their growth or differentiation in the absence of exogenous cytokines.
  • FIG. 5A and 5B shows that 3 H-thymidine inco ⁇ oration measurement of T cell proliferation correlated directly with cell growth after stimulation with immobilized antibodies. Proliferation of purified CD4 + T cells was measured at day 7 with a 12 hr pulse of 3 H-thymidine, while cell number was measured on day 8 by direct cell counting with a hemocytometer. Such findings indicate that measurement of T cell proliferation by 3 H-thymidine uptake is directly reflective of the ability of co- immobilized anti-CD2, anti-CD3 and anti-CD28 antibodies to expand T cell numbers in cultures.
  • Figure 7A and 7B demonstrates that co-immobilization of antibodies on the same beads produced higher levels of T cell proliferation than a mixture of beads with separately immobilized antibodies, indicating that aggregation of multiple surface molecules on T cells is achieved optimally by positioning the antibodies in close proximity to each other.
  • Figure 8 shows that anti-CD2 immobilized on separate beads or added in solution inhibited T cell proliferation stimulated by anti-CD3 and anti-CD28 co-immobilized on the same beads.
  • T cells were selectively stimulated by anti-TCR variable region antibodies co-immobilized on culture plates with anti-CD28, followed by analysis of V ⁇ specificity of the cultured cells.
  • the cells stimulated with co-immobilized anti- TCR V ⁇ 8 and anti-CD28 were 72% positive for expression of V ⁇ 8, but did not express V ⁇ 9, V ⁇ l4, or V ⁇ 20 above the level detected by control anti-mouse IgG second step reagent alone ( Figure 9B, 9D, and 9F).
  • the cells stimulated with co- immobilized anti-TCR V ⁇ 9 and anti-CD28 from the same donor sample did not react with the anti-V ⁇ 8, anti-V ⁇ l4, or anti-V ⁇ 20 antibodies, but reacted significantly (65% positive) with the anti-V ⁇ 9 mAb ( Figure 9A, 9C and 9E).
  • the cells from this donor analyzed before antibody stimulation showed that expression of each of these V ⁇ specificities was less that 5%.
  • TCR V ⁇ usage shows a significant correlation with antigen-specific reactivity of T cells, and TCR V ⁇ usage can be highly skewed in patients with autoimmune disease and cancer, it is likely that antigen-specific T cells or T cells highly enriched for a specific antigen recognition can be selectively expanded using the appropriate V ⁇ mAb immobilized with an anti-CD28 mAb.
  • T cell antigen such as CD2, CD 150, CD5, or ICOS
  • additional T cell antigen such as CD2, CD 150, CD5, or ICOS
  • Antibodies to two or more V ⁇ chains may also be used together with anti- CD28 and additional mAbs to expand T cells expressing the desired V ⁇ polypeptide chains without expanding the other T cell subsets.
  • T cells expressing ⁇ TCR may also be selectively expanded by a mAb to ⁇ heterodimer co-immobilized with other antibodies.
  • any antibody reactive with a component of the TCR/CD3 complex including any CD3 polypeptide chain or epitopes of the TCR alpha/beta or gamma/delta dimers such as the CDRs may be used for the practice of the invention.
  • Llama llama were obtained from JJJ Farms (Redmond, WA) and immunized intraperitoneally with human cells in PBS and Freund's complete adjuvant, followed by at least 3 rounds of boosting with the same cells in Freund's incomplete adjuvant.
  • the cell types used for immunization included normal unstimulated or activated human peripheral blood lymphocytes (PBL), T cell lines such as Jurkat and HPB-ALL, B cell lines such as Daudi and Ramos or EBV-transformed line CESS.
  • Llamas were also immunized with 100-500 ⁇ g purified fusion proteins in PBS mixed with adjuvant as described above for the cells. Animals were bled 4-7 days after each boost to determine if sera contained antibodies reactive with the target cells. Large bleeds (200 ml) were performed after the third boost or after later boosts, depending on the antibody response of the animal. Animals were bled by venipuncture of the jugular vein and whole blood was treated with citrate
  • Llama whole blood (200 ml) was centrifuged at 900 ⁇ m for 20 minutes and the upper layer of cells containing peripheral blood mononuclear cells was aspirated to a secondary tube. This fraction was then diluted 1 :1 in PBS and 30 ml were loaded onto 15 ml cushions of Lymphocyte Separation Media (LSM, Organon Teknika). Buffy coats were fractionated by centrifugation at 2000 ⁇ m for 20 minutes in a Sorvall tabletop centrifuge and isolated by aspiration from the serum LSM interface. Cells were washed three times in PBS or serum free RPMI, spun at 1200-1400 ⁇ m for 10 minutes, and counted after the final spin.
  • LSM Lymphocyte Separation Media
  • the appropriate number of cells was aliquoted to fresh centrifuge tubes for the final spin.
  • the final cell pellets were snap frozen without liquid in dry ice-ethanol baths at 10 8 cells/tube and placed at -70°C until mRNA isolation.
  • cells were resuspended and cultured overnight in RPMI/10% fetal calf serum at a cell density of 10 6 cells/ml for use in binding assays or functional studies in vitro. Cells were also frozen in aliquots of 2 x 10 7 cells in serum 10% DMSO for use in future functional assays.
  • PBL from L. llama were isolated by centrifugation on LSM and the cells were stained with an anti-CD40 mAb, G28-5, (U.S. Patent No. 5,182,368), an anti-llama immunoglobulin (Ig), and an anti-light chain antibody.
  • the anti-CD40 antibody (G28-5) was labeled with biotin, and its binding was detected with phycoerythrin-conjugated strepavidin.
  • the anti-llama Ig was directly labeled with fluorescein.
  • the anti-light chain staining was performed using fluorescein-conjugated anti-human kappa plus anti-human lambda reagents from Caltag (Burlingame, CA). Cell staining was analyzed by a FACSCAN flow cytometer.
  • PBL from L. llama were isolated by centrifugation on LSM.
  • the lymphocytes were stimulated with phorbol-12-myristic acid (PMA) (10 ng/ml), an anti-CD40 mAb (G28-5 at 1 ⁇ g/ml), CD86-expressing Chinese hamster ovary (CHO) cells, control CHO cells or combinations of the aforementioned reagents.
  • PMA phorbol-12-myristic acid
  • an anti-CD40 mAb G28-5 at 1 ⁇ g/ml
  • CD86-expressing Chinese hamster ovary (CHO) cells control CHO cells or combinations of the aforementioned reagents.
  • CHO cells were irradiated prior to the assay to prevent CHO cell proliferation.
  • Lymphocyte proliferation was measured in quadruplicate wells of a microtiter plate containing 50,000 lymphocytes each by inco ⁇ oration of 3 H-thymidine during the last 12 hr of a three day culture period. Mean
  • Serum from a llama immunized with multiple injections of Jurkat T cells was fractionated by a multi-step procedure into conventional and heavy chain-only IgG isotypes. Serum was first bound to Protein A, eluted, and then separated by DEAE ion exchange chromatography. The Protein A eluate was separately fractionated by binding to Protein G, followed by elution at pH 2.7 or at pH 3.5. Fractions were analyzed by SDS-PAGE after reduction.
  • Isolated llama PBL were reacted with anti-CD40 and anti-Ig or anti-light chain antibodies, and analyzed by flow cytometry.
  • Figure 10A and 10B shows that a population of llama peripheral blood cells reacted with an anti-human CD40 antibody.
  • Two color staining further demonstrates that all CD40 + cells expressed surface Ig, indicating that these cells were antibody-producing B cells ( Figure 10E and 10F).
  • Figure IOC and 10D only a portion of the CD40 + cells expressed detectable light chain.
  • PBL from two llamas were isolated and stimulated with different reagents, followed by measurement of cellular proliferation.
  • Anti-CD40 antibody stimulated llama B cell proliferation, which was further enhanced by PMA ( Figure 11). While CD86 (or B7.2)-expressing CHO cells alone did not induce L. llama B cell proliferation, its combined use with PMA induced significant proliferation ( Figure 11). CD40 stimulation may also induce llama B cell differentiation and Ig affinity maturation in culture. Therefore, CD40 stimulation may be used to selectively expand llama B cells producing heavy chain-only antibodies to facilitate the isolation of these antibodies and their specific V HH regions.
  • an anti-CD40 antibody may be injected into llamas to stimulate B cells in vivo in order to enhance the number of B cells producing V HH .
  • Cells expressing specific variable regions may be isolated by a variety of methods, including rosetting with specific antigen bound to red blood cells.
  • FIG. 12 shows purified Ig isotypes, including IgGl D (DEAE flowthrough in lane 1), IgGl G (Protein G, pH 2.7 elution in lane 2), IgG2 + IgG3 (Protein G, pH 3.5 elution in lane 3), and IgG3 (Protein G flowthrough in lane 4).
  • the IgG2 and IgG3 isotypes (lanes 3 and 4) contained a heavy chain band without detectable light chain.
  • the heavy chain-only antibodies (IgG2 + IgG3, and IgG3 fractions) were incubated with Jurkat T cells for detection of antibody binding to cell surface antigens. Specific binding was detected using a fluorescein-conjugated anti-llama Ig or anti-light chain second step reagent, followed by analysis with a flow cytometer ( Figure 13A-13H). Negative controls were purified IgG isotypes at the same concentrations from an unimmunized llama.
  • Llama PBL mRNA was prepared by a modification of the guanidinium- thiocyanate acid-phenol procedure of Chomczynski and Sacchi (1987, Anal. Biochem. 162:156-159). For 10 8 cells, 5-10 ml denaturing/lysis solution was added to prepare RNA. PolyA RNA was isolated using oligo dT cellulose, washed in 75% ethanol/DEPC treated water, recentrifuged, and resuspended in DEPC treated water.
  • RT-PCR cDNA was generated by random hexamer primed reverse transcription reactions using Superscript II reverse transcriptase (GIBCO-BRL). PCR reactions were performed using the following primer set: The forward primer was LVH5'-1, one of a battery of 20- mers designed from amino-terminal sequencing of the V HH protein, with the sequence
  • V H and V HH sequences were then purified, cloned into the phage display vector XPDNT, and used as template in generating libraries of llama variable regions containing mostly V HH sequences. Additional methods for the cloning of llama V HH region sequences are as follows.
  • Llama IgG 2 -specific V HH regions were cloned from cDNA prepared from llama PBL and amplified by PCR using a human Vhl family-specific 5' primer and a 3' llama IgG 2 hinge region primer.
  • the sequences of these primers were AGGTGCAGCTGGTGCAGTCTGG (SEQ ID NO: 49) and GGTTGTGGTTTTGGTGTCTTG (SEQ ID NO: 50), respectively.
  • llama IgG 2 -specific V HH regions were cloned from cDNA prepared from llama PBL and amplified by PCR using a human Vh2 family-specific 5' primer with a 3' llama IgG 2 hinge region primer.
  • the sequences of these primers were CAGGTCAACTTAAAGGGAGTCTGG (SEQ ID NO: 51) and GGTTGTGGTTTTGGTGTCTTG (SEQ ID NO: 50), respectively.
  • Llama IgG 2 -specific V HH regions were also cloned from cDNA prepared from llama PBL and amplified by PCR using a human Vh4 family-specific 5 primer with a 3' llama IgG 2 hinge region primer.
  • the sequences of these primers were AGGTGCAGCTGCAGGAGTCGG (SEQ ID NO: 52) and GGTTGTGGTTTTGGTGTCTTG (SEQ ID NO: 50), respectively.
  • V HH sequences from the amplifications were pooled and digested with Sad and BamHI, then inserted into the modified phage display vector XPDNT, creating gene III fusion cassettes.
  • the V HH library was transformed into E. coli XL 1 BLUE bacteria by electroporation and plated to large NUNC bioassay dishes containing SB/amp/tet media. Platings on serially diluted samples were also performed at this step to estimate transformation efficiency. Libraries were scraped into SB/amp/tet containing 20% glycerol and frozen in 1-2 ml aliquots at -70 °C.
  • Phage stocks or supernatants were preblocked by incubation in 10% nonfat milk PBS for 1 hour on ice prior to panning against preblocked human antigen or cells. Many rounds of panning were precleared with untransfected or normal human cells or with irrelevant -Ig fusion protein to reduce the frequency of nonspecific binders. Preclearing and panning were performed by coincubating the blocked phage with antigen or cells for 1 hour on ice and centrifugation to pellet bound phage. For panning with -Ig fusion protein antigens, protein A sepharose was used to capture phage-antigen complexes prior to centrifugation.
  • Bound cells or protein A sepharose were washed at least 6 times and as many as 12 times in 10% milk/PBS, PBS/1%BSA or PBS/blocker/0.05% Tween prior to elution. Elution of bound phage was performed by incubation in one of several different buffers, and incubation for 10 minutes at room temperature. Elution buffers included 0.1N HC1, pH 2.5 in PBS, 0.1 M citric acid pH 2.8, 0.5% NP-40 in PBS, or 100MM triethylamine. Cells/sepharose were pelleted and the supernatant containing eluted phage aliquoted to fresh tubes.
  • Eluates were neutralized in IM Tris, pH 9.5, prior to infection of logarithmic XL 1 BLUE cells. After infection, aliquots were taken to determine eluted phage titers. Random clones from these platings were then amplified to determine insert frequency and DNA sequence at each round of panning. Llama V HH sequences were determined from the initial library and after each round of panning from random clones.
  • a phage display vector was constructed which created a hybrid fusion protein encoding llama immunoglobulin V HH domains specific for human antigens attached to a truncated version of bacteriophage Ml 3 coat protein III ( Figure 14).
  • the phagemid vector contained a pUC vector backbone, and several Ml 3 phage derived sequences for expression of gene III fusion proteins and packaging of the phagemid after coinfection with helper phage.
  • the vector was constructed in two forms which differed by the manner in which the fusion between the two protein domains was achieved. The first form included a his ⁇ tag between the two domains as a potential tool for purification and detection of functional fusion proteins.
  • the second form lacked this tag and contained only a single (gly 4 ser) subunit between the two cassettes.
  • Both versions of the vector were constructed with the gene III fusion out of frame and nonfunctional unless a V HH was inserted between the leader peptide domain and the gene III domain. All V HH molecules were PCR amplified with SacI-BamHI ends for insertion between the ompA leader peptide (EcoRI-SacI) and the gene III fusion beginning at Spel. Once V HH cassettes with binding activity for human antigens or cells were detected and isolated, the SacI- BamHI fragments could be directly transferred to a mammalian expression vector with compatible sites.
  • the mammalian vector contained a Hindlll-Sacl leader peptide and a BamHI-Xbal immunoglobulin domain for expressing human, llama, or mouse Ig fusion proteins. This altered vector permitted rapid shuttling of putative antigen binding V HH into a system more amenable to functional analysis.
  • phage clones were isolated after 3-5 rounds of panning with target antigens. Eluates from each round of panning were infected into host bacteria and aliquots were plated to LB/amp/tet plates for isolated colonies. Individual clones were inoculated into 2XYT/amp/tet liquid media for several hours, infected with helper phage, and grown under selective conditions overnight at 30 °C. Phage supernatants were then prepared by centrifugation to pellet cells and culture supernatants were aliquoted to fresh tubes. Precipitated, concentrated phage (100X) were prepared by PEG precipitation of the culture supernatants and resuspension in PBS/1%BSA.
  • Human PBL or monocytes were counted and resuspended in 5% nonfat milk/PBS and preblocked on ice for 30 minutes. Thereafter, cells were pelleted and resuspended in 5% nonfat milk/PBS, added to preblocked phage in 25 ⁇ d per sample, and incubated on ice for 1 hour. Following binding, cells were washed 3 times with alternating 5% milk/PBS and 1% BSA/PBS.
  • Subcloned DNA fragments were subjected to cycle sequencing on a PE 2400 thermocycler using a 25 cycle program with a denaturation profile of 96 °C for 10 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 4 minutes.
  • the sequencing primers used were the T7 promoter primer 5 'TAA TAC GAC TCA CTA TAG GGA GA3' (SEQ ID NO: 53) and the M13 reverse sequencing primer 5'AAC AGC TAT GAC CAT G3' (SEQ ID NO: 54) (Genosys Biotechnologies, The Woodlands, Texas). Reactions were performed using the Big Dye Terminator Ready Sequencing Mix (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Samples were ethanol precipitated, denatured, and analyzed by capillary electrophoresis on an ABI 310 Genetic Analyzer (PE-Applied Biosystems). Sequence was edited and translated using Sequencher 3.0 (Genecodes).
  • Llamas were immunized with human lymphocytes or fusion proteins for the generation of antibody responses against lymphocyte surface antigens as described in Section 7.1.1, supra. After immunization, llama PBL were prepared and V HH -containing DNA fragments were obtained by RT/PCR for the construction of V HH libraries.
  • a phage display vector was constructed for the cloning of cell-binding V HH sequences from llamas immunized with human lymphocytes ( Figure 14 and Section 8.1.3., infra). Table I shows several isolated phage clones, each of which exhibited a characteristic pattern of binding to different human cell types. Subsequent sequence analysis verified that each clone encoded a unique V HH . In addition, two V HH clones, L10 and LI 1, were isolated which reacted with a high molecular weight glycoprotein of 150- 200K Da antigen expressed on CHO cells ( Figure 15). Binding of these clones to the target antigen was completely abrogated when CHO cells were pre -treated with trypsin. V HH binding was only partially reduced following treatment of cells with neuraminidase or other endoglycosidases. Thus, the V HH clones reacted with a glycoprotein expressed on the surface of CHO cells.
  • sequence diversity of the clones was reduced after five rounds of panning.
  • the resulting protein sequences of the V HH were aligned to identify sequence motifs present in this family of antibody variable regions from L. llama.
  • Sequence alignment revealed two subclasses of V HH sequences in L. llama, which are referred to herein as hybrid (SEQ ID NOS: 1-9) and complete (SEQ ID NOS: 10- 15) V HH sequences.
  • Neither subclass contains a CHI domain of conventional heavy chains, and thus both are expressed as V HH domains fused directly to the hinge-CH2-CH3 domains of an antibody.
  • the hypervariable domains CDRl, CDR2 and CDR3 present in most antibody variable regions are seen in both types of V HH molecule ( Figure 16A and 16B).
  • the CDR3 sequence in L. llama V HH domains is longer on average than most CDR3 domains of conventional antibodies composed of heavy and light chains, with the longest CDR3 shown in Figure 16B containing 26 amino acid residues. It was previously reported that the CDR3 and CDR2 (or occasionally the CDRl domain) domains in camels usually contained a cysteine residue which was hypothesized to be involved in the formation of a disulfide linkage between the two CDR domains (Muyldermans et al., 1994, Prot. Engin. 7:1129-1135).
  • Residue 47 is more variable, encoding a Gly or Arg in the L. llama complete V HH sequences, but encoding the hydrophobic residues Leu or Phe in the hybrid V HH sequences. Subsequent clones have been found to contain tryptophan, isoleucine, serine or alanine as well.
  • Residue 44 (Gly) is also more variable, substituting Glu or Asp for Gly in the complete V HH subclass, while Glu, Lys, and Gin occur at this position in the hybrid group. A clone containing threonine at position 44 has also been isolated.
  • V HH sequences possess the following characteristics:
  • variable region polypeptides are derived from antibodies devoid of light chains, which contain no CHI domains.
  • the amino acid residue at position 11 is usually a leucine instead of serine.
  • the antigen-llamalgG fusion proteins were coupled to "DYNAL" beads and . incubated with a serum sample from an immunized llama. The antigen-bead complex was then spun out of solution, washed and incubated on ice in 0.1 M citric acid pH 2.3 to remove any antigen-reactive proteins bound during the serum incubation. The antigen- bead complex was again spun out of solution and the supernatant was neutralized in one half volume 0.1M Tris pH 9.5.
  • Llama constant region coding sequences were cloned using a series of oligonucleotide primers. RNA from llama PBL was isolated and cDNA prepared using random primers or oligo dT. Specific primers designed to amplify the constant domains of the antibody heavy chain were then used to PCR the different llama isotypes.
  • Llama constant region coding sequences were ligated with various human leukocyte antigen coding sequences for the expression of fusion proteins.
  • Table III shows a number of recombinant fusion proteins between llama constant regions and human lymphocyte surface antigens which retained the surface antigen binding activities.
  • the different hinge regions of llama IgG,, IgG, and IgG 3 allow for the design of different types of fusion proteins, depending on whether the naturally-occurring molecule is a monomer or dimer. Fusion proteins with llama constant regions are particularly useful as immunogens for immunizing llamas because they do not stimulate anti-constant region immune responses, thereby maximizing the antibody response against the non- immunoglobulin portion of the molecule.
  • a llama was immunized with a human CD40/llama IgG, fusion protein at 250 ⁇ g in PBS.
  • Pre-immune serum was collected prior to immunization.
  • Serum was also collected from the llama two weeks after the first immunization, followed by a second immunization. Then serum was again collected two weeks later.
  • an anti-CD40 IgG response was observed following the first immunization.
  • anti-CD40 activity was detected in both IgG, and IgG 2 fractions.
  • the CD40/Ig fusion protein was a potent immunogen in llama; and could be used as a tool for detecting serum reactivity of the host during the course of immunization.
  • a pair of complementary oligonucleotides was designed at the approximate midpoint of an antibody variable region coding sequence.
  • the DNA duplex formed by these annealed oligonucleotides was the starting point for constructing the rest of a V- region using overlapping single stranded primers which extended the length of the starting oligonucleotides by 18-24 bases at both ends. Since the DNA was very short at TABLE III
  • cycling times during the PCR were kept very short (10 seconds annealing and 20 seconds extension times for the first six reactions, and increasing to 30 second extension for the remaining reaction sets) and the molar amount of overlapping primer was kept low as well.
  • Stock solutions of each primer pair were prepared with concentrations ranging from 1 ⁇ M to 32 ⁇ M. These stocks were then diluted 1 :20 into the PCR mix and added to the existing reactions for each successive 10 cycle step. With each consecutive amplification step, the molar concentration of newly added primer was increased and the cycling times were adjusted for slightly longer extensions. In this way, the de novo construction of the desired coding sequence proceeded bidirectionally and was terminated by a final PCR that added unique restriction sites to each end of the DNA to facilitate cloning.
  • the 9.3V H molecule was resynthesized by diluting all primers in TE at a final concentration of 64 ⁇ M.
  • Primer sets were then prepared by mixing the complementary primer pair together in equimolar amounts as the starting pair. All other primers were combined in pairwise sets that overlapped the previous set in both the 5' and 3' direction. These primer pairs were then diluted so that the final concentration of primers ranged from 1 ⁇ M to 32 ⁇ M in TE.
  • the reaction for the first PCR cycling was prepared as follows: 12 ng primer pair H31 -47 (SEQ ID NO:28) and HAS47-31 (SEQ ID NO:31) were added to the reaction mix so that the final concentration was 0.6 ng/ ⁇ l, followed by the addition of 1 ⁇ l of a 1 ⁇ M stock of primer pair 2 containing primers H22-36 (SEQ ID NO:27) and H54-40 (SEQ ID NO:34) (final concentration was 50nM), and 17 ⁇ l PCR mixture containing ExTaq (TaKaRa Biomedicals, Siga, Japan) dilution buffer, dNTPs, distilled water and ExTaq DNA polymerase (1 unit) according to manufacturer's instructions.
  • ExTaq TaKaRa Biomedicals, Siga, Japan
  • the reaction was incubated for 10 cycles with a denaturation at 94°C for 30 seconds, annealing at 55°C for 10 seconds, and extension at 72°C for 20 seconds.
  • the first primer pair used was (LV1 and LI HAS) (SEQ ID NOS:29 and 32) or (LV2 and L2HAS) (SEQ ID NOS:30 and 33) and 1 ⁇ l of a 1 ⁇ M stock of primer pair H22-36 (SEQ ID NO:27) and L1H54-40 (SEQ ID NO:35) (or L2H54-40; SEQ ID NO:36) was added to the first reaction.
  • the second 10 cycle reaction proceeded under the same cycling conditions after addition of 19 ⁇ l PCR mix and 1 ⁇ l of primer pair H22-36 (SEQ ID NO:27) and H62-49 (SEQ ID NO:37) (2 ⁇ M stock).
  • a third 10 cycle PCR was performed after addition of 19 ⁇ l PCR mix and 1 ⁇ l of primer pair HI 3-27 (SEQ ID NO:26) and H70-57 (SEQ ID NO:38) (4 ⁇ M stock).
  • a fourth round of PCR was performed using the same conditions and 1 ⁇ l of primer pair H4-18 (SEQ ID NO:25) and H78-65 (SEQ ID NO:39) (8 ⁇ M stock).
  • the fifth round of PCR utilized identical conditions after addition of 19 ⁇ l PCR mix and 1 ⁇ l of primer pair HRS1-10 (SEQ ID NO: 24) and H84-73 (SEQ ID NO:40) (16 ⁇ M stock).
  • a 20 cycle reaction was performed under identical conditions after addition of 1 ⁇ l primer pair HRS 1-10 and H92-81 (SEQ ID NO:41) (32 ⁇ M stock).
  • Eight microliters of the PCR were subjected to agarose gel electrophoresis to check for amplification. The rest of the PCR was purified using PCR quick columns (QIAGEN) according to manufacturer's instructions and eluted in 50 ⁇ l TE.
  • New PCR were then set up beginning the whole series of reaction sets over in terms of increasing concentrations of primers and extension time.
  • To 18 ⁇ l PCR mix was added 1 ⁇ l PCR product eluate and 1 ⁇ l primer pair HRS 1-10 and HI 00-87 (SEQ ID NO:42) (1 ⁇ M).
  • Reactions were denatured for 1 minute at 94°C, followed by a new 10 cycle program using a 30 second denaturation step at 94°C, a 55°C annealing step for 10 seconds, and a 72°C extension step for 25 seconds.
  • the next PCR was performed under identical conditions, but using 19 ⁇ l PCR mix plus 1 ⁇ l primer pair HRS 1-10 and HI 04- 95 (SEQ ID NO:43) (2 ⁇ M).
  • the third round of PCR was performed using a 10 cycle program identical to the others except for an increase in the extension time at 72°C to 30 seconds, addition of 19 ⁇ l PCR mix and 1 ⁇ l primer pair HRS 1-10 and HI 11-100 (SEQ ID NO:44) (4 ⁇ M).
  • the fourth round of PCR was performed after addition of 19 ⁇ l PCR mix and 1 ⁇ l primer pair HRS1-10 and H3RS-104 (SEQ ID NO:46) (8 ⁇ M).
  • the primer pair used was HRS1-10 and 93VH3'-BAM (SEQ ID NO:45) (8 ⁇ M).
  • the 80 ⁇ l PCR reaction was PCR-Quick purified and eluted in 30 ⁇ l TE.
  • a final PCR reaction was set up using 0.5 ⁇ l of PCR eluate, 5 ⁇ l 10X ExTaq buffer, 4 ⁇ l 2.5 ⁇ M dNTPs, 40 ⁇ l dH2O, 1 ⁇ l primer pair HRS1-10 and H3RS-104 (or 93VH3-BAM).
  • the reaction conditions included a denaturation step at 94°C for 60 seconds, a 30 cycle program with denaturation at 94°C for 30 seconds, annealing at 55°C for 10 seconds, and extension at 72°C for 40 seconds, followed by a final extension at 72°C for 2 minutes, and a hold at 4°C until recovery.
  • the leader peptide was ultimately attached by repeating two PCR cycles using the subcloned PCR product above as template.
  • OKT3/9.3HYB SEQ ID NO:23
  • 93VH3-BAM or H3RS-104
  • Llamalized 9.3 V H molecules LV1 and LV2 were constructed as described for rederivation of the 9.3 V H , using the oligo pairs with alterations in the sequence at residues 37, 44, 45, and 47 in the mature V H ( Figure 18). These PCR products were digested with Hindlll and BamHI and subcloned into the pXD expression vector. The vector also contained a BamHI-Xbal fusion protein cassette encoding the llama IgG, constant region. Similar constructs were also made using the llama IgG, and IgG 3 constant domains. The fusion protein expression cassette was then transiently transfected into COS cells in serum free medium and the supernatants were harvested 48 hours later. Culture supernatants were concentrated ten fold using AMICON filtration units, and 100 ⁇ l incubated with 10 6 Jurkat T cells for 2 hours on ice. Cells were spun at
  • V H sequences from isolated mAbs were determined or identified using sequence data available from the Genbank DNA sequence database. These sequences were used to design short, overlapping oligonucleotides encoding short peptides of the V H domain. An accompanying PCR cycling method was developed which permitted de novo synthesis of the V H domain using the appropriate combinations of these oligonucleotides.
  • position 11 of any antibody may be changed to S, K, V, T or E; position 37 may be changed to Y, F, L, V, A or I; position 44 may be changed to E, D, K, T, Q, P, A or L; position 45 may be changed to R, L or I; and position 47 may be changed to F, G S, A, L, I, R, Y, M or W.
  • V H domains were subcloned as Hindlll+Xbal fragments into pUC19 for sequence analysis. Once the sequence changes were verified, the cassettes were shuttled into a mammalian expression vector encoding a leader peptide and an Ig fusion domain for expression studies. Culture supernatants from transient transfection experiments were then screened for expression of soluble Ig fusion protein and antigen binding capacity.
  • the aforementioned method was applied to an anti-CD28 antibody 9.3 using the overlapping oligonucleotides shown in Figure 18.
  • a pair of complementary oligonucleotides were designed at the approximate midpoint of the antibody V-region coding sequence.
  • the DNA duplex formed by these annealed oligonucleotides was the starting point for constructing the rest of the V-region using overlapping single stranded primers which extended the length of the starting oligonucleotides by 24 bases at both ends. Since the DNA was very short at this stage, cycling times during the PCR were kept very short and the molar amount of overlapping primer was kept low as well. With each consecutive amplification step, the molar concentration of newly added primer was increased and the cycling times were adjusted for slightly longer extensions.
  • Figure 19 shows a histogram display for Jurkat cells stained with llamalized version 2 of 9.3 antibody culture supernatant (lOx) as compared with second step FITC- conjugated anti-llama antibody alone. The results demonstrate that a llamalized mouse anti-CD28 antibody was able to bind to its target antigen on cells as a heavy chain-only antibody.
  • This section describes the generation of soluble recombinant fusion proteins containing the extracellular domains of CD3 ⁇ , e or ⁇ subunit.
  • Co-expression of CD3e with either CD3 ⁇ or CD3 ⁇ results in fusion proteins that interacted at high affinities with a number of anti-CD3 mAbs including the ones that bound only to native conformational epitopes.
  • this represents a method for producing native CD3e/ ⁇ or CD3e/ ⁇ heterodimers.
  • This system is suitable for defining the conditions required for CD3 heterodimer formation, providing the tools to identify potential ligands for CD3 heterodimers, screening for molecules potentially capable of interfering with the interaction between the CD3 complex and the TCR on T cells.
  • Peptides corresponding to the entire CDR3 regions of anti-CD3 and anti-CD298 mAbs were synthesized, and Tyr/Phe-Cysteine residues were added to both amino and carboxyl termini. Modifications of peptides were made by eliminating one amino acid of the CDR3 region at a time from the terminus. Peptide synthesis was carried out on solid phase by using Fmoc chemistry (HBTU/DIEA activation and TFA cleavage). Crude peptides were combined in a batch of 3-5 peptides and cyclized by air oxidation at pH 8.5. Crude cyclic peptides were purified on a reverse phase HPLC, lyophilized and characterized by analytical HPLC and mass spectroscopy.
  • BIACORE uses surface plasmon resonance (SPR) which occurs when surface plasmon waves are excited at a metal/liquid interface. Light is directed at, and reflected due to bimolecular interactions between analyte (in solution) and ligand (immobilized).
  • SPR surface plasmon resonance
  • CD3e ⁇ huIg, CD3eehuIg and CD28huIg were covalently immobilized on a carboxymethy dextran chip using EDC/NHS chemistry followed by blocking with ethanol amine.
  • Peptides were dissolved in HBS buffer at pH 7.2 with or without 1% DMSO, and were allowed to pass over these fusion protein-immobilized surfaces. Nonspecific binding was substrated by passing these peptides over a controlled surface prepared by immobilizing EDC/NHS alone followed by ethanolamine.
  • a cDNA encoding the extracellular domain of CD3e including the native start codon and the leader sequence was amplified from total RNA of anti-CD3 plus anti-CD28-activated T cells (72 hours) by RT-PCR using the following primers set: Forward primer, 5' GCG [CTC GAG] CCC ACC ATG CAG TCG GGC ACT CAC TGG (SEQ ID NO:55) and reverse primer 5 * GGC C[GG ATC C]GG ATC CAT CTC CAT GCA GTT CTC ACA (SEQ ID NO:56).
  • Nucleotides in parenthesis are the Xhol (CTC GAG) and BamHI (GGA TCC) sites designed for cloning.
  • PCR products were digested with Xhol and BamHI. The cut fragment was purified.
  • a CDM8 expression vector harboring a genomic fragment encoding human IgG, hinge-CH2-CH3 was cut with Xhol and BamHI. Ligation of the cut vector and PCR product placed the cDNA encoding CD3e extracellular domain in front of and in-frame with the genomic fragment encoding IgG, hinge-CH2-CH3.
  • the CMV promoter in this vector controlled expression of CD3-Ig fusion protein in mammalian cells.
  • a cDNA fragment encoding human IgG, hinge-CH2-CH3 was used as a fusion partner for the CD3 ⁇ -(phCD3 ⁇ 0Ig) and CD3 ⁇ -Ig (phCD3 ⁇ -Ig) constructs instead of a genomic fragment.
  • This fragment was cloned into the BamHI and Xbal sites of the pD18 expression vector, also containing a CMV promoter for protein expression.
  • Fragments of cDNA encoding the extracellular domains of CD3 ⁇ and CD3 ⁇ including the native start codons and leader sequences were isolated by RT-PCR from the same total RNA described above.
  • the primers used are as follows: CD3 ⁇ forward, 5' GCG ATA [AAG CTT] GCC ACC ATG GAA CAT AGC
  • CD3 ⁇ forward 5' GCG ATA [AAG CTT] GCC ACC ATG GAA CAG GGG
  • fusion proteins were usually expressed as dimers.
  • Transient expression in COS-7 cells was used to generate different CD3-Ig fusion proteins.
  • the plasmids phCD3e-Ig, and phCD3 ⁇ -Ig were transfected individually or in combinations of phCD3e-Ig + phCD3 ⁇ -Ig and phCD3e-Ig + phCD3 ⁇ -Ig into COS-7 by the DEAE-dextran method.
  • Transfected cells were maintained in medium supplemented with a low concentration, 0.5%, FBS and insulin. Spent media were collected in three- day intervals up to three weeks post transfection. Fusion proteins were then purified from spent media by protein A-Sepharose chromatography. Fusion protein expression was confirmed by SDS-PAGE and ELISA using anti-CD3 mAb.
  • CD3-Ig fusion proteins were characterized by ELISA using a number of anti-CD3 mAbs including G19-4, OKT3, BC3, and 64.1 Anti-CD3 mAbs were immobilized to capture CD3-Ig.
  • An antibody-horseradish peroxidase conjugate specific against human IgG hinge-CD2-CD3 was used to detect the binding of CD3-Ig to anti-CD3 mAbs.
  • no binding of CD3 ⁇ -Ig to G19-4 was detectable even at lOO ⁇ g/ml of the fusion protein ( Figure 20).
  • CD3e-Ig and CD3 ⁇ -Ig did not reach saturation even at concentrations as high as 100 ⁇ g/ml.
  • CD3e ⁇ -Ig and CD3e ⁇ -Ig heterodimers bound to G19-4 at much higher affinities ( Figure 20).
  • CD3e ⁇ -Ig and CD3e ⁇ -Ig saturated at 4 ⁇ g/ml and 20 ⁇ g/ml in this assay, respectively.
  • OKT3, BC3, and 64.1 anti-CD3 mAbs also showed much better binding to the CD3e ⁇ -Ig heterodimer than the CD3e ⁇ -Ig.
  • CD3e-Ig co-expression of either CD3e-Ig with CD3 ⁇ -Ig, or to some extent CD3e-Ig with CD3 ⁇ -Ig, in COS cells resulted in heterodimeric CD3-Ig fusion proteins that were folded to their native conformation as defined by anti-CD3 mAbs.
  • CD3e ⁇ and CD3e ⁇ heterodimers may be used in detecting anti-CD3 antibody activity in antibody- coated plates or beads, as well as in screening of small molecules or peptides that bind specifically to CD3.
  • ⁇ M* Binding was at micromolar level or below.
  • the CDR3 region of an anti-CD3 mAb and an anti-CD28 mAb was determined, and peptides corresponding to this region were synthesized. Cysteine residues were added to the ends of the peptides, followed by an aromatic residue tyrosine or tryptophan (Greene, WO95/34312). Upon air oxidation, the peptides were cyclized due to the formation of a disulphide linkage between the cysteines. As a result, the aromatic residues were in the exocyclic portion of the cyclized CDR peptides. The binding affinities of the various peptides to their target antigens in the form of Ig fusion proteins were measured by BIACORE.
  • Table V shows that a number of peptides exhibited high binding affinities for CD3e ⁇ -Ig, whereas several peptides exhibited binding affinities for CD28-Ig.
  • small CDR peptides may be used in lymphocyte activation in place of antibodies.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US1999/003309 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation WO1999042077A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
BR9907950-0A BR9907950A (pt) 1998-02-19 1999-02-18 Composições e processos para regulagem deativação de linfócitos
JP2000532094A JP2003525016A (ja) 1998-02-19 1999-02-18 リンパ球活性化を調節するための組成物および方法
KR1020007009178A KR20010034512A (ko) 1998-02-19 1999-02-18 림프구 활성화 조절을 위한 조성물 및 그 방법
CA002321199A CA2321199A1 (en) 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation
NZ506453A NZ506453A (en) 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation
AU32952/99A AU3295299A (en) 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation
EP19990934239 EP1469883A2 (en) 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation
IL13796399A IL137963A0 (en) 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation
NO20004095A NO20004095L (no) 1998-02-19 2000-08-16 Blandinger og fremgangsmÕter for regulering av lymfocyttaktivering
HK02102629.3A HK1041210A1 (zh) 1998-02-19 2002-04-09 用於調節淋巴細胞活化的組合物及方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US7527498P 1998-02-19 1998-02-19
US60/075,274 1998-02-19
US10868398P 1998-11-16 1998-11-16
US60/108,683 1998-11-16

Publications (2)

Publication Number Publication Date
WO1999042077A2 true WO1999042077A2 (en) 1999-08-26
WO1999042077A3 WO1999042077A3 (en) 2004-05-27

Family

ID=26756645

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/003309 WO1999042077A2 (en) 1998-02-19 1999-02-18 Compositions and methods for regulating lymphocyte activation

Country Status (14)

Country Link
US (3) US20020155604A1 (xx)
EP (1) EP1469883A2 (xx)
JP (1) JP2003525016A (xx)
KR (1) KR20010034512A (xx)
CN (1) CN1316910A (xx)
AU (1) AU3295299A (xx)
BR (1) BR9907950A (xx)
CA (1) CA2321199A1 (xx)
HK (1) HK1041210A1 (xx)
ID (1) ID26964A (xx)
IL (1) IL137963A0 (xx)
NO (1) NO20004095L (xx)
NZ (1) NZ506453A (xx)
WO (1) WO1999042077A2 (xx)

Cited By (107)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001090190A2 (en) * 2000-05-26 2001-11-29 National Research Council Of Canada Single-domain antigen-binding antibody fragments derived from llama antibodies
WO2002085945A2 (en) * 2001-04-24 2002-10-31 Erasmus Universiteit Rotterdam Vhh single heavy chain antibody and a method for its preparation in a mammal
WO2003077658A1 (en) * 2002-03-07 2003-09-25 Valeocyte Therapies Llc Re-activated t-cells for adoptive immunotherapy
WO2003035694A3 (en) * 2001-10-24 2003-10-02 Vlaams Interuniv Inst Biotech Functional heavy chain antibodies, fragments thereof, library thereof and methods of production thereof
WO2003030835A3 (en) * 2001-10-12 2003-10-09 Schering Corp Use of bispecific antibodies to regulate immune responses
WO2005075515A2 (en) * 2004-02-06 2005-08-18 Unilever N.V. Immunoglobulins and method for their modification
JP2007516213A (ja) * 2003-08-08 2007-06-21 イミューノメディクス、インコーポレイテッド 腫瘍および罹患細胞のアポトーシスを誘発するための二重特異性抗体
US7371849B2 (en) * 2001-09-13 2008-05-13 Institute For Antibodies Co., Ltd. Methods of constructing camel antibody libraries
WO2010010119A1 (en) 2008-07-22 2010-01-28 Ablynx Nv Amino acid sequences directed against multitarget scavenger receptors and polypeptides
US7754209B2 (en) 2003-07-26 2010-07-13 Trubion Pharmaceuticals Binding constructs and methods for use thereof
US7754208B2 (en) 2001-01-17 2010-07-13 Trubion Pharmaceuticals, Inc. Binding domain-immunoglobulin fusion proteins
US7829084B2 (en) 2001-01-17 2010-11-09 Trubion Pharmaceuticals, Inc. Binding constructs and methods for use thereof
US7897729B2 (en) 2001-03-09 2011-03-01 Iterative Therapeutics, Inc. Polymeric immunoglobulin fusion proteins that target low affinity FcγReceptors
US7943129B2 (en) * 2000-05-26 2011-05-17 National Research Council Of Canada Single-domain brain-targeting antibody fragments derived from llama antibodies
WO2011064382A1 (en) 2009-11-30 2011-06-03 Ablynx N.V. Improved amino acid sequences directed against human respiratory syncytial virus (hrsv) and polypeptides comprising the same for the prevention and/or treatment of respiratory tract infections
WO2011073180A1 (en) 2009-12-14 2011-06-23 Ablynx N.V. Single variable domain antibodies against ox40l, constructs and therapeutic use
WO2011083140A1 (en) 2010-01-08 2011-07-14 Ablynx Nv Immunoglobulin single variable domain directed against human cxcr4
WO2011098520A1 (en) 2010-02-10 2011-08-18 Novartis Ag Agonist dr5 binding polypeptides
WO2011098518A2 (en) 2010-02-11 2011-08-18 Ablynx Nv Delivery of immunoglobulin variable domains and constructs thereof
EP2365000A2 (en) 2005-05-18 2011-09-14 Ablynx N.V. Improved nanobodiesTM against tumor necrosis factor-alpha
WO2011117423A1 (en) 2010-03-26 2011-09-29 Ablynx N.V. Immunoglobulin single variable domains directed against cxcr7
WO2011144749A1 (en) 2010-05-20 2011-11-24 Ablynx Nv Biological materials related to her3
WO2011161263A1 (en) 2010-06-25 2011-12-29 Ablynx Nv Pharmaceutical compositions for cutaneous administration
WO2012042026A1 (en) 2010-09-30 2012-04-05 Ablynx Nv Biological materials related to c-met
US8163289B2 (en) 2001-03-09 2012-04-24 Iterative Therapeutics, Inc. Methods and compositions involving polymeric immunoglobulin fusion proteins
EP2444424A1 (en) 2005-05-20 2012-04-25 Ablynx N.V. Improved nanobodies TM for the treatment of aggregation-mediated disorders
WO2012062713A1 (en) 2010-11-08 2012-05-18 Novartis Ag Cxcr2 binding polypeptides
US8188237B2 (en) 2001-01-17 2012-05-29 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
WO2012109624A2 (en) 2011-02-11 2012-08-16 Zyngenia, Inc. Monovalent and multivalent multispecific complexes and uses thereof
WO2012130874A1 (en) 2011-03-28 2012-10-04 Ablynx Nv Bispecific anti-cxcr7 immunoglobulin single variable domains
EP2514767A1 (en) 2006-12-19 2012-10-24 Ablynx N.V. Amino acid sequences directed against a metalloproteinase from the ADAM family and polypeptides comprising the same for the treatment of ADAM-related diseases and disorders
WO2012156219A1 (en) 2011-05-05 2012-11-22 Ablynx Nv Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same
US8333966B2 (en) 2008-04-11 2012-12-18 Emergent Product Development Seattle, Llc CD37 immunotherapeutics and uses thereof
WO2012175740A1 (en) 2011-06-23 2012-12-27 Ablynx Nv Immunoglobulin single variable domains directed against ige
EP2557090A2 (en) 2006-12-19 2013-02-13 Ablynx N.V. Amino acid sequences directed against GPCRs and polypeptides comprising the same for the treatment of GPCR-related diseases and disorders
WO2013036130A1 (en) 2011-09-09 2013-03-14 Universiteit Utrecht Holding B.V. Broadly neutralizing vhh against hiv-1
US8409577B2 (en) 2006-06-12 2013-04-02 Emergent Product Development Seattle, Llc Single chain multivalent binding proteins with effector function
WO2013045707A2 (en) 2011-09-30 2013-04-04 Ablynx Nv Biological materials related to c-met
WO2013168108A2 (en) 2012-05-09 2013-11-14 Novartis Ag Chemokine receptor binding polypeptides
US8703131B2 (en) 2005-05-21 2014-04-22 Ablynx N.V. Nanobodies against tumor necrosis factor-alpha
WO2014087010A1 (en) 2012-12-07 2014-06-12 Ablynx N.V. IMPROVED POLYPEPTIDES DIRECTED AGAINST IgE
US8975382B2 (en) 2007-11-27 2015-03-10 Ablynx N.V. Amino acid sequences directed against HER2 and polypeptides comprising the same for the treatment of cancers and/or tumors
EP2947097A1 (en) 2008-04-07 2015-11-25 Ablynx N.V. Amino acid sequences directed against the Notch pathways and uses thereof
WO2015193452A1 (en) 2014-06-18 2015-12-23 Ablynx Nv Kv1.3 binding immunoglobulins
WO2016097313A1 (en) 2014-12-19 2016-06-23 Ablynx N.V. Cysteine linked nanobody dimers
WO2016156570A1 (en) 2015-04-02 2016-10-06 Ablynx N.V. Bispecific cxcr4-cd-4 polypeptides with potent anti-hiv activity
WO2016164305A1 (en) 2015-04-06 2016-10-13 Subdomain, Llc De novo binding domain containing polypeptides and uses thereof
WO2016180982A1 (en) 2015-05-13 2016-11-17 Ablynx N.V. T cell recruiting polypeptides based on cd3 reactivity
WO2016180969A1 (en) 2015-05-13 2016-11-17 Ablynx N.V. T cell recruiting polypeptides based on tcr alpha/beta reactivity
EP3205670A1 (en) 2009-06-05 2017-08-16 Ablynx N.V. Improved amino acid sequences directed against human respiratory syncytial virus (hrsv) and polypeptides comprising the same for the prevention and/or treatment of respiratory tract infections
WO2017167714A1 (en) 2016-03-30 2017-10-05 F. Hoffmann-La Roche Ag B-cell cultivation method
WO2017191108A1 (en) 2016-05-02 2017-11-09 Ablynx Nv Treatment of rsv infection
EP3266798A2 (en) 2015-11-12 2018-01-10 Ablynx NV Improved tnf binders
WO2018007442A1 (en) 2016-07-06 2018-01-11 Ablynx N.V. Treatment of il-6r related diseases
WO2018029182A1 (en) 2016-08-08 2018-02-15 Ablynx N.V. Il-6r single variable domain antibodies for treatment of il-6r related diseases
WO2018050833A1 (en) 2016-09-15 2018-03-22 Ablynx Nv Immunoglobulin single variable domains directed against macrophage migration inhibitory factor
EP3311837A1 (en) 2011-09-23 2018-04-25 Ablynx NV Prolonged inhibition of interleukin-6 mediated signaling
WO2018091606A1 (en) 2016-11-16 2018-05-24 Ablynx Nv T cell recruiting polypeptides capable of binding cd123 and tcr alpha/beta
WO2018099968A1 (en) 2016-11-29 2018-06-07 Ablynx N.V. Treatment of infection by respiratory syncytial virus (rsv)
US9993550B2 (en) 1999-05-07 2018-06-12 Genentech, Inc. Treatment of pemphigus
WO2018122147A1 (en) 2017-01-02 2018-07-05 F. Hoffmann-La Roche Ag B-cell cultivation method
US10112988B2 (en) 2012-01-09 2018-10-30 Icb International, Inc. Methods of assessing amyloid-beta peptides in the central nervous system by blood-brain barrier permeable peptide compositions comprising a vab domain of a camelid single domain heavy chain antibody against an anti-amyloid-beta peptide
US10112987B2 (en) 2012-01-09 2018-10-30 Icb International, Inc. Blood-brain barrier permeable peptide compositions comprising a vab domain of a camelid single domain heavy chain antibody against an amyloid-beta peptide
WO2018206734A1 (en) 2017-05-11 2018-11-15 Vib Vzw Glycosylation of variable immunoglobulin domains
WO2018210896A1 (en) 2017-05-19 2018-11-22 F. Hoffmann-La Roche Ag Method for the production of thymocyte supernatant
US10143748B2 (en) 2005-07-25 2018-12-04 Aptevo Research And Development Llc B-cell reduction using CD37-specific and CD20-specific binding molecules
WO2018220234A1 (en) 2017-06-02 2018-12-06 Merck Patent Gmbh Adamts binding immunoglobulins
WO2018220235A1 (en) 2017-06-02 2018-12-06 Merck Patent Gmbh Mmp13 binding immunoglobulins
WO2018220236A1 (en) 2017-06-02 2018-12-06 Merck Patent Gmbh Polypeptides binding adamts5, mmp13 and aggrecan
WO2018220225A1 (en) 2017-06-02 2018-12-06 Ablynx Nv Aggrecan binding immunoglobulins
GB201901608D0 (en) 2019-02-06 2019-03-27 Vib Vzw Vaccine adjuvant conjugates
EP3461844A2 (en) 2009-04-10 2019-04-03 Ablynx N.V. Improved amino acid sequences directed against il-6r and polypeptides comprising the same for the treatment of il-6r related diseases and disorders
WO2019099433A2 (en) 2017-11-14 2019-05-23 Arcellx, Inc. D-domain containing polypeptides and uses thereof
WO2019105864A1 (en) 2017-11-30 2019-06-06 F. Hoffmann-La Roche Ag B-cell cultivation method
WO2019151865A1 (en) 2018-02-05 2019-08-08 Stichting Vu Inverse agonistic anti-us28 antibodies
WO2019156566A1 (en) 2018-02-12 2019-08-15 Umc Utrecht Holding B.V. Bispecific molecules comprising gamma-delta tcr and t-cell or nk cell binding domain
WO2019162521A1 (en) 2018-02-26 2019-08-29 Ablynx Nv Improved nucleotide sequences encoding peptide linkers
WO2019226050A2 (en) 2018-05-24 2019-11-28 Wageningen Universiteit Novel viral anti-infective reagents
US10512739B2 (en) 2014-10-10 2019-12-24 Vectura Gmbh Inhalation device for use in aerosol therapy of respiratory diseases
US10561805B2 (en) 2014-10-10 2020-02-18 Ablynx N.V. Methods of treating RSV infections
EP3636657A1 (en) 2018-10-08 2020-04-15 Ablynx N.V. Chromatography-free antibody purification method
WO2020080941A1 (en) 2018-10-16 2020-04-23 Umc Utrecht Holding B.V. Anti- low-density lipoprotein receptor-related protein 5/6 antibodies
WO2020130838A2 (en) 2018-12-21 2020-06-25 Qvq Holding B.V. Antibodies for preventing or treating candidiasis
WO2020204714A1 (en) 2019-04-02 2020-10-08 Immunetune B.V. Immune-stimulatory compositions and use thereof
WO2020245663A1 (en) 2019-06-01 2020-12-10 Institut Pasteur Nanobody-based ns1 assay for the specific diagnosis of acute zika virus infection
WO2021025556A1 (en) 2019-08-05 2021-02-11 Stichting Vu Identification and elimination of hcmv-infected cells
US10946104B2 (en) 2012-01-13 2021-03-16 Apo-Tb.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
US11098115B2 (en) 2011-09-29 2021-08-24 Apo-T B.V. Multi-specific binding molecules targeting aberrant cells
EP3932945A1 (en) 2015-11-27 2022-01-05 Ablynx NV Polypeptides inhibiting cd40l
US11352426B2 (en) 2015-09-21 2022-06-07 Aptevo Research And Development Llc CD3 binding polypeptides
WO2022129637A1 (en) 2020-12-18 2022-06-23 Ablynx Nv T cell recruiting polypeptides based on tcr alpha/beta reactivity
WO2022178255A2 (en) 2021-02-19 2022-08-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Single domain antibodies that neutralize sars-cov-2
WO2022216157A1 (en) 2021-04-09 2022-10-13 Stichting Radboud Universiteit Off the shelf proximity biotinylation enzyme
WO2022258606A1 (en) 2021-06-07 2022-12-15 Gadeta B.V. Delta T-cell or Gamma T-cell receptor chains or parts thereof that mediate an anti-tumour or anti-infective response
US11560420B2 (en) 2013-05-21 2023-01-24 Roche Diagnostics Operations, Inc. Method for producing antibodies using ovine B-cells and uses thereof
WO2023014222A1 (en) 2021-08-03 2023-02-09 Wageningen Universiteit Argonaute-based nucleic acid detection system
US11667723B2 (en) 2020-08-17 2023-06-06 Utc Therapeutics (Shanghai) Co., Ltd. Lymphocytes-antigen presenting cells co-stimulators and uses thereof
US11708404B2 (en) 2014-05-16 2023-07-25 Ablynx N.V. Immunoglobulin variable domains
WO2023227594A1 (en) 2022-05-24 2023-11-30 Gadeta Bv Novel deltat-cell receptor chains, gammat-cell receptor chains, or parts thereof
WO2024017915A1 (en) 2022-07-18 2024-01-25 Ablynx N.V. Cx3cr1-binding compounds, uses thereof and related methods
WO2024023271A1 (en) 2022-07-27 2024-02-01 Ablynx Nv Polypeptides binding to a specific epitope of the neonatal fc receptor
WO2024083843A1 (en) 2022-10-18 2024-04-25 Confo Therapeutics N.V. Amino acid sequences directed against the melanocortin 4 receptor and polypeptides comprising the same for the treatment of mc4r-related diseases and disorders
WO2024096735A1 (en) 2022-10-31 2024-05-10 Stichting Amsterdam UMC Single domain anti-cd169 antibodies
WO2024101989A1 (en) 2022-11-08 2024-05-16 Stichting Amsterdam UMC Activation inducible antigen receptors for adoptive immunotherapy
WO2024133301A1 (en) 2022-12-19 2024-06-27 Umc Utrecht Holding B.V. Btn2a1 binding peptide
WO2024133935A1 (en) 2022-12-23 2024-06-27 Ablynx Nv Protein-based conjugation carriers
WO2024170756A1 (en) 2023-02-17 2024-08-22 Ablynx N.V. Polypeptides binding to the neonatal fc receptor

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002048193A2 (en) * 2000-12-13 2002-06-20 Unilever N.V. Camelidae antibody arrays
US20040058445A1 (en) * 2001-04-26 2004-03-25 Ledbetter Jeffrey Alan Activation of tumor-reactive lymphocytes via antibodies or genes recognizing CD3 or 4-1BB
US20030219436A1 (en) * 2002-03-15 2003-11-27 Ledbetter Jeffrey A. Compositions and methods to regulate an immune response using CD83 gene expressed in tumors and using soluble CD83-Ig fusion protein
US20090217404A1 (en) * 2002-09-27 2009-08-27 Lowe Scott W Cell-based RNA interference and related methods and compositions
US20090186839A1 (en) * 2003-02-17 2009-07-23 Cold Spring Harbor Laboratory Model for studying the role of genes in chemoresistance
WO2004074445A2 (en) * 2003-02-17 2004-09-02 Cold Spring Harbor Laboratory Model for studying the role of genes in tumor resistance to chemotherapy
WO2004104185A1 (en) * 2003-05-08 2004-12-02 Xcyte Therapies, Inc. Generation and isolation of antigen-specific t cells
EP1663308A1 (en) * 2003-09-22 2006-06-07 Xcyte Therapies, Inc Compositions and methods to accelerate hematologic recovery
WO2005049085A1 (en) * 2003-11-18 2005-06-02 Valeocyte Therapies Llc Use of soluble complexes to facilitate cell activation
ATE540973T1 (de) 2004-07-22 2012-01-15 Five Prime Therapeutics Inc Zusammensetzungen und verfahren zur verwendung von mgd-cdf zur krankheitsbehandlung
FR2879605B1 (fr) 2004-12-16 2008-10-17 Centre Nat Rech Scient Cnrse Production de formats d'anticorps et applications immunologiques de ces formats
US8137907B2 (en) * 2005-01-03 2012-03-20 Cold Spring Harbor Laboratory Orthotopic and genetically tractable non-human animal model for liver cancer and the uses thereof
US8444973B2 (en) 2005-02-15 2013-05-21 Duke University Anti-CD19 antibodies and uses in B cell disorders
AU2006214121B9 (en) * 2005-02-15 2013-02-14 Duke University Anti-CD19 antibodies and uses in oncology
JP5047947B2 (ja) * 2005-05-05 2012-10-10 デューク ユニバーシティ 自己免疫疾患のための抗ｃｄ１９抗体治療
US20070044164A1 (en) 2005-05-31 2007-02-22 Cold Spring Harbor Laboratory Methods for producing microRNAs
EP1904101A4 (en) * 2005-06-08 2011-06-15 Univ Duke ANTI-CD19 ANTIBODY THERAPY FOR TRANSPLANTATION
EP2066349B1 (en) 2006-09-08 2012-03-28 MedImmune, LLC Humanized anti-cd19 antibodies and their use in treatment of tumors, transplantation and autoimmune diseases
EP2344540B1 (en) 2008-10-02 2017-11-29 Aptevo Research and Development LLC Cd86 antagonist multi-target binding proteins
AU2010319323B2 (en) * 2009-11-14 2015-01-15 Cardiovax, Llc Immunomodulatory methods and systems for treatment and/or prevention of atherosclerosis
JP6568207B2 (ja) * 2014-05-19 2019-08-28 エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ ヒツジｂ細胞を用いて抗体を産生するための方法およびその使用
AU2015283704A1 (en) 2014-07-01 2016-12-15 Pfizer Inc. Bispecific heterodimeric diabodies and uses thereof
AU2016344745A1 (en) * 2015-10-28 2018-05-17 Life Technologies As Selective expansion of different subpopulations of T cells by the alteration of cell surfacing signals and signal ratio
WO2017161051A1 (en) * 2016-03-15 2017-09-21 Nexgenia, Inc. Cell-surface molecule binding stimuli-responsive polymer compositions and methods cross-reference to related applications
CN108264561B (zh) * 2016-12-30 2021-09-10 惠和生物技术(上海)有限公司 一种结合cd19、cd3和t细胞负共刺激分子的三功能分子及其应用
JP2023538891A (ja) 2020-08-19 2023-09-12 ゼンコア インコーポレイテッド 抗ｃｄ２８組成物
WO2023237541A1 (en) 2022-06-07 2023-12-14 Gadeta B.V. Delta t-cell or gamma t-cell receptor chains or parts thereof that mediate an anti-tumour or anti-infective response
WO2024013401A1 (en) 2022-07-15 2024-01-18 Gadeta B.V. Novel method for identifying gamma t-cell (or delta t-cell) receptor chains (or gammadelta t-cell receptors) or fragments thereof that mediate an anti-tumour or an anti-infective response

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991008482A1 (en) * 1989-12-01 1991-06-13 Unilever Plc Antibody variable domain conjugates
EP0584421A1 (en) * 1992-08-21 1994-03-02 Cécile Casterman Immunoglobulins devoid of light chains
US5573920A (en) * 1991-04-26 1996-11-12 Surface Active Limited Antibodies, and methods for their use
US5601819A (en) * 1988-08-11 1997-02-11 The General Hospital Corporation Bispecific antibodies for selective immune regulation and for selective immune cell binding

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5601819A (en) * 1988-08-11 1997-02-11 The General Hospital Corporation Bispecific antibodies for selective immune regulation and for selective immune cell binding
WO1991008482A1 (en) * 1989-12-01 1991-06-13 Unilever Plc Antibody variable domain conjugates
US5573920A (en) * 1991-04-26 1996-11-12 Surface Active Limited Antibodies, and methods for their use
EP0584421A1 (en) * 1992-08-21 1994-03-02 Cécile Casterman Immunoglobulins devoid of light chains

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WILLIAM E. PAUL: 'FUNDAMENTAL IMMUNOLOGY', teil 3 EDIT 1993, RAVEN PRESS, NEW YORK Artikel WEISS ARTHUR: 'T Lymphocyte Activation', pages 467 - 529, XP002918969 *

Cited By (161)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9993550B2 (en) 1999-05-07 2018-06-12 Genentech, Inc. Treatment of pemphigus
US7943129B2 (en) * 2000-05-26 2011-05-17 National Research Council Of Canada Single-domain brain-targeting antibody fragments derived from llama antibodies
WO2001090190A3 (en) * 2000-05-26 2002-08-01 Ca Nat Research Council Single-domain antigen-binding antibody fragments derived from llama antibodies
WO2001090190A2 (en) * 2000-05-26 2001-11-29 National Research Council Of Canada Single-domain antigen-binding antibody fragments derived from llama antibodies
US8715659B2 (en) 2000-05-26 2014-05-06 National Research Council Of Canada Single domain brain-targeting antibody fragments derived from llama antibodies
US8383107B2 (en) 2000-05-26 2013-02-26 National Research Council Of Canada Single domain brain-targeting antibody fragments derived from llama antibodies
US8257705B2 (en) 2000-05-26 2012-09-04 National Research Council Of Canada Single-domain antigen-binding antibody fragments derived from llama antibodies
US8197810B2 (en) 2001-01-17 2012-06-12 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
US9005612B2 (en) 2001-01-17 2015-04-14 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
US8188237B2 (en) 2001-01-17 2012-05-29 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
US8853366B2 (en) 2001-01-17 2014-10-07 Emergent Product Development Seattle, Llc Binding domain-immunoglobulin fusion proteins
US7829084B2 (en) 2001-01-17 2010-11-09 Trubion Pharmaceuticals, Inc. Binding constructs and methods for use thereof
US7754208B2 (en) 2001-01-17 2010-07-13 Trubion Pharmaceuticals, Inc. Binding domain-immunoglobulin fusion proteins
US8163289B2 (en) 2001-03-09 2012-04-24 Iterative Therapeutics, Inc. Methods and compositions involving polymeric immunoglobulin fusion proteins
US9127063B2 (en) 2001-03-09 2015-09-08 Iterative Therapeutics, Inc. Nucleic acids related to fusion proteins
US8986698B2 (en) 2001-03-09 2015-03-24 Iterative Therapeutics, Inc. Method of using fusion proteins
US7897729B2 (en) 2001-03-09 2011-03-01 Iterative Therapeutics, Inc. Polymeric immunoglobulin fusion proteins that target low affinity FcγReceptors
WO2002085945A2 (en) * 2001-04-24 2002-10-31 Erasmus Universiteit Rotterdam Vhh single heavy chain antibody and a method for its preparation in a mammal
WO2002085945A3 (en) * 2001-04-24 2003-03-06 Univ Erasmus Vhh single heavy chain antibody and a method for its preparation in a mammal
WO2002085944A3 (en) * 2001-04-24 2004-03-04 Univ Erasmus Single chain camelid vhh antibodies, method for their production in a mammal and their uses
CN1520424B (zh) * 2001-04-24 2012-09-05 鹿特丹伊拉兹马斯大学 免疫球蛋白2
WO2002085944A2 (en) * 2001-04-24 2002-10-31 Erasmus Universiteit Rotterdam Single chain camelid vhh antibodies, method for their production in a mammal and their uses
AU2002256866B2 (en) * 2001-04-24 2007-06-21 Erasmus Universiteit Rotterdam Single chain camelid VHH antibodies, method for their production in a mammal, and their uses
US8502014B2 (en) 2001-04-24 2013-08-06 Erasmus Universiteit Rotterdam Method for the production of a single heavy chain antibody
JP2010013479A (ja) * 2001-04-24 2010-01-21 Erasmus Univ Rotterdam 免疫グロブリン２
US8507748B2 (en) 2001-04-24 2013-08-13 Erasmus Universiteit Rotterdam Method for the production of a single heavy chain antibody
US7371849B2 (en) * 2001-09-13 2008-05-13 Institute For Antibodies Co., Ltd. Methods of constructing camel antibody libraries
US8236309B2 (en) 2001-10-12 2012-08-07 Schering Corporation Use of bispecific antibodies to regulate immune responses
WO2003030835A3 (en) * 2001-10-12 2003-10-09 Schering Corp Use of bispecific antibodies to regulate immune responses
US9156905B2 (en) 2001-10-24 2015-10-13 Vib Vzw Functional heavy chain antibodies, fragments thereof, library thereof and methods of production thereof
US8097251B2 (en) 2001-10-24 2012-01-17 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Functional heavy chain antibodies, fragments thereof, library thereof and methods of production thereof
WO2003035694A3 (en) * 2001-10-24 2003-10-02 Vlaams Interuniv Inst Biotech Functional heavy chain antibodies, fragments thereof, library thereof and methods of production thereof
EP1693384A3 (en) * 2001-10-24 2006-11-08 Vlaams Interuniversitair Instituut voor Biotechnologie vzw. Functional immunoglobulins against human serum albumin, fragments thereof, library thereof and methods of production thereof
WO2003077658A1 (en) * 2002-03-07 2003-09-25 Valeocyte Therapies Llc Re-activated t-cells for adoptive immunotherapy
US7754209B2 (en) 2003-07-26 2010-07-13 Trubion Pharmaceuticals Binding constructs and methods for use thereof
JP4818917B2 (ja) * 2003-08-08 2011-11-16 イミューノメディクス、インコーポレイテッド 腫瘍および罹患細胞のアポトーシスを誘発するための二重特異性抗体
JP2007516213A (ja) * 2003-08-08 2007-06-21 イミューノメディクス、インコーポレイテッド 腫瘍および罹患細胞のアポトーシスを誘発するための二重特異性抗体
WO2005075515A3 (en) * 2004-02-06 2005-11-24 Unilever Nv Immunoglobulins and method for their modification
WO2005075515A2 (en) * 2004-02-06 2005-08-18 Unilever N.V. Immunoglobulins and method for their modification
US11472871B2 (en) 2005-05-18 2022-10-18 Ablynx N.V. Nanobodies against tumor necrosis factor-alpha
EP2479191A2 (en) 2005-05-18 2012-07-25 Ablynx N.V. Improved nanobodiesTM against tumor necrosis factor-alpha
EP3613767A1 (en) 2005-05-18 2020-02-26 Ablynx N.V. Improved nanobodiestm against tumor cecrosis factor-alpha
US8188223B2 (en) 2005-05-18 2012-05-29 Ablynx N.V. Serum albumin binding proteins
EP2365000A2 (en) 2005-05-18 2011-09-14 Ablynx N.V. Improved nanobodiesTM against tumor necrosis factor-alpha
US9067991B2 (en) 2005-05-18 2015-06-30 Ablynx N.V. Nanobodies against tumor necrosis factor-alpha
EP2949668A1 (en) 2005-05-18 2015-12-02 Ablynx N.V. Improved nanobodiestm against tumor necrosis factor-alpha
EP2444424A1 (en) 2005-05-20 2012-04-25 Ablynx N.V. Improved nanobodies TM for the treatment of aggregation-mediated disorders
EP3415535A1 (en) 2005-05-20 2018-12-19 Ablynx N.V. Improved nanobodies tm for the treatment of aggregation-mediated disorders
EP3243839A1 (en) 2005-05-20 2017-11-15 Ablynx N.V. Improved nanobodies tm for the treatment of aggregation-mediated disorders
US8703131B2 (en) 2005-05-21 2014-04-22 Ablynx N.V. Nanobodies against tumor necrosis factor-alpha
US10307481B2 (en) 2005-07-25 2019-06-04 Aptevo Research And Development Llc CD37 immunotherapeutics and uses thereof
US10143748B2 (en) 2005-07-25 2018-12-04 Aptevo Research And Development Llc B-cell reduction using CD37-specific and CD20-specific binding molecules
US8409577B2 (en) 2006-06-12 2013-04-02 Emergent Product Development Seattle, Llc Single chain multivalent binding proteins with effector function
EP2514767A1 (en) 2006-12-19 2012-10-24 Ablynx N.V. Amino acid sequences directed against a metalloproteinase from the ADAM family and polypeptides comprising the same for the treatment of ADAM-related diseases and disorders
EP2557090A2 (en) 2006-12-19 2013-02-13 Ablynx N.V. Amino acid sequences directed against GPCRs and polypeptides comprising the same for the treatment of GPCR-related diseases and disorders
US9969805B2 (en) 2007-11-27 2018-05-15 Ablynx N.V. Amino acid sequences directed against HER2 and polypeptides comprising the same for the treatment of cancers and/or tumors
US8975382B2 (en) 2007-11-27 2015-03-10 Ablynx N.V. Amino acid sequences directed against HER2 and polypeptides comprising the same for the treatment of cancers and/or tumors
EP2947097A1 (en) 2008-04-07 2015-11-25 Ablynx N.V. Amino acid sequences directed against the Notch pathways and uses thereof
US8333966B2 (en) 2008-04-11 2012-12-18 Emergent Product Development Seattle, Llc CD37 immunotherapeutics and uses thereof
US9101609B2 (en) 2008-04-11 2015-08-11 Emergent Product Development Seattle, Llc CD37 immunotherapeutic and combination with bifunctional chemotherapeutic thereof
WO2010010119A1 (en) 2008-07-22 2010-01-28 Ablynx Nv Amino acid sequences directed against multitarget scavenger receptors and polypeptides
EP3461844A2 (en) 2009-04-10 2019-04-03 Ablynx N.V. Improved amino acid sequences directed against il-6r and polypeptides comprising the same for the treatment of il-6r related diseases and disorders
EP3205670A1 (en) 2009-06-05 2017-08-16 Ablynx N.V. Improved amino acid sequences directed against human respiratory syncytial virus (hrsv) and polypeptides comprising the same for the prevention and/or treatment of respiratory tract infections
WO2011064382A1 (en) 2009-11-30 2011-06-03 Ablynx N.V. Improved amino acid sequences directed against human respiratory syncytial virus (hrsv) and polypeptides comprising the same for the prevention and/or treatment of respiratory tract infections
EP3309176A1 (en) 2009-12-14 2018-04-18 Ablynx N.V. Immunoglobulin single variable domain antibodies against ox40l, constructs and therapeutic use
WO2011073180A1 (en) 2009-12-14 2011-06-23 Ablynx N.V. Single variable domain antibodies against ox40l, constructs and therapeutic use
WO2011083140A1 (en) 2010-01-08 2011-07-14 Ablynx Nv Immunoglobulin single variable domain directed against human cxcr4
WO2011098520A1 (en) 2010-02-10 2011-08-18 Novartis Ag Agonist dr5 binding polypeptides
WO2011098518A2 (en) 2010-02-11 2011-08-18 Ablynx Nv Delivery of immunoglobulin variable domains and constructs thereof
WO2011117423A1 (en) 2010-03-26 2011-09-29 Ablynx N.V. Immunoglobulin single variable domains directed against cxcr7
EP3546483A1 (en) 2010-05-20 2019-10-02 Ablynx N.V. Biological materials related to her3
WO2011144749A1 (en) 2010-05-20 2011-11-24 Ablynx Nv Biological materials related to her3
WO2011161263A1 (en) 2010-06-25 2011-12-29 Ablynx Nv Pharmaceutical compositions for cutaneous administration
WO2012042026A1 (en) 2010-09-30 2012-04-05 Ablynx Nv Biological materials related to c-met
EP3575321A1 (en) 2010-11-08 2019-12-04 Ablynx N.V. Cxcr2 binding polypeptides
EP3578568A2 (en) 2010-11-08 2019-12-11 Ablynx N.V. Cxcr2 binding polypeptides
WO2012062713A1 (en) 2010-11-08 2012-05-18 Novartis Ag Cxcr2 binding polypeptides
WO2012109624A2 (en) 2011-02-11 2012-08-16 Zyngenia, Inc. Monovalent and multivalent multispecific complexes and uses thereof
WO2012130874A1 (en) 2011-03-28 2012-10-04 Ablynx Nv Bispecific anti-cxcr7 immunoglobulin single variable domains
WO2012156219A1 (en) 2011-05-05 2012-11-22 Ablynx Nv Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same
EP3363815A1 (en) 2011-05-05 2018-08-22 Merck Patent GmbH Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same
EP4105231A1 (en) 2011-05-05 2022-12-21 Merck Patent GmbH Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same
WO2012175740A1 (en) 2011-06-23 2012-12-27 Ablynx Nv Immunoglobulin single variable domains directed against ige
WO2013036130A1 (en) 2011-09-09 2013-03-14 Universiteit Utrecht Holding B.V. Broadly neutralizing vhh against hiv-1
EP3311837A1 (en) 2011-09-23 2018-04-25 Ablynx NV Prolonged inhibition of interleukin-6 mediated signaling
US11098115B2 (en) 2011-09-29 2021-08-24 Apo-T B.V. Multi-specific binding molecules targeting aberrant cells
WO2013045707A2 (en) 2011-09-30 2013-04-04 Ablynx Nv Biological materials related to c-met
US10738109B2 (en) 2012-01-09 2020-08-11 Icb International, Inc. Blood-brain barrier permeable peptide compositions comprising a VAB domain of an anti-amyloid-beta camelid single-domain heavy-chain only antibody
US10112987B2 (en) 2012-01-09 2018-10-30 Icb International, Inc. Blood-brain barrier permeable peptide compositions comprising a vab domain of a camelid single domain heavy chain antibody against an amyloid-beta peptide
US10112988B2 (en) 2012-01-09 2018-10-30 Icb International, Inc. Methods of assessing amyloid-beta peptides in the central nervous system by blood-brain barrier permeable peptide compositions comprising a vab domain of a camelid single domain heavy chain antibody against an anti-amyloid-beta peptide
US10946104B2 (en) 2012-01-13 2021-03-16 Apo-Tb.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
WO2013168108A2 (en) 2012-05-09 2013-11-14 Novartis Ag Chemokine receptor binding polypeptides
WO2014087010A1 (en) 2012-12-07 2014-06-12 Ablynx N.V. IMPROVED POLYPEPTIDES DIRECTED AGAINST IgE
US11560420B2 (en) 2013-05-21 2023-01-24 Roche Diagnostics Operations, Inc. Method for producing antibodies using ovine B-cells and uses thereof
US11708404B2 (en) 2014-05-16 2023-07-25 Ablynx N.V. Immunoglobulin variable domains
WO2015193452A1 (en) 2014-06-18 2015-12-23 Ablynx Nv Kv1.3 binding immunoglobulins
US10561805B2 (en) 2014-10-10 2020-02-18 Ablynx N.V. Methods of treating RSV infections
US10512739B2 (en) 2014-10-10 2019-12-24 Vectura Gmbh Inhalation device for use in aerosol therapy of respiratory diseases
WO2016097313A1 (en) 2014-12-19 2016-06-23 Ablynx N.V. Cysteine linked nanobody dimers
WO2016156570A1 (en) 2015-04-02 2016-10-06 Ablynx N.V. Bispecific cxcr4-cd-4 polypeptides with potent anti-hiv activity
WO2016164305A1 (en) 2015-04-06 2016-10-13 Subdomain, Llc De novo binding domain containing polypeptides and uses thereof
WO2016164308A1 (en) 2015-04-06 2016-10-13 Subdomain, Llc De novo binding domain containing polypeptides and uses thereof
EP3903804A1 (en) 2015-04-06 2021-11-03 Subdomain, LLC De novo binding domain containing polypeptides and uses thereof
WO2016180969A1 (en) 2015-05-13 2016-11-17 Ablynx N.V. T cell recruiting polypeptides based on tcr alpha/beta reactivity
AU2016260909B2 (en) * 2015-05-13 2019-08-22 Ablynx N.V. T cell recruiting polypeptides based on CD3 reactivity
EP4345112A3 (en) * 2015-05-13 2024-06-26 Ablynx N.V. T cell recruiting polypeptides based on cd3 reactivity
CN107847559B (zh) * 2015-05-13 2022-07-01 埃博灵克斯股份有限公司 基于cd3反应性的t细胞募集多肽
EP4345112A2 (en) 2015-05-13 2024-04-03 Ablynx N.V. T cell recruiting polypeptides based on cd3 reactivity
CN107847559A (zh) * 2015-05-13 2018-03-27 埃博灵克斯股份有限公司 基于cd3反应性的t细胞募集多肽
US11046767B2 (en) 2015-05-13 2021-06-29 Ablynx N.V. T cell recruiting polypeptides based on CD3 reactivity
EP3611192A2 (en) 2015-05-13 2020-02-19 Ablynx N.V. T cell recruiting polypeptides based on tcr alpha/beta reactivity
WO2016180982A1 (en) 2015-05-13 2016-11-17 Ablynx N.V. T cell recruiting polypeptides based on cd3 reactivity
US11352426B2 (en) 2015-09-21 2022-06-07 Aptevo Research And Development Llc CD3 binding polypeptides
EP3266798A2 (en) 2015-11-12 2018-01-10 Ablynx NV Improved tnf binders
EP3932945A1 (en) 2015-11-27 2022-01-05 Ablynx NV Polypeptides inhibiting cd40l
EP4273232A2 (en) 2016-03-30 2023-11-08 F. Hoffmann-La Roche AG B-cell cultivation method
WO2017167714A1 (en) 2016-03-30 2017-10-05 F. Hoffmann-La Roche Ag B-cell cultivation method
WO2017191108A1 (en) 2016-05-02 2017-11-09 Ablynx Nv Treatment of rsv infection
WO2018007442A1 (en) 2016-07-06 2018-01-11 Ablynx N.V. Treatment of il-6r related diseases
WO2018029182A1 (en) 2016-08-08 2018-02-15 Ablynx N.V. Il-6r single variable domain antibodies for treatment of il-6r related diseases
WO2018050833A1 (en) 2016-09-15 2018-03-22 Ablynx Nv Immunoglobulin single variable domains directed against macrophage migration inhibitory factor
WO2018091606A1 (en) 2016-11-16 2018-05-24 Ablynx Nv T cell recruiting polypeptides capable of binding cd123 and tcr alpha/beta
WO2018099968A1 (en) 2016-11-29 2018-06-07 Ablynx N.V. Treatment of infection by respiratory syncytial virus (rsv)
WO2018122147A1 (en) 2017-01-02 2018-07-05 F. Hoffmann-La Roche Ag B-cell cultivation method
WO2018206734A1 (en) 2017-05-11 2018-11-15 Vib Vzw Glycosylation of variable immunoglobulin domains
WO2018210896A1 (en) 2017-05-19 2018-11-22 F. Hoffmann-La Roche Ag Method for the production of thymocyte supernatant
US11891624B2 (en) 2017-05-19 2024-02-06 Hoffmann-La Roche Inc. Method for the production of thymocyte supernatant
EP4272822A2 (en) 2017-06-02 2023-11-08 Merck Patent GmbH Adamts binding immunoglobulins
WO2018220234A1 (en) 2017-06-02 2018-12-06 Merck Patent Gmbh Adamts binding immunoglobulins
WO2018220236A1 (en) 2017-06-02 2018-12-06 Merck Patent Gmbh Polypeptides binding adamts5, mmp13 and aggrecan
WO2018220225A1 (en) 2017-06-02 2018-12-06 Ablynx Nv Aggrecan binding immunoglobulins
WO2018220235A1 (en) 2017-06-02 2018-12-06 Merck Patent Gmbh Mmp13 binding immunoglobulins
WO2019099433A2 (en) 2017-11-14 2019-05-23 Arcellx, Inc. D-domain containing polypeptides and uses thereof
WO2019105864A1 (en) 2017-11-30 2019-06-06 F. Hoffmann-La Roche Ag B-cell cultivation method
WO2019151865A1 (en) 2018-02-05 2019-08-08 Stichting Vu Inverse agonistic anti-us28 antibodies
WO2019156566A1 (en) 2018-02-12 2019-08-15 Umc Utrecht Holding B.V. Bispecific molecules comprising gamma-delta tcr and t-cell or nk cell binding domain
WO2019162521A1 (en) 2018-02-26 2019-08-29 Ablynx Nv Improved nucleotide sequences encoding peptide linkers
WO2019226050A2 (en) 2018-05-24 2019-11-28 Wageningen Universiteit Novel viral anti-infective reagents
WO2020074483A1 (en) 2018-10-08 2020-04-16 Ablynx Nv Chromatography-free antibody purification method
EP3636657A1 (en) 2018-10-08 2020-04-15 Ablynx N.V. Chromatography-free antibody purification method
WO2020080941A1 (en) 2018-10-16 2020-04-23 Umc Utrecht Holding B.V. Anti- low-density lipoprotein receptor-related protein 5/6 antibodies
WO2020130838A2 (en) 2018-12-21 2020-06-25 Qvq Holding B.V. Antibodies for preventing or treating candidiasis
GB201901608D0 (en) 2019-02-06 2019-03-27 Vib Vzw Vaccine adjuvant conjugates
WO2020204714A1 (en) 2019-04-02 2020-10-08 Immunetune B.V. Immune-stimulatory compositions and use thereof
WO2020245663A1 (en) 2019-06-01 2020-12-10 Institut Pasteur Nanobody-based ns1 assay for the specific diagnosis of acute zika virus infection
WO2021025556A1 (en) 2019-08-05 2021-02-11 Stichting Vu Identification and elimination of hcmv-infected cells
US11667723B2 (en) 2020-08-17 2023-06-06 Utc Therapeutics (Shanghai) Co., Ltd. Lymphocytes-antigen presenting cells co-stimulators and uses thereof
WO2022129637A1 (en) 2020-12-18 2022-06-23 Ablynx Nv T cell recruiting polypeptides based on tcr alpha/beta reactivity
WO2022178255A2 (en) 2021-02-19 2022-08-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Single domain antibodies that neutralize sars-cov-2
WO2022216157A1 (en) 2021-04-09 2022-10-13 Stichting Radboud Universiteit Off the shelf proximity biotinylation enzyme
WO2022258606A1 (en) 2021-06-07 2022-12-15 Gadeta B.V. Delta T-cell or Gamma T-cell receptor chains or parts thereof that mediate an anti-tumour or anti-infective response
WO2023014222A1 (en) 2021-08-03 2023-02-09 Wageningen Universiteit Argonaute-based nucleic acid detection system
WO2023227594A1 (en) 2022-05-24 2023-11-30 Gadeta Bv Novel deltat-cell receptor chains, gammat-cell receptor chains, or parts thereof
WO2024017915A1 (en) 2022-07-18 2024-01-25 Ablynx N.V. Cx3cr1-binding compounds, uses thereof and related methods
WO2024023271A1 (en) 2022-07-27 2024-02-01 Ablynx Nv Polypeptides binding to a specific epitope of the neonatal fc receptor
WO2024083843A1 (en) 2022-10-18 2024-04-25 Confo Therapeutics N.V. Amino acid sequences directed against the melanocortin 4 receptor and polypeptides comprising the same for the treatment of mc4r-related diseases and disorders
WO2024096735A1 (en) 2022-10-31 2024-05-10 Stichting Amsterdam UMC Single domain anti-cd169 antibodies
WO2024101989A1 (en) 2022-11-08 2024-05-16 Stichting Amsterdam UMC Activation inducible antigen receptors for adoptive immunotherapy
WO2024133301A1 (en) 2022-12-19 2024-06-27 Umc Utrecht Holding B.V. Btn2a1 binding peptide
WO2024133935A1 (en) 2022-12-23 2024-06-27 Ablynx Nv Protein-based conjugation carriers
WO2024170756A1 (en) 2023-02-17 2024-08-22 Ablynx N.V. Polypeptides binding to the neonatal fc receptor

Also Published As

Publication number Publication date
CA2321199A1 (en) 1999-08-26
HK1041210A1 (zh) 2002-07-05
WO1999042077A3 (en) 2004-05-27
BR9907950A (pt) 2001-12-18
ID26964A (id) 2001-02-22
JP2003525016A (ja) 2003-08-26
US20020155604A1 (en) 2002-10-24
EP1469883A2 (en) 2004-10-27
US20050261478A1 (en) 2005-11-24
KR20010034512A (ko) 2001-04-25
US20040253250A1 (en) 2004-12-16
CN1316910A (zh) 2001-10-10
AU3295299A (en) 1999-09-06
NO20004095D0 (no) 2000-08-16
NZ506453A (en) 2003-02-28
IL137963A0 (en) 2001-10-31
NO20004095L (no) 2000-10-18

Similar Documents

Publication Publication Date Title
US20050261478A1 (en) Compositions and methods for regulating lymphocyte activation
US5885573A (en) Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies
JP4467188B2 (ja) 多重特異的結合分子とその使用
US6491916B1 (en) Methods and materials for modulation of the immunosuppresive activity and toxicity of monoclonal antibodies
AU682325B2 (en) Methods for regulating the immune response using CTLA4-binding molecules and IL4-binding molecules
CA2212750C (en) Humanized antibodies against cd3
US5851795A (en) Soluble CTLA4 molecules and uses thereof
US7105166B1 (en) Soluble CTLA4 mutant molecules and uses thereof
US20060292142A1 (en) Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies
WO1994028027A9 (en) Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies
IL113343A (en) Ctla4/cd28 hybrid fusion proteins and compositions containing them
JP2002003399A (ja) 免疫疾患の治療のための可溶性ｃｔｌａ４タンパク質の使用
WO1998058965A2 (en) B7-binding molecules for treating immune diseases
KR20220035367A (ko) 항-dll3 키메라 항원 수용체 및 이의 용도
EP0503646A1 (en) Monoclonal antibodies recognizing lymphocyte function associated antigen-3
AU773844B2 (en) Compositions and methods for regulating lymphocyte activation
AU1872902A (en) Compositions and methods for regulating lymphocyte activation
EP1097210B1 (en) Immunological reagent specifically interacting with the extracellular domain of the human zeta chain
MXPA00008125A (en) Compositions and methods for regulating lymphocyte activation
EP4219553A1 (en) Anti-tigit antibody and double antibody and their application
CN117460744A (zh) 靶向afp肽/mhc复合物的抗体及其用途
CN117715935A (zh) 抗cd33抗体及其用途
JPH11332563A (ja) 抗体及びそれをコードする核酸
MXPA01000325A (en) Immunological reagent specifically interacting with the extracellular domain of the human zeta chain
MXPA95001794A (en) Ctla4 molecules and il-4 link molecules and uses of mis

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99804546.2

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2321199

Country of ref document: CA

Ref document number: 2321199

Country of ref document: CA

Kind code of ref document: A

Ref document number: 2000 532094

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2000/008125

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 1020007009178

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 137963

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 506453

Country of ref document: NZ

Ref document number: 32952/99

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: IN/PCT/2000/00341/MU

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 1999934239

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1020007009178

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1020007009178

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1999934239

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999934239

Country of ref document: EP