WO1999041397A1 - Anti-viral vectors - Google Patents
Anti-viral vectors Download PDFInfo
- Publication number
- WO1999041397A1 WO1999041397A1 PCT/GB1999/000325 GB9900325W WO9941397A1 WO 1999041397 A1 WO1999041397 A1 WO 1999041397A1 GB 9900325 W GB9900325 W GB 9900325W WO 9941397 A1 WO9941397 A1 WO 9941397A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- viral
- nucleotide sequence
- vector
- hiv
- genome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present invention relates to novel viral vectors capable of delivering anti-viral inhibitory RNA molecules to target cells.
- the gene encodes protein products that inhibit the virus in a number of possible ways.
- One example of such a protein is the RevMlO derivative of the HIV Rev protein (16).
- the RevMlO protein acts as a transdominant negative mutant and so competitively inhibits Rev function in the virus.
- the RevMlO protein is a derivative of a native HIV protein. While this provides the basis for the anti-HIV effect, it also has serious disadvantages. In particular, this type of strategy demands that in the absence of the virus there is little or no expression of the gene.
- RNA molecules may be anti-sense RNA (15, 31), ribozymes (5) or competitive decoys (1).
- Ribozymes are enzymatic RNA molecules which catalyse sequence-specific RNA processing. The design and structure of ribozymes has been described extensively in the literature in recent years (3, 7, 31). Amongst the most powerful systems are those that deliver multitarget ribozymes that cleave RNA of the target virus at multiple sites (5, 21).
- HIV vectors In recent years a number of laboratories have developed retroviral vector systems based on HIV (2, 4, 18, 19, 22-24, 27, 32, 35, 39, 43). In the context of anti-HIV gene therapy these vectors have a number of advantages over the more conventional murine based vectors -2- such as murine leukaemia virus (MLV) vectors. Firstly, HIV vectors would target precisely those cells that are susceptible to HIV infection (22, 23). Secondly, the HIV- based vector would transduce cells such as macrophages that are normally refractory to transduction by murine vectors (19, 20). Thirdly, the anti-HIV vector genome would be propagated through the CD4+ cell population by any virus (HIV) that escaped the therapeutic strategy (7). This is because the vector genome has the packaging signal that will be recognised by the viral particle packaging system. These various attributes make HIV -vectors a powerful tool in the field of anti-HIV gene therapy.
- MMV murine leukaemia virus
- a combination of the multitarget ribozyme and an HIV-based vector would be attractive as a therapeutic strategy.
- Vector particle production takes place in producer cells which express the packaging components of the particles and package the vector genome.
- the ribozymes that are designed to destroy the viral RNA would therefore also interrupt the expression of the components of the HIV- based vector system during vector production.
- the present invention aims to overcome this problem.
- the system includes both a viral genome encoding the inhibitory RNA molcules and nucleotide constructs encoding the components required for packaging the viral genome in a producer cell.
- the packaging components have substantially the same amino acid sequence as the corresponding components of the target virus
- the inhibitory RNA molecules do not affect production of the viral particles in the producer cells because the nucleotide sequence of the packaging components used in the viral system have been modified to prevent the inhibitory RNA molecules from effecting cleavage or degradation of the RNA transcripts produced from the constructs.
- Such a viral particle may be used to treat viral infections, in -3- particular HIV infections.
- the present invention provides a viral vector system comprising: (i) a first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles; and
- the present invention provides a viral vector production system comprising: (i) a viral genome comprising at least one first nucleotide sequence encoding a gene product capable of binding to and effecting the cleavage, directly or indirectly, of a second nucleotide sequence, or transcription product thereof, encoding a viral polypeptide required for the assembly of viral particles;
- the gene product is typically an RNA inhibitory sequence selected from a ribozyme and an anti-sense ribonucleic acid, preferably a ribozyme.
- the viral vector is a retroviral vector, more preferably a lentiviral vector, such as an HIV vector.
- the second nucleotide sequence and the third nucleotide sequences are typically from the same viral species, more preferably from the same viral strain.
- the viral genome is also from the same viral species, more preferably from the same viral strain.
- the polypeptide required for the assembly of viral particles is selected from gag, pol and env proteins.
- at least the gag and pol sequences are lentiviral sequences, more preferably HIV sequences.
- the env sequence is a lentiviral sequence, more preferably an HIV sequence.
- the third nucleotide sequence is resistant to cleavage directed by the gene product as a result of one or more conservative alterations in the nucleotide sequence which remove cleavage sites recognised by the at least one gene product and/or binding sites for the at least one gene product.
- the gene product is a ribozyme
- the third nucleotide sequence is adapted to be resistant to cleavage by the ribozyme.
- the third nucleotide sequence is codon optimised for expression in host cells.
- the host cells which term includes producer cells and packaging cells, are typically mammalian cells.
- the viral genome is an HIV genome comprising nucleotide sequences encoding anti-HIV ribozymes and/or anti-HIV antisense sequences directed against HIV packaging component sequences (such as gag.pol) in a target HIV and
- the viral system for producing packaged HIV particles further comprises nucleotide constructs encoding the same packaging components (such as gag.pol proteins) as in the target HIV wherein the sequence of the nucleotide constructs is different from that found in the target HIV so that the anti-HIV ribozyme and/or antisense HIV sequences cannot effect cleavage or degradation of the gag.pol transcripts during production of the HIV particles in producer cells.
- the present invention also provides a viral particle comprising a viral vector according to the present invention and one or more polypeptides encoded by the third nucleotide sequences according to the present invention.
- the present invention provides a viral particle produced using the viral vector production system of the invention. -5-
- the present invention provides a method for producing a viral particle which method comprises introducing into a host cell (i) a viral genome vector according to the present invention; (ii) one or more third nucleotide sequences according to the present invention; and (iii) nucleotide sequences encoding the other essential viral packaging components not encoded by the one or more third nucleotide sequences.
- the present invention further provides a viral particle produced using by the method of the invention.
- the present invention also provides a pharmaceutical composition
- a pharmaceutical composition comprising a viral particle according to the present invention together with a pharmaceutically acceptable carrier or diluent.
- the viral system of the invention or viral particles of the invention may be used to treat viral infections, particularly retroviral infections such as lentiviral infections including HIV infections.
- the present invention provides a method of treating a viral infection which method comprises administering to a human or animal patient suffering from the viral infection an effective amount of a viral system, viral particle or pharmaceutical composition of the present invention.
- the invention relates in particular to HIV-based vectors carrying anti-HIV ribozymes.
- the invention can be applied to any other virus, in particular any other lentivirus, for which treatment by gene therapy may be desirable.
- the invention is illustrated herein for HIV, but this is not considered to limit the scope of the invention to HIV-based anti- HIV vectors.
- viral vector refers to a nucleotide construct comprising a viral genome capable of being transcribed in a host cell, which genome comprises sufficient viral genetic information to allow packaging of the viral RNA genome, in the presence of packaging components, into a viral particle capable of infecting a target cell. Infection of the target -6- cell includes reverse transcription and integration into the target cell genome, where appropriate for particular viruses.
- the viral vector in use typically carries heterologous coding sequences (nucleotides of interest) which are to be delivered by the vector to the target cell, for example a first nucleotide sequence encoding a ribozyme.
- a viral vector is incapable of independent replication to produce infectious viral particles within the final target cell.
- viral vector system is intended to mean a kit of parts which can be used when combined with other necessary components for viral particle production to produce viral particles in host cells.
- the first nucleotide sequence may typically be present in a plasmid vector construct suitable for cloning the first nucleotide sequence into a viral genome vector construct.
- a kit with a third nucleotide sequence which will also typically be present in a separate plasmid vector construct, the resulting combination of plasmid containing the first nucleotide sequence and plasmid containing the third nucleotide sequence comprises the essential elements of the invention.
- kit may then be used by the skilled person in the production of suitable viral vector genome constructs which when transfected into a host cell together with the plasmid containing the third nucleotide sequence, and optionally nucleic acid constructs encoding other components required for viral assembly, will lead to the production of infectious viral particles.
- the third nucleotide sequence may be stably present within a packaging cell line that is included in the kit.
- the kit may include the other components needed to produce viral particles, such as host cells and other plasmids encoding essential viral polypeptides required for viral assembly.
- the kit may contain (i) a plasmid containing a first nucleotide sequence encoding an anti-HIV ribozyme and (ii) a plasmid containing a third nucleotide sequence encoding a modified HIV gag.pol construct which cannot be cleaved by the anti-HIV ribozyme.
- Optional components would then be (a) an HIV viral genome construct with suitable restriction enzyme recognition sites for cloning the first nucleotide sequence into the viral genome; (b) a plasmid encoding a VSV-G env protein.
- nucleotide -7- sequence encoding viral polypeptides required for assembly of viral particles may be provided in the kit as packaging cell lines comprising the nucleotide sequences, for example a VSV-G expressing cell line.
- viral vector production system refers to the viral vector system described above wherein the first nucleotide sequence has already been inserted into a suitable viral vector genome.
- Viral vectors are typically retroviral vectors, in particular lentiviral vectors such as HIV vectors.
- the retroviral vector of the present invention may be derived from or may be derivable from any suitable retrovirus.
- retro viruses A large number of different retro viruses have been identified. Examples include: murine leukemia virus (MLV), human immunodeficiency virus (HIV), simian immunodeficiency virus, human T-cell leukemia virus (HTLV).
- Mo-MLV FBR murine osteosarcoma virus
- FBR MSV FBR murine osteosarcoma virus
- MC29 Avian erythroblastosis virus
- AEV Avian erythroblastosis virus
- the lentivirus group can be split even further into “primate” and "non-primate”.
- primate lentiviruses include human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV).
- the non-primate lentiviral group includes the prototype "slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV). -8-
- the basic structure of a retrovirus genome is a 5' LTR and a 3' LTR, between or within which are located a packaging signal to enable the genome to be packaged, a primer binding site, integration sites to enable integration into a host cell genome and gag, pol and env genes encoding the packaging components - these are polypeptides required for the assembly of viral particles.
- More complex retroviruses have additional features, such as rev and RRE sequences in HIV, which enable the efficient export of RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of an infected target cell.
- LTRs long terminal repeats
- the LTRs are responsible for pro viral integration, and transcription. LTRs also serve as enhancer-promoter sequences and can control the expression of the viral genes. Encapsidation of the retroviral RNAs occurs by virtue of apsi sequence located at the 5' end of the viral genome.
- the LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5.
- U3 is derived from the sequence unique to the 3' end of the RNA.
- R is derived from a sequence repeated at both ends of the RNA and
- U5 is derived from the sequence unique to the 5' end of the RNA.
- the sizes of the three elements can vary considerably among different retroviruses.
- pol and env may be absent or not functional.
- the R regions at both ends of the RNA are repeated sequences.
- U5 and U3 represent unique sequences at the 5' and 3' ends of the RNA genome respectively.
- At least part of one or more of the gag, pol and env protein coding regions essential for replication may be removed from the virus.
- the removed portions may even be replaced by a nucleotide sequence of interest (NOI), such as a first nucleotide sequence of the invention, to generate a virus capable of integrating its genome into a host genome but wherein the modified viral genome is unable to propagate itself due to a lack of structural proteins.
- NOI nucleotide sequence of interest
- the transfer of an NOI into a site of interest is typically achieved by: integrating the NOI into the recombinant viral vector; packaging the modified viral vector into a virion coat; and allowing transduction of a site of interest - such as a targeted cell or a targeted cell population.
- a minimal retroviral genome for use in the present invention will therefore comprise (5') R - U5 - one or more first nucleotide sequences - U3-R (3').
- the plasmid vector used to produce the retroviral genome within a host cell/packaging cell will also include transcriptional regulatory control sequences operably linked to the retroviral genome to direct transcription of the genome in a host cell/packaging cell.
- These regulatory sequences may be the natural sequences associated with the transcribed retroviral sequence, i.e. the 5' U3 region, or they may be a heterologous promoter such as another viral promoter, for example the CMV promoter.
- rev and RRE sequence are preferably included. However the requirement for rev and RRE can be reduced or eliminated by codon optimisation.
- the promoter is located in the 5' LTR U3 region of the provirus.
- the promoter driving expression of a therapeutic gene may be the native retroviral promoter in the 5' U3 region, or an alternative promoter engineered into the vector.
- the alternative promoter may physically replace the 5' U3 promoter native to the retrovirus, or it may be incorporated at a different place within the vector genome such as between the LTRs.
- the first nucleotide sequence will also be operably linked to a transcriptional regulatory control sequence to allow transcription of the first nucleotide sequence to occur in the target cell.
- the control sequence will typically be active in mammalian cells.
- the control sequence may, for example, be a viral promoter such as the natural viral promoter or a CMV promoter or it may be a mammalian promoter. It is particularly preferred to use a promoter that is preferentially active in a particular cell type or tissue type in which the JO- virus to be treated primarily infects.
- a tissue-specific regulatory sequences may be used.
- the regulatory control sequences driving expression of the one or more first nucleotide sequences may be constitutive or regulated promoters.
- Replication-defective retroviral vectors are typically propagated, for example to prepare suitable titres of the retroviral vector for subsequent transduction, by using a combination of a packaging or helper cell line and the recombinant vector. That is to say, that the three packaging proteins can be provided in trans.
- a "packaging cell line” contains one or more of the retroviral gag, pol and env genes.
- the packaging cell line produces the proteins required for packaging retroviral DNA but it cannot bring about encapsidation due to the lack of a psi region.
- the helper proteins can package the j ⁇ yz-positive recombinant vector to produce the recombinant virus stock. This virus stock can be used to transduce cells to introduce the NOI into the genome of the target cells.
- psi plus a psi packaging signal that contains additional sequences spanning from upstream of the splice donor to downstream of the gag start codon (Bender et al. (46)) since this has been shown to increase viral titres.
- the recombinant virus whose genome lacks all genes required to make viral proteins can tranduce only once and cannot propagate.
- These viral vectors which are only capable of a single round of transduction of target cells are known as replication defective vectors.
- the NOI is introduced into the host/target cell genome without the generation of potentially harmful retrovirus.
- Retroviral packaging cell lines in which the gag, pol and env viral coding regions are carried on separate expression plasmids that are independently transfected into a packaging cell line are preferably used.
- This strategy sometimes referred to as the three plasmid transfection method (Soneoka et al. (33)), reduces the potential for production of a replication-competent virus since three recombinant events are required for wild type viral -11- production.
- As recombination is greatly facilitated by homology, reducing or eliminating homology between the genomes of the vector and the helper can also be used to reduce the problem of replication-competent helper virus production.
- transiently transfected packaging cell lines An alternative to stably transfected packaging cell lines is to use transiently transfected cell lines.
- Transient transfections may advantageously be used to measure levels of vector production when vectors are being developed. In this regard, transient transfection avoids the longer time required to generate stable vector-producing cell lines and may also be used if the vector or retroviral packaging components are toxic to cells.
- Components typically used to generate retroviral vectors include a plasmid encoding the gag/pol proteins, a plasmid encoding the env protein and a plasmid containing an NOI. Vector production involves transient transfection of one or more of these components into cells containing the other required components.
- the vector encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apotosis, it may be difficult to generate stable vector-producing cell lines, but transient transfection can be used to produce the vector before the cells die. Also, cell lines have been developed using transient transfection that produce vector titre levels that are comparable to the levels obtained from stable vector-producing cell lines (Pear et al. (47)).
- Producer cells/packaging cells can be of any suitable cell type. Most commonly, mammalian producer cells are used but other cells, such as insect cells are not excluded. Clearly, the producer cells will need to be capable of efficiently translating the env and gag, pol mRNA. Many suitable producer/packaging cell lines are known in the art. The skilled person is also capable of making suitable packaging cell lines by, for example stably introducing a nucleotide construct encoding a packaging component into a cell line.
- the retroviral genome encodes an inhibitory RNA molecule capable of effecting the cleavage of gag, pol and/or env RNA transcripts
- the nucleotide sequences present in the packaging cell line either integrated or carried on plasmids, or in the transiently transfected producer cell line, which encode gag, pol and or env proteins will be modified so as to reduce or prevent binding of the inhibitory RNA molecule(s).
- the inhibitory RNA molecule(s) will not prevent expression of -12- components in packaging cell lines that are essential for packaging of viral particles.
- the use of different envelope proteins such as the G protein from vesicular-stomatitis virus has improved titres following concentration to 10 per ml (Cosset et ⁇ l. (48)).
- the envelope protein will be chosen such that the viral particle will preferentially infect cells that are infected with the virus which it desired to treat.
- the env protein used will be the HIV env protein.
- Suitable first nucleotide sequences for use according to the present invention encode gene products that result in the cleavage and/or enzymatic degradation of a target nucleotide sequence, which will generally be a ribonucleotide.
- ribozymes, and antisense sequences may be mentioned.
- Ribozymes are RNA enzymes which cleave RNA at specific sites. Ribozymes can be engineered so as to be specific for any chosen sequence containing a ribozyme cleavage site. Thus, ribozymes can be engineered which have chosen recognition sites in transcribed viral sequences.
- ribozymes encoded by the first nucleotide sequence recognise and cleave essential elements of viral genomes required for the production of viral particles, such as packaging components. Thus, for retroviral genomes, such essential elements include the gag, pol and env gene products.
- a suitable ribozyme capable of recognising at least one of the gag, pol and env gene sequences, or more typically, the RNA sequences transcribed from these genes, is able to bind to and cleave such a sequence. This will reduce or prevent production of the gal, pol or env protein as appropriate and thus reduce or prevent the production of retroviral particles.
- Ribozymes come in several forms, including hammerhead, hairpin and hepatitis delta antigenomic ribozymes. Preferred for use herein are hammerhead ribozymes, in part because of their relatively small size, because the sequence requirements for their target cleavage site are minimal and because they have been well characterised.
- the ribozymes -13- most commonly used in research at present are hammerhead and hairpin ribozymes.
- Each individual ribozyme has a motif which recognises and binds to a recognition site in the target RNA.
- This motif takes the form of one or more "binding arms", generally two binding arms.
- the binding arms in hammerhead ribozymes are the flanking sequences Helix I and Helix III, which flank Helix II. These can be of variable length, usually between 6 to 10 nucleotides each, but can be shorter or longer.
- the length of the flanking sequences can affect the rate of cleavage. For example, it has been found that reducing the total number of nucleotides in the flanking sequences from 20 to 12 can increase the turnover rate of the ribozyme cleaving a HIV sequence, by 10-fold (44).
- a catalytic motif in the ribozyme Helix II in hammerhead ribozymes cleaves the target RNA at a site which is referred to as the cleavage site. Whether or not a ribozyme will cleave any given RNA is determined by the presence or absence of a recognition site for the ribozyme containing an appropriate cleavage site.
- Each type of ribozyme recognises its own cleavage site.
- the hammerhead ribozyme cleavage site has the nucleotide base triplet GUX directly upstream where G is guanine, U is uracil and X is any nucleotide base.
- Hairpin ribozymes have a cleavage site of BCUGNYR, where B is any nucleotide base other than adenine, N is any nucleotide, Y is cytosine or thymine and R is guanine or adenine. Cleavage by hairpin ribozymes takes places between the G and the N in the cleavage site.
- the nucleic acid sequences encoding the packaging components may be resistant to the ribozyme or ribozymes because they lack any cleavage sites for the ribozyme or ribozymes. This prohibits enzymatic activity by the ribozyme or ribozymes and therefore there is no effective recognition site for the ribozyme or ribozymes.
- the potential recognition sites may be altered in the flanking sequences which form the part of the recognition site to which the ribozyme binds.
- flanking sequences are altered, they are preferably altered such that catalytic activity of the ribozyme at -14- the altered target sequence is negligible and is effectively eliminated.
- a series of several anti-HIV ribozymes is employed in the invention (5, 7, 10, 13, 21, 36, 38, 40). These can be any anti-HIV ribozymes but must include one or more which cleave the RNA that is required for the expression of gag, pol or env.
- a plurality of ribozymes is employed, together capable of cleaving gag, pol and env RNA of the native retrovirus at a plurality of sites. Since HIV exists as a population of quasispecies, not all of the target sequences for the ribozymes will be included in all HIV variants. The problem presented by this variability can be overcome by using multiple ribozymes.
- ribozymes can be included in series in a single vector and can function independently when expressed as a single RNA sequence.
- a single RNA containing two or more ribozymes having different target recognition sites may be referred to as a multitarget ribozyme.
- the placement of ribozymes in series has been demonstrated to enhance cleavage.
- the use of a plurality of ribozymes is not limited to treating HIV infection but may be used in relation to other viruses, retroviruses or otherwise.
- Antisense technology is well known on the art. There are various mechanisms by which antisense sequences are believed to inhibit gene expression. One mechanism by which antisense sequences are believed to function is the recruitment of the cellular protein RNAseH to the target sequence/antisense construct heteroduplex which results in cleavage and degradation of the heteroduplex. Thus the antisense construct, by contrast to ribozymes, can be said to lead indirectly to cleavage/degradation of the target sequence.
- a first nucleotide sequence may encode an antisense RNA that binds to either a gene encoding an essential/packaging component or the RNA transcribed from said gene such that expression of the gene is inhibited, for example as a result of RNAseH degradation of a resulting heteroduplex. It is not necessary for the antisense construct to encode the entire complementary sequence of the gene encoding an essential/packaging component - a portion may suffice. The skilled person will easily be able to determine how to design a suitable antisense construct.
- the nucleic acid sequences encoding the essential/packaging components of the viral particles required for the assembly of viral particles in the host cells/producer -15- cells/packaging cells are resistant to the inhibitory RNA molecules encoded by the first nucleotide sequence.
- resistance is typically by virtue of alterations in the sequences which eliminate the ribozyme recognition sites.
- the amino acid coding sequence for the essential/packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the essential/packaging components is not compromised.
- viral polypeptide required for the assembly of viral particles means a polypeptide normally encoded by the viral genome to be packaged into viral particles, in the absence of which the viral genome cannot be packaged.
- polypeptides would include gag, pol and env.
- packaging component and "essential component” are also included within this definition.
- the third nucleotide sequence differs from the second nucleotide sequence encoding the target viral packaging component antisense sequence to the extent that although the antisense sequence can bind to the second nucleotide sequence, or transcript thereof, the antisense sequence can not bind effectively to the third nucleotide sequence or RNA transcribed from therefrom.
- the changes between the second and third nucleotide sequences will typically be conservative changes, although a small number of amino acid changes may be tolerated provided that, as described above, the function of the essential/packaging components is not significantly impaired.
- the alterations to the coding sequences for the viral components improve the sequences for codon usage in the mammalian cells or other cells which are to act as the producer cells for retroviral vector particle production.
- This improvement in codon usage is referred to as "codon optimisation".
- Many viruses, including HIV and other lentiviruses use a large number of rare codons and by changing these to correspond to commonly used mammalian codons, increased expression of the packaging components in mammalian producer cells can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. -16-
- the sequences encoding the packaging components are codon optimised. More preferably, the sequences are codon optimised in their entirety. Following codon optimisation, it is found that there are numerous sites in the wild type gag, pol and env sequences which can serve as ribozyme recognition sites and which are no longer present in the sequences encoding the packaging components. In an alternative but less practical strategy, the sequences encoding the packaging components can be altered by targeted conservative alterations so as to render them resistant to selected ribozymes capable of cleaving the wild type sequences.
- codon optimising HIV packaging components can increase gene expression.
- it can render gag, pol expression Rev independent so that rev and RRE need not be included in the genome (11).
- Rev-independent vectors are therefore possible. This in turn enables the use of anti-rev or RRE factors in the retroviral vector.
- the packaging components for a retroviral vector include expression products of gag, pol and env genes.
- gag and pol employed in the packaging system are derived from the target retrovirus on which the vector genome is based.
- gag and pol would normally be cleavable by the ribozymes present in the vector genome.
- the env gene employed in the packaging system may be derived from a different virus, including other retroviruses such as MLV and non-retroviruses such as VSV (a Rhabdovirus), in which case it may not need any sequence alteration to render it resistant to ribozyme cleavage.
- env may be derived from the same retrovirus as gag and pol, in which case any recognition sites for the ribozymes will need to be eliminated by sequence alteration.
- the process of producing a retroviral vector in which the envelope protein is not the native envelope of the retrovirus is known as "pseudotyping".
- Certain envelope proteins such as MLV envelope protein and vesicular stomatitis virus G (VSV-G) protein, pseudotype retroviruses very well. Pseudotyping can be useful for altering the target cell range of the retrovirus.
- VSV-G vesicular stomatitis virus G
- the envelope protein may be the same as that of the target virus, for example HIV.
- therapeutic coding sequences may be present along with the first nucleotide sequence or sequences.
- Other therapeutic coding sequences include, but are not limited to, sequences encoding cytokines, hormones, antibodies, immunoglobulin fusion proteins, enzymes, immune co-stimulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a single chain antibody, tumour suppresser protein and growth factors.
- a suitable promoter which may be the promoter driving expression of the first nucleotide sequence or a different promoter or promoters.
- the invention comprises two components.
- the first is a genome construction that will be packaged by viral packaging components and which carries a series of anti-viral inhibitory RNA molecules such as anti-HIV ribozymes (5, 7, 10, 13, 21, 36, 38, 40). These could be any anti-HIV ribozymes but the key issue for this invention is that some of them cleave RNA that is required for the expression of native or wild type HIV gag, pol or env coding sequences.
- the second component is the packaging system which comprises a cassette for the expression of HIV gag, pol and a cassette either for HIV env or an envelope gene encoding a pseudotyping envelope protein - the packaging system beig resistant to the inhibitory RNA molecules.
- the viral particles of the present invention, and the viral vector system and methods used to produce may thus be used to treat or prevent viral infections, preferably retroviral infections, in particular lentiviral, especially HIV, infections.
- the viral particles of the invention, typically produced using the viral vector system of the present invention may be used to deliver inhibitory RNA molecules to a human or animal in need of treatment for a viral infection.
- the viral production system may be used to transfect cells obtained from a patient ex vivo and then returned to the patient.
- Patient cells transfected ex vivo may be formulated as a pharmaceutical composition (see below) prior to -18- readminstration to the patient.
- the viral particles are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
- the present invention also provides a pharmaceutical composition for treating an individual, wherein the composition comprises a therapeutically effective amount of the viral particle of the present invention, together with a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
- the pharmaceutical composition may be for human or animal usage.
- Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline.
- the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
- the pharmaceutical composition may be formulated for parenteral, intramuscular, intravenous, intracranial, subcutaneous, intraocular or transdermal administration.
- the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
- compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
- compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner. -19-
- the amount of virus administered is typically in the range of from 10 to 10 pfu, preferably from 10 to 10 pfu, more preferably from 10 to 10 pfu.
- typically 1-10 ⁇ l of virus in a pharmaceutically acceptable suitable carrier or diluent is administered.
- the amount of nucleic acid administered is typically in the range of from 1 ⁇ g to 10 mg, preferably from 100 ⁇ g to 1 mg.
- the first nucleotide sequence (or other therapeutic sequence) is under the control of an inducible regulatory sequence, it may only be necessary to induce gene expression for the duration of the treatment. Once the condition has been treated, the inducer is removed and expression of the NOI is stopped. This will clearly have clinical advantages.
- Such a system may, for example, involve administering the antibiotic tetracycline, to activate gene expression via its effect on the tet repressor/VP16 fusion protein.
- Figure 1 shows schematically ribozymes inserted into four different HIV vectors
- Figure 2 shows schematically how to create a suitable 3' LTR by PCR
- Figure 3 shows the codon usage table for wild type HIV gagpol of strain HXB2 (accession number: K03455).
- Figure 4 shows the codon usage table of the codon optimised sequence designated gag,pol- SYNgp. -20-
- Figure 5 shows the codon usage table of the wild type HIV env called env-mn.
- Figure 6 shows the codon usage table of the codon optimised sequence of HIV env designated SYNgpl ⁇ Omn.
- Figure 7 shows three plasmid constructs for use in the invention.
- Figure 8 shows the principle behind two systems for producing retroviral vector particles.
- the HIV gag.pol sequence was codon optimised ( Figure 4 and SEQ I.D. No. 1) and synthesised using overlapping oligos of around 40 nucleotides. This has three advantages. Firstly it allows an HIV based vector to carry ribozymes and other therapeutic factors. Secondly the codon optimisation generates a higher vector titre due to a higher level of gene expression. Thirdly gag.pol expression becomes rev independent which allows the use of anti-rev or RRE factors.
- gag.pol conserved sequences within gag.pol were identified by reference to the HIV Sequence database at Los Alamos National Laboratory (http:// hiv-web.lanl.gov/) and used to design ribozymes. Because of the variability between subtypes of HIV-1 the ribozymes were designed to cleave the predominant subtype within North America, Latin America and the Caribbean, Europe, Japan and Australia; that is subtype B. The sites chosen were cross- referenced with the synthetic gagpol sequence to ensure that there was a low possibility of cutting the codon optimised gagpol mRNA. The ribozymes were designed with Xhol and -21-
- the ribozymes are hammerhead (25) structures of the following general structure:
- the catalytic domain of the ribozyme (Helix II) can tolerate some changes without reducing catalytic turnover.
- cleavage sites, targeting gag and pol, with the essential GUX triplet are as follows:
- GAG 2 5 AACCCAGAUUGUAAGACUAUUU
- the ribozymes are inserted into four different HIV vectors (pH4 (10), pH6, pH4J, or pH6J) ( Figure 1). In pH4 and pH6, transcription of the ribozymes is driven by an internal
- HCMV promoter (9). From pH4J and pH6J, the ribozymes are expressed from the 5'
- pH4 and pH4J have the HIV U3 in the 3' LTR.
- pH6 and pH6J have HCMV in the 3'LTR.
- the HCMV promoter replaces most of the U3 and will drive expression at high constitutive levels while the HIV-1 U3 will support a high level of expression only in the presence of Tat.
- the HCMV/HIV-1 hybrid 3' LTR is created by recombinant PCR with three PCR primers ( Figure 2).
- the first round of PCR is performed with RIB1 and RIB2 using pH4 (12) as the template to amplify the HIV-1 HXB2 sequence 8900-9123.
- the second round of PCR makes the junction between the 5' end of the HIV-1 U3 and the HCMV promoter by amplifying the hybrid 5' LTR from pH4.
- the PCR product from the first PCR reaction and RIB 3 serves as the 5' primer and 3' primer respectively.
- pH6 The PCR product is then cut with Sphl and Sail and inserted into pH4 thereby replacing the 3' LTR.
- the resulting plasmid is designated pH6.
- the internal HCMV promoter (Spel - Xhol) in pH4 and pH6 is replaced with the polycloning site of pBluescript II KS+ (Stratagene) (Spel - Xhol).
- the ribozymes are inserted into the Xhol sites in the genome vector backbones. Any ribozymes in any configuration could be used in a similar way.
- the packaging system can take various forms.
- the HIV gag, pol components are co-expressed with the HIV env coding sequence.
- both the gag, pol and the env coding sequences are altered such that they are resistant to the anti-HIV ribozymes that are built into the genome.
- the codons can be chosen to match the usage pattern of the most highly expressed mammalian genes. This dramatically increases expression -23- levels (28, 29) and so increases titre.
- a codon optimised HIV env coding sequence has been described by Haas et al (9).
- a modified codon optimised HIV env sequence is used (SEQ I.D.
- the corresponding env expression plasmid is designated pSYNgpl ⁇ Omn.
- the modified sequence contains extra motifs not used by Haas et al. The extra sequences were taken from the HIV env sequence of strain MN and codon optimised. Any similar modification of the nucleic acid sequence would function similarly as long as it used codons corresponding to abundant tRNAs (42) and lead to resistance to the ribozymes in the genome.
- a gag, pol coding sequence with optimised codon usage overlapping oligonucleotides are synthesised and then ligated together to produce the synthetic coding sequence.
- the sequence of a wild-type (Genbank accession no. K03455) and synthetic (gagpol-SYNgp) gagpol sequence is shown in SEQ I.D. Nos 1 and 2, respectively and their codon usage is shown in Figures 3 and 4, respectively.
- the sequence of a wild type env coding sequence (Genbank Accession No. Ml 7449) is given in SEQ I.D. No 3
- the sequence of a synthetic codon optimised sequence is given in SEQ. I.D. No. 4 and their codon usage tables are given in Figures 5 and 6, respectively.
- gag, pol sequence that achieves resistance to the ribozymes could be used.
- the synthetic sequence shown is designated gag, pol-SYNgp and has an EcoRI site at the 5' end and a Notl site at the 3' end. It is inserted into pClneo (Promega) to produce plasmid pSY ⁇ gp.
- a synthetic gag, pol cassette is coexpressed with a non-HIV envelope coding sequence that produces a surface protein that pseudotypes HIV.
- Vector particles can be produced either from a transient three-plasmid transfection system similar to that described by Soneoka et al. (33) or from producer cell lines similar to those used for other retroviral vectors (20, 35, 39). These principles are illustrated in Figures 7 and 8. For example, by using pH6Rz, pSYNgp and pRV67 (VSV-G expression plasmid) in a three plasmid transfection of 293T cells ( Figure 8), as described by Soneoka et al (33), vector particles designated H6Rz-VSV are produced. These transduce the H6Rz genome to CD4+ cells such as C1866 or Jurkat and produce the multitarget ribozymes. HIV replication in these cells is now severely restricted.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- AIDS & HIV (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Tropical Medicine & Parasitology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU25274/99A AU757284B2 (en) | 1998-02-17 | 1999-02-17 | Anti-viral vectors |
| JP2000531578A JP2002503477A (ja) | 1998-02-17 | 1999-02-17 | 抗ウイルスベクター |
| EP99904956A EP1054988B1 (en) | 1998-02-17 | 1999-02-17 | Anti-viral vectors |
| DE69935714T DE69935714T2 (de) | 1998-02-17 | 1999-02-17 | Anti-virale vektoren |
| CA002321097A CA2321097A1 (en) | 1998-02-17 | 1999-02-17 | Anti-viral vectors |
| US09/552,950 US6541248B1 (en) | 1998-02-17 | 2000-04-20 | Anti-viral vectors |
| US10/351,938 US7790419B2 (en) | 1998-02-17 | 2003-01-27 | Antiviral vectors |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB9803351.7 | 1998-02-17 | ||
| GBGB9803351.7A GB9803351D0 (en) | 1998-02-17 | 1998-02-17 | Anti-viral vectors |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/552,950 Continuation-In-Part US6541248B1 (en) | 1998-02-17 | 2000-04-20 | Anti-viral vectors |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1999041397A1 true WO1999041397A1 (en) | 1999-08-19 |
Family
ID=10827139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB1999/000325 Ceased WO1999041397A1 (en) | 1998-02-17 | 1999-02-17 | Anti-viral vectors |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US6541248B1 (https=) |
| EP (2) | EP1054988B1 (https=) |
| JP (1) | JP2002503477A (https=) |
| CN (1) | CN1297486A (https=) |
| AT (1) | ATE358732T1 (https=) |
| AU (1) | AU757284B2 (https=) |
| CA (1) | CA2321097A1 (https=) |
| DE (1) | DE69935714T2 (https=) |
| GB (1) | GB9803351D0 (https=) |
| WO (1) | WO1999041397A1 (https=) |
Cited By (145)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000055341A1 (en) * | 1999-03-17 | 2000-09-21 | Oxford Biomedica (Uk) Limited | Anti-viral vectors |
| WO2000039302A3 (en) * | 1998-12-31 | 2001-01-04 | Chiron Corp | Improved expression of hiv polypeptides and production of virus-like particles |
| WO2000039304A3 (en) * | 1998-12-31 | 2001-01-18 | Chiron Corp | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| WO2001079518A2 (en) | 2000-04-19 | 2001-10-25 | Oxford Biomedica (Uk) Limited | Codon optimisation for expression in retrovirus packaging cells |
| WO2001036614A3 (de) * | 1999-11-16 | 2002-02-28 | Geneart Gmbh Gessellschaft Fue | Das genom des hiv-1 intersubtyps (c/b') und seine anwendungen |
| WO2002024897A3 (en) * | 2000-09-22 | 2003-07-31 | Virxsys | Conditionally replicating viral vectors and their use |
| WO2003064665A2 (en) | 2002-02-01 | 2003-08-07 | Oxford Biomedica (Uk) Limited | Viral vector |
| EP1535995A1 (en) * | 1998-12-31 | 2005-06-01 | Chiron Corporation | Polynucleotides encoding the antigenic HIV type C env polypeptide and uses thereof |
| EP1320621A4 (en) * | 2000-09-15 | 2005-11-23 | Merck & Co Inc | IMPROVED ADENOVIRAL VACCINES OF THE FIRST GENERATION FOR THE EXPRESSION OF CODON-OPTIMIZED HIV-1 GAG, POL, NEF AND MODIFICATIONS (25.03.02) |
| US6969598B2 (en) | 2001-04-30 | 2005-11-29 | Oxford Biomedica (Uk) Limited | Methods for producing high titre vectors and compositions used in such methods |
| US7211659B2 (en) | 2001-07-05 | 2007-05-01 | Chiron Corporation | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
| US7427474B2 (en) | 2001-01-25 | 2008-09-23 | Virxsys Corporation | High-throughput methods for identifying gene function using lentiviral vectors |
| EP2020450A1 (en) * | 2000-09-01 | 2009-02-04 | Gen-Probe Incorporated | Amplification of HIV-1 sequences for detection of sequences associated with drug-resistance mutations |
| US7618642B2 (en) | 2000-07-05 | 2009-11-17 | Novartis Vaccines And Diagnostics, Inc. | Expression cassettes encoding modified human immunodeficiency virus type 1 subtype C envelope glycoproteins |
| EP2180057A1 (en) | 2000-10-06 | 2010-04-28 | Oxford Biomedica (UK) Limited | Vector system |
| US7790419B2 (en) | 1998-02-17 | 2010-09-07 | Oxford Biomedica (Uk) Ltd. | Antiviral vectors |
| US8043611B2 (en) | 2001-10-30 | 2011-10-25 | Virxsys Corporation | Regulated nucleic acid expression system |
| WO2012075337A2 (en) | 2010-12-01 | 2012-06-07 | Spinal Modulation, Inc. | Directed delivery of agents to neural anatomy |
| WO2013061076A1 (en) | 2011-10-28 | 2013-05-02 | Oxford Biomedica (Uk) Limited | Construct |
| WO2016042461A1 (en) | 2014-09-15 | 2016-03-24 | Molmed Spa | Chimeric antigen receptors |
| WO2016063264A1 (en) | 2014-10-24 | 2016-04-28 | Ospedale San Raffaele S.R.L. | Permanent epigenetic gene silencing |
| WO2016100389A1 (en) * | 2014-12-16 | 2016-06-23 | Synthetic Genomics, Inc. | Compositions of and methods for in vitro viral genome engineering |
| WO2017091786A1 (en) | 2015-11-23 | 2017-06-01 | Novartis Ag | Optimized lentiviral transfer vectors and uses thereof |
| EP3192874A1 (en) | 2008-06-18 | 2017-07-19 | Oxford BioMedica (UK) Limited | Virus purification |
| EP3318285A1 (en) | 2016-11-08 | 2018-05-09 | Oxford University Innovation Limited | Treatment of eye disease |
| WO2018099933A1 (en) | 2016-12-01 | 2018-06-07 | Nestec S.A. | Methods of modulating fam46a |
| EP3375876A1 (en) | 2017-03-13 | 2018-09-19 | Evonetix Ltd | Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures |
| WO2018178247A1 (en) | 2017-03-31 | 2018-10-04 | Nestec S.A. | Methods of modulating ank1 |
| WO2018193119A1 (en) | 2017-04-21 | 2018-10-25 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2018197492A1 (en) | 2017-04-24 | 2018-11-01 | Ospedale San Raffaele S.R.L. | Tcr and peptides |
| GB201900687D0 (en) | 2019-01-17 | 2019-03-06 | King S College London | Immunotherapeutic methods and compositions |
| WO2019068854A1 (en) | 2017-10-06 | 2019-04-11 | Ospedale San Raffaele S.R.L. | GENE THERAPY OF NEURODEGENERATIVE DISEASES USING VAA VECTORS |
| WO2019079488A1 (en) | 2017-10-17 | 2019-04-25 | Nightstarx Limited | PRENYLATION ASSAY |
| WO2019101490A1 (en) | 2017-11-21 | 2019-05-31 | Nestec S.A. | Methods of modulating alk |
| EP3502260A1 (en) | 2017-12-22 | 2019-06-26 | Oxford BioMedica (UK) Limited | Retroviral vector |
| WO2019134866A1 (en) | 2018-01-03 | 2019-07-11 | Molmed Spa | Chimeric antigen receptors containing optimal spacer region |
| WO2019222403A2 (en) | 2018-05-15 | 2019-11-21 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| WO2019219308A1 (en) | 2018-05-17 | 2019-11-21 | Societe Des Produits Nestle S.A. | Methods of modulating nkx6.3 |
| WO2019229109A1 (en) | 2018-05-30 | 2019-12-05 | Glycostem Therapeutics B.V. | Car nk cells |
| EP3587582A1 (en) | 2013-10-24 | 2020-01-01 | Adaptimmune Limited | Vectors for transgene expression |
| WO2020014209A1 (en) | 2018-07-09 | 2020-01-16 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| WO2020044055A1 (en) | 2018-08-31 | 2020-03-05 | King's College London | Engineered regulatory t cell |
| WO2020089433A2 (en) | 2018-10-31 | 2020-05-07 | Ospedale San Raffaele S.R.L | Tcr and peptides |
| EP3650548A1 (en) | 2013-12-20 | 2020-05-13 | Oxford BioMedica (UK) Limited | Viral vector production system |
| WO2020102503A2 (en) | 2018-11-14 | 2020-05-22 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions for t cell delivery |
| WO2020102499A2 (en) | 2018-11-14 | 2020-05-22 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions for cns delivery |
| WO2020102485A1 (en) | 2018-11-14 | 2020-05-22 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions for hematopoietic stem cell delivery |
| WO2020128478A1 (en) | 2018-12-19 | 2020-06-25 | King's College London | Immunotherapeutic methods and compositions |
| WO2020169974A1 (en) | 2019-02-19 | 2020-08-27 | King's College London | Hypoxia-responsive chimeric antigen receptors |
| WO2020183374A1 (en) | 2019-03-10 | 2020-09-17 | Axovant Sciences Gmbh | Gene therapy compositions and methods for treating parkinson's disease |
| WO2020212448A1 (en) | 2019-04-15 | 2020-10-22 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2020239964A1 (en) | 2019-05-28 | 2020-12-03 | Ospedale San Raffaele S.R.L. | Agents and methods for treating viral infections |
| GB202018657D0 (en) | 2020-11-26 | 2021-01-13 | Ospedale San Raffaele Srl | Agents and methods for increasing liver immune response |
| EP3786176A1 (en) | 2015-10-28 | 2021-03-03 | Syncona Investment Management Limited | Gene therapy |
| WO2021038249A1 (en) | 2019-08-30 | 2021-03-04 | King's College London | Engineered regulatory t cell |
| WO2021046143A1 (en) | 2019-09-03 | 2021-03-11 | Sana Biotechnology, Inc. | Cd24-associated particles and related methods and uses thereof |
| GB202102637D0 (en) | 2021-02-24 | 2021-04-07 | Quell Therapeutics Ltd | Engineered regulatory t cell |
| WO2021094752A1 (en) | 2019-11-12 | 2021-05-20 | Oxford Biomedica (Uk) Limited | Production system |
| WO2021160993A1 (en) | 2020-02-13 | 2021-08-19 | Oxford Biomedica (Uk) Limited | Production of lentiviral vectors |
| EP3868892A1 (en) | 2016-03-10 | 2021-08-25 | Nightstarx Limited | Prenylation assay |
| WO2021170666A1 (en) | 2020-02-25 | 2021-09-02 | Quell Therapeutics Limited | Chimeric receptors for use in engineered cells |
| DE102020106710A1 (de) | 2020-03-11 | 2021-09-16 | Immatics US, Inc. | Wpre-mutantenkonstrukte, zusammensetzungen und zugehörige verfahren |
| WO2021183643A1 (en) | 2020-03-11 | 2021-09-16 | Immatics US, Inc. | Wpre mutant constructs, compositions and methods thereof |
| WO2021181108A1 (en) | 2020-03-13 | 2021-09-16 | Oxford Biomedica (Uk) Limited | Lentiviral vectors |
| WO2021202604A1 (en) | 2020-03-31 | 2021-10-07 | Sana Biotechnology, Inc. | Targeted lipid particles and compositions and uses thereof |
| WO2021222222A1 (en) | 2020-04-27 | 2021-11-04 | Mccray Jr Paul B | Compositions and methods for the treatment of cystic fibrosis |
| WO2021229242A1 (en) | 2020-05-15 | 2021-11-18 | Oxford Biomedica (Uk) Limited | Viral vector production |
| WO2021229075A2 (en) | 2020-05-14 | 2021-11-18 | Ospedale San Raffaele S.R.L. | Epidermal growth factor receptor |
| GB202114529D0 (en) | 2021-10-12 | 2021-11-24 | Oxford Biomedica Ltd | Lentiviral vectors |
| GB202114530D0 (en) | 2021-10-12 | 2021-11-24 | Oxford Biomedica Ltd | Retroviral vectors |
| GB202114532D0 (en) | 2021-10-12 | 2021-11-24 | Oxford Biomedica Ltd | Lentiviral Vectors |
| WO2021236852A1 (en) | 2020-05-20 | 2021-11-25 | Sana Biotechnology, Inc. | Methods and compositions for treatment of viral infections |
| WO2022047316A1 (en) | 2020-08-28 | 2022-03-03 | Sana Biotechnology, Inc. | Modified anti-viral binding agents |
| WO2022043483A1 (en) | 2020-08-27 | 2022-03-03 | Quell Therapeutics Limited | Nucleic acid constructs for expressing polypeptides in cells |
| WO2022101617A1 (en) | 2020-11-10 | 2022-05-19 | Oxford Biomedica (Uk) Limited | Preparation of a solution of polymer/nucleic acid complexes |
| WO2022136874A1 (en) | 2020-12-23 | 2022-06-30 | Quell Therapeutics Limited | Inducible signalling protein |
| WO2022150731A1 (en) | 2021-01-11 | 2022-07-14 | Sana Biotechnology, Inc. | Use of cd8-targeted viral vectors |
| WO2022162247A1 (en) | 2021-02-01 | 2022-08-04 | Epsilen Bio S.R.L. | Gene silencing |
| WO2022171902A1 (en) | 2021-02-15 | 2022-08-18 | Ospedale San Raffaele S.R.L. | Epigenetic silencing for treatment of cancer |
| WO2022238556A1 (en) | 2021-05-12 | 2022-11-17 | Fondazione Telethon | Vector system |
| WO2022251712A1 (en) | 2021-05-28 | 2022-12-01 | Sana Biotechnology, Inc. | Lipid particles containing a truncated baboon endogenous retrovirus (baev) envelope glycoprotein and related methods and uses |
| WO2023015217A1 (en) | 2021-08-04 | 2023-02-09 | Sana Biotechnology, Inc. | Use of cd4-targeted viral vectors |
| WO2023047100A1 (en) | 2021-09-21 | 2023-03-30 | Quell Therapeutics Ltd | Anti-trem2 chimeric antigen receptor |
| WO2023047098A2 (en) | 2021-09-21 | 2023-03-30 | Quell Therapeutics Ltd | Anti-p75ntr chimeric antigen receptor |
| WO2023062359A2 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Novel viral regulatory elements |
| WO2023062363A1 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Lentiviral vectors |
| WO2023077107A1 (en) | 2021-10-29 | 2023-05-04 | Sana Biotechnology, Inc. | Methods and reagents for amplifying viral vector nucleic acid products |
| WO2023099886A1 (en) | 2021-11-30 | 2023-06-08 | Quell Therapeutics Limited | Signalling protein |
| WO2023115041A1 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae attachment glycoproteins |
| WO2023115039A2 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae fusion glycoproteins |
| WO2023114949A1 (en) | 2021-12-16 | 2023-06-22 | Sana Biotechnology, Inc. | Methods and systems of particle production |
| WO2023118878A1 (en) | 2021-12-22 | 2023-06-29 | Quell Therapeutics Limited | Constitutive cytokine receptors |
| EP4209511A1 (en) | 2022-01-05 | 2023-07-12 | Gyala Therapeutics Sociedad Limitada | Anti-cd84 antibodies amd chimeric antigen receptors |
| WO2023133595A2 (en) | 2022-01-10 | 2023-07-13 | Sana Biotechnology, Inc. | Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses |
| WO2023131657A1 (en) | 2022-01-05 | 2023-07-13 | Gyala Therapeutics Sociedad Limitada | Anti-cd84 antibodies and chimeric antigen receptors |
| WO2023150647A1 (en) | 2022-02-02 | 2023-08-10 | Sana Biotechnology, Inc. | Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses |
| WO2023150518A1 (en) | 2022-02-01 | 2023-08-10 | Sana Biotechnology, Inc. | Cd3-targeted lentiviral vectors and uses thereof |
| WO2023193015A1 (en) | 2022-04-01 | 2023-10-05 | Sana Biotechnology, Inc. | Cytokine receptor agonist and viral vector combination therapies |
| EP4269426A1 (en) | 2022-04-29 | 2023-11-01 | Ospedale San Raffaele S.r.l. | Gene therapy |
| EP4303226A1 (en) | 2022-07-08 | 2024-01-10 | Ospedale San Raffaele S.r.l. | Transgene cassettes and epigenetic silencers for the treatment of disorders |
| WO2024008950A1 (en) | 2022-07-08 | 2024-01-11 | Ospedale San Raffaele S.R.L. | Transgene cassettes |
| WO2024026377A1 (en) | 2022-07-27 | 2024-02-01 | Sana Biotechnology, Inc. | Methods of transduction using a viral vector and inhibitors of antiviral restriction factors |
| WO2024033544A1 (en) | 2022-08-12 | 2024-02-15 | Ospedale San Raffaele S.R.L. | Deglycosylation of native glycoproteins expressed on a tumor cell surface |
| WO2024038266A1 (en) | 2022-08-16 | 2024-02-22 | Oxford Biomedica (Uk) Limited | Envelope proteins |
| WO2024044655A1 (en) | 2022-08-24 | 2024-02-29 | Sana Biotechnology, Inc. | Delivery of heterologous proteins |
| WO2024064838A1 (en) | 2022-09-21 | 2024-03-28 | Sana Biotechnology, Inc. | Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof |
| WO2024081820A1 (en) | 2022-10-13 | 2024-04-18 | Sana Biotechnology, Inc. | Viral particles targeting hematopoietic stem cells |
| WO2024100145A1 (en) | 2022-11-08 | 2024-05-16 | Ospedale San Raffaele S.R.L. | Polynucleotide and vector |
| WO2024100294A1 (en) | 2022-11-11 | 2024-05-16 | Ospedale San Raffaele S.R.L. | Cdh17 car |
| WO2024110751A1 (en) | 2022-11-24 | 2024-05-30 | Quell Therapeutics Limited | Constitutively active chimeric antigen receptor for treg cell survival and/or persistence |
| WO2024119157A1 (en) | 2022-12-02 | 2024-06-06 | Sana Biotechnology, Inc. | Lipid particles with cofusogens and methods of producing and using the same |
| WO2024133472A1 (en) | 2022-12-22 | 2024-06-27 | Quell Therapeutics Limited | Constitutive cytokine receptors |
| EP4403580A1 (en) | 2023-01-23 | 2024-07-24 | Medizinische Hochschule Hannover | Anti-entpd3 chimeric antigen receptor |
| WO2024153644A1 (en) | 2023-01-16 | 2024-07-25 | Ospedale San Raffaele S.R.L. | T-cell receptors |
| WO2024156716A1 (en) | 2023-01-23 | 2024-08-02 | Medizinische Hochschule Hannover | Anti-entpd3 chimeric antigen receptor |
| WO2024165859A1 (en) | 2023-02-07 | 2024-08-15 | Quell Therapeutics Limited | Culture method for treg cells |
| EP4420676A1 (en) | 2023-02-24 | 2024-08-28 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024175805A1 (en) | 2023-02-24 | 2024-08-29 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| US12077774B2 (en) | 2018-04-18 | 2024-09-03 | UCL Business Ltd. | Method for enhancing the suppressive properties of Treg cells |
| EP4434539A1 (en) | 2023-03-20 | 2024-09-25 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024194605A1 (en) | 2023-03-17 | 2024-09-26 | Quell Therapeutics Limited | Treg therapy |
| WO2024194649A1 (en) | 2023-03-22 | 2024-09-26 | Quell Therapeutics Limited | Engineered t cells and uses thereof |
| WO2024194491A1 (en) | 2023-03-22 | 2024-09-26 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2024194223A2 (en) | 2023-03-17 | 2024-09-26 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2024194642A1 (en) | 2023-03-22 | 2024-09-26 | Quell Therapeutics Limited | Engineered t regulatory cell |
| WO2024194355A1 (en) | 2023-03-20 | 2024-09-26 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024220597A2 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Digital droplet based assay for detecting replication competent lentiviral vector |
| WO2024220560A1 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Engineered protein g fusogens and related lipid particles and methods thereof |
| WO2024220574A1 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Universal protein g fusogens and adapter systems thereof and related lipid particles and uses |
| WO2024236193A1 (en) | 2023-05-17 | 2024-11-21 | Ospedale San Raffaele S.R.L. | Vector |
| WO2024243340A1 (en) | 2023-05-23 | 2024-11-28 | Sana Biotechnology, Inc. | Tandem fusogens and related lipid particles |
| WO2024259299A1 (en) | 2023-06-14 | 2024-12-19 | The Broad Institute, Inc. | Compositions and methods for identification of vhh antibodies that bind a target antigen |
| WO2024261480A1 (en) | 2023-06-21 | 2024-12-26 | Quell Therapeutics Limited | Constitutive cytokine receptors |
| WO2025003481A2 (en) | 2023-06-28 | 2025-01-02 | Ospedale San Raffaele S.R.L. | T-cell receptors |
| USRE50283E1 (en) | 2013-04-18 | 2025-01-28 | Fondazione Telethon Ets | Effective delivery of large genes by dual AAV vectors |
| WO2025032194A1 (en) | 2023-08-08 | 2025-02-13 | Ospedale San Raffaele S.R.L. | T-cell receptors |
| IT202300022191A1 (it) | 2023-10-24 | 2025-04-24 | Fond Telethon Ets | Mezzi e metodi per la modifica genetica di uba1 |
| WO2025088077A1 (en) | 2023-10-24 | 2025-05-01 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2025109189A1 (en) | 2023-11-24 | 2025-05-30 | Ospedale San Raffaele S.R.L. | Engineered regulatory t cells and uses thereof |
| WO2025184529A1 (en) | 2024-03-01 | 2025-09-04 | Sana Biotechnology, Inc. | Viral particles with fusogen display and related compositions and methods |
| EP4640830A1 (en) | 2024-04-23 | 2025-10-29 | Fondazione Telethon ETS | Means and methods for safe and efficient gene editing in cells |
| WO2026008994A1 (en) | 2024-07-04 | 2026-01-08 | Quell Therapeutics Limited | Expression construct |
| WO2026027876A1 (en) | 2024-07-29 | 2026-02-05 | Quell Therapeutics Limited | Chimeric antigen receptor |
| WO2026033206A1 (en) | 2024-08-06 | 2026-02-12 | Quell Therapeutics Limited | Method for culturing regulatory t-cells |
| WO2026078259A1 (en) | 2024-10-11 | 2026-04-16 | Ospedale San Raffaele S.R.L. | Mesoangioblast cell production methods and products |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8202846B2 (en) | 2000-03-16 | 2012-06-19 | Cold Spring Harbor Laboratory | Methods and compositions for RNA interference |
| EP1272630A2 (en) * | 2000-03-16 | 2003-01-08 | Genetica, Inc. | Methods and compositions for rna interference |
| GB0526211D0 (en) * | 2005-12-22 | 2006-02-01 | Oxford Biomedica Ltd | Viral vectors |
| WO2008134879A1 (en) | 2007-05-04 | 2008-11-13 | University Health Network | Il-12 immunotherapy for cancer |
| US20090088625A1 (en) * | 2007-10-01 | 2009-04-02 | Kenneth Oosting | Photonic Based Non-Invasive Surgery System That Includes Automated Cell Control and Eradication Via Pre-Calculated Feed-Forward Control Plus Image Feedback Control For Targeted Energy Delivery |
| WO2014093965A1 (en) * | 2012-12-14 | 2014-06-19 | Case Western Reserve University | Genomic rna packaging enhancer element |
| US20250000966A1 (en) * | 2021-10-13 | 2025-01-02 | The Cleveland Clinic Foundation | Mrna vaccine design via the alteration of codon usage |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0612844A2 (en) * | 1993-02-25 | 1994-08-31 | Ortho Pharmaceutical Corporation | Expression constructs containing HIV inhibitory antisense and other nucleotide sequences, retroviral vectors and recombinant retroviruses containing same |
| EP0759471A1 (en) * | 1994-05-10 | 1997-02-26 | Hisamitsu Pharmaceutical Co., Inc. | Recombinant human immunodeficiency virus vector and process for producing the same |
| WO1997020060A1 (en) * | 1995-11-28 | 1997-06-05 | The Johns Hopkins University School Of Medicine | Conditionally replicating viral vectors and their use |
Family Cites Families (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR8807631A (pt) | 1987-07-29 | 1990-06-26 | Basf Lacke & Farben | Banhos de laca de eletro-imersao aquosos,contendo resinas sinteticas catodicamente precipitaveis e processo para o revestimento de substratos eletricamente condutores |
| DE69434860T2 (de) | 1993-02-22 | 2007-03-15 | The Rockefeller University | Herstellung von helfer-freien retroviren mit hohem titer mittels transienter transfektion |
| US5834256A (en) | 1993-06-11 | 1998-11-10 | Cell Genesys, Inc. | Method for production of high titer virus and high efficiency retroviral mediated transduction of mammalian cells |
| DE69535669T2 (de) | 1994-05-09 | 2008-12-04 | Oxford Biomedica (Uk) Ltd. | Retrovirale vektoren mit verminderter rekombinationsrate |
| US6013517A (en) | 1994-05-09 | 2000-01-11 | Chiron Corporation | Crossless retroviral vectors |
| US5795737A (en) * | 1994-09-19 | 1998-08-18 | The General Hospital Corporation | High level expression of proteins |
| US5786464C1 (en) | 1994-09-19 | 2012-04-24 | Gen Hospital Corp | Overexpression of mammalian and viral proteins |
| CA2221769C (en) * | 1995-05-26 | 2003-07-01 | Asahi Kasei Kogyo Kabushiki Kaisha | Method for quantitatively determining an antibody having the ability to inhibit the activity of a reverse transcriptase |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| GB9525639D0 (en) | 1995-12-15 | 1996-02-14 | Isis Innovation | Improved retroviral vectors |
| WO1997027310A1 (en) | 1996-01-23 | 1997-07-31 | Oxford Biomedica (Uk) Limited | Retroviral vector and its use in gene therapy |
| PL328730A1 (en) | 1996-02-22 | 1999-02-15 | Merck & Co Inc | Synthetic hiv genes |
| WO1997042338A1 (en) | 1996-05-06 | 1997-11-13 | Chiron Corporation | Crossless retroviral vectors |
| US6114148C1 (en) | 1996-09-20 | 2012-05-01 | Gen Hospital Corp | High level expression of proteins |
| PT904392E (pt) | 1996-10-17 | 2001-06-29 | Oxford Biomedica Ltd | Vectores retrovirais |
| GB9621680D0 (en) | 1996-10-17 | 1996-12-11 | Oxford Biomedica Ltd | Lentiviral vectors |
| EE9900343A (et) * | 1997-02-07 | 2000-02-15 | Merck & Co., Inc. | Sünteetiline polünukleotiid, immuunvastuste tekitamise meetod, immunogeenne kompositsioon, anti-HIV immuunvastuste indutseerimise meetod, meetod antigeeni tekitava raku indutseerimiseks ja farmatseutiline kompositsioon |
| US6696291B2 (en) * | 1997-02-07 | 2004-02-24 | Merck & Co., Inc. | Synthetic HIV gag genes |
| IL132463A0 (en) | 1997-05-13 | 2001-03-19 | Univ North Carolina | Lentivirus - based gene transfer vectors |
| ES2373406T3 (es) | 1997-12-22 | 2012-02-03 | Oxford Biomedica (Uk) Limited | Vectores basados en el virus de la anemia infecciosa equina (vaie). |
| GB9803351D0 (en) | 1998-02-17 | 1998-04-15 | Oxford Biomedica Ltd | Anti-viral vectors |
| WO2000015819A1 (en) | 1998-09-11 | 2000-03-23 | The Children's Medical Center Corporation | Packaging cell lines for hiv-derived retroviral vector particles |
| US6958226B1 (en) * | 1998-09-11 | 2005-10-25 | The Children's Medical Center Corp. | Packaging cells comprising codon-optimized gagpol sequences and lacking lentiviral accessory proteins |
| GB9825524D0 (en) | 1998-11-20 | 1999-01-13 | Oxford Biomedica Ltd | Vector |
| AU2221600A (en) | 1998-12-31 | 2000-07-31 | Chiron Corporation | Improved expression of hiv polypeptides and production of virus-like particles |
| GB9906177D0 (en) | 1999-03-17 | 1999-05-12 | Oxford Biomedica Ltd | Anti-viral vectors |
| BR0010077A (pt) | 1999-04-26 | 2002-01-15 | K U Leuven Res & Dev Universit | Gene sintético para expressão de uma proteìna retroviral ativa em eucariotas |
| GB9923558D0 (en) | 1999-10-05 | 1999-12-08 | Oxford Biomedica Ltd | Producer cell |
-
1998
- 1998-02-17 GB GBGB9803351.7A patent/GB9803351D0/en not_active Ceased
-
1999
- 1999-02-17 EP EP99904956A patent/EP1054988B1/en not_active Expired - Lifetime
- 1999-02-17 WO PCT/GB1999/000325 patent/WO1999041397A1/en not_active Ceased
- 1999-02-17 AU AU25274/99A patent/AU757284B2/en not_active Expired
- 1999-02-17 CA CA002321097A patent/CA2321097A1/en not_active Abandoned
- 1999-02-17 DE DE69935714T patent/DE69935714T2/de not_active Expired - Lifetime
- 1999-02-17 EP EP07000193A patent/EP1790658A3/en not_active Withdrawn
- 1999-02-17 CN CN99805126A patent/CN1297486A/zh active Pending
- 1999-02-17 AT AT99904956T patent/ATE358732T1/de not_active IP Right Cessation
- 1999-02-17 JP JP2000531578A patent/JP2002503477A/ja not_active Ceased
-
2000
- 2000-04-20 US US09/552,950 patent/US6541248B1/en not_active Expired - Lifetime
-
2003
- 2003-01-27 US US10/351,938 patent/US7790419B2/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0612844A2 (en) * | 1993-02-25 | 1994-08-31 | Ortho Pharmaceutical Corporation | Expression constructs containing HIV inhibitory antisense and other nucleotide sequences, retroviral vectors and recombinant retroviruses containing same |
| EP0759471A1 (en) * | 1994-05-10 | 1997-02-26 | Hisamitsu Pharmaceutical Co., Inc. | Recombinant human immunodeficiency virus vector and process for producing the same |
| WO1997020060A1 (en) * | 1995-11-28 | 1997-06-05 | The Johns Hopkins University School Of Medicine | Conditionally replicating viral vectors and their use |
Non-Patent Citations (1)
| Title |
|---|
| VANDENDRIESSCHE T ET AL: "Inhibition of clinical human immunodeficiency virus (HIV) type 1 isolates in primary CD4+ T lymphocytes by retroviral vectors expressing anti-HIV genes", JOURNAL OF VIROLOGY, vol. 69, no. 7, July 1995 (1995-07-01), AMERICAN SOCIETY FOR MICROBIOLOGY US, pages 4045 - 4052, XP002109322 * |
Cited By (197)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7790419B2 (en) | 1998-02-17 | 2010-09-07 | Oxford Biomedica (Uk) Ltd. | Antiviral vectors |
| EP1980617A1 (en) * | 1998-12-31 | 2008-10-15 | Novartis Vaccines and Diagnostics, Inc. | Improved expression of HIV polypeptides and production of virus-like particles |
| WO2000039302A3 (en) * | 1998-12-31 | 2001-01-04 | Chiron Corp | Improved expression of hiv polypeptides and production of virus-like particles |
| US7348177B2 (en) | 1998-12-31 | 2008-03-25 | Novartis Vaccines And Diagnostics, Inc. | Expression of HIV polypeptides and production of virus-like particles |
| EP2206785A1 (en) * | 1998-12-31 | 2010-07-14 | Novartis Vaccines and Diagnostics, Inc. | Improved expression of HIV polypeptides and production of virus-like particles |
| US7935805B1 (en) | 1998-12-31 | 2011-05-03 | Novartis Vaccines & Diagnostics, Inc | Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof |
| US7943375B2 (en) | 1998-12-31 | 2011-05-17 | Novartis Vaccines & Diagnostics, Inc | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
| WO2000039304A3 (en) * | 1998-12-31 | 2001-01-18 | Chiron Corp | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| EP1535995A1 (en) * | 1998-12-31 | 2005-06-01 | Chiron Corporation | Polynucleotides encoding the antigenic HIV type C env polypeptide and uses thereof |
| US6783981B1 (en) | 1999-03-17 | 2004-08-31 | Oxford Biomedica (Uk) Limited | Anti-viral vectors |
| GB2363794A (en) * | 1999-03-17 | 2002-01-09 | Oxford Biomedica Ltd | Anti-viral vectors |
| WO2000055341A1 (en) * | 1999-03-17 | 2000-09-21 | Oxford Biomedica (Uk) Limited | Anti-viral vectors |
| WO2001036614A3 (de) * | 1999-11-16 | 2002-02-28 | Geneart Gmbh Gessellschaft Fue | Das genom des hiv-1 intersubtyps (c/b') und seine anwendungen |
| US7323557B2 (en) | 1999-11-16 | 2008-01-29 | Geneart Ag | Genome of the HIV-1 inter-subtype (C/B') and use thereof |
| US7332588B1 (en) | 1999-11-16 | 2008-02-19 | Geneart Ag | Genome of the HIV-1 inter-subtype (C/B) and use thereof |
| AP1674A (en) * | 1999-11-16 | 2006-10-30 | Geneart Ag | The genome of the HIV-1 inter-subtype (C/B') and use thereof. |
| JP2004508808A (ja) * | 2000-04-19 | 2004-03-25 | オックスフォード バイオメディカ(ユーケイ)リミテッド | レトロウイルスパッケージング細胞での発現のためのコドン最適化 |
| AU2001248619B2 (en) * | 2000-04-19 | 2006-06-15 | Oxford Biomedica (Uk) Limited | Method |
| WO2001079518A2 (en) | 2000-04-19 | 2001-10-25 | Oxford Biomedica (Uk) Limited | Codon optimisation for expression in retrovirus packaging cells |
| WO2001079518A3 (en) * | 2000-04-19 | 2002-05-16 | Oxford Biomedica Ltd | Codon optimisation for expression in retrovirus packaging cells |
| EP2194137A3 (en) * | 2000-04-19 | 2010-07-28 | Oxford BioMedica (UK) Limited | Cells comprising codon optimized retroviral particles |
| EP2194137A2 (en) | 2000-04-19 | 2010-06-09 | Oxford BioMedica (UK) Limited | Cells comprising codon optimized retroviral particles |
| US7618642B2 (en) | 2000-07-05 | 2009-11-17 | Novartis Vaccines And Diagnostics, Inc. | Expression cassettes encoding modified human immunodeficiency virus type 1 subtype C envelope glycoproteins |
| EP2020450A1 (en) * | 2000-09-01 | 2009-02-04 | Gen-Probe Incorporated | Amplification of HIV-1 sequences for detection of sequences associated with drug-resistance mutations |
| EP1320621A4 (en) * | 2000-09-15 | 2005-11-23 | Merck & Co Inc | IMPROVED ADENOVIRAL VACCINES OF THE FIRST GENERATION FOR THE EXPRESSION OF CODON-OPTIMIZED HIV-1 GAG, POL, NEF AND MODIFICATIONS (25.03.02) |
| WO2002024897A3 (en) * | 2000-09-22 | 2003-07-31 | Virxsys | Conditionally replicating viral vectors and their use |
| EP2180057A1 (en) | 2000-10-06 | 2010-04-28 | Oxford Biomedica (UK) Limited | Vector system |
| US7427474B2 (en) | 2001-01-25 | 2008-09-23 | Virxsys Corporation | High-throughput methods for identifying gene function using lentiviral vectors |
| US6969598B2 (en) | 2001-04-30 | 2005-11-29 | Oxford Biomedica (Uk) Limited | Methods for producing high titre vectors and compositions used in such methods |
| US9598469B2 (en) | 2001-07-05 | 2017-03-21 | Novartis Vaccines And Diagnostics, Inc. | HIV-1 south african subtype C env proteins |
| US7211659B2 (en) | 2001-07-05 | 2007-05-01 | Chiron Corporation | Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof |
| US8133494B2 (en) | 2001-07-05 | 2012-03-13 | Novartis Vaccine & Diagnostics Inc | Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2 |
| US8043611B2 (en) | 2001-10-30 | 2011-10-25 | Virxsys Corporation | Regulated nucleic acid expression system |
| WO2003064665A2 (en) | 2002-02-01 | 2003-08-07 | Oxford Biomedica (Uk) Limited | Viral vector |
| JP2010263904A (ja) * | 2002-02-01 | 2010-11-25 | Oxford Biomedica (Uk) Ltd | ウイルスベクター |
| EP2348119A2 (en) | 2002-02-01 | 2011-07-27 | Oxford BioMedica (UK) Limited | Multicistronic lentiviral vector |
| EP3192874A1 (en) | 2008-06-18 | 2017-07-19 | Oxford BioMedica (UK) Limited | Virus purification |
| WO2012075337A2 (en) | 2010-12-01 | 2012-06-07 | Spinal Modulation, Inc. | Directed delivery of agents to neural anatomy |
| WO2013061076A1 (en) | 2011-10-28 | 2013-05-02 | Oxford Biomedica (Uk) Limited | Construct |
| EP3219801A1 (en) | 2011-10-28 | 2017-09-20 | Oxford BioMedica (UK) Limited | Construct |
| USRE50283E1 (en) | 2013-04-18 | 2025-01-28 | Fondazione Telethon Ets | Effective delivery of large genes by dual AAV vectors |
| EP3587582A1 (en) | 2013-10-24 | 2020-01-01 | Adaptimmune Limited | Vectors for transgene expression |
| EP3650548A1 (en) | 2013-12-20 | 2020-05-13 | Oxford BioMedica (UK) Limited | Viral vector production system |
| EP3575315A1 (en) | 2014-09-15 | 2019-12-04 | MolMed SpA | Chimeric antigen receptors |
| US11299529B2 (en) | 2014-09-15 | 2022-04-12 | Agc Biologics S.P.A. | Chimeric antigen receptors |
| EP4159752A1 (en) | 2014-09-15 | 2023-04-05 | MolMed SpA | Chimeric antigen receptors |
| WO2016042461A1 (en) | 2014-09-15 | 2016-03-24 | Molmed Spa | Chimeric antigen receptors |
| US12152240B2 (en) | 2014-10-24 | 2024-11-26 | Ospedale San Raffaele S.R.L. | Permanent epigenetic gene silencing |
| WO2016063264A1 (en) | 2014-10-24 | 2016-04-28 | Ospedale San Raffaele S.R.L. | Permanent epigenetic gene silencing |
| US10221398B2 (en) | 2014-12-16 | 2019-03-05 | C3J Therapeutics, Inc. | Compositions of and methods for in vitro viral genome engineering |
| WO2016100389A1 (en) * | 2014-12-16 | 2016-06-23 | Synthetic Genomics, Inc. | Compositions of and methods for in vitro viral genome engineering |
| EA038595B1 (ru) * | 2014-12-16 | 2021-09-21 | Си3Джей ТЕРАПЬЮТИКС, ИНК. | Композиции и способы для конструирования вирусного генома in vitro |
| US11913032B2 (en) | 2014-12-16 | 2024-02-27 | C3J Therapeutics, Inc. | Compositions of and methods for in vitro viral genome engineering |
| US10711253B2 (en) | 2014-12-16 | 2020-07-14 | C3J Therapeutics, Inc. | Compositions of and methods for in vitro viral genome engineering |
| US10837004B2 (en) | 2014-12-16 | 2020-11-17 | C3J Therapeutics, Inc. | Compositions of and methods for in vitro viral genome engineering |
| EP3786176A1 (en) | 2015-10-28 | 2021-03-03 | Syncona Investment Management Limited | Gene therapy |
| WO2017091786A1 (en) | 2015-11-23 | 2017-06-01 | Novartis Ag | Optimized lentiviral transfer vectors and uses thereof |
| EP4458957A2 (en) | 2015-11-23 | 2024-11-06 | Novartis AG | Optimized lentiviral transfer vectors and uses thereof |
| EP3868892A1 (en) | 2016-03-10 | 2021-08-25 | Nightstarx Limited | Prenylation assay |
| EP3318285A1 (en) | 2016-11-08 | 2018-05-09 | Oxford University Innovation Limited | Treatment of eye disease |
| WO2018099933A1 (en) | 2016-12-01 | 2018-06-07 | Nestec S.A. | Methods of modulating fam46a |
| WO2018167475A1 (en) | 2017-03-13 | 2018-09-20 | Evonetix Ltd | Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures |
| US12071650B2 (en) | 2017-03-13 | 2024-08-27 | Evonetix Ltd | Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures |
| EP3375876A1 (en) | 2017-03-13 | 2018-09-19 | Evonetix Ltd | Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures |
| WO2018178247A1 (en) | 2017-03-31 | 2018-10-04 | Nestec S.A. | Methods of modulating ank1 |
| EP4491233A2 (en) | 2017-04-21 | 2025-01-15 | Ospedale San Raffaele S.r.l. | Gene therapy |
| CN110785488A (zh) * | 2017-04-21 | 2020-02-11 | 圣拉斐尔医院有限责任公司 | 基因疗法 |
| WO2018193119A1 (en) | 2017-04-21 | 2018-10-25 | Ospedale San Raffaele S.R.L. | Gene therapy |
| US11597755B2 (en) | 2017-04-24 | 2023-03-07 | Ospedale San Raffaele S.R.L. | TCR and peptides |
| WO2018197492A1 (en) | 2017-04-24 | 2018-11-01 | Ospedale San Raffaele S.R.L. | Tcr and peptides |
| EP4585681A2 (en) | 2017-04-24 | 2025-07-16 | Ospedale San Raffaele S.r.l. | Tcr and peptides |
| WO2019068854A1 (en) | 2017-10-06 | 2019-04-11 | Ospedale San Raffaele S.R.L. | GENE THERAPY OF NEURODEGENERATIVE DISEASES USING VAA VECTORS |
| WO2019079488A1 (en) | 2017-10-17 | 2019-04-25 | Nightstarx Limited | PRENYLATION ASSAY |
| WO2019101490A1 (en) | 2017-11-21 | 2019-05-31 | Nestec S.A. | Methods of modulating alk |
| EP3502260A1 (en) | 2017-12-22 | 2019-06-26 | Oxford BioMedica (UK) Limited | Retroviral vector |
| EP3696272A1 (en) | 2017-12-22 | 2020-08-19 | Oxford BioMedica (UK) Limited | Retroviral vector |
| EP3633040A1 (en) | 2017-12-22 | 2020-04-08 | Oxford BioMedica (UK) Limited | Retroviral vector |
| WO2019134866A1 (en) | 2018-01-03 | 2019-07-11 | Molmed Spa | Chimeric antigen receptors containing optimal spacer region |
| US12077774B2 (en) | 2018-04-18 | 2024-09-03 | UCL Business Ltd. | Method for enhancing the suppressive properties of Treg cells |
| WO2019222403A2 (en) | 2018-05-15 | 2019-11-21 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| WO2019219308A1 (en) | 2018-05-17 | 2019-11-21 | Societe Des Produits Nestle S.A. | Methods of modulating nkx6.3 |
| WO2019229109A1 (en) | 2018-05-30 | 2019-12-05 | Glycostem Therapeutics B.V. | Car nk cells |
| US12378578B2 (en) | 2018-07-09 | 2025-08-05 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| WO2020014209A1 (en) | 2018-07-09 | 2020-01-16 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions and uses thereof |
| WO2020044055A1 (en) | 2018-08-31 | 2020-03-05 | King's College London | Engineered regulatory t cell |
| WO2020089433A2 (en) | 2018-10-31 | 2020-05-07 | Ospedale San Raffaele S.R.L | Tcr and peptides |
| WO2020102485A1 (en) | 2018-11-14 | 2020-05-22 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions for hematopoietic stem cell delivery |
| WO2020102503A2 (en) | 2018-11-14 | 2020-05-22 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions for t cell delivery |
| WO2020102499A2 (en) | 2018-11-14 | 2020-05-22 | Flagship Pioneering Innovations V, Inc. | Fusosome compositions for cns delivery |
| WO2020128478A1 (en) | 2018-12-19 | 2020-06-25 | King's College London | Immunotherapeutic methods and compositions |
| GB201900687D0 (en) | 2019-01-17 | 2019-03-06 | King S College London | Immunotherapeutic methods and compositions |
| WO2020169974A1 (en) | 2019-02-19 | 2020-08-27 | King's College London | Hypoxia-responsive chimeric antigen receptors |
| WO2020183374A1 (en) | 2019-03-10 | 2020-09-17 | Axovant Sciences Gmbh | Gene therapy compositions and methods for treating parkinson's disease |
| WO2020212448A1 (en) | 2019-04-15 | 2020-10-22 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2020239964A1 (en) | 2019-05-28 | 2020-12-03 | Ospedale San Raffaele S.R.L. | Agents and methods for treating viral infections |
| WO2021038249A1 (en) | 2019-08-30 | 2021-03-04 | King's College London | Engineered regulatory t cell |
| WO2021046143A1 (en) | 2019-09-03 | 2021-03-11 | Sana Biotechnology, Inc. | Cd24-associated particles and related methods and uses thereof |
| WO2021094752A1 (en) | 2019-11-12 | 2021-05-20 | Oxford Biomedica (Uk) Limited | Production system |
| WO2021160993A1 (en) | 2020-02-13 | 2021-08-19 | Oxford Biomedica (Uk) Limited | Production of lentiviral vectors |
| WO2021170666A1 (en) | 2020-02-25 | 2021-09-02 | Quell Therapeutics Limited | Chimeric receptors for use in engineered cells |
| DE102020111571A1 (de) | 2020-03-11 | 2021-09-16 | Immatics US, Inc. | Wpre-mutantenkonstrukte, zusammensetzungen und zugehörige verfahren |
| DE102020106710A1 (de) | 2020-03-11 | 2021-09-16 | Immatics US, Inc. | Wpre-mutantenkonstrukte, zusammensetzungen und zugehörige verfahren |
| WO2021183643A1 (en) | 2020-03-11 | 2021-09-16 | Immatics US, Inc. | Wpre mutant constructs, compositions and methods thereof |
| WO2021181108A1 (en) | 2020-03-13 | 2021-09-16 | Oxford Biomedica (Uk) Limited | Lentiviral vectors |
| WO2021202604A1 (en) | 2020-03-31 | 2021-10-07 | Sana Biotechnology, Inc. | Targeted lipid particles and compositions and uses thereof |
| WO2021222222A1 (en) | 2020-04-27 | 2021-11-04 | Mccray Jr Paul B | Compositions and methods for the treatment of cystic fibrosis |
| WO2021229075A2 (en) | 2020-05-14 | 2021-11-18 | Ospedale San Raffaele S.R.L. | Epidermal growth factor receptor |
| WO2021229242A1 (en) | 2020-05-15 | 2021-11-18 | Oxford Biomedica (Uk) Limited | Viral vector production |
| WO2021236852A1 (en) | 2020-05-20 | 2021-11-25 | Sana Biotechnology, Inc. | Methods and compositions for treatment of viral infections |
| WO2022043483A1 (en) | 2020-08-27 | 2022-03-03 | Quell Therapeutics Limited | Nucleic acid constructs for expressing polypeptides in cells |
| WO2022047316A1 (en) | 2020-08-28 | 2022-03-03 | Sana Biotechnology, Inc. | Modified anti-viral binding agents |
| EP4335458A2 (en) | 2020-11-10 | 2024-03-13 | Oxford BioMedica (UK) Limited | Preparation of a solution of polymer/nucleic acid complexes |
| EP4335457A2 (en) | 2020-11-10 | 2024-03-13 | Oxford BioMedica (UK) Limited | Preparation of a solution of polymer/nucleic acid complexes |
| WO2022101617A1 (en) | 2020-11-10 | 2022-05-19 | Oxford Biomedica (Uk) Limited | Preparation of a solution of polymer/nucleic acid complexes |
| WO2022112522A1 (en) | 2020-11-26 | 2022-06-02 | Ospedale San Raffaele S.R.L. | Agents and methods for increasing liver immune response |
| GB202018657D0 (en) | 2020-11-26 | 2021-01-13 | Ospedale San Raffaele Srl | Agents and methods for increasing liver immune response |
| WO2022136874A1 (en) | 2020-12-23 | 2022-06-30 | Quell Therapeutics Limited | Inducible signalling protein |
| WO2022150731A1 (en) | 2021-01-11 | 2022-07-14 | Sana Biotechnology, Inc. | Use of cd8-targeted viral vectors |
| WO2022162247A1 (en) | 2021-02-01 | 2022-08-04 | Epsilen Bio S.R.L. | Gene silencing |
| WO2022171902A1 (en) | 2021-02-15 | 2022-08-18 | Ospedale San Raffaele S.R.L. | Epigenetic silencing for treatment of cancer |
| WO2022180152A1 (en) | 2021-02-24 | 2022-09-01 | Quell Therapeutics Limited | Engineered regulatory t cell |
| GB202102637D0 (en) | 2021-02-24 | 2021-04-07 | Quell Therapeutics Ltd | Engineered regulatory t cell |
| WO2022238556A1 (en) | 2021-05-12 | 2022-11-17 | Fondazione Telethon | Vector system |
| WO2022251712A1 (en) | 2021-05-28 | 2022-12-01 | Sana Biotechnology, Inc. | Lipid particles containing a truncated baboon endogenous retrovirus (baev) envelope glycoprotein and related methods and uses |
| WO2023015217A1 (en) | 2021-08-04 | 2023-02-09 | Sana Biotechnology, Inc. | Use of cd4-targeted viral vectors |
| WO2023047098A2 (en) | 2021-09-21 | 2023-03-30 | Quell Therapeutics Ltd | Anti-p75ntr chimeric antigen receptor |
| WO2023047100A1 (en) | 2021-09-21 | 2023-03-30 | Quell Therapeutics Ltd | Anti-trem2 chimeric antigen receptor |
| GB202114530D0 (en) | 2021-10-12 | 2021-11-24 | Oxford Biomedica Ltd | Retroviral vectors |
| WO2023062367A1 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Lentiviral vectors |
| WO2023062359A2 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Novel viral regulatory elements |
| WO2023062363A1 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Lentiviral vectors |
| WO2023062366A1 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Retroviral vectors |
| WO2023062365A2 (en) | 2021-10-12 | 2023-04-20 | Oxford Biomedica (Uk) Limited | Lentiviral vectors |
| EP4530355A2 (en) | 2021-10-12 | 2025-04-02 | Oxford BioMedica (UK) Limited | Lentiviral vectors |
| GB202114529D0 (en) | 2021-10-12 | 2021-11-24 | Oxford Biomedica Ltd | Lentiviral vectors |
| GB202114532D0 (en) | 2021-10-12 | 2021-11-24 | Oxford Biomedica Ltd | Lentiviral Vectors |
| WO2023077107A1 (en) | 2021-10-29 | 2023-05-04 | Sana Biotechnology, Inc. | Methods and reagents for amplifying viral vector nucleic acid products |
| WO2023099886A1 (en) | 2021-11-30 | 2023-06-08 | Quell Therapeutics Limited | Signalling protein |
| WO2023114949A1 (en) | 2021-12-16 | 2023-06-22 | Sana Biotechnology, Inc. | Methods and systems of particle production |
| WO2023115039A2 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae fusion glycoproteins |
| WO2023115041A1 (en) | 2021-12-17 | 2023-06-22 | Sana Biotechnology, Inc. | Modified paramyxoviridae attachment glycoproteins |
| WO2023118878A1 (en) | 2021-12-22 | 2023-06-29 | Quell Therapeutics Limited | Constitutive cytokine receptors |
| WO2023131657A1 (en) | 2022-01-05 | 2023-07-13 | Gyala Therapeutics Sociedad Limitada | Anti-cd84 antibodies and chimeric antigen receptors |
| EP4209511A1 (en) | 2022-01-05 | 2023-07-12 | Gyala Therapeutics Sociedad Limitada | Anti-cd84 antibodies amd chimeric antigen receptors |
| WO2023133595A2 (en) | 2022-01-10 | 2023-07-13 | Sana Biotechnology, Inc. | Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses |
| WO2023150518A1 (en) | 2022-02-01 | 2023-08-10 | Sana Biotechnology, Inc. | Cd3-targeted lentiviral vectors and uses thereof |
| WO2023150647A1 (en) | 2022-02-02 | 2023-08-10 | Sana Biotechnology, Inc. | Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses |
| WO2023193015A1 (en) | 2022-04-01 | 2023-10-05 | Sana Biotechnology, Inc. | Cytokine receptor agonist and viral vector combination therapies |
| EP4269426A1 (en) | 2022-04-29 | 2023-11-01 | Ospedale San Raffaele S.r.l. | Gene therapy |
| WO2023209221A1 (en) | 2022-04-29 | 2023-11-02 | Ospedale San Raffaele S.R.L. | Gene therapy |
| EP4303226A1 (en) | 2022-07-08 | 2024-01-10 | Ospedale San Raffaele S.r.l. | Transgene cassettes and epigenetic silencers for the treatment of disorders |
| WO2024008950A1 (en) | 2022-07-08 | 2024-01-11 | Ospedale San Raffaele S.R.L. | Transgene cassettes |
| WO2024008966A1 (en) | 2022-07-08 | 2024-01-11 | Ospedale San Raffaele S.R.L. | Transgene cassettes and epigenetic silencers for the treatment of disorders |
| WO2024026377A1 (en) | 2022-07-27 | 2024-02-01 | Sana Biotechnology, Inc. | Methods of transduction using a viral vector and inhibitors of antiviral restriction factors |
| WO2024033544A1 (en) | 2022-08-12 | 2024-02-15 | Ospedale San Raffaele S.R.L. | Deglycosylation of native glycoproteins expressed on a tumor cell surface |
| WO2024038266A1 (en) | 2022-08-16 | 2024-02-22 | Oxford Biomedica (Uk) Limited | Envelope proteins |
| WO2024044655A1 (en) | 2022-08-24 | 2024-02-29 | Sana Biotechnology, Inc. | Delivery of heterologous proteins |
| WO2024064838A1 (en) | 2022-09-21 | 2024-03-28 | Sana Biotechnology, Inc. | Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof |
| WO2024081820A1 (en) | 2022-10-13 | 2024-04-18 | Sana Biotechnology, Inc. | Viral particles targeting hematopoietic stem cells |
| WO2024100145A1 (en) | 2022-11-08 | 2024-05-16 | Ospedale San Raffaele S.R.L. | Polynucleotide and vector |
| WO2024100294A1 (en) | 2022-11-11 | 2024-05-16 | Ospedale San Raffaele S.R.L. | Cdh17 car |
| WO2024110751A1 (en) | 2022-11-24 | 2024-05-30 | Quell Therapeutics Limited | Constitutively active chimeric antigen receptor for treg cell survival and/or persistence |
| WO2024119157A1 (en) | 2022-12-02 | 2024-06-06 | Sana Biotechnology, Inc. | Lipid particles with cofusogens and methods of producing and using the same |
| WO2024133472A1 (en) | 2022-12-22 | 2024-06-27 | Quell Therapeutics Limited | Constitutive cytokine receptors |
| WO2024153644A1 (en) | 2023-01-16 | 2024-07-25 | Ospedale San Raffaele S.R.L. | T-cell receptors |
| EP4403580A1 (en) | 2023-01-23 | 2024-07-24 | Medizinische Hochschule Hannover | Anti-entpd3 chimeric antigen receptor |
| WO2024156716A1 (en) | 2023-01-23 | 2024-08-02 | Medizinische Hochschule Hannover | Anti-entpd3 chimeric antigen receptor |
| WO2024165859A1 (en) | 2023-02-07 | 2024-08-15 | Quell Therapeutics Limited | Culture method for treg cells |
| EP4420676A1 (en) | 2023-02-24 | 2024-08-28 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024175805A1 (en) | 2023-02-24 | 2024-08-29 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024194223A2 (en) | 2023-03-17 | 2024-09-26 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2024194605A1 (en) | 2023-03-17 | 2024-09-26 | Quell Therapeutics Limited | Treg therapy |
| EP4434539A1 (en) | 2023-03-20 | 2024-09-25 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024194355A1 (en) | 2023-03-20 | 2024-09-26 | Medizinische Hochschule Hannover | Chimeric antigen receptor |
| WO2024194642A1 (en) | 2023-03-22 | 2024-09-26 | Quell Therapeutics Limited | Engineered t regulatory cell |
| WO2024194649A1 (en) | 2023-03-22 | 2024-09-26 | Quell Therapeutics Limited | Engineered t cells and uses thereof |
| WO2024194491A1 (en) | 2023-03-22 | 2024-09-26 | Ospedale San Raffaele S.R.L. | Gene therapy |
| WO2024220597A2 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Digital droplet based assay for detecting replication competent lentiviral vector |
| WO2024220560A1 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Engineered protein g fusogens and related lipid particles and methods thereof |
| WO2024220574A1 (en) | 2023-04-18 | 2024-10-24 | Sana Biotechnology, Inc. | Universal protein g fusogens and adapter systems thereof and related lipid particles and uses |
| WO2024236193A1 (en) | 2023-05-17 | 2024-11-21 | Ospedale San Raffaele S.R.L. | Vector |
| WO2024243340A1 (en) | 2023-05-23 | 2024-11-28 | Sana Biotechnology, Inc. | Tandem fusogens and related lipid particles |
| WO2024259299A1 (en) | 2023-06-14 | 2024-12-19 | The Broad Institute, Inc. | Compositions and methods for identification of vhh antibodies that bind a target antigen |
| WO2024261480A1 (en) | 2023-06-21 | 2024-12-26 | Quell Therapeutics Limited | Constitutive cytokine receptors |
| WO2025003481A2 (en) | 2023-06-28 | 2025-01-02 | Ospedale San Raffaele S.R.L. | T-cell receptors |
| WO2025032194A1 (en) | 2023-08-08 | 2025-02-13 | Ospedale San Raffaele S.R.L. | T-cell receptors |
| WO2025088508A1 (en) | 2023-10-24 | 2025-05-01 | Fondazione Telethon Ets | Means and methods for genetic modification of uba1 |
| WO2025088077A1 (en) | 2023-10-24 | 2025-05-01 | Ospedale San Raffaele S.R.L. | Gene therapy |
| IT202300022191A1 (it) | 2023-10-24 | 2025-04-24 | Fond Telethon Ets | Mezzi e metodi per la modifica genetica di uba1 |
| WO2025109189A1 (en) | 2023-11-24 | 2025-05-30 | Ospedale San Raffaele S.R.L. | Engineered regulatory t cells and uses thereof |
| WO2025184529A1 (en) | 2024-03-01 | 2025-09-04 | Sana Biotechnology, Inc. | Viral particles with fusogen display and related compositions and methods |
| EP4640830A1 (en) | 2024-04-23 | 2025-10-29 | Fondazione Telethon ETS | Means and methods for safe and efficient gene editing in cells |
| WO2025224634A1 (en) | 2024-04-23 | 2025-10-30 | Fondazione Telethon Ets | Means and methods for safe and efficient gene editing in cells |
| WO2026008994A1 (en) | 2024-07-04 | 2026-01-08 | Quell Therapeutics Limited | Expression construct |
| WO2026027876A1 (en) | 2024-07-29 | 2026-02-05 | Quell Therapeutics Limited | Chimeric antigen receptor |
| WO2026033206A1 (en) | 2024-08-06 | 2026-02-12 | Quell Therapeutics Limited | Method for culturing regulatory t-cells |
| WO2026078259A1 (en) | 2024-10-11 | 2026-04-16 | Ospedale San Raffaele S.R.L. | Mesoangioblast cell production methods and products |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1297486A (zh) | 2001-05-30 |
| DE69935714D1 (de) | 2007-05-16 |
| GB9803351D0 (en) | 1998-04-15 |
| US20040009603A1 (en) | 2004-01-15 |
| EP1054988A1 (en) | 2000-11-29 |
| US6541248B1 (en) | 2003-04-01 |
| EP1790658A2 (en) | 2007-05-30 |
| EP1054988B1 (en) | 2007-04-04 |
| AU2527499A (en) | 1999-08-30 |
| US7790419B2 (en) | 2010-09-07 |
| EP1790658A3 (en) | 2007-09-12 |
| DE69935714T2 (de) | 2007-12-27 |
| CA2321097A1 (en) | 1999-08-19 |
| JP2002503477A (ja) | 2002-02-05 |
| AU757284B2 (en) | 2003-02-13 |
| ATE358732T1 (de) | 2007-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1054988B1 (en) | Anti-viral vectors | |
| US6168953B1 (en) | Genetic antiviral agents and methods for their use | |
| WO2000055341A1 (en) | Anti-viral vectors | |
| EP3060668B1 (en) | Vectors for transgene expression | |
| Mautino et al. | Enhanced inhibition of human immunodeficiency virus type 1 replication by novel lentiviral vectors expressing human immunodeficiency virus type 1 envelope antisense RNA | |
| EP0871757B1 (en) | Conditionally replicating viral vectors and their use | |
| Poluri et al. | Genetic therapy for HIV/AIDS | |
| EP1180167B1 (en) | In vivo selection method for determining inhibitory rna molecules | |
| US20020102537A1 (en) | Retroviral production | |
| HK1223124B (en) | Vectors for transgene expression | |
| HK1060152B (en) | Conditionally replicating viral vectors and their use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 99805126.8 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 09552950 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999904956 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 25274/99 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2321097 Country of ref document: CA Ref document number: 2321097 Country of ref document: CA Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999904956 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 25274/99 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1999904956 Country of ref document: EP |