WO2023062366A1

WO2023062366A1 - Retroviral vectors

Info

Publication number: WO2023062366A1
Application number: PCT/GB2022/052585
Authority: WO
Inventors: Daniel Farley; Jordan Wright
Original assignee: Oxford Biomedica (Uk) Limited
Priority date: 2021-10-12
Filing date: 2022-10-12
Publication date: 2023-04-20
Also published as: GB202114530D0

Abstract

The invention relates to the production of retroviral vectors. More specifically, the present invention relates to a set of nucleic acid sequences for producing a retroviral vector comprising (i) a nucleic acid sequence encoding the retroviral vector genome, wherein the retroviral vector genome comprises a transgene expression cassette; and (ii) at least one nucleic acid sequence encoding an interfering RNA. Methods and uses of the set of nucleic acid sequences are also encompassed by the invention.

Description

RETROVIRAL VECTORS FIELD OF THE INVENTION The invention relates to retroviral vectors designed to improve their efficiency of production. More specifically, the present invention relates to a set of nucleotide sequences encoding retroviral vector genome and an interfering RNA. The invention also relates to a retroviral vector genome comprising a transgene and a nucleotide sequence encoding an interfering RNA. Methods and uses involving such nucleotide sequences or retroviral vector genomes are also encompassed by the invention. BACKGROUND TO THE INVENTION The development and manufacture of viral vectors towards vaccines and human gene therapy over the last several decades is well documented in scientific journals and in patents. The use of engineered viruses to deliver transgenes for therapeutic effect is wide-ranging. Contemporary gene therapy vectors based on RNA viruses such as γ-retroviruses and lentiviruses (Muhlebach, M.D. et al., 2010, Retroviruses: Molecular Biology, Genomics and Pathogenesis, 13:347-370; Antoniou, M.N., Skipper, K.A. & Anakok, O., 2013, Hum. Gene Ther., 24:363-374), and DNA viruses such as adenovirus (Capasso, C. et al., 2014, Viruses, 6:832-855) and adeno-associated virus (AAV) (Kotterman, M.A. & Schaffer, D.V., 2014, Nat. Rev. Genet., 15:445-451) have shown promise in a growing number of human disease indications. These include ex vivo modification of patient cells for hematological conditions (Morgan, R.A. & Kakarla, S., 2014, Cancer J., 20:145-150; Touzot, F. et al., 2014, Expert Opin. Biol. Ther., 14:789-798), and in vivo treatment of ophthalmic (Balaggan, K.S. & Ali, R.R., 2012, Gene Ther., 19:145-153), cardiovascular (Katz, M.G. et al., 2013, Hum. Gene Ther., 24:914-927), neurodegenerative diseases (Coune, P.G., Schneider, B.L. & Aebischer, P., 2012, Cold Spring Harb. Perspect. Med., 4:a009431) and tumor therapy (Pazarentzos, E. & Mazarakis, N.D., 2014, Adv. Exp. Med Biol., 818:255-280). The expression of transgenes during viral vector production can be detrimental to vector yields and/or quality by negatively affecting one or more aspects of the production phase. For example, a transgene protein may be cytotoxic or may, directly or indirectly, impair vector virion assembly and/or infectivity, or its presence during downstream processing or in the final product may be problematic. Thus, expression of the protein encoded by the NOI within viral vector production cells can adversely affect therapeutic vector titres (as shown in WO2015/092440). In addition, an NOI encoding a transmembrane POI may, for example, lead to high surface expression of the transmembrane protein in the viral vector virion, potentially altering the physical properties of the virions. Furthermore, this incorporation may present the POI to the patient’s immune system at the site of delivery, which may negatively affect transduction and/or the long-term expression of the therapeutic gene in vivo. The NOI could also induce the production of undesirable secondary proteins or metabolites which could negatively influence production, purification, recovery and immunogenicity and it is therefore desirable to minimise this. The present inventors previously developed the TRiP system to overcome the problems associated with expression of transgenes during viral vector production by employing a translational repression system (see WO2015/092440; WO2021/094752; and Maunder et al. (2017), Nat. Commun.8: 14834). As the underlying causes of many genetic diseases are being revealed, it is clear that the delivery of more functionality to the genetic payload (rather than a single gene) within vector genomes is becoming extremely desirable. Therefore, the design and configuration of transgene cassettes will need to be more complex/nuanced. For example, inverted transgene cassettes may need to be employed and/or bi-directional promoters may need to be employed when delivering multiple therapeutic genes or gene switch systems. The principal problem with retroviral vectors carrying inverted transgene cassettes that are active during vector production is the production of long dsRNA that forms by base pairing between the viral RNA genome (vRNA) and the mRNA encoding the transgene. The presence of dsRNA within the production cell triggers innate dsRNA sensing pathways, such as those involving oligoadenylate synthetase–ribonuclease L (OAS-RNase L), protein kinase R (PKR), and interferon (IFN)/ melanoma differentiation-associated protein 5 (MDA-5). One solution to avoid this response is to knock-down or knock-out endogenous PKR in the LV production cell, or over-express protein factors shown to inhibit dsRNA sensing mechanisms, as indeed others have shown is possible (Hu et al. (2018) Gene Ther, 25: 454-472; Maetzig et al. (2010), Gene Ther. 17: 400-411; and Poling et al. (2017), RNA Biol. 14: 1570-1579). However, knock- down/-out of these factors may be laborious or difficult, or it may be impossible to achieve the required reduction/loss in activity, and over-expression of protein factors may alter other aspects of the vector production cell, such as viability/vitality, leading to generally less healthy vector production cells. Thus, there is an ever-present need in the art for viral vectors with improved efficiency of production. SUMMARY OF THE INVENTION As described above, expression of the transgene protein during retroviral vector production may have unwanted effects on vector virion assembly, vector virion activity, process yields and/or final product quality. Therefore, it is desirable to repress expression of the transgene in viral vector production cells. However, repressing the expression of a NOI in viral vector production cells without impeding effective expression of the NOI in target cells, the native pathway of virion assembly and the resulting functionality of the viral vector particles is not straightforward because the NOI expression cassette and the vector genome molecule that will be packaged into virions are operably linked. Thus, modification of the NOI expression cassette may have adverse consequences on the ability to produce the vector genome molecule in the cell. For example, if a physical transcription block (e.g. TetR repressor system) is used to repress the NOI expression cassette it is likely that production of the vector genome molecule would also be inhibited through steric hindrance. In addition, the transgene repression mechanism used must not adversely affect transduction of the target cell. For example, a retroviral vector genome RNA molecule must be capable of the processes of reverse transcription and integration). The formation of double-stranded (ds) RNA (which typically results from opposed transcription within cells) triggers innate dsRNA sensing pathways within the cell leading to loss of de novo protein synthesis. If this occurs during retroviral vector production (e.g. when the retroviral vector genome comprises an inverted transgene expression cassette), this leads to a loss in expression of vector components, and consequently loss in titre. However, knock-down/-out of factors involved in these innate dsRNA sensing pathways may be laborious or difficult, or it may be impossible to achieve the required reduction/loss in activity, and over-expression of protein factors may alter other aspects of the vector production cell, such as viability/vitality, leading to generally less healthy vector production cells. The invention relates to improved production of retroviral vectors, such as those based on HIV-1 and murine leukaemia virus (MLV). The present inventors surprisingly found that RNA interference (RNAi) targeting a nucleotide of interest (NOI) can be employed in retroviral vector production cells during production of retroviral vectors comprising the NOI without impeding effective expression of the NOI in target cells, the native pathway of virion assembly and the resulting functionality of the viral vector particles. The present inventors show that RNAi can be employed in retroviral vector production cells to suppress the expression of the NOI (i.e. transgene) during retroviral vector production in order to minimize unwanted effects of the transgene protein on vector virion assembly, vector virion activity, process yields and/or final product quality. Advantageously, the use of RNAi in retroviral vector production cells also permits the rescue of titres of retroviral vectors harbouring an actively transcribed inverted transgene cassette (wherein the transgene expression cassette is all or in part inverted with respect to the retroviral vector genome expression cassette). The inventors surprisingly found that RNAi can be employed during vector production to minimize/eliminate transgene mRNA but not vector genome RNA (vRNA) required for packaging. Thus, the present invention is particularly advantageous for the improved production of retroviral vectors harbouring an actively transcribed inverted transgene cassette. Accordingly, the present invention provides a single approach to both mediating transgene repression and rescuing titres of vectors containing actively expressed inverted transgene cassettes by the use of RNAi to target the transgene mRNA during retroviral vector production. In one aspect, the invention provides a set of nucleic acid sequences for producing a retroviral vector comprising: (i) a nucleic acid sequence encoding the retroviral vector genome, wherein the retroviral vector genome comprises a transgene expression cassette; and (ii) at least one nucleic acid sequence encoding an interfering RNA which is specific for mRNA encoding the transgene. In some embodiments, the set of nucleic acid sequences further comprises nucleic acid sequences encoding Gag/pol and env or a functional substitute thereof. In some embodiments, the set of nucleic acid sequences further comprises a nucleic acid sequence encoding rev or a functional substitute thereof. In some embodiments, the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette. In some embodiments, the transgene expression cassette is in the forward direction with respect to the retroviral vector genome expression cassette. In some embodiments, the 3’ UTR or the 5’ UTR of the transgene expression cassette comprises at least one target nucleotide sequence. In some embodiments, the transgene expression cassette is genetically engineered to comprise at least one target nucleotide sequence within the 3’ UTR or 5’ UTR. In some embodiments, the interfering RNA is specific for the at least one target nucleotide sequence. In some embodiments, the set of nucleic acid sequences comprises multiple nucleic acid sequences encoding a plurality of interfering RNAs specific for multiple target nucleotide sequences. In some embodiments, the interfering RNA(s) promote cleavage of mRNA encoding the transgene. In some embodiments, the interfering RNA(s) target mRNA encoding the transgene for cleavage, preferably for cleavage by the RISC. In some embodiments, the interfering RNA is an siRNA; a sisiRNA; a tsiRNA; a RNA-DNA chimeric duplex; a tkRNA; a Dicer-substrate dsRNA; a shRNA; a tRNA-shRNA; an aiRNA; a miRNA; a pre-miRNA; a pri-miRNA mimic; a pri-miRNA mimic cluster; a transcriptional gene silencing (TGS); and/or combinations thereof. In some embodiments, the interfering RNA is a siRNA, a shRNA and/or a miRNA. In some embodiments, the interfering RNA is a miRNA. In some embodiments, the guide strand of the miRNA is fully complementary to the target sequence of the transgene mRNA. In some embodiments, the miRNA comprises a passenger strand which comprises at least one mismatch with its complimentary sequence within the RNA genome of the retroviral vector. In some embodiments, the nucleic acid encoding the retroviral vector genome comprises the nucleic acid sequence encoding the interfering RNA. In some embodiments, the retroviral vector genome expression cassette further comprises a vector intron. In some embodiments, the vector intron comprises the nucleic acid sequence encoding the interfering RNA. In some embodiments, the set of nucleic acid sequences comprises a first nucleic acid sequence encoding the retroviral vector genome and at least a second nucleic acid sequence encoding the interfering RNA. In some embodiments, the nucleic acid encoding the retroviral vector genome does not comprise the nucleic acid sequence encoding the interfering RNA. In some embodiments, the retroviral vector genome further comprises a tryptophan RNA- binding attenuation protein (TRAP) binding site. In some embodiments, the major splice donor site in the retroviral vector genome is inactivated, and optionally wherein the cryptic splice donor site 3’ to the major splice donor site is inactivated. In some embodiments, the inactivated major splice donor site has the sequence set forth in SEQ ID NO: 4. In some embodiments, the set of nucleic acid sequences further comprises a nucleic acid sequence encoding a modified U1 snRNA, wherein the modified U1 snRNA has been modified to bind to a nucleotide sequence within the packaging region of the retroviral vector genome sequence. In some embodiments, the transgene gives rise to a therapeutic effect. In some embodiments, the retroviral vector is a lentiviral vector, preferably wherein the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus. In some embodiments, the lentiviral vector genome comprises at least one modified viral cis- acting sequence, wherein at least one internal open reading frame (ORF) in the viral cis-acting sequence is disrupted. In some embodiments, the at least one viral cis-acting sequence is: (a) a Rev response element (RRE); and/or (b) a Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE). In some embodiments, the lentiviral vector genome expression cassette comprises a modified nucleotide sequence encoding gag, and wherein at least one internal open reading frame (ORF) in the modified nucleotide sequence encoding gag is disrupted. In some embodiments, the at least one internal ORF is disrupted by mutating at least one ATG sequence. In some embodiments: (a) the modified RRE comprises less than eight ATG sequences; and/or (b) the modified WPRE comprises less than seven ATG sequences. In some embodiments, the first ATG sequence within the nucleotide sequence encoding gag is mutated. In some embodiments, the lentiviral vector genome expression cassette lacks (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17, preferably wherein the fragment of a nucleotide sequence encoding Gag-p17 comprises a nucleotide sequence encoding p17 instability element. In some embodiments, the nucleotide sequence comprising a lentiviral vector genome expression cassette does not express Gag-p17 or a fragment thereof, preferably wherein said fragment of Gag-p17 comprises the p17 instability element. In a further aspect, the invention provides a retroviral vector production system comprising the set of nucleic acid sequences of the invention. In a further aspect, the invention provides a retroviral vector production system comprising a viral vector production cell, wherein the viral vector production cell comprises the set of nucleic acid sequences of the invention. In a further aspect, the invention provides an expression cassette encoding a retroviral vector genome comprising: a) a transgene expression cassette; and b) a vector intron comprising at least one interfering RNA as defined herein. In some embodiments, the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette. In a further aspect, the invention provides a nucleotide sequence comprising the expression cassette of the invention. In a further aspect, the invention provides a retroviral vector genome comprising a transgene expression cassette and a vector intron, optionally wherein the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette, and wherein the vector intron comprises at least one interfering RNA as described herein. In a further aspect, the invention provides a cell comprising the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention or the retroviral vector genome of the invention. In a further aspect, the invention provides a cell for producing retroviral vectors comprising: a) the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention or the retroviral vector genome of the invention; and b) optionally, a nucleic acid sequence encoding a modified U1 snRNA and/or a nucleic acid sequence encoding TRAP. In a further aspect, the invention provides a method for producing a retroviral vector, comprising the steps of: (i) introducing: a. the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention or the retroviral vector genome of the invention; and b. optionally, a nucleic acid sequence encoding a modified U1 snRNA and/or a nucleic acid sequence encoding TRAP, into a cell; (ii) optionally, selecting for a cell which comprises the nucleic acid sequences encoding vector components; and (iii) culturing the cell under conditions suitable for the production of the retroviral vector. In a further aspect, the invention provides a method for producing a retroviral vector, comprising the step of culturing the cell of the invention under conditions suitable for the production of the retroviral vector. In a further aspect, the invention provides a retroviral vector produced by the method of the invention. In a further aspect, the invention provides the use of the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention, the retroviral vector genome of the invention, or the cell of the invention for producing a retroviral vector. In a further aspect, the invention provides the use of a nucleic acid sequence encoding an interfering RNA as described herein for repressing expression of a transgene and/or increasing retroviral titre during retroviral vector production. DESCRIPTION OF THE FIGURES Figure 1. A schematic showing how microRNA targeted against the transgene mRNA of an lentiviral vector (LV) containing an inverted transgene cassette can be used to avoid production of dsRNA, and to reduce transgene expression. The configurations of both forward facing and inverted transgene cassettes with LV genome expression cassettes are indicated, as are the packaged vRNA (Ψ) and transgene mRNAs in each case. Use of inverted transgene cassettes within retroviral vectors typically leads to a reduction in vector production due to the generation of long dsRNA; this typically induces dsRNA sensing pathways in the cell (such as PKR-mediated translation suppression), leading to reduction in vector component protein expression. To avoid this, one or more microRNAs can be co- expressed during vector production (e.g. by co-transfection with siRNA or with a microRNA expression cassette), wherein the microRNA targets the transgene mRNA for cleavage. Use of a mis-matched passenger strand can avoid loss of vRNA due to low level loading of the passenger strand as the guide within the RISC. Cleavage (and resultant degradation) of transgene mRNA leads to reduction in transgene protein expression during LV production, which can be advantage in achieving maximal titres and/or product recovery/purity. Figure 2. Utilisation of LV genome cassettes containing inverted transgene cassettes expressed during LV production leads to suppression of de novo vector component protein expression via a cytoplasmic dsRNA sensing mechanism. Standard RRE- containing LV genome plasmids (STD RRE-LV) were generated with either forward (Fwd) or inverted (Invert) EFS-GFP transgene cassettes, and used to produce LV harvest supernatants in suspension (serum-free) HEK293T cells. Packaging plasmids (pGagPol and pVSVG) were co-transfected together with or without pRev where indicated. Supernatants were analysed by SDS-PAGE/immunoblotting to VSVG and p24 (capsid). The data indicate that inverted transgene cassettes induce suppression of de novo LV component synthesis, consistent with a cytoplasmic dsRNA sensing mechanism e.g. PKR. Figure 3. A schematic showing the different microRNA ‘modalities’ that can be adopted in the invention. The transgene-targeting microRNA can be part of a ‘transient’ or ‘stable’ vector process using cell transfection or stable cell lines, respectively. For transient transfection approaches the microRNA can be delivered as siRNA or shRNA, or as a miR expression cassette, where the microRNA is transcribed de novo, for example, from a polymerase-III promoter such as U6 or a tRNA promoter. The miR cassette may be a separate plasmid or alternatively could be inserted within the vector genome plasmid or packaging plasmids. The miR may also be stably integrated into the production cell, which itself may or may not also contain the all or some of the vector components. Figure 4. Production of LVs using siRNA to repress transgene expression from forward facing or inverted transgene cassettes. LVs containing an EFS-promoter driven GFP cassette either in the forward (Fwd) or inverted (Invert) orientation were produced in suspension (serum-free) HEK293T cells. Production cells were co-transfected with LV genome and packaging plasmids with or without the stated siRNAs, as well as a DsRed-Xprs reporter plasmid control, and post-production cells analysed by flow cytometry for GFP/DsRed-Xprs expression levels (% positive gate x median fluorescence intensity; Arbitrary units). Clarified vector supernatants were titrated by transduction of adherent HEK293T cells followed by flow cytometry (Titre in TU/mL). The control siRNA was directed to Luciferase (not present), and the DsRed-Xprs reporter was present to assess the impact of dsRNA production on de novo protein synthesis. Figure 5. A schematic showing an example of a Vector-Intron LV genome with inverted transgene cassette. A Vector-Intron LV genome with a reverse facing transgene cassette containing an intron is shown. Since the VI stimulates intron loss only from the vRNA (top strand-copied), the transgene cassette will retain its own intron. Depending on the strength of the transgene cassette promoter, a significant amount of double-stranded RNA may form between the vRNA and the transgene mRNA during LV production. This can potentially lead to a PKR response, cleavage by Dicer or deamination by ADAR; any or all of these mechanisms can contribute to reduced vector titres. This can be avoided by utilizing the unique features of the VI by inserting into it cis-acting element(s) (X) within the 3’UTR of the inverted transgene cassette. Such cis- acting elements are those that would reduce the abundance of only the transgene mRNA e.g. AU-rich [instability] elements (AREs), miRNAs, and/or self-cleaving ribozymes. The action of these reduce the amount of transgene mRNA available for pairing with the complementary vRNA to generate dsRNA. In addition, reduced transgene mRNA (and resultant protein) can be advantageous for LV production. Importantly, the cis-acting element(s) will not be present within the final integrated transgene cassette due to out-splicing of the VI, and therefore transgene mRNA stability in the transduced cell will be efficient. Figure 6. A schematic showing an example of a Vector-Intron LV genome with inverted transgene cassette and further details of cis-acting elements within the 3’UTR of the transgene cassette that mediate transgene mRNA degradation. A Vector-Intron LV genome with a reverse facing transgene cassette containing an intron is shown during LV production. The use of ‘functional’ cis-acting elements (‘X’) within the 3’UTR of the transgene cassette – and located within the anti-sense VI sequence – can be used to achieve transgene repression and to avoid dsRNA responses during LV production. One or multiple pre-miRNAs (‘m’) can be inserted within the anti-sense VI sequence of the 3’UTR, leading to pre-miRNA cleavage/processing resulting in cleavage of the pre-mRNA. Importantly, the miRNAs can be targeted to the transgene mRNA so that any mRNA that does locate to the cytoplasm is a target for microRNA-mediated cleavage (the guide strand should be 100% matched to its target). The vRNA will not be targeted by the guide strand. The passenger strand is preferably mis-matched with regard to the vRNA sequence to avoid cleavage of the vRNA should the passenger strand become a legitimate microRNA effector. Thus, these interfering RNAs can be used to reduce/eliminate transgene mRNA (and dsRNA) only in LV production, since these functional cis-acting elements will be lost from the packaged vRNA due to loss of the VI. Figure 7: A schematic comparing DNA expression cassettes for standard and Vector- Intron containing LV genomes and the mRNAs transcribed therefrom. The general structure of typical standard 3^rd generation LV genomes is shown, containing: a U3-deleted, tat-independent heterologous promoter driving transcription (Pro), the broad packaging sequence from R-U5 to the gag region, the RRE, the central polypurine tract (cppt), an internal transgene expression cassette (Pro-GOI), a post-transcriptional regulatory element (PRE) and a self-inactivating 3’LTR. The SL1 loop of the broad packaging sequence contains the MSD and adjacent crDS. The core packaging motif (Ψ) is within SL3. The amount of retained gag sequence can vary but is typically between 340 and 690 nts from the primary ATG codon of gag, and includes the p17 instability element (p17-INS). The RRE is typically in the region of 780bp, and includes the splice acceptor ‘7’ site (sa7) from HIV-1. For standard LV genome cassettes, apart from the main transgene mRNA (assuming the internal promoter is active in production cells), the primary transcript produced and exported to steady-state levels in the cytoplasm by rev was thought to be the full length vRNA. However, the inventors have shown elsewhere that promiscuous or aberrant splicing from the MSD or the crSD in the SL2 loop occurs to (cryptic) splice acceptors downstream of sa7 even in the presence of rev. The amount of spliced product compared to full length vRNA can be 20:1, especially when the transgene cassette contains a strong splice acceptor such as the one present in the EF1a promoter. The novel LV genome of the present invention replaces the RRE entirely with a single intron in order to increase transgene payload, since the intronic sequence will be absent from the full length vRNA. The MSD/crSD mutation ensures that no aberrant splicing from SL2 can occur with the VI splice acceptor. Surprisingly, not only does the act of splicing out of the VI allow vRNA to be stabilized in a rev/RRE-independent manner, it also abrogates the attenuating effect of MSD/crSD mutation on LV titres. Further, it is shown that RRE-deleted VI genomes achieve greatest titres in a rev-independent manner when the MSD/crSD is mutated. The novel LV genome may also incorporate a deletion of the p17-INS, therefore also increasing transgene capacity by a total of ~1kb. Figure 8: Rev/RRE-independent HIV-1 based LVs containing a Vector-Intron are improved by mutation of the major splice donor and cryptic splice donor sites in SL2 of the packaging signal. HIV-1 based LV genomes (with an internal CMV-GFP cassette) were generated containing various combinations of either standard or mutated/deleted cis-acting elements (STD-MSD or MSD-2KO, ±RRE, ± Vector-Intron; see Figure 7). These genome plasmids were used to produce LV-CMV-GFP vectors in either adherent (A) or suspension [serum-free] (B) HEK293T cells in the presence or absence of a rev-expression plasmid. Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and vector titres plotted on a log10 scale. Figure 9: Analysis of vector cassette-derived RNA in adherent production cells and in resulting vector particles for variant genomes containing a Vector-Intron in combination with other cis-elements/mutations. Total extracted RNA from production cells and vector particles from the adherent cell production run of Vector-Intron (VI_v1.1) genomes described for Figure 8A was subjected to RT-PCR to assess the species produced by each genome variant (panel B). The DNA, pre- RNA and main splicing products for these four Vector-Intron genome variants is shown schematically in panel A. The splicing of the Vector-Intron is denoted as well as the potential aberrant splicing of the MSD to the VI splice acceptor. The optional presence of the RRE is also denoted, as well as the positions of the PCR primers (grey arrows) used for the RT-PCR analysis (oligo-dT primer was used for the cDNA step). Figure 10. Vector-Intron LVs harbouring self-cleaving elements within the transgene 3’UTR: use of production cell derived microRNA target sites. The inverted transgene cassette comprises self-cleaving elements within the 3’UTR sequence that is encompassed by the Vector-Intron sequence on the top strand, and thus such elements are spliced out of packaged vRNA and not delivered to target cells. Self-cleaving elements (such as ribozymes [Z]) eliminate transgene mRNA, and therefore avoid triggering dsRNA- sensing pathways that otherwise reduce LV titres, as well as leading to suppression of transgene protein expression that might otherwise impact on LV titres. In this case, one or more microRNA target sequences are inserted into the 3’UTR, optionally with other self- cleaving elements such as ribozymes. These target sequences may be synthetic, and be targeted by a miRNA expressed exogenously (e.g. by a U6-driven cassette introduced into the production cell) or by endogenous miRNAs. Figure 11. Production cell transgene expression and output titres of Vector-Intron LVs harbouring self-cleaving elements within the transgene 3’UTR: use of production cell derived microRNA target sites. Vector-Intron LVs harbouring an inverted EF1a-GFP cassette were generated in a similar format as per Figure 10. Specifically, the 3’UTR of the inverted transgene that is encompassed by the VI on the top strand had 1x or 3x copies of three different target sequences of miRNAs found to be endogenously expressed in HEK293(T) cells (miR17-5p, miR20a and mi106a). Two sets of variants were produced in which the ribozymes T3H38 and HDV_AG were additionally present within the VI-encompassed 3’UTR region (at positions [1] and [2] respectively). For the variants containing both ribozymes and miRNA target sequence(s), the miRNA target sequences were positioned between the two ribozymes. A third variant type was generated in which a single copy of all three miRNAs were present between the ribozymes (17-5p/20a/106a). LVs were produced in suspension (serum-free) HEK293T cells alongside a standard LV, containing the EF1a-GFP cassette in the forward orientation. Post-production cells were analysed by flow cytometry to generate GFP Expression scores (%GFP x MFI), and resultant vector supernatants were titrated on adherent HEK293T cells by flow cytometry to yield GFP TU/mL values. Titre values and GFP expression scores were normalised to that attained by the standard LV (set to 100%). Figure 12. Vector-Intron LVs harbouring, self-cleaving elements within the transgene 3’UTR: use of Vector-Intron embedded microRNAs. The inverted transgene cassette comprises self-cleaving elements within the 3’UTR sequence that is encompassed by the Vector-Intron sequence on the top strand, and thus such elements are spliced out of packaged vRNA and not delivered to target cells. Self-cleaving elements (such as ribozymes [Z]) eliminate transgene mRNA, and therefore avoid triggering dsRNA- sensing pathways that otherwise reduce LV titres, as well as leading to suppression of transgene protein expression that might otherwise impact on LV titres. In this case, one or more microRNA cassettes are inserted into the 3’UTR (processing of which will cleave the transgene mRNA), and optionally the miRNAs produced from processing target sites within the transgene mRNA (in this case 3’UTR sequence). Optionally, these miRs/miRNA targets are combined with other self-cleaving elements such as ribozymes. DETAILED DESCRIPTION OF THE INVENTION Set of nucleic acid sequences In one aspect, the invention provides a set of nucleic acid sequences for producing a retroviral vector comprising: (i) a nucleic acid sequence encoding the retroviral vector genome, wherein the retroviral vector genome comprises a transgene expression cassette; and (ii) at least one nucleic acid sequence encoding an interfering RNA which is specific for mRNA encoding the transgene. In one aspect, the invention provides a set of nucleic acid sequences for producing a retroviral vector comprising: (i) a nucleic acid sequence comprising a retroviral vector genome expression cassette, wherein the retroviral vector genome expression cassette comprises a transgene expression cassette; and (ii) at least one nucleic acid sequence encoding an interfering RNA which is specific for mRNA encoding the transgene. In one embodiment, the set of nucleotide sequences for producing a retroviral vector encodes the components required for production of the retroviral vector. Accordingly, the set of nucleotide sequences may encode the retroviral vector components necessary to generate viral vector particles. Suitably, retroviral vector components necessary to generate viral vector particles include gag, env, rev and/or the genome of the retroviral vector (e.g. the RNA genome of the lentiviral vector when the retroviral vector is a lentiviral vector). In some embodiments, the set of nucleic acid sequences further comprises nucleic acid sequences encoding Gag/pol and env or a functional substitute thereof. In some embodiments, the set of nucleic acid sequences further comprises a nucleic acid sequence encoding rev or a functional substitute thereof. Introns within the transgene expression cassette (e.g. the intron within the EF1α promoter if employed as the internal transgene promoter) provide a boost to expression in certain target cells. However, such additional introns within the transgene expression cassette may be spliced-out during transcription. A way of ensuring transgene intron retention within vRNA is to invert the transgene cassette so that the intron within the transgene expression cassette is not recognised as such because it is in the anti-sense direction with respect to the retroviral vector genome expression cassette. Accordingly, the transgene expression cassette may be inverted with respect to the retroviral vector genome expression cassette. In other words, the internal transgene promoter and transgene sequences oppose the retroviral vector genome cassette promoter such that the retroviral vector genome and transgene are in opposed transcriptional orientations. Thus, the transgene expression cassette may be in the antisense orientation (i.e. encoded on the antisense strand / the bottom strand) with respect to the retroviral vector genome expression cassette. Alternatively, the transgene expression cassette may be in the forward orientation with respect to the retroviral vector genome expression cassette. In other words, the internal transgene promoter and transgene sequences are in the same orientation as the retroviral vector genome cassette promoter such that the retroviral vector genome and transgene are in the same transcriptional orientation. Thus, the transgene expression cassette may be in the sense orientation (i.e. encoded on the sense strand / on the top strand) with respect to the retroviral vector genome expression cassette. Hence, the transgene expression cassette can be inverted or non-inverted (i.e. in the forward orientation) with respect to the retroviral vector genome cassette. If a tissue specific promoter is utilized as the internal transgene promoter that is not/minimally active during retroviral vector production then the inverted transgene approach requires no further considerations. However, should the transgene promoter generate sufficient levels of transgene mRNA during retroviral vector production then the possibility of generating long dsRNA products via vRNA:mRNA annealing increases, and this will trigger innate dsRNA sensing pathways, such as those involving oligoadenylate synthetase–ribonuclease L (OAS- RNase L), protein kinase R (PKR), and interferon (IFN)/ melanoma differentiation-associated protein 5 (MDA-5). Whilst a number of these pathways are likely to be (partly) defective in HEK293(T) cells (Ferreira, C., B., et. al., Mol Ther Methods Clin Dev. (2019);17:209-219.), here the inventors provide evidence that generation of cytoplasmic dsRNA results in suppression of de novo protein synthesis (see Figure 2). The present inventors have surprisingly found that RNAi can be employed in retroviral vector production cells to suppress the expression of the NOI (i.e. transgene) during retroviral vector production in order to minimize unwanted effects of the transgene protein during vector production and/or to rescue titres of retroviral vectors harbouring an actively transcribed inverted transgene cassette. The inventors surprisingly found that RNAi can be employed during vector production to minimize and/or eliminate mRNA encoding the transgene but not vector genome RNA (vRNA) required for packaging. Thus, the amount of transgene mRNA produced to be available for forming dsRNA with the vRNA is reduced, minimizing the impact on titres of retroviral vectors harbouring an actively transcribed inverted transgene cassette. This feature also provides a mechanism for transgene repression during LV production, which has previously shown to be an effective way of rescuing titres for genomes encoding toxic or ‘problematic’ transgene proteins. In other words, the use of interfering RNA(s) specific for the transgene mRNA provides a mechanism for avoiding de novo protein synthesis inhibition and/or the consequences of other dsRNA sensing pathway and enables rescue of inverted transgene retroviral vector titres. The interfering RNA is targeted to the transgene mRNA so that any mRNA that does locate to the cytoplasm is a target for RNAi-mediated degradation and/or cleavage, preferably cleavage. Preferably, the interfering RNA(s) employed result in cleavage of mRNA encoding the transgene in order to minimize and/or eliminate the formation of dsRNA. Suitably, the interfering RNA(s) target the mRNA encoding the transgene for cleavage. The interfering RNA(s) may target the mRNA encoding the transgene for cleavage by the RNA-induced silencing complex (RISC). As used herein, the term “is specific for” means that the interfering RNA preferentially binds to mRNA encoding the transgene over an mRNA molecule which does not encode the transgene. Thus, the interfering RNA targets the mRNA encoding the transgene. As used herein, the term “interfering RNA” means an RNA which is capable of mediating RNA interference (RNAi). Interfering RNAs may be, for example, a siRNA; a sisiRNA; a tsiRNA; a RNA-DNA chimeric duplex; a tkRNA; a Dicer-substrate dsRNA; a shRNA; a tRNA-shRNA; an aiRNA; a pre- miRNA; a pri-miRNA mimic; a pri-miRNA mimic cluster; and combinations thereof. The interfering may be synthetic. Synthetic interfering RNAs are suitable for use by transient co-transfection during lentiviral vector production, i.e. may be provided in trans to the viral vector genome expression cassette in a retroviral vector production cell. Suitably, the interfering RNA may be provided in cis to the viral vector genome expression cassette in a lentiviral vector production cell, i.e. the vector intron may comprise the interfering RNA. Examples of interfering RNAs which maybe provided in cis include a siRNA; a shRNA; a tRNA-shRNA; a pre-miRNA; a pri-miRNA mimic; a pri-miRNA mimic cluster; and combinations thereof. Preferably, the interfering RNA is siRNA, shRNA or miRNA. Preferably, the interfering RNA is shRNA or miRNA. Preferably, the interfering RNA for use according to the invention is a miRNA. An alternative or additional type of element that can be used are target sequences for miRNAs expressed during lentiviral vector production; these miRNAs expressed during lentiviral vector production can either be endogenously expressed miRNAs by the host cell or by exogenously expressed miRNAs (e.g. by co-transfection of a U6-driven mi/shRNA cassette). This concept is described in Figure 10. miRNAs are transcribed as primary miRNA (pri-miRNA) that can be several kilobases long. These transcripts are processed in the nucleus to 60–90 nt long precursor-miRNA hairpins (pre-miRs or pre-miRNAs, these terms are used interchangeably herein) by the Microprocessor complex. Thus, pre-miRs refer to the hairpin precursors of miRNAs formed by the cleavage of primary miRNAs by DCGR8 and Drosha. A further example of the use of miRNA to degrade transgene mRNA when using Vector-Intron lentiviral vectors harbouring an inverted transgene cassette, is the use of the 3’UTR sequence encompassed by the VI on the top strand to contain one or more pre-miRs, such that processing of such pre-miRs leads to cleavage of the 3’UTR by Drosha/Pasha. Optionally, the miRNA generated by such pre-miR cassettes could then target other sequences across the transgene mRNA. Again, critically these self-cleaving sequences are removed by splicing out of the VI to generate packaged vRNA, and are therefore not present in the target cell. This concept is presented in Figure 12. Accordingly, in some embodiments the interfering RNA is a pre-miR. In some embodiments, the interfering RNA is a target sequences for a miRNAs. Suitably, the miRNA is expressed during lentiviral vector production either endogenously by the host cell or exogenously. In some embodiments, the guide strand of the interfering RNA (preferably, miRNA) is fully complementary to the target sequence of the transgene mRNA (Figure 6). In this instance, the guide strand is 100% matched, i.e.100% complementary, to its target. Thus, the guide strand may target the RISC complex to the target sequence of the mRNA encoding the transgene (i.e. transgene mRNA) Watson-Crick base pairing. The vRNA is not targeted by the guide strand in order to avoid degradation and/or cleavage of vRNA required for packaging. In one embodiment, the guide strand of the interfering RNA, preferably miRNA, does not comprise a mismatch with the target sequence within the mRNA encoding the transgene. As used herein, the term “mismatch” refers to the presence of an uncomplimentary base. Thus, a “mismatch” refers to an uncomplimentary base in the guide strand or passenger strand which is not capable of Watson-Crick base pairing with the complementary sequence within the mRNA encoding the transgene or vRNA, respectively. Preferably, when employing the interfering RNA to target mRNA encoding the transgene derived from an inverted transgene cassette, the interfering RNA (preferably miRNA) is designed such that the passenger strand is mismatched (i.e. not 100% complementary) to its complementary sequence in the vRNA (Figure 6). In this way, should the passenger strand be used as the guide strand in a RISC, it will not lead to cleavage of the vRNA, which would otherwise lead to reduction in vRNA available for packaging. In some embodiments, the interfering RNA (preferably miRNA) comprises a passenger strand which comprises at least one mismatch (suitably, at least two, or at least three) – preferably at position 2, 9, 10, or 11 of the passenger stand – with its complimentary sequence within the RNA genome of the retroviral vector. In another aspect, the passenger strand of the interfering RNA (preferably miRNA) imperfectly matches its target vector genome sequence resulting in a central bulge. In some embodiments, the set of nucleic acid sequences comprises multiple nucleic acid sequences encoding a plurality of interfering RNAs specific for multiple target nucleotide sequences. Preferably, each interfering RNA is specific for a different target nucleotide sequence. The interfering RNA(s) can be provided in trans or in cis during retroviral vector production. Cis elements are present on the same molecule of DNA as the gene they affect whereas trans elements can affect genes distant from the gene from which they were transcribed. Thus, an interfering RNA expression cassette may be co-expressed with retroviral vector components during retroviral vector production. The interfering RNA is an interfering RNA as described herein. Thus, the interfering RNA targets the mRNA encoding the transgene, leading to mRNA degradation and concomitant reduction in dsRNA and transgene expression. Such an interfering RNA expression cassette may be easily constructed by those skilled in the art, for example driven by a U6 pol-III promoter or tRNA promoter. The target of the interfering RNA may be the sequence of the 3’ UTR of the transgene mRNA encompassed by the VI. Accordingly, in some embodiments, the set of nucleic acid sequences comprises a first nucleic acid sequence encoding the retroviral vector genome and at least a second nucleic acid sequence encoding the interfering RNA. Preferably, the first and second nucleic acid sequences are separate nucleic acid sequences. Suitably, the nucleic acid encoding the retroviral vector genome may not comprise the nucleic acid sequence encoding the interfering RNA. In some alternative embodiments, the lentiviral vector genome expression cassette further comprises a vector intron. Suitably, the vector intron comprises the nucleic acid sequence encoding the interfering RNA. Thus, the interfering RNA may be provided in cis during lentiviral vector production. Inverted transgene expression cassettes are able to retain an intron (herein termed “vector intron” (VI)) within the transgene cassette. By contrast, in non-inverted cassettes the transgene cassette would be spliced out together with the VI, which is undesirable. Thus, the VI is provided in the forward orientation (i.e. on the sense strand) with respect to the retroviral vector genome expression cassette. This permits out-splicing of the VI during transcription of the lentiviral vector genome. The inverted transgene expression cassettes of the invention may make use of the VI to reduce transgene mRNA expression during vector production, since an interfering RNA which is specific for the mRNA encoding the transgene can be inserted within the 3’ UTR of the inverted transgene expression cassette, such that the interfering RNA is also encompassed by the VI on the sense strand. Thus, transgene mRNA is destabilized and/or degraded within vector production cells. By contrast, upon splicing-out of the VI, the interfering RNA is also removed from the packaged genome of the lentiviral vector (e.g. vRNA) such that the transgene mRNA will lack the interfering RNA in transduced cells (see Figure 5). As such, critically, the interfering RNA are only active during lentiviral vector production because they are lost from the packaged vRNA by splicing-out of the VI. One or more interfering RNAs can be inserted within the antisense VI sequence, i.e. the inverted VI. In some embodiments, the nucleic acid encoding the retroviral vector genome comprises the nucleic acid sequence encoding the interfering RNA. By way of illustrative example, the interfering RNA may be one or more ‘self-cleaving’ miRNAs that are located within the 3’ UTR of the transgene expression cassette. The one or more miRNAs (i.e. pre-miRNAs) are therefore cleaved from the 3’ UTR of the mRNA encoding the transgene (thus removing the polyA tail of the mRNA, leading to destabilisation of the mRNA encoding the transgene), and then are processed by DROSHA/Dicer into mature miRNAs and loaded into the RISC to target sequences within the transgene mRNA such that further cleavage can occur. dsRNA fragments are loaded into RISC with each strand having a different fate based on the asymmetry rule phenomenon, the selection of one strand as the guide strand over the other based on thermodynamic stability. The newly generated miRNA or siRNA act as single-stranded guide sequences for RISC to target mRNA for degradation. The strand with the less thermodynamically stable 5' end is selected by the protein Argonaute and integrated into RISC. This strand is known as the guide strand and targets mRNA for degradation. The other strand, known as the passenger strand, is degraded by RISC. By ‘self-cleaving’ it is meant that, since the miRNA(s) are located within the 3’ UTR of the mRNA encoding the transgene and target the mRNA encoding the transgene, the miRNA(s) are self-targeting for cleavage. The interfering RNA may be specific for a sequence within the 5’ UTR and/or coding-region and/or 3’UTR of the transgene expression cassette (i.e. the 5’ UTR and/or coding-region and/or 3’UTR of the transgene expression cassette comprises a target nucleotide sequence). Suitably, the target nucleotide sequence may be within the 5’ UTR of the transgene expression cassette. Alternatively, the target nucleotide sequence may be within the 3’ UTR. If a plurality of interfering RNAs are employed, the target nucleotide sequences may be within the 3’ UTR and the 5’ UTR of the transgene expression cassette. In some embodiments, the 3’ UTR or the 5’ UTR of the transgene expression cassette comprises at least one target nucleotide sequence. In some embodiments, the transgene expression cassette is genetically engineered to comprise at least one target nucleotide sequence within the 3’ UTR or 5’ UTR. The at least one target nucleotide sequence may be at least one predetermined heterologous target nucleotide sequence for which efficient interfering RNAs are already available. Molecular cloning methods to introduce a nucleotide sequence into a target sequence are known in the art. For example, conventional techniques of molecular biology (described elsewhere herein) may be employed. In some embodiments, the interfering RNA is specific for the at least one target nucleotide sequence. As used herein, the term “target nucleotide sequence” means a sequence within the transgene expression cassette to which the interfering RNA binds. Suitably, the target nucleotide sequence is 100% complementary to the guide strand of the interfering RNA, which is preferably a miRNA. In some preferred embodiments, the transgene gives rise to a therapeutic effect. In some preferred embodiments, the retroviral vector is a lentiviral vector. In some embodiments, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus. As described herein, the interfering RNA may be provided in cis during retroviral vector production. Accordingly, in a further aspect, the invention provides an expression cassette encoding a retroviral vector genome comprising: (i) a transgene expression cassette; and (ii) a vector intron comprising at least one interfering RNA as described herein. In a further aspect, the invention provides a retroviral vector genome comprising a transgene expression cassette and a vector intron, wherein the vector intron comprises at least one interfering RNA as described herein. In some embodiments, the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette. In a further aspect, the invention provides a nucleotide sequence comprising the expression cassette of the invention. RNA interference Post-transcriptional gene silencing (PTGS) mediated by double-stranded RNA (dsRNA) is a conserved cellular defence mechanism for controlling the expression of foreign genes. It is thought that the random integration of elements such as transposons or viruses causes the expression of dsRNA which activates sequence-specific degradation of homologous single- stranded mRNA or viral genomic RNA. The silencing effect is known as RNA interference (RNAi). RNAi has also been exploited to modulate the expression of a target nucleotide sequence. RNAi is a biological process in which RNA molecules inhibit gene expression or translation, by inhibiting targeted mRNA molecules (Ralph et al.2005, Nat. Medicine 11: 429-433). The mechanism of RNAi involves the processing of long dsRNAs into duplexes of about 21-25 nucleotide (nt) RNAs. These products are called small interfering or silencing RNAs (siRNAs) which are the sequence-specific mediators of mRNA degradation. shRNAs consist of short inverted RNA repeats separated by a small loop sequence. These are rapidly processed by the cellular machinery into 19-22 nt siRNAs, thereby suppressing the target gene expression. Micro-RNAs (miRNAs) are typically small (22–25 nucleotides in length) noncoding RNAs that can effectively reduce the translation and/or stability of target mRNAs by binding to their 3’ untranslated region (UTR). Micro-RNAs can also effectively reduce the translation and/or of target mRNAs by binding to another portion of target mRNAs, e.g. the coding region or the 5’ UTR. Micro-RNAs are a very large group of small RNAs produced naturally in organisms, at least some of which regulate the expression of target genes. Founding members of the micro- RNA family are let-7 and lin-4. The let-7 gene encodes a small, highly conserved RNA species that regulates the expression of endogenous protein-coding genes during worm development. The active RNA species is transcribed initially as a ~70 nt precursor, which is post- transcriptionally processed into a mature ~21 nt form. Both let-7 and lin-4 are transcribed as hairpin RNA precursors which are processed to their mature forms by Dicer enzyme. Methods for the design of interfering RNA to modulate the expression of a target nucleotide sequence are well known in the art. An illustrative example of the use of one or more interfering RNAs to target transgene mRNA for cleavage by the RISC complex in order to [1] reduce transgene expression during retroviral vector production and [2] avoid the production of dsRNA when employing transgene cassettes containing active transcription units that are inverted with respect to the vector genome cassette, and thus would otherwise lead to dsRNA sensing pathways detrimental to vector production (see Figure 1 and Figure 2) is provided below. Illustrative example The illustrative example of a process flow of implementing this approach can be summarized as follows: 1. Identify one or more target sites within the transgene mRNA sequence to enable efficient mRNA cleavage(s), leading to reduced steady-state levels of mRNA, reduction of transgene protein expression and rescue of titres (for inverted transgenes). This can be achieved in a number of ways. Firstly, the transgene mRNA sequence can be in silico screened for potential sites that are predicted to be good targets for microRNA (such services are commercially available, for example: ^ iScore (http://www.med.nagoya-u.ac.jp/neurogenetics/i_Score/i_score.html); ^ Invitrogen (http://rnaidesigner.invitrogen.com/rnaiexpress/design.do); ^ Thermo Fisher (http://www.thermoscientificbio.com/design-center/); ^ siSPOTR (https://sispotr.icts.uiowa.edu/sispotr/tools/sispotr). This process involves: I. Target sequence analysis II. Thermodynamic profiling of guide strand III. Addition of passenger strand mis-matches if required IV. Assessment of microRNA secondary structure (e.g. via m-fold) V. Selected siRNA candidates tested for off target effects by blasting (e.g. NCBI BLAST) against human transcriptome using the following settings: word size - 7; threshold 1000; mismatch penalty -1 or 0; gap open 3; extension 2. (Such loose criteria ensure an effective search for siRNA off-targets, unlike using the default BLAST settings.) Several (for example, up to 10) siRNAs or shRNAs can be generated and screened against a simple transgene expression cassette within the production cells, thus identifying one or more siRNA/shRNAs that can be used in the invention. Alternatively, a predetermined heterologous target sequence for which there is already available efficient siRNA/shRNAs can be cloned within the 5’ or 3’ UTRs of the transgene cassette and empirically tested for mRNA cleavage and transgene protein knock-down by supplying these siRNA/shRNAs in co-transfection experiments. Alternatively, the production cell may be characterized for endogenous microRNAs that are highly expressed constitutively, and/or under vector production conditions (for example microRNAs upregulated by sodium butyrate induction). The target sequence(s) of these endogenous microRNAs can be cloned into the 5’ or 3’ UTRs of the transgene cassette and empirically tested for mRNA cleavage and transgene protein knock-down. Multiple target sites of one or more microRNAs can optionally be cloned into 5’ and/or 3’ UTRs of the transgene cassette. It is desirable for the guide strand of the microRNA to be designed such that the resultant active RISC mediates transgene mRNA cleavage i.e. the guide strand is fully complementary to the target sequence. Optionally, microRNAs can be designed for use with inverted transgene cassettes such that the passenger strand is mis-matched in order to minimize any possible cleavage of vRNA should the passenger strand be loaded into a RISC. 2. Choice of microRNA modality (see Figure 3) The siRNA/shRNA/miRNA identified to induce the desired levels of transgene repression and/or mRNA cleavage can be used directly in co-transfection production of retroviral vectors. Alternatively, the interfering RNA can be designed as part of an expression cassette in order to be de novo transcribed during vector production, for example, by a polymerase-III promoter such as U6 or a tRNA promoter. Thus, a plasmid encoding the miRNA cassette can be co- transfected into the production cell together with vector component plasmids. The miRNA plasmid may contain multiple single miRNA expression cassettes, or a single expression cassette encoding multiple tandem miRNAs processed from a single transcript. Alternatively, the miRNA expression cassette(s) may be stably integrated into the host cell DNA or stably maintained as an episome. Alternatively, such miRNA expression cassette(s) may be cloned into the vector genome or packaging plasmids in cis. 3. Optimisation of vector production Depending on the mode of microRNA being employed for the implementation of transgene mRNA knock-down during vector production, the process can be optimized to achieve the maximal effect i.e. efficient transgene repression and/or recovery in titres of vectors containing an inverted transgene cassette. For transient production utilizing siRNA/shRNA/miRNA, this will involve empirically testing different amounts and ratios of interfering RNA effectors relative to plasmids encoding vector components and transfection reagent, as well as harvest times and/or sodium butyrate induction levels/timings. For the approach where the miRNA cassette(s) is inserted in cis on one or more plasmids encoding vector components, the number, position and orientation of the miRNA(s) should be empirically tested. For development of stable a cell line expressing miRNA(s), the screening process will empirically test and identify clones that have low transgene levels and high vector titres. Use of an interfering RNA In a further aspect, the invention provides the use of a nucleic acid sequence encoding an interfering RNA as described herein for repressing expression of a transgene and/or increasing retroviral titre during retroviral vector production. In a further aspect, the invention provides the use of a nucleic acid sequence encoding an interfering RNA as described herein for repressing expression of a transgene and/or increasing retroviral titre in a retroviral vector production cell. Suitably, the nucleic acid sequence encoding an interfering RNA as described herein is used in conjunction with nucleotide sequences encoding retroviral vector components. Titres of vectors containing actively expressed inverted transgene cassettes may be negatively impacted due to the triggering of innate dsRNA sensing pathways within the cell leading to loss of de novo protein synthesis as described above. Thus, titres of vectors containing actively expressed inverted transgene cassettes may be enhanced by the use of an interfering RNA as described herein to target the transgene mRNA during retroviral vector production, thereby preventing the triggering of innate dsRNA sensing pathways and the loss of de novo protein synthesis. In addition, certain transgenes may be toxic to the cell or have other deleterious properties when expressed in a cell. Thus, the use of an interfering RNA as described herein to target the transgene mRNA during retroviral vector production may further boost titres of vectors harbouring such a transgene. Suitably, titres of vectors containing actively expressed inverted transgene cassettes may be restored to the titre levels seen during production of a retroviral vector harbouring a reporter gene construct (e.g. a GFP transgene) by the use of an interfering RNA as described herein to target the transgene mRNA during retroviral vector production. Accordingly, the use of an interfering RNA as described herein may enhance the titre of a retroviral vector containing an actively expressed inverted transgene cassette during retroviral vector production relative to retroviral vector production of the corresponding retroviral vector in the absence of an interfering RNA as described herein. Thus, production of a retroviral vector containing an actively expressed inverted transgene cassette in the presence of an interfering RNA as described herein enhances retroviral vector titre relative to retroviral vector production of the corresponding retroviral vector in the absence of an interfering RNA as described herein. The present invention is particularly advantageous for enhancing the titre of retroviral vectors harbouring an actively transcribed inverted transgene cassette and a transgene which is, for example, toxic to the cell. A suitable assay for the measurement of retroviral vector titre is as described herein. Suitably, the retroviral vector production involves co-expression of said interfering RNA with vector components including gag, env, rev and the genome of the retroviral vector. Alternatively, the retroviral vector production involves provision of said interfering RNA in cis. In some embodiments, the use of an interfering RNA as described herein may increase retroviral vector titre of a retroviral vector containing an actively expressed inverted transgene cassette during retroviral vector production by at least 30% relative to retroviral vector production of the corresponding retroviral vector in the absence of an interfering RNA as described herein. Suitably, the use of an interfering RNA as described herein may increase retroviral vector titre of a retroviral vector containing an actively expressed inverted transgene cassette during retroviral vector production by at least 35% (suitably at least 40%, 45%, 50%, 60%, 70%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950% or 1000%) relative to retroviral vector production of the corresponding retroviral vector in the absence of an interfering RNA as described herein. As described above, expression of the transgene protein during retroviral vector production may have unwanted effects on vector virion assembly, vector virion activity, process yields and/or final product quality. Therefore, it is desirable to repress expression of the transgene in viral vector production cells. Suitably, the translation of the mRNA encoding the transgene may be repressed. Repression or prevention of the translation of the NOI (i.e. transgene) is to be understood as alteration of the amount of the product (e.g. transgene protein) encoded by the NOI that is translated during viral vector production in comparison to the amount translated in the absence of the interfering RNA as described herein at the equivalent time point. In one embodiment, expression of the transgene is repressed or prevented in a retroviral vector production cell. The expression of the protein from the transgene at any given time during vector production may be reduced to 90% (suitably, to 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1%) of the amount expressed in the absence of the interfering RNA as described herein at the same time-point in vector production. The expression of the protein from the transgene at any given time during vector production may be reduced to less than 90% (suitably, to less than 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1%) of the amount expressed in the absence of the interfering RNA as described herein at the same time-point in vector production. In one embodiment, translation of the transgene is repressed or prevented in a retroviral vector production cell. Preventing the expression of the protein from the transgene is to be understood as reducing the amount of the protein that is expressed to substantially zero (suitably, to zero). The translation of the transgene at any given time during vector production may be reduced to 90% (suitably, to 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1%) of the amount translated in the absence of the interfering RNA as described herein at the same time-point in vector production. The translation of the NOI at any given time during vector production may be reduced to less than 90% (suitably, to less than 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.5% or 0.1%) of the amount translated in the absence of the interfering RNA as described herein at the same time-point in vector production. Preventing the translation of the NOI is to be understood as reducing the amount of translation to substantially zero (suitably, to zero). Methods for the analysis and/or quantification of the translation of a transgene are well known in the art. A protein product from lysed cells may be analysed using methods such as SDS-PAGE analysis with visualisation by Coomassie or silver staining. Alternatively a protein product may be analysed using Western blotting or enzyme-linked immunosorbent assays (ELISA) with antibody probes which bind the protein product. A protein product in intact cells may be analysed by immunofluorescence. RNA Splicing The present invention, as disclosed herein, may be combined with major splice donor (MSD) site knock out retroviral vector genomes, and in particular MSD knock out lentiviral vector genomes. The invention may employ retroviral (e.g. lentiviral) vector genomes in which the major splice donor site, and optionally the cryptic splice donor site 3’ to the major splice donor site, are inactivated. Thus, in some embodiments, the major splice donor site in the genome of the retroviral vector and the cryptic splice donor site 3’ to the major splice donor site in the genome of the retroviral vector are inactivated. In some embodiments, the inactivated major splice donor site has the sequence set forth in SEQ ID NO: 4. Suitable inactivated splice sites for use according to the present invention are described in WO 2021/160993 and incorporated herein by reference. RNA splicing is catalysed by a large RNA-protein complex called the spliceosome, which is comprised of five small nuclear ribonucleoproteins (snRNPs). The borders between introns and exons are marked by specific nucleotide sequences within a pre-mRNA, which delineate where splicing will occur. Such boundaries are referred to as "splice sites." The term "splice site” refers to polynucleotides that are capable of being recognized by the splicing machinery of a eukaryotic cell as suitable for being cut and/or ligated to another splice site. Splice sites allow for the excision of introns present in a pre-mRNA transcript. Typically, the 5' splice boundary is referred to as the "splice donor site" or the "5' splice site" and the 3' splice boundary is referred to as the "splice acceptor site" or the "3' splice site." Splice sites include, for example, naturally occurring splice sites, engineered or synthetic splice sites, canonical or consensus splice sites, and/or non-canonical splice sites, for example, cryptic splice sites. Splice acceptor sites generally consist of three separate sequence elements: the branch point or branch site, a polypyrimidine tract and the acceptor consensus sequence. The branch point consensus sequence in eukaryotes is YNYTRAC (where Y is a pyrimidine, N is any nucleotide, and R is a purine). The 3' acceptor splice site consensus sequence is YAG (where Y is a pyrimidine) (see, e.g., Griffiths et al., eds., Modern Genetic Analysis, 2nd edition, W.H. Freeman and Company, New York (2002)). The 3' splice acceptor site typically is located at the 3' end of an intron. The terms "canonical splice site" or "consensus splice site" may be used interchangeably and refer to splice sites that are conserved across species. Consensus sequences for the 5' donor splice site and the 3' acceptor splice site used in eukaryotic RNA splicing are well known in the art. These consensus sequences include nearly invariant dinucleotides at each end of the intron: GT at the 5' end of the intron, and AG at the 3' end of an intron. The canonical splice donor site consensus sequence may be (for DNA) AG/GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is a purine and

indicates the cleavage site). This conforms to the more general splice donor consensus sequence MAGGURR described herein. It is well known in the art that a splice donor may deviate from this consensus, especially in viral genomes where other constraints bear on the same sequence, such as secondary structure for example within a vRNA packaging region. Non- canonical splice sites are also well known in the art, albeit they occur rarely compared to the canonical splice donor consensus sequence. By “major splice donor site” is meant the first (dominant) splice donor site in the viral vector genome, encoded and embedded within the native viral RNA packaging sequence typically located in the 5’ region of the viral vector nucleotide sequence. In one embodiment, the retroviral vector genome does not contain an active major splice donor site, that is splicing does not occur from the major splice donor site, and splicing activity from the major splice donor site is ablated. The major splice donor site is located in the 5’ packaging region of a lentiviral genome. In the case of the HIV-1 virus, the major splice donor consensus sequence is (for DNA) TG/GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is a purine and indicates the cleavage site). In one embodiment, the splice donor region, i.e. the region of the vector genome which comprises the major splice donor site prior to mutation, may have the following sequence: GGGGCGGCGACTGGTGAGTACGCCAAAAAT (SEQ ID NO:1) In one embodiment, the mutated splice donor region may comprise the sequence: GGGGCGGCGACTGCAGACAACGCCAAAAAT (SEQ ID NO:2 – MSD-2KO) In one embodiment, the mutated splice donor region may comprise the sequence: GGGGCGGCGAGTGGAGACTACGCCAAAAAT (SEQ ID NO:3 – MSD-2KOv2) In one embodiment, the mutated splice donor region may comprise the sequence: GGGGAAGGCAACAGATAAATATGCCTTAAAAT (SEQ ID NO:4 – MSD-2KOm5) In one embodiment, prior to modification the splice donor region may comprise the sequence: GGCGACTGGTGAGTACGCC (SEQ ID NO:5) This sequence is also referred to herein as the “stem loop 2” region (SL2). This sequence may form a stem loop structure in the splice donor region of the vector genome. In one aspect of the invention this sequence (SL2) may have been deleted from the nucleotide sequence according to the invention as described herein. As such, the invention encompasses the use of a retroviral vector genome that does not comprise SL2. The invention encompasses the use of a retroviral vector genome that does not comprise a sequence according to SEQ ID NO:5. In one aspect of the invention the major splice donor site may have the following consensus sequence, wherein R is a purine and "/" is the cleavage site: TG/GTRAGT In one aspect, R may be guanine (G). In one aspect of the invention, the major splice donor and cryptic splice donor region may have the following core sequence, wherein "/" are the cleavage sites at the major splice donor and cryptic splice donor sites: /GTGA/GTA. In one aspect of the invention the MSD-mutated vector genome may have at least two mutations in the major splice donor and cryptic splice donor ‘region’ (/GTGA/GTA), wherein the first and second ‘GT’ nucleotides are the immediately 3’ of the major splice donor and cryptic splice donor nucleotides respectively In one aspect of the invention the major splice donor consensus sequence is CTGGT. The major splice donor site may contain the sequence CTGGT. In one aspect the nucleotide sequence encoding the retroviral vector genome, prior to inactivation of the splice sites, comprises the sequence as set forth in any of SEQ ID NOs: 1, 5 and/or the sequence TG/GTRAGT, CTGGT, TGAGT and/or /GTGA/GTA. In one aspect the nucleotide sequence comprises an inactivated major splice donor site which would otherwise have a cleavage site between nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO:1. According to the invention as described herein, the nucleotide sequence encoding the retroviral vector genome also contains an inactive cryptic splice donor site. In one aspect the nucleotide sequence does not contain an active cryptic splice donor site adjacent to (3’ of) the major splice donor site, that is to say that splicing does not occur from the adjacent cryptic splice donor site, and splicing from the cryptic splice donor site is ablated. The term "cryptic splice donor site" refers to a nucleic acid sequence which does not normally function as a splice donor site or is utilised less efficiently as a splice donor site due to the adjacent sequence context (e.g. the presence of a nearby ‘preferred’ splice donor), but can be activated to become a more efficient functioning splice donor site by mutation of the adjacent sequence (e.g. mutation of the nearby ‘preferred’ splice donor). In one aspect the cryptic splice donor site is the first cryptic splice donor site 3’ of the major splice donor. In one aspect the cryptic splice donor site is within 6 nucleotides of the major splice donor site on the 3’ side of the major splice donor site. Preferably the cryptic splice donor site is within 4 or 5, preferably 4, nucleotides of the major splice donor cleavage site. In one aspect of the invention the cryptic splice donor site has the consensus sequence TGAGT. In one aspect the inactivated cryptic splice donor site which would otherwise have a cleavage site between nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO:1. In one aspect of the invention the major splice donor site and/or adjacent cryptic splice donor site contain a “GT” motif. In one aspect of the invention both the major splice donor site and adjacent cryptic splice donor site contain a “GT” motif which is mutated. The mutated GT motifs may inactivate splice activity from both the major splice donor site and adjacent cryptic splice donor site. An example of such a mutation is referred to herein as “MSD-2KO”. In one aspect the splice donor region may comprise the following sequence: CAGACA For example, in one aspect the mutated splice donor region may comprise the following sequence: GGCGACTGCAGACAACGCC (SEQ ID NO:6) A further example of an inactivating mutation is referred to herein as “MSD-2KOv2”. In one aspect the mutated splice donor region may comprise the following sequence: GTGGAGACT For example, in one aspect the mutated splice donor region may comprise the following sequence: GGCGAGTGGAGACTACGCC (SEQ ID NO:7) For example, in one aspect the mutated splice donor region may comprise the following sequence: AAGGCAACAGATAAATATGCCTT (SEQ ID NO:8) In one aspect the stem loop 2 region as described above may be deleted from the splice donor region, resulting in inactivation of both the major splice donor site and the adjacent cryptic splice donor site. Such a deletion is referred to herein as “ΔSL2”. A variety of different types of mutations can be introduced into the nucleic acid sequence in order to inactivate the major and adjacent cryptic splice donor sites. In one aspect the mutation is a functional mutation to ablate or suppress splicing activity in the splice region. The nucleotide sequence may contain a mutation or deletion in any of the nucleotides in any of SEQ ID NOs: 1, 5 and/or the sequence TG/GTRAGT, CTGGT, TGAGT and/or /GTGA/GTA. Suitable mutations will be known to one skilled in the art, and are described herein. For example, a point mutation can be introduced into the nucleic acid sequence. The term "point mutation," as used herein, refers to any change to a single nucleotide. Point mutations include, for example, deletions, transitions, and transversions; these can be classified as nonsense mutations, missense mutations, or silent mutations when present within protein coding sequence. A "nonsense" mutation produces a stop codon. A "missense" mutation produces a codon that encodes a different amino acid. A "silent" mutation produces a codon that encodes either the same amino acid or a different amino acid that does not alter the function of the protein. One or more point mutations can be introduced into the nucleic acid sequence comprising the cryptic splice donor site. For example, the nucleic acid sequence comprising the cryptic splice site can be mutated by introducing two or more point mutations therein. At least two point mutations can be introduced in several locations within the nucleic acid sequence comprising the major splice donor and cryptic splice donor sites to achieve attenuation of splicing from the splice donor region. In one aspect the mutations may be within the four nucleotides at the splice donor cleavage site; in the canonical splice donor consensus sequence this is A¹G²/G³T⁴, wherein "/" is the cleavage site. It is well known in the art that a splice donor cleavage site may deviate from this consensus, especially in viral genomes where other constraints bear on the same sequence, such as secondary structure for example within a vRNA packaging region. It is well known that the G³T⁴ dinucleotide is generally the least variable sequence within the canonical splice donor consensus sequence, and mutations to the G³ and or T⁴ will most likely achieve the greatest attenuating effect. For example, for the major splice donor site in HIV-1 viral vector genomes this can be T¹G²/G³T⁴, wherein "/" is the cleavage site. For example, for the cryptic splice donor site in HIV-1 viral vector genomes this can be G¹A²/G³T⁴, wherein "/" is the cleavage site. Additionally, the point mutation(s) can be introduced adjacent to a splice donor site. For example, the point mutation can be introduced upstream or downstream of a splice donor site. In aspects where the nucleic acid sequence comprising a major and/or cryptic splice donor site is mutated by introducing multiple point mutations therein, the point mutations can be introduced upstream and/or downstream of the cryptic splice donor site. As described herein, the nucleotide sequence encoding the RNA genome of the lentiviral vector for use according to the invention may optionally further comprise a mutation in a cryptic splice donor site within the SL4 loop of the packaging sequence. In one aspect a GT dinucleotide in said cryptic splice donor site within the SL4 loop of the packaging sequence is mutated to GC. In one aspect, the nucleotide sequence encoding the retroviral vector genome may be suitable for use in a lentiviral vector in a U3 or tat-independent system for vector production. As described herein, 3^rd generation lentiviral vectors are U3/tat-independent, and the nucleotide sequences according to the present invention may be used in the context of a 3^rd generation lentiviral vector. In one aspect of the invention tat is not provided in the lentiviral vector production system, for example tat is not provided in trans. In one aspect the cell or vector or vector production system as described herein does not comprise the tat protein. In one aspect of the invention HIV-1 U3 is not present in the lentiviral vector production system, for example HIV-1 U3 is not provided in cis to drive transcription of vector genome expression cassette. In one aspect the major splice donor site in the retroviral vector genome is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence is for use in a tat-independent lentiviral vector. In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence is produced in the absence of tat. In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence has been transcribed independently of tat. In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence is for use in a U3-independent lentiviral vector. In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence has been transcribed independently of the U3 promoter. In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence has been transcribed by a heterologous promoter. In one aspect, transcription of the nucleotide sequence as described herein is not dependent on the presence of U3. The nucleotide sequence may be derived from a U3-independent transcription event. The nucleotide sequence may be derived from a heterologous promoter. A nucleotide sequence as described herein may not comprise a native U3 promoter. Construction of Splice Site Mutants Splice site mutants of the present invention may be constructed using a variety of techniques. For example, mutations may be introduced at particular loci by synthesising oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence comprises a derivative having the desired nucleotide insertion, substitution, or deletion. By way of further example, splice site mutants may be constructed as described in WO 2021/160993 (which is incorporated herein by reference in its entirety). Other known techniques allowing alterations of DNA sequence include recombination approaches such as Gibson assembly, Golden-gate cloning and In-fusion. Alternatively, oligonucleotide-directed site-specific (or segment specific) mutagenesis procedures may be employed to provide an altered sequence according to the substitution, deletion, or insertion required. Deletion or truncation derivatives of splice site mutants may also be constructed by utilising convenient restriction endonuclease sites adjacent to the desired deletion. Subsequent to restriction, overhangs may be filled in, and the DNA religated. Exemplary methods of making the alterations set forth above are disclosed by Sambrook et al. (Molecular cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, 1989). Splice site mutants may also be constructed utilising techniques of PCR mutagenesis, chemical mutagenesis, chemical mutagenesis (Drinkwater and Klinedinst, 1986) by forced nucleotide misincorporation (e.g., Liao and Wise, 1990), or by use of randomly mutagenised oligonucleotides (Horwitz et al., 1989). The present invention also provides a method for producing a lentiviral vector nucleotide sequence, comprising the steps of: providing a nucleotide sequence encoding the RNA genome of a lentiviral vector as described herein; and mutating the major splice donor site and cryptic splice donor site as described herein in said nucleotide sequence. Combination with modified U1 snRNA to improve vector titre MSD-mutated lentiviral vectors are preferable to current standard lentiviral vectors for use as gene therapy vectors due to their reduced capacity to partake in aberrant splicing events both during LV production and in target cells. However, the production of MSD mutated vectors has either relied upon supply of the HIV-1 tat protein (1^st and 2^nd generation U3-dependent lentiviral vectors), has been of lower efficiency due to the destabilising effect of mutating the MSD on vector RNA levels (in 3^rd generation vectors), or, as discovered by the present inventors, is improved by co-expression of modified U1 snRNA. The present inventors have previously found that MSD-mutated, 3^rd generation (i.e. U3/tat-independent) LVs could be produced to high titre by co-expression of a modified U1 snRNA directed to bind to the 5’packaging region of the vector genome RNA during production (see WO 2021/014157 and WO 2021/160993, incorporated herein by reference). The amount of vRNA produced from so-called MSD-mutated (or MSD-2KO) lentiviral vector genomes is typically substantially reduced, leading to lower vector titres. It is theorized that an ‘early’ interaction with the MSD and U1 snRNA (prior to splicing decisions) is important for transcription elongation from the external promoter. The inventors previously found that one solution to this problem was to provide a modified U1 snRNA in trans during LV production to stabilize the vRNA (see WO 2021/014157 and WO 2021/160993). These modified U1 snRNAs can enhance the production titres of MSD-mutated LVs in a manner that is independent of the presence of the 5’polyA signal within the 5’R region, indicating a novel mechanism over others’ use of modified U1 snRNAs to suppress polyadenylation (so called U1-interference, [Ui]). Targeting the modified U1 snRNAs to critical sequences of the packaging region produced the greatest enhancement in MSD-mutated LV titres. The present inventors previously showed that the output titres of lentiviral vectors can be enhanced by co-expressing non-coding RNAs based on U1 snRNAs, which have been modified so that they no longer target the endogenous sequence (a splice donor site) but now target a sequence within the vRNA molecule. As demonstrated in WO 2021/014157 and WO 2021/160993, the relative enhancement in output titres of lentiviral vectors harbouring attenuating mutations within the major splice donor region (containing the major splice donor and cryptic splice donor sites) by said modified U1 snRNAs are greater than standard lentiviral vectors containing a non-mutated major splice donor region. Vector genomes harbouring a broad range of mutation types within the major splice donor region (point mutations, region deletion, and sequence replacement) that lead to reduced titres may be used in combination with a modified U1 snRNA. The approach may comprise co- expression of modified U1 snRNAs together with the other vector components during vector production. The modified U1 snRNAs are designed such that binding to the consensus splice donor site has been ablated by replacing it with a heterologous sequence that is complementary to a target sequence within the vector genome vRNA. In some embodiments, the set of nucleic acid sequences of the invention are used in combination with a modified U1 snRNA. In some embodiments, the set of nucleic acid sequences of the invention further comprise a nucleotide sequence encoding a modified U1 snRNA. In some embodiments, the nucleotide sequence encoding the retroviral vector genome further encodes a modified U1 snRNA. Splicing and polyadenylation are key processes for mRNA maturation, particularly in higher eukaryotes where most protein-coding transcripts contain multiple introns. The elements within a pre-mRNA that are required for splicing include the 5' splice donor signal, the sequence surrounding the branch point and the 3' splice acceptor signal. Interacting with these three elements is the spliceosome, which is formed by five small nuclear RNAs (snRNAs), including U1 snRNA, and associated nuclear proteins (snRNP). U1 snRNA is expressed by a polymerase II promoter and is present in most eukaryotic cells (Lund et al., 1984, J. Biol. Chem., 259:2013-2021). Human U1 snRNA (small nuclear RNA) is 164 nt long with a well-defined structure consisting of four stem–loops (West, S., 2012, Biochemical Society Transactions, 40:846-849). U1 snRNA contains a short sequence at its 5’-end that is broadly complementary to the 5’ splice donor sites at exon-intron junctions. U1 snRNA participates in splice-site selection and spliceosome assembly by base pairing to the 5’ splice donor site. A known function for U1 snRNA outside splicing is in the regulation of 3’-end mRNA processing: it suppresses premature polyadenylation (polyA) at early polyA signals (particularly within introns). Human U1 snRNA (small nuclear RNA) is 164 nt long with a well-defined structure consisting of four stem–loops. The endogenous non-coding RNA, U1 snRNA, binds to the consensus 5’ splice donor site (e.g.5’-MAGGURR-3’, wherein M is A or C and R is A or G) via the native splice donor annealing sequence (e.g. 5’-ACUUACCUG-3’) during early steps of intron splicing. Stem loop I binds to U1A-70K protein that has been shown to be important for polyA suppression. Stem loop II binds to U1A protein, and the 5’-AUUUGUGG-3’ sequence binds to Sm proteins, which together with Stem loop IV, is important for U1 snRNA processing. As defined herein, the modified U1 snRNA for use according to the present invention is modified to introduce a heterologous sequence that is complementary to a target sequence within the vector genome vRNA molecule at the site of the native splice donor targeting/annealing sequence. In one embodiment, the nucleotide sequence encoding a modified U1 snRNA may be on a different nucleotide sequence, for example on a different plasmid. Suitable modified U1 snRNAs for use according to the present invention are described in WO 2021/014157 and WO 2021/160993 and are incorporated herein by reference. The modified U1 snRNAs can be manufactured according to methods generally known in the art. For example, the modified U1 snRNAs can be manufactured by chemical synthesis or recombinant DNA/RNA technology. By way of further example, the modified U1 snRNAs as described herein can be manufactured as described in WO 2021/014157 and WO 2021/160993. The introduction of a nucleotide sequence encoding a modified U1 snRNA as described herein into a cell using conventional molecular and cell biology techniques is within the capabilities of a person of ordinary skill in the art. TRIP System The present invention, as disclosed herein, may be combined with the ‘TRIP’ system. WO2015/092440 and WO2021/094752, which are incorporated in their entirety herein by reference, disclose the use of a heterologous translation control system in eukaryotic cell cultures to repress the translation of the NOI (repress transgene expression) during viral vector production and thus repress or prevent expression of the protein encoded by the NOI. This system is referred to as the Transgene Repression In vector Production cell system or TRIP system. In one form, the TRIP system utilises the bacterial trp operon regulation protein, tryptophan RNA-binding attenuation protein (TRAP), and the TRAP binding site/sequence (tbs) to mediate transgene repression. The use of this system does not impede the production of packageable vector genome molecules nor the activity of vector virions, and does not interfere with the long-term expression of the NOI in the target cell. The term “binding site” is to be understood as a nucleic acid sequence that is capable of interacting with a certain protein. By “capable of interacting” it is to be understood that the nucleic acid binding site (e.g. tbs or portion thereof) is capable of binding to a protein, for example TRAP, under the conditions that are encountered in a cell, for example a eukaryotic viral vector production cell. Such an interaction with an RNA-binding protein such as TRAP results in the repression or prevention of translation of a NOI to which the nucleic acid binding site (e.g. the tbs or portion thereof) is operably linked. A consensus TRAP binding site sequence that is capable of binding TRAP is [KAGNN] repeated multiple times (e.g.6, 7, 8, 9, 10, 11, 12 or more times); such sequence is found in the native trp operon. In the native context, occasionally AAGNN is tolerated and occasionally additional “spacing” N nucleotides result in a functional sequence. In vitro experiments have demonstrated that at least 6 or more consensus repeats are required for TRAP-RNA binding (Babitzke P, Y. J., Campanelli D. (1996) Journal of Bacteriology 178(17): 5159-5163). Therefore, preferably in one aspect there are 6 or more continuous [KAGN≥2] sequences present within the tbs, wherein “K” may be T or G in DNA and U or G in RNA and “N” is to be understood as specifying any nucleotide at that position in the sequence (for example, “N” could be G, A, T, C or U). In some embodiments, the retroviral vector genome further comprises a tbs. In some embodiments, the nucleotide sequence of the invention further comprises a TRAP binding site (tbs). Suitable tbs are described in WO2015/092440 and WO2021/094752 and are incorporated herein by reference. Suitably, the nucleotide sequence may further comprise a tbs, and also may comprise a Kozak sequence, wherein said tbs overlaps the Kozak sequence, or wherein said Kozak sequence comprises a portion of a tbs. Suitably, the nucleotide sequence may further comprise a multiple cloning site and a Kozak sequence, wherein said multiple cloning site is overlapping with or located downstream to the 3’ KAGN2-3 repeat of the tbs and upstream of the Kozak sequence. As used herein, a “multiple cloning site” is to be understood as a DNA region which contains several restriction enzyme recognition sites (restriction enzyme sites) very close to each other. In one aspect, the RE sites may be overlapping in the MCS for use in the invention. As used herein, a “restriction enzyme site” or “restriction enzyme recognition site” is a location on a DNA molecule containing specific sequences of nucleotides, 4-8 nucleotides in length, which are recognised by restriction enzymes. A restriction enzyme recognises a specific RE site (i.e. a specific sequence) and cleaves the DNA molecule within, or nearby, the RE site. In some aspects of the present invention, the nucleotide of interest (i.e. transgene) is operably linked to the tbs. In some aspects, the nucleotide of interest is translated in a target cell which lacks TRAP. By “operably linked” it is to be understood that the components described are in a relationship permitting them to function in their intended manner. Therefore a tbs or portion thereof for use in the invention operably linked to a NOI is positioned in such a way that translation of the NOI is modified when as TRAP binds to the tbs or portion thereof. The tbs may be capable of interacting with TRAP such that translation of the nucleotide of interest is repressed or prevented in a viral vector production cell. Viral cis-acting sequences ORFs present in the vector backbone delivered in transduced (e.g. patient) cells could be transcribed, for example, when read-through transcription from upstream cellular promoters occurs (lentiviral vectors target active transcription sites), leading to potential aberrant transcription of genetic material located in the vector backbone in patient cells. This potential aberrant transcription of genetic material located in the vector backbone following read- through transcription could also occur during lentiviral vector production in production cells. The viral cis-acting sequence and/or nucleotide sequence encoding gag present within lentiviral vector genomes may contain multiple internal ORFs. These internal ORFs may be found between an internal ATG sequence of the viral cis-acting sequence or nucleotide sequence encoding gag and the stop codon immediately 3’ to the ATG sequence. Modifications in a viral cis-acting sequence or nucleotide sequence encoding gag to disrupt at least one internal ORF, for example by mutating the ATG sequence which denotes the start of the at least one internal ORF, are tolerated. Thus, the modified viral cis-acting sequence or modified nucleotide sequence encoding gag described herein retains its function. Accordingly, in some embodiments of the present invention, the lentiviral vector genome comprises at least one modified viral cis-acting sequence, wherein at least one internal open reading frame (ORF) in the viral cis-acting sequence is disrupted (see WO 2021/181108, incorporated herein by reference in its entirety). The at least one internal ORF may be disrupted by mutating at least one ATG sequence (ATG sequences may function as translation initiation codons). In some embodiments of the present invention, the lentiviral vector genome comprises a modified nucleotide sequence encoding gag, wherein at least one internal ORF in the modified nucleotide sequence encoding gag is disrupted (see WO 2021/181108, incorporated herein by reference in its entirety). The at least one internal ORF in the modified nucleotide sequence encoding gag may be disrupted by mutating at least one ATG sequence as described herein. Suitable modified viral cis-acting sequences and modified nucleotide sequences encoding gag for use according to the present invention are described in WO 2021/181108 and are incorporated herein by reference. In some embodiments, the lentiviral vector genome comprises at least two (suitably at least three, at least four, at least five, at least six, at least seven) modified viral cis-acting sequences. In some embodiments, at least two (suitably at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen or at least twenty) internal ORFs in the at least one viral cis-acting sequence and/or in the nucleotide sequence encoding gag may be disrupted. In some embodiments, at least three internal ORFs in the at least one viral cis-acting sequence and/or in the nucleotide sequence encoding gag may be disrupted. In some embodiments, one (suitably, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen or twenty) internal ORFs in the at least one viral cis-acting sequence and/or the nucleotide sequence encoding gag may be disrupted. In some embodiments, the at least one internal ORF may be disrupted such that the internal ORF is not expressed. In some embodiments, the at least one internal ORF may be disrupted such that the internal ORF is not translated. In some embodiments, the at least one internal ORF may be disrupted such that no protein is expressed from the internal ORF. In some embodiments, the at least one internal ORF may be disrupted such that no protein is translated from the internal ORF. Thus, the at least one internal ORF present in the modified viral cis- acting sequence and/or in the modified nucleotide sequence encoding gag in the vector backbone delivered in transduced cells may be disrupted such that aberrant transcription of the internal ORF is prevented when there is read-through transcription from upstream cellular promoters. In one embodiment, the at least one internal ORF may be disrupted by mutating at least one ATG sequence. A “mutation” of an ATG sequence may comprise one or more nucleotide deletions, additions, or substitutions. In one embodiment, the at least one ATG sequence may be mutated in the modified viral cis- acting sequence and/or in the modified nucleotide sequence encoding gag to a sequence selected from the group consisting of: a) an ATTG sequence; b) an ACG sequence; c) an A-G sequence; d) an AAG sequence; e) a TTG sequence; and/or f) an ATT sequence. In one embodiment, the at least one modified viral cis-acting element and/or the modified nucleotide sequence encoding gag may lack ATG sequences. In some embodiments, all ATG sequences within viral cis-acting sequences and/or the nucleotide sequence encoding gag in the lentiviral vector genome are mutated. Lentiviral vectors typically comprise multiple viral cis-acting sequences. Example viral cis- acting sequences include gag-p17, Rev response element (RRE), central polypurine tract (cppt) and Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE). In some embodiments, the at least one viral cis-acting sequence may be at least one lentiviral cis-acting sequence. Example lentiviral cis-acting sequences include the RRE and cppt. In some embodiments, the at least one viral cis-acting sequence may be at least one non- lentiviral cis-acting sequence. In some embodiments, the at least one viral cis-acting sequence may be at least one lentiviral cis-acting sequence and at least one non-lentiviral cis-acting sequence. In some embodiments, the at least one viral cis-acting sequence is: a) gag-p17; and/or b) a Rev response element (RRE); and/or c) a Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE). In some embodiments, the lentiviral vector genome comprises a modified RRE as described herein and a modified WPRE as described herein. In some embodiments, the lentiviral vector genome comprises a modified RRE as described herein, a modified WPRE as described herein and a modified nucleotide sequence encoding gag as described herein. In one embodiment, the lentiviral vector genome as described herein lacks ATG sequences in the backbone of the vector genome. In one embodiment, the lentiviral vector genome as described herein lacks ATG sequences except in the NOI (i.e. transgene). In one embodiment, the lentiviral vector genome comprises at least one modified viral cis- acting sequence and/or a modified nucleotide sequence encoding gag, wherein at least one internal open reading frame (ORF) in the viral cis-acting sequence or in the nucleotide sequence encoding gag is ablated. In one embodiment, the lentiviral vector genome comprises at least one modified viral cis- acting sequence and/or a modified nucleotide sequence encoding gag, wherein at least one internal open reading frame (ORF) in the viral cis-acting sequence or in the nucleotide sequence encoding gag is silenced. Modified gag and viral Gag-p17 protein A further preferred but optional feature of the invention is the minimization of gag sequences included within the packaging sequences used in combination with the aforementioned features. The amount of gag typically included within HIV-1 lentiviral vector packaging sequences can be reduced by at least 270 nucleotides, but may be reduced by up to the entire gag sequence. The deleted gag nucleotide sequence may be that of the gag-p17 instability sequence. Deletion of the gag-p17 instability sequence typically results in reduced vector titers unless the first ATG codon of the remaining gag sequence is mutated. In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 80 (suitably, the first 70, the first 60, the first 50, the first 40, the first 30, the first 20 or the first 10) nucleotides of gag remain. In some aspects the reduced packaging sequences comprise deleted gag sequences wherein no nucleotides of gag remain. In some aspects, nucleotide sequences of the invention comprise ablated gag sequences wherein the gag sequences comprise only up to the first 10, up to the first 20, up to the first 30, up to the first 40, up to the first 50, up to the first 60, up to the first 70, or up to the first 80 nucleotides of gag. The nucleotide sequence encoding gag may be a truncated nucleotide sequence encoding a part of gag. The nucleotide sequence encoding gag may be a minimal truncated nucleotide sequence encoding a part of gag. The part of gag may be a contiguous sequence. The truncated nucleotide sequence or minimal truncated nucleotide sequence encoding a part of gag may also contain at least one frameshift mutation. An example truncated nucleotide sequence encoding a part of gag and which contains a frameshift mutation at position 45-46 is as follows: ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGG CCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGC AGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCC TTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAA AGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGGAGAGCAAAACAAAAGTAAGA (SEQ ID NO: 9). An example minimal truncated nucleotide sequence encoding a part of gag and which contains a frameshift mutation at position 45-46 is as follows: ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGG CCAGGGGGAAAGA (SED ID NO: 10). The nucleotide sequence encoding gag and/or modified nucleotide sequence encoding gag may, for example, comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 9; or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 10. The modified nucleotide sequence encoding gag may comprise the sequence as set forth in SEQ ID NO: 9 or SEQ ID NO: 10, or a sequence having at least 80% identity (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) thereto, wherein at least one ATG sequence selected from (a) to (c) is mutated: a) ATG corresponding to positions 1-3 of SEQ ID NO: 9; b) ATG corresponding to positions 47-49 of SEQ ID NO: 9; and/or c) ATG corresponding to positions 107-109 of SEQ ID NO: 9. An example modified truncated nucleotide sequence encoding part of gag and which contains a frameshift mutation is as follows: ACGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATTGGGAAAAAATTCGGTTAAG GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATTGGGCAAGCAGGGAGCTAGAACGATTC GCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATC CCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATC AAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGGAGAGCAAAACAAAAGTAAG A (SEQ ID NO: 11). An example modified minimal truncated nucleotide sequence encoding a part of gag and which contains a frameshift mutation is as follows: ACGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATTGGGAAAAAATTCGGTTAAG GCCAGGGGGAAAGA (SED ID NO: 12). The modified nucleotide sequence encoding gag may comprise the sequence as set forth in SEQ ID NO: 11, or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than three (suitably less than two or less than one) ATG sequences. The modified nucleotide sequence encoding gag may comprise the sequence as set forth in SEQ ID NO: 12, or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than two (suitably less than one) ATG sequences. The modified nucleotide sequence encoding gag may comprise less than three ATG sequences. Suitably, the modified nucleotide sequence encoding gag may comprise less than two or less than one ATG sequence(s). The modified nucleotide sequence encoding gag may lack an ATG sequence. Lentiviral vector genomes lacking a nucleotide sequence encoding Gag-p17 or a fragment thereof are described in WO 2021/181108, incorporated herein by reference in its entirety. Such lentiviral vector genomes as described in WO 2021/181108 are suitable for use according to the present invention. The lentiviral vector genome as described herein may lack a nucleotide sequence encoding Gag-p17 or a fragment thereof. The lentiviral vector genome may, for example, not express Gag-p17 or a fragment thereof. In one embodiment, the lentiviral vector genome may lack the sequence as set forth in SEQ ID NO: 13. The viral protein Gag-p17 surrounds the capsid of the lentiviral vector particle, and is in turn surrounded by the envelope protein. A nucleotide sequence encoding Gag-p17 has historically been included in lentiviral vector genomes for the production of therapeutic lentiviral vectors. The nucleotide sequence encoding Gag-p17 present within lentiviral vector genomes is typically embedded within the packaging region containing highly structured RNA towards the 5’ region of the RNA (the 5’UTR). The nucleotide sequence encoding Gag-p17 typically comprises an RNA instability sequence (INS), herein referred to as p17-INS. Deletion of p17-INS from the backbone of the lentiviral vector genome does not significantly impact vector titres during lentiviral vector production. The lentiviral vector genome lacking a nucleotide sequence encoding Gag-p17 or p17-INS is of a smaller size compared to a lentiviral vector genome comprising a nucleotide sequence encoding Gag-p17 or p17-INS. Thus, the amount of viral DNA contained within the viral vector backbone delivered in transduced cells is reduced when a lentiviral vector genome lacking a nucleotide sequence encoding Gag-p17 or p17-INS is used. Further, the lentiviral vector genome lacking a nucleotide sequence encoding Gag-p17 or p17-INS may be used to deliver a transgene of larger size than the transgenes which can be delivered using a lentiviral vector genome containing a nucleotide sequence encoding Gag-p17 or p17-INS. Therefore, there are several reasons why it may be desirable to delete nucleotide sequence encoding Gag-p17 or p17-INS within the vector backbone. Deletion of gag sequences in order to reduce the size of lentiviral vector genome sequences has been reported (Sertkaya, H., et al., Sci Rep 11:12067 (2021)). In some embodiments, the lentiviral vector genome lacks either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17. In some embodiments, the lentiviral vector genome lacks a nucleotide sequence encoding p17-INS or a fragment thereof. An example p17-INS is as follows: AAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGC CTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATC AGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAA AAGACACCAAGGAAGCTTTAGACAAGATAGAGGGAGAGCAAAACAAAAGTA (SEQ ID NO: 13). In one embodiment, the lentiviral vector genome may lack the sequence as set forth in SEQ ID NO: 13. In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 is a part of a full-length nucleotide sequence encoding Gag-p17. In one embodiment, the fragment comprises or consists of at least about 10 nucleotides (suitably at least about 20, at least about 30, at least about 40, at least about 50, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350 nucleotides). In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is between 1% and 99% of full-length nucleotide sequence encoding Gag-p17. Suitably, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is at least about 10% (suitably at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%) of a full-length nucleotide sequence encoding Gag-p17, such as a native nucleotide sequence encoding Gag- p17. The fragment may be a contiguous region of a full-length nucleotide sequence encoding Gag-p17, such as a native nucleotide sequence encoding Gag-p17. In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is between 1% and 99% of full-length nucleotide sequence encoding p17-INS. Suitably, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is at least about 10% (suitably at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%) of a full-length nucleotide sequence encoding p17-INS, such as a native nucleotide sequence encoding p17- INS (e.g. SEQ ID NO: 13). The fragment may be a contiguous region of a full-length nucleotide sequence encoding p17-INS, such as a native nucleotide sequence encoding p17-INS (e.g. SEQ ID NO: 13). In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 comprises or consists of the INS located in the nucleotide sequence encoding Gag-p17. In one embodiment, the lentiviral vector genome lacking either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17 comprises at least one modified viral cis-acting sequence as described herein. In one embodiment, the lentiviral vector genome lacking either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17 may comprise a modified RRE, a modified WPRE and/or a modified nucleotide sequence encoding gag as described herein. In one embodiment, the lentiviral vector genome lacking either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17 may comprise a modified RRE as described herein, a modified WPRE as described herein and a modified nucleotide sequence encoding gag as described herein. Modified Rev response element (RRE) In some embodiments, the lentiviral vector genome comprises a modified Rev response element (RRE), wherein at least one internal open reading frame (ORF) in the RRE is disrupted as described herein. The RRE is an essential viral RNA element that is well conserved across lentiviral vectors and across different wild-type HIV-1 isolates. The RRE present within lentiviral vector genomes may contain multiple internal ORFs. These internal ORFs may be found between an internal ATG sequence of the RRE and the stop codon immediately 3’ to the ATG sequence. The RRE present within lentiviral vector genomes is typically embedded within the packaging region containing highly structured RNA towards the 5’ region of the RNA (the 5’UTR). The 5’ UTR structure consists of series of stem-loop structures connected by small linkers. These stem-loops include the RRE. Thus, the RRE itself has a complex secondary structure, involving complementary base-pairing, to which Rev binds. Modifications in the RRE to disrupt at least one internal ORF, for example by mutating the ATG sequence which denotes the start of the at least one internal ORF, are tolerated. Thus, the modified RREs described herein retain Rev binding capacity. The modified RRE may comprise less than eight ATG sequences. Accordingly, in some embodiments, the lentiviral vector genome comprises a modified Rev response element (RRE), wherein the modified RRE comprises less than eight ATG sequences. Suitably, the modified RRE may comprise less than seven, less than six, less than five, less than four, less than three, less than two or less than one ATG sequence(s). The modified RRE may lack an ATG sequence. The RRE may be a minimal functional RRE. An example minimal functional RRE is as follows: AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGA CGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAG GCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGT GGAAAGATACCTAAAGGATCAACAGCTCCT (SEQ ID NO: 14). By “minimal functional RRE” or “minimal RRE” is meant a truncated RRE sequence which retains the function of the full-length RRE. Thus, the minimal functional RRE retains Rev binding capacity. The RRE may be the core RRE. An example core RRE is as follows: GGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGAC GGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGG CGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTG GAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCAC TGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGA TGGAGTGGGAC (SEQ ID NO: 47) The RRE may be a full-length RRE. An example full-length RRE is as follows: TGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTA GTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAG AGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGT CAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAG AATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAAC TCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAAT CACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGA AGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGT GGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTG GTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATT ATCGTTTCAGACCCACCTCCCAACCCCGAGGGGAC (SEQ ID NO: 15). The RRE may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 14; b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 47; and/or c) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 15. The modified RRE may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 14; b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 47; and/or c) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 15. The modified RRE may comprise the sequence as set forth in SEQ ID NO: 14, SEQ ID NO: 47 or SEQ ID NO: 15, or a sequence having at least 80% identity (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) thereto, wherein at least one ATG sequence selected from the group (a)-(h) is mutated: a) ATG corresponding to positions 27-29 of SEQ ID NO: 15; b) ATG corresponding to positions 192-194 of SEQ ID NO: 15; c) ATG corresponding to positions 207-209 of SEQ ID NO: 15; d) ATG corresponding to positions 436-438 of SEQ ID NO: 15; e) ATG corresponding to positions 489-491 of SEQ ID NO: 15; f) ATG corresponding to positions 571-573 of SEQ ID NO: 15; g) ATG corresponding to positions 599-601 of SEQ ID NO: 15; and/or h) ATG corresponding to positions 663-665 of SEQ ID NO: 15. An example modified RRE sequence is as follows: AGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATTGGGCGCAGCGTCAATTGACGCT GACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTG AGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCT GTGGAAAGATACCTAAAGGATCAACAGCTCCT (SEQ ID NO: 16). A further example modified RRE sequence is as follows: GGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATTGGGCGCAGCGTCAATTGACGCTG ACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGA GGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTG TGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACC ACTGCTGTGCCTTGGAATTGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCT GGATTGGAGTGGGAC (SEQ ID NO: 48) A further example modified RRE sequence is as follows: TGATCTTCAGACCTGGAGGAGGAGATATTGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGT AGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAA GAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATTGGGCGCAGC GTCAATTGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTG CTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGC AAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAA AACTCATTTGCACCACTGCTGTGCCTTGGAATTGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTG GAATCACACGACCTGGATTGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTA ATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAG TTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATTGATAGTAGGA GGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTC ACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGAC (SEQ ID NO: 17). An example of a modified RRE sequence lacking an ATG sequence is as follows: TGATCTTCAGACCTGGAGGAGGAGATATTGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGT AGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAA GAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATTGGGCGCAGC GTCAATTGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTG CTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGC AAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAA AACTCATTTGCACCACTGCTGTGCCTTGGAATTGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTG GAATCACACGACCTGGATTGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTA ATTGAAGAATCGCAAAACCAGCAAGAAAAGAATtGAACAAGAATTATTGGAATTAGATAAATtGGGCA AGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATTGATAGTAG GAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATAT TCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGAC (SEQ ID NO: 18). The modified RRE may comprise the sequence as set forth in SEQ ID NO: 16, SEQ ID NO: 48, SEQ ID NO: 17 or SEQ ID NO: 18, or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than eight (suitably less than seven, less than six, less than five, less than four, less than three, less than two or less than one) ATG sequences. Modified Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE) In some embodiments, the lentiviral vector genome comprises a modified Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE), wherein at least one internal open reading frame (ORF) in the WPRE is disrupted as described herein. The WPRE can enhance expression from a number of different vector types including lentiviral vectors (U.S. Patent Nos.6,136,597; 6,287,814; Zufferey, R., et al. (1999) J. Virol.73: 2886- 92). Without wanting to be bound by theory, this enhancement is thought to be due to improved RNA processing at the post-transcriptional level, resulting in increased levels of nuclear transcripts. A two-fold increase in mRNA stability also contributes to this enhancement (Zufferey, R., et al. ibid). The level of enhancement of protein expression from transcripts containing the WPRE versus those without the WPRE has been reported to be around 2-to-5 fold, and correlates well with the increase in transcript levels. This has been demonstrated with a number of different transgenes (Zufferey, R., et al. ibid). The WPRE contains three cis-acting sequences important for its function in enhancing expression levels. In addition, it contains a fragment of approximately 180 bp comprising the 5’-end of the WHV X protein ORF (full length ORF is 425bp), together with its associated promoter. The full-length X protein has been implicated in tumorigenesis (Flajolet, M. et al, (1998) J. Virol. 72: 6175-6180). Translation from transcripts initiated from the X promoter results in formation of a protein representing the NH₂-terminal 60 amino acids of the X protein. This truncated X protein can promote tumorigenesis, particularly if the truncated X protein sequence is integrated into the host cell genome at specific loci (Balsano, C. et al, (1991) Biochem. Biophys Res. Commun.176: 985-92; Flajolet, M. et al, (1998) J. Virol.72: 6175-80; Zheng, Y.W., et al, (1994) J. Biol. Chem.269: 22593-8; Runkel, L., et al, (1993) Virology 197: 529-36). Therefore, expression of the truncated X protein could promote tumorigenesis if delivered to cells of interest, precluding safe use of wild-type WPRE sequences. US 2005/0002907 discloses that mutation of a region of the WPRE corresponding to the X protein ORF ablates the tumorigenic activity of the X protein, thereby allowing the WPRE to be used safely in lentiviral expression vectors to enhance expression levels of heterologous genes or nucleotides of interest. As used herein, the “X region” of the WPRE is defined as comprising at least the first 60-amino acids of the X protein ORF, including the translation initiation codon, and its associated promoter. A “functional” X protein is defined herein as a truncated X protein that is capable of promoting tumorigenesis, or a transformed phenotype, when expressed in cells of interest. A “non-functional” X protein in the context of this application is defined as an X protein that is incapable of promoting tumorigenesis in cells of interest. The modified WPREs described herein retain the capacity to enhance expression from the lentiviral vector. The modified WPRE may comprise less than seven ATG sequences. The modified WPRE may comprise less than six ATG sequences. Accordingly, in some embodiments, the lentiviral vector genome comprises a modified Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE), wherein the modified WPRE comprises less than seven ATG sequences, preferably less than six ATG sequences. Suitably, the modified WPRE may comprise less than seven, less than six, less than five, less than four, less than three, less than two or less than one ATG sequence(s). The modified WPRE may lack ATG sequences. In some embodiments, at least one ATG sequence in the X region of the WPRE is mutated, whereby expression of a functional X protein is prevented. In preferred embodiments, the mutation is in the translation initiation codon of the X region. As a result of the mutation of the at least one ATG sequence, the X protein may not be expressed. In some embodiments, the modified WPRE does not comprise a mutation in an ATG sequence in the X region of the WPRE. An example WPRE sequence is as follows: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCT TTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCT GCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTT CCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCC TTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC (SEQ ID NO: 19). An example WPRE sequence which contains a disrupted X-protein ORF is as follows: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCT TTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCT GCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTT CCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCC TTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC (SEQ ID NO: 20). The WPRE may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 19; and/or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 20. The modified WPRE may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 19; and/or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 20. The modified WPRE may comprise the sequence as set forth in SEQ ID NO: 19 or SEQ ID NO: 20, or a sequence having at least 80% identity (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) thereto, wherein at least one ATG sequence selected from the group (a)-(g) is mutated: a) ATG corresponding to positions 53-55 of SEQ ID NO: 19; b) ATG corresponding to positions 72-74 of SEQ ID NO: 19; c) ATG corresponding to positions 91-93 of SEQ ID NO: 19; d) ATG corresponding to positions 104-106 of SEQ ID NO: 19; e) ATG corresponding to positions 121-123 of SEQ ID NO: 19; f) ATG corresponding to positions 170-172 of SEQ ID NO: 19; and/or g) ATG corresponding to positions 411-413 of SEQ ID NO: 19. The WRPE typically contains a retained Pol ORF. An example retained Pol ORF sequence is as follows: ATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCAC TGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCA CGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAAT TCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCT GCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGC TGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCC GCCTCC (SEQ ID NO: 21). In one embodiment, at least one (suitably at least two or at least three) ATG sequence within the retained Pol ORF sequence in the WPRE is mutated. In one embodiment, all ATG sequences within the retained Pol ORF sequence in the WPRE are mutated. In one embodiment, the modified WPRE comprises less than three (suitably less than two or less than one) ATG sequences in the retained Pol ORF sequence in the WPRE. In one embodiment, the modified WPRE lacks an ATG sequence in the retained Pol ORF sequence in the WPRE. An example modified WPRE sequence in which all ATG codons within the retained Pol ORF are mutated is as follows: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATTGCTATTGCTTCCCGTATGGCTTTCATTTTC TCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATTGAGGAGTTGTGGCCCGTTGTCAGGCAACGTG GCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTC CTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCG CTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCT TTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCG GCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCG CCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC (SEQ ID NO: 22). An example of a modified WPRE sequence lacking an ATG sequence is as follows: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATtGTTGCTCCTTTTA CGCTATtGTGGATACGCTGCTTTAATtGCCTTTGTATCATtGCTATTGCTTCCCGTATtGGCTTTCAT TTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATtGAGGAGTTGTGGCCCGTTGTCAGGCAA CGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCA GCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTG CCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCG TCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCC TTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTC TTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC (SEQ ID NO: 23). The modified WPRE may comprise the sequence as set forth in SEQ ID NO: 22 or SEQ ID NO: 23, or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than six (suitably less than five, less than four, less than three, less than two or less than one) ATG sequences. Vector intron In some embodiments, the interfering RNA which is specific for mRNA encoding the transgene as described herein is combined with a vector intron (VI). Thus, a vector intron may comprise the interfering RNA which is specific for mRNA encoding the transgene as described herein. As described herein, the retroviral vector may be a lentiviral vector. Thus, in some embodiments, the set of nucleic acid sequences comprises a nucleotide sequence encoding the lentiviral vector genome, wherein the lentiviral vector genome comprises a transgene expression cassette and a vector intron. In some preferred embodiments, the vector intron comprises the nucleic acid sequence encoding the interfering RNA. Thus, the interfering RNA may be provided in cis during lentiviral vector production. In some embodiments of the nucleotide sequence encoding a lentiviral vector genome expression cassette: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron. In some embodiments, the cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette is inactivated. The vector intron is in the sense orientation (i.e. forward orientation) with respect to the lentiviral vector genome expression cassette. In some embodiments, the vector intron comprises one or more interfering RNA(s) which is specific for mRNA encoding the transgene as described herein. In some embodiments, the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and: a) the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and/or b) the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT; and/or c) the 3’ UTR of the transgene expression cassette comprises the vector intron. In some embodiments, the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and: a) the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and b) the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT; and c) the 3’ UTR of the transgene expression cassette comprises the vector intron. In some embodiments, the 3’ UTR of the transgene expression cassette comprises the vector intron encoded in antisense with respect to the transgene expression cassette. Thus, when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and the 3’ UTR of the transgene expression cassette comprises the vector intron; the vector intron is in an antisense orientation with respect to the lentiviral vector genome expression cassette. In some embodiments of the nucleotide sequence encoding a lentiviral vector genome expression cassette: i) the major splice donor site and cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette are inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) a) When the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette: i. the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and ii. the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequence CAGACA, and/or GTGGAGACT; and iii. the 3’ UTR of the transgene expression cassette comprises the vector intron; and b) the vector intron comprises one or more one or more interfering RNA(s) which is specific for mRNA encoding the transgene as described herein. As described herein, the present inventors surprisingly found that the VI enabled deletion of the RRE and resulted in a rev/RRE-independent LV genome (see Example 2). Since the VI sequence is removed from the LV vRNA prior to appearance in the cytoplasm, this allows for increased transgene capacity of LVs by ~780nts. The present inventors have also found that at least a further ~260nts can be liberated by deletion of the gag-p17 instability (p17-INS) element from the gag sequence typically retained as part of the packaging sequence. Even more surprising was that to achieve the highest LV titres using the VI in a RRE-deleted LV genome, the MSD-2KO feature appeared to be beneficial (see Example 2). Therefore, the MSD-2KO and VI features of these new class of rev/RRE-independent LV genomes may be mutually ‘symbiotic’, i.e. mutually beneficial, at the molecular level. The VI may rescue the negative impact of the MSD-2KO mutation on LV vRNA production/titres, and the MSD-2KO mutation may stop aberrant splicing to internal splice acceptors (including that of the VI) and to allow for maximal titres of VI-containing, RRE-deleted LV genomes. The VI according to the present invention may be any suitable functional intron. As such, VI may comprise any nucleotide sequence recognizable as an intron. Introns are well known in the art. Typically, an intron is a nucleotide sequence within a gene that is spliced- out, i.e. removed by RNA splicing, before the RNA molecule is translated into protein. Introns may be identified by a number of features, e.g. the presence of splice sites and/or a branch point. Thus, the VI according to the present invention comprises a splice donor site, a splice acceptor site, and a branch point. As used herein, the term “branch point” refers to a nucleotide, which initiates a nucleophilic attack on the splice donor site during RNA splicing. The resulting free 3’ end of the upstream exon may then initiate a second nucleophilic attack on the splice acceptor site, releasing the intron as an RNA lariat and covalently combining the two sequences flanking the intron (e.g. the upstream and downstream exons). Illustrative splice donor and splice acceptor sequences suitable for use according to the invention are provided in Table 4 below. Table 4. Illustrative splice donor and splice acceptor sequences.

In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127. In some embodiments, the vector intron according to the invention comprises a sequence selected from SEQ ID NOs: 128-133. In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127 and a sequence selected from SEQ ID NOs: 128-133. In one preferred embodiment, the vector intron according to the invention comprises the sequence as set forth in SEQ ID NO: 126 and the sequence as set forth in SEQ ID NO: 132. Native splice donor sequences may not adhere fully to the core splice donor consensus sequence described herein (i.e. to MAGGURR; wherein M is A or C and R is A or G). For example, the splice donor sequence of SEQ ID NO: 126 does not fully adhere to the core splice donor consensus sequence. Such native splice donor sequences may be modified to increase the conformity, or to fully conform with, with the core splice donor consensus sequence without deleterious effect on the function of the resulting modified splice donor sequence and/or vector intron comprising the resulting modified splice donor sequence. Methods to modify a nucleotide sequence are known in the art. Modifying a splice donor sequence as described above to increase its conformity with the core splice donor consensus sequence is within the ambit of the skilled person. The VI according to the present invention may be a naturally occurring intron. The VI according to the present invention may be synthetic, or derived wholly or partially from any suitable organism. In one embodiment the intron is from EF1α. In one embodiment, the intron is the intron of EF1α. In one embodiment the intron is from human β-globin intron-2. In one embodiment the intron is human β-globin intron-2. Further, the VI may be optimized to improve vector titre by use of the following sequences: [1] short exonic splicing enhancers (ESEs) upstream of the VI splice donor site, [2] optimal splice donor sites (typically with maximal annealing potential to U1 snRNA), [3] use of optimal branch and splice acceptor sites, and [4] the use of short exonic splicing enhancers (ESEs) downstream of the VI splice acceptor site. The VI according to the present invention may be a chimeric or modular intron comprising sequences, such as functional sequences, from different introns. Thus, the VI of the invention may be designed to comprise a composite of different sequences, such as functional sequences, from more than one intron, such sequences may comprise, for example, a splice donor site sequence, a splice acceptor site sequence, a branch point sequence (see Table 1). The branch point and splice acceptor site sequence may together be referred to as the “branch-splice acceptor sequence” herein. The VI according to the invention may be furnished with upstream exonic splicing enhancer (ESE) elements, for example hESE, hESE2 and hGAR from HIV-1 (see Table 1). The sequences of hESE, hESE2 and hGAR are provided below. hESE (underlined = hESE): GTCGACTGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGATGCATCTCGAGC (SEQ ID NO: 134) hESE2, shown downstream of cppt/CTS (underlined = hESE2; bold = cppt/CTS): AAATTGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGG GGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTA CAAAAATTCAAAATTTTCGGGTTTCACGTGACGCGTCTGCAGCCGAAGGAATAGAAGAAGAA GGTGGAGAGAGAGACAGAGACCTGCAGACG (SEQ ID NO: 135) GAR (underlined = GAR): TGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAA (SEQ ID NO: 136) In one embodiment, the VI of the invention comprises a sequence as set forth in SEQ ID NO: 134, 135 or 136. In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127 and a sequence selected from SEQ ID NOs: 134-136. In some embodiments, the vector intron according to the invention comprises a sequence selected from SEQ ID NOs: 128-133 and a sequence selected from SEQ ID NOs: 134-136. In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127, and a sequence selected from SEQ ID NOs: 128-133 and a sequence selected from SEQ ID NOs: 134-136. In one preferred embodiment, the vector intron according to the invention comprises the sequences as set forth in SEQ ID NO: 126, SEQ ID NO: 132 and SEQ ID NO: 135. In one preferred embodiment, the vector intron according to the invention comprises the sequences as set forth in SEQ ID NO: 126, SEQ ID NO: 132 and SEQ ID NO: 136. In one preferred embodiment, the vector intron according to the invention comprises the sequences as set forth in SEQ ID NO: 126, SEQ ID NO: 132, SEQ ID NO: 135 and SEQ ID NO: 136. In one embodiment, the VI of the invention is operably linked to an upstream exonic splicing enhancer (ESE) element, such as hESE, hESE2 or hGAR. In one embodiment, the VI of the invention is a synthetic vector intron comprising the HIV-1 guanosine-adenosine rich (GAR or hGAR) splicing element. In one embodiment, the VI of the invention is a synthetic vector intron comprising the HIV-1 guanosine-adenosine rich (GAR) splicing element upstream of the splice donor sequence. In one embodiment, the VI of the invention is is a synthetic vector intron comprising the hESE2 downstream of the splice acceptor. In one embodiment, the VI of the invention is is a synthetic vector intron comprising the hESE2 downstream of the splice acceptor and the cppt/CTS sequence of the vector genome. In one embodiment, the lentiviral vector genome expression cassette comprises a hGAR upstream enhancer element and a VI comprising or consisting of a HIV SD4 splice donor sequence, and a human β-globin intron-2 derived sequence containing a branch-splice acceptor sequence. In one embodiment, the lentiviral vector genome expression cassette comprises a hGAR upstream enhancer element and a VI comprising or consisting of a HIV SD4 splice donor sequence, a human β-globin intron-2 derived sequence containing a branch-splice acceptor sequence, and hESE2 downstream of the cppt/CTS. In one embodiment, the VI of the invention comprises any of the features disclosed in Table 1. In another embodiment, the VI of the invention comprises an intron and (where applicable) an upstream enhancer element with the combination of features described for any one of VI_v1.1, VI_v1.2, VI_v2.1, VI_v2.2, VI_v3.1, VI_v4.1, VI_v4.2, VI_v4.3, VI_v4.4, VI_v4.5, VI_v4.6, VI_v4.7, VI_v4.8, VI_v4.9, VI_v4.10, VI_v4.11, VI_v4.12, VI_v5.1, VI_v5.2, VI_v5.3, VI_v5.4, VI_v5.5, or VI_v5.7. In a preferred embodiment the VI of the invention comprises the features of VI_v5.5. Illustrative examples of vector intron sequences are provided below. VI_4.12 (bold = GAR; underlined = HIV-1 splice donor 4; italics = chimeric intron-branch-splice acceptor sequence; plain text = exon/intron/exon): TTTTGGTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACT AGTCAGACTCATCAAGCTTCTCTATCAAAGCA/GTAAGTAGTACATGTAACAAGGTTACAAG ACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCT GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG/GTGTCCACTC CCAGTTC (SEQ ID NO: 137) VI_5.5 (bold = GAR; underlined = HIV-1 splice donor 4; italics = human β-globin [intron 2] splice acceptor; plain text = exon/intron/exon) TTTTGGTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACT AGTCAGACTCATCAAGCTTCTCTATCAAAGCA/GTAAGTAGTACATGTAAGAGTCTATGGGA CCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAA GTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGC TTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCT TTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGA TAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTT ATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCAT GTTCATACCTCTTATCTTCCTCCCACAG/GTGTCCACTCCCAGTTC (SEQ ID NO: 138) VI_5.6 (bold = GAR; underlined = HIV-1 splice donor 4; italics = human β-globin [intron 2] splice acceptor; plain text = exon/intron/exon; boxed = cppt/CTS; bold italics = hESE2) TTTTGGTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACT AGTCAGACTCATCAAGCTTCTCTATCAAAGCA/GTAAGTAGTACATGTAAGAGTCTATGGGA CCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAA GTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGC TTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCT TTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGA TAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTT ATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCAT

GGAGAGAGAGACAGAGACCTGCAGACGCGT (SEQ ID NO: 139) In one embodiment, the vector intron of the invention comprises the sequence as set forth in SEQ ID NO: 137. In a preferred embodiment, the vector intron of the invention comprises the sequence as set forth in SEQ ID NO: 138. In one embodiment, the vector intron of the invention comprises the sequence as set forth in SEQ ID NO: 139. As illustrative example of a nucleotide sequence encoding a lentiviral vector genome sequence comprising a vector intron of the invention is provided below: LV-MSD2KOm5-∆p17INS-∆RRE-VI_5.6 (shown is the 5’ R to internal transgene cassette: bold italics = MSD2KOm5; underlined = gag∆p17INS; bold = VI_5.6; boxed = cppt/CTS): GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACT GCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTG ACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGC GCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGG CTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGAAGGCAACAGATAAATATGCCTTAAAATT TTGACTAGCGGAGGCTAGAAGGAGAGAGACGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAG AATTAGATCGCGATTGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGACTCGAGCAATTTTG GTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACTAGTCA GACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAAGAGTCTATGGGACCCTTG ATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACA GGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTT CTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGG GCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTT CTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGA TGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTA TGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCAT

GAGACAGAGACCTGCAGACGCGT (SEQ ID NO: 140) Transgene sequences followed by the 3’ SIN-LTR may be located at the 3’ end of SEQ ID NO: 140. In one embodiment, the nucleotide sequence encoding the lentiviral vector genome of the invention comprises the sequence as set forth in SEQ ID NO: 140. As out-splicing of other introns is stimulated by the presence of VI (and absence of rev/RRE system), transgene cassettes encoding their own intron(s) (e.g. the EF1a promoter) will lose these introns from the vRNA. To avoid this, the transgene cassette may be inverted. Inverting the transgene cassette allows the embedded introns to not be lost from the resultant vRNA since they will not function as introns within the LV genome expression cassette. A drawback of this configuration is a reduction in LV titres due to production of double-stranded RNA (dsRNA) species that are formed as a result of annealing between the vRNA and transgene mRNA. Sensing of dsRNA can trigger cellular responses such as the PKR response, cleavage by Dicer, or deamination by ADAR. Thus, the vector intron may comprise one or more interfering RNAs as described herein. The VI intron of the present invention facilitates the use of LV genomes comprising additional desirable features, e.g. MSD-2KO and RRE-deletions. Hence, use of MSD-2KO, RRE-deleted LV genomes containing VI advantageously enables: [1] increased transgene capacity, [2] ablation of aberrant splicing from the packaging sequence, [3] removal of rev from the production system, [4] reduced transcriptional read-in in target cells, and [5] use of inverted transgene cassettes with 3’ UTR cis-elements to repress transgene expression during LV production. All of the aforementioned contribute to improved safety of the vector genome expression cassettes of the invention. In one embodiment, the vector intron is a synthetic vector intron. In one embodiment, the synthetic vector intron comprises the HIV-1 GAR splicing element. In one embodiment, the vector intron comprises a splice donor sequence, wherein said splice donor sequence comprises from 7 to 11 nucleotides which are complementary to a portion of the U1 snRNA sequence. In one embodiment, the synthetic vector intron comprises the HIV-1 guanosine-adenosine rich splicing element upstream of the splice donor sequence. In one embodiment, the synthetic vector intron comprises the branch site and splice acceptor of the human beta-globin intron-2. Since introns, such as a the VI according to the invention, may be spliced out of a given nucleotide sequence, such as the nucleotide sequences comprising the lentiviral vector genome expression cassettes according to the invention, it is to be understood that products of such nucleotides, e.g. nucleotide products and cells or particles comprising the same, may not comprise the VI. Such nucleotides, cells, and/or particles may comprise a residual sequence, such as a splice junction sequence, by virtue of splicing of the VI. The junctional sequence may correspond to SEQ ID NO: 24. An illustrative splice junction sequence is provided below (bold denotes the CAG from the splice donor and the GT from the splice acceptor; “/” denotes the junction site): GAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACTAGTCAGACTCATCAAGCTTCTCTATCAAAG CAG/GTGTCCACTCCCAGTT (SEQ ID NO: 24). The terms “EF1α” and “EF1a” are used interchangeably herein. As described herein, the present inventors surprisingly found that inclusion of a Vector-Intron negated the need for the RRE to be present. As such, in one preferred embodiment, the nucleotide sequence comprising a lentiviral vector genome expression cassette according to the invention does not comprise a rev-response element. In one embodiment, the rev-response element may have been removed, or deleted, or otherwise inactivated in the nucleotide sequence. Suitable methods for such removal, deletion or inactivation will be known to those of skill in the art. In one embodiment, the VI of the invention comprises any of the features disclosed in Table 2. In one embodiment, the VI of the invention comprises a sequence as set forth in any of SEQ ID NOs: 146-163. Illustrative Vector-Intron sequences, and in combination with embedded ‘self- cleaving/targeting’ element (shown in antisense) for inverted transgene cassettes. Illustrative sequences for use according to the invention are provided in Table 2 below: Key for the following sequences: ^ Sequences are all presented 5’ to 3’ in vector RNA sense (top strand) configuration, including the encompassed elements that are present within the 3’ UTR of the inverted transgene cassette (i.e. ‘self-cleaving’, ‘self-targeting’ elements are shown in anti- sense). ^ The Vector-Intron splice donor and splice acceptor core sequences are boxed. ^ The Guanosine-Adenosine Rich upstream splicing enhancer (GAR) is indicated in bold/underline. ^ The HDV_AG ribozyme is indicated in italics. ^ The T3H38 ribozyme is underlined and italicised. ^ cPPT sequences are indicated in bold italics. ^ The downstream splice enhancer sequence is indicated in bold, underlined italics. ^ The sequences highlighted in bold only were replaced with the miRNA target sites. ^ The pre-miRNA cassette was inserted in the underlined bracketed region. TABLE 2

Vector / Expression Cassette A vector is a tool that allows or facilitates the transfer of an entity from one environment to another. In accordance with the present invention, and by way of example, some vectors used in recombinant nucleic acid techniques allow entities, such as a segment of nucleic acid (e.g. a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into and expressed by a target cell. The vector may facilitate the integration of the nucleotide sequence encoding a viral vector component to maintain the nucleotide sequence encoding the viral vector component and its expression within the target cell. The vector may be or may include an expression cassette (also termed an expression construct). Expression cassettes as described herein comprise regions of nucleic acid containing sequences capable of being transcribed. Thus, sequences encoding mRNA, tRNA and rRNA are included within this definition. The vector may contain one or more selectable marker genes (e.g. a neomycin resistance gene) and/or traceable marker gene(s) (e.g. a gene encoding green fluorescent protein (GFP)). Vectors may be used, for example, to infect and/or transduce a target cell. The vector may further comprise a nucleotide sequence enabling the vector to replicate in the host cell in question, such as a conditionally replicating oncolytic vector. The term "cassette" - which is synonymous with terms such as "conjugate", "construct" and "hybrid" - includes a polynucleotide sequence directly or indirectly attached to a promoter. Preferably the cassette comprises at least a polynucleotide sequence operably linked to a promoter. For example, expression cassettes for use in the invention may comprise a promoter for the expression of the nucleotide sequence encoding a viral vector component and optionally a regulator of the nucleotide sequence encoding the viral vector component. The choice of expression cassette, e.g. plasmid, cosmid, virus or phage vector, will often depend on the host cell into which it is to be introduced. The expression cassette can be a DNA plasmid (supercoiled, nicked or linearised), minicircle DNA (linear or supercoiled), plasmid DNA containing just the regions of interest by removal of the plasmid backbone by restriction enzyme digestion and purification, DNA generated using an enzymatic DNA amplification platform e.g. doggybone DNA (dbDNA™) where the final DNA used is in a closed ligated form or where it has been prepared (e.g. restriction enzyme digestion) to have open cut ends. Retroviral Vector Production Systems and Cells In one aspect, the invention provides a retroviral vector production system comprising the set of nucleic acid sequences as described herein. In a further aspect, the invention provides a retroviral vector production system comprising a viral vector production cell, wherein the viral vector production cell comprises the set of nucleic acid sequences as described herein. In a further aspect, the invention provides a cell comprising the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention or the retroviral vector genome of the invention. In a further aspect, the invention provides a cell for producing retroviral vectors comprising: a) the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention or the retroviral vector genome of the invention; and b) optionally, a nucleic acid sequence encoding a modified U1 snRNA and/or a nucleic acid sequence encoding TRAP. In a further aspect, the invention provides a method for producing a retroviral vector, comprising the steps of: (i) introducing: a. the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention or the retroviral vector genome of the invention; and b. optionally, a nucleic acid sequence encoding a modified U1 snRNA and/or a nucleic acid sequence encoding TRAP, into a cell; (ii) optionally, selecting for a cell which comprises the nucleic acid sequences encoding vector components; and (iii) culturing the cell under conditions suitable for the production of the retroviral vector. In a further aspect, the invention provides a method for producing a retroviral vector, comprising the step of culturing the cell of the invention under conditions suitable for the production of the retroviral vector. In a further aspect, the invention provides a retroviral vector produced by the method of the invention. In a further aspect, the invention provides the use of the set of nucleic acid sequences of the invention, the retroviral vector production system of the invention, the expression cassette of the invention, the nucleotide sequence of the invention, the retroviral vector genome of the invention, or the cell of the invention for producing a retroviral vector. The interfering RNA(s) can be provided in trans or in cis during retroviral vector production. Thus, a vector encoding the interfering RNA expression cassette can be co-transfected into the production cell together with vectors encoding the retroviral vector components. The vector encoding the interfering RNA may contain multiple single interfering RNA expression cassettes, or a single expression cassette encoding multiple tandem interfering RNAs processed from a single transcript. Alternatively, the interfering RNA expression cassette(s) may be stably integrated into the host cell DNA or stably maintained as an episome. Alternatively, such interfering RNA expression cassette(s) may be cloned into the vector genome or vectors encoding the retroviral vector packaging components in cis. A retroviral vector production system comprises a set of nucleotide sequences encoding the components required for production of the retroviral vector. Accordingly, a vector production system comprises a set of nucleotide sequences which encode the viral vector components necessary to generate retroviral vector particles. “Viral vector production system” or “vector production system” or “production system” is to be understood as a system comprising the necessary components for retroviral vector production. In an aspect, the viral vector production system comprises nucleotide sequences encoding Gag and Gag/Pol proteins, and Env protein and the vector genome sequence. The production system may optionally comprise a nucleotide sequence encoding the Rev protein, or functional substitute thereof. In an aspect, the viral vector production system comprises modular nucleic acid constructs (modular constructs). A modular construct is a DNA expression construct comprising two or more nucleic acids used in the production of lentiviral vectors. A modular construct can be a DNA plasmid comprising two or more nucleic acids used in the production of lentiviral vectors. The plasmid may be a bacterial plasmid. The nucleic acids can encode for example, gag-pol, rev, env, vector genome. In addition, modular constructs designed for generation of packaging and producer cell lines may additionally need to encode transcriptional regulatory proteins (e.g. TetR, CymR) and/or translational repression proteins (e.g. TRAP) and selectable markers (e.g. Zeocin™, hygromycin, blasticidin, puromycin, neomycin resistance genes). Suitable modular constructs for use in the present invention are described in EP 3502260, which is hereby incorporated by reference in its entirety. As the modular constructs for use in accordance with the present invention contain nucleic acid sequences encoding two or more of the retroviral components on one construct, the safety profile of these modular constructs has been considered and additional safety features directly engineered into the constructs. These features include the use of insulators for multiple open reading frames of retroviral vector components and/or the specific orientation and arrangement of the retroviral genes in the modular constructs. It is believed that by using these features the direct read-through to generate replication-competent viral particles will be prevented. The nucleic acid sequences encoding the viral vector components may be in reverse and/or alternating transcriptional orientations in the modular construct. Thus, the nucleic acid sequences encoding the viral vector components are not presented in the same 5’ to 3’ orientation, such that the viral vector components cannot be produced from the same mRNA molecule. The reverse orientation may mean that at least two coding sequences for different vector components are presented in the ‘head-to-head’ and ‘tail-to-tail’ transcriptional orientations. This may be achieved by providing the coding sequence for one vector component, e.g. env, on one strand and the coding sequence for another vector component, e.g. rev, on the opposing strand of the modular construct. Preferably, when coding sequences for more than two vector components are present in the modular construct, at least two of the coding sequences are present in the reverse transcriptional orientation. Accordingly, when coding sequences for more than two vector components are present in the modular construct, each component may be orientated such that it is present in the opposite 5’ to 3’ orientation to all of the adjacent coding sequence(s) for other vector components to which it is adjacent, i.e. alternating 5’ to 3’ (or transcriptional) orientations for each coding sequence may be employed. The modular construct for use according to the present invention may comprise nucleic acid sequences encoding two or more of the following vector components: gag-pol, rev, an env, vector genome. The modular construct may comprise nucleic acid sequences encoding any combination of the vector components. In an aspect, the modular construct may comprise nucleic acid sequences encoding: i) the RNA genome of the retroviral vector and rev, or a functional substitute thereof; ii) the RNA genome of the retroviral vector and gag-pol; iii) the RNA genome of the retroviral vector and env; iv) gag-pol and rev, or a functional substitute thereof; v) gag-pol and env; vi) env and rev, or a functional substitute thereof; vii) the RNA genome of the retroviral vector, rev, or a functional substitute thereof, and gag-pol; viii) the RNA genome of the retroviral vector, rev, or a functional substitute thereof, and env; ix) the RNA genome of the retroviral vector, gag-pol and env; or x) gag-pol, rev, or a functional substitute thereof, and env, wherein the nucleic acid sequences are in reverse and/or alternating orientations. In one aspect, a cell for producing retroviral vectors may comprise nucleic acid sequences encoding any one of the combinations i) to x) above, wherein the nucleic acid sequences are located at the same genetic locus and are in reverse and/or alternating orientations. The same genetic locus may refer to a single extrachromosomal locus in the cell, e.g. a single plasmid, or a single locus (i.e. a single insertion site) in the genome of the cell. The cell may be a stable or transient cell for producing retroviral vectors, e.g. lentiviral vectors. In one aspect the cell does not comprise tat. The DNA expression construct can be a DNA plasmid (supercoiled, nicked or linearised), minicircle DNA (linear or supercoiled), plasmid DNA containing just the regions of interest by removal of the plasmid backbone by restriction enzyme digestion and purification, DNA generated using an enzymatic DNA amplification platform e.g. doggybone DNA (dbDNA™) where the final DNA used is in a closed ligated form or where it has been prepared (e.g restriction enzyme digestion) to have open cut ends. In one aspect, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus. A “viral vector production cell”, “vector production cell”, or “production cell” is to be understood as a cell that is capable of producing a retroviral vector or retroviral vector particle. Retroviral vector production cells may be “producer cells” or “packaging cells”. One or more DNA constructs of the viral vector system may be either stably integrated or episomally maintained within the viral vector production cell. Alternatively, all the DNA components of the viral vector system may be transiently transfected into the viral vector production cell. In yet another alternative, a production cell stably expressing some of the components may be transiently transfected with the remaining components required for vector production. As used herein, the term “packaging cell” refers to a cell which contains the elements necessary for production of retroviral vector particles but which lacks the vector genome. Optionally, such packaging cells contain one or more expression cassettes which are capable of expressing viral structural proteins (such as gag, gag/pol and env). Producer cells/packaging cells can be of any suitable cell type. Producer cells are generally mammalian cells but can be derived from other organisms, e.g. insect cells. As used herein, the term “producer cell” or “vector producing/producer cell” refers to a cell which contains all the elements necessary for production of retroviral vector particles. The producer cell may be either a stable producer cell line or derived transiently or may be a stable packaging cell wherein the retroviral genome is transiently expressed. In the methods of the invention, the vector components may include gag, env, rev and/or the RNA genome of the lentiviral vector when the viral vector is a lentiviral vector. The nucleotide sequences encoding vector components may be introduced into the cell either simultaneously or sequentially in any order. The vector production cells may be cells cultured in vitro such as a tissue culture cell line. In some aspects of the methods and uses of the invention, suitable production cells or cells for producing a lentiviral vector are those cells which are capable of producing viral vectors or viral vector particles when cultured under appropriate conditions. Thus, the cells typically comprise nucleotide sequences encoding vector components, which may include gag, env, rev and the RNA genome of the lentiviral vector. Suitable cell lines include, but are not limited to, mammalian cells such as murine fibroblast derived cell lines or human cell lines. They are generally mammalian, including human cells, for example HEK293T, HEK293, CAP, CAP-T or CHO cells, but can be, for example, insect cells such as SF9 cells. Preferably, the vector production cells are derived from a human cell line. Accordingly, such suitable production cells may be employed in any of the methods or uses of the present invention. Methods for introducing nucleotide sequences into cells are well known in the art and have been described previously. Thus, the introduction into a cell of nucleotide sequences encoding vector components including gag, env, rev and the RNA genome of the lentiviral vector, using conventional techniques in molecular and cell biology is within the capabilities of a person skilled in the art. Stable production cells may be packaging or producer cells. To generate producer cells from packaging cells the vector genome DNA construct may be introduced stably or transiently. Packaging/producer cells can be generated by transducing a suitable cell line with a retroviral vector which expresses one of the components of the vector, i.e. a genome, the gag-pol components and an envelope as described in WO 2004/022761. Alternatively, the nucleotide sequence can be transfected into cells and then integration into the production cell genome occurs infrequently and randomly. The transfection methods may be performed using methods well known in the art. For example, a stable transfection process may employ constructs which have been engineered to aid concatemerisation. In another example, the transfection process may be performed using calcium phosphate or commercially available formulations such as Lipofectamine^TM 2000CD (Invitrogen, CA), FuGENE^® HD or polyethylenimine (PEI). Alternatively nucleotide sequences may be introduced into the production cell via electroporation. The skilled person will be aware of methods to encourage integration of the nucleotide sequences into production cells. For example, linearising a nucleic acid construct can help if it is naturally circular. Less random integration methodologies may involve the nucleic acid construct comprising of areas of shared homology with the endogenous chromosomes of the mammalian host cell to guide integration to a selected site within the endogenous genome. Furthermore, if recombination sites are present on the construct then these can be used for targeted recombination. For example, the nucleic acid construct may contain a loxP site which allows for targeted integration when combined with Cre recombinase (i.e. using the Cre/lox system derived from P1 bacteriophage). Alternatively or additionally, the recombination site is an att site (e.g. from λ phage), wherein the att site permits site-directed integration in the presence of a lambda integrase. This would allow the lentiviral genes to be targeted to a locus within the host cellular genome which allows for high and/or stable expression. Other methods of targeted integration are well known in the art. For example, methods of inducing targeted cleavage of genomic DNA can be used to encourage targeted recombination at a selected chromosomal locus. These methods often involve the use of methods or systems to induce a double strand break (DSB) e.g. a nick in the endogenous genome to induce repair of the break by physiological mechanisms such as non-homologous end joining (NHEJ). Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription-activator like effector nucleases (TALENs), using CRISPR/Cas9 systems with an engineered crRNA/tracr RNA ('single guide RNA') to guide specific cleavage, and/or using nucleases based on the Argonaute system (e.g., from T. thermophilus). Packaging/producer cell lines can be generated by integration of nucleotide sequences using methods of just lentiviral transduction or just nucleic acid transfection, or a combination of both can be used. Methods for generating retroviral vectors from production cells and in particular the processing of retroviral vectors are described in WO 2009/153563. In one aspect, the production cell may comprise the RNA-binding protein (e.g. tryptophan RNA-binding attenuation protein, TRAP) and/or the Tet Repressor (TetR) protein or alternative regulatory proteins (e.g. CymR). Production of lentiviral vector from production cells can be via transfection methods, from production from stable cell lines which can include induction steps (e.g. doxycycline induction) or via a combination of both. The transfection methods may be performed using methods well known in the art, and examples have been described previously. Production cells, either packaging or producer cell lines or those transiently transfected with the lentiviral vector encoding components are cultured to increase cell and virus numbers and/or virus titres. Culturing a cell is performed to enable it to metabolize, and/or grow and/or divide and/or produce viral vectors of interest according to the invention. This can be accomplished by methods well known to persons skilled in the art, and includes but is not limited to providing nutrients for the cell, for instance in the appropriate culture media. The methods may comprise growth adhering to surfaces, growth in suspension, or combinations thereof. Culturing can be done for instance in tissue culture flasks, tissue culture multiwell plates, dishes, roller bottles, wave bags or in bioreactors, using batch, fed-batch, continuous systems and the like. In order to achieve large scale production of viral vector through cell culture it is preferred in the art to have cells capable of growing in suspension. Suitable conditions for culturing cells are known (see e.g. Tissue Culture, Academic Press, Kruse and Paterson, editors (1973), and R.I. Freshney, Culture of animal cells: A manual of basic technique, fourth edition (Wiley- Liss Inc., 2000, ISBN 0-471-34889-9). Preferably cells are initially ‘bulked up’ in tissue culture flasks or bioreactors and subsequently grown in multi-layered culture vessels or large bioreactors (greater than 50L) to generate the vector producing cells for use in the present invention. Preferably cells are grown in a suspension mode to generate the vector producing cells for use in the present invention. Retroviral Vectors The retroviral vector of the present invention may be derived from or may be derivable from any suitable retrovirus. A large number of different retroviruses have been identified. Examples include: murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29) and Avian erythroblastosis virus (AEV). A detailed list of retroviruses may be found in Coffin et al. (1997) “Retroviruses”, Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763. Retroviruses may be broadly divided into two categories, namely “simple” and “complex”. Retroviruses may even be further divided into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are the lentiviruses and the spumaviruses. A review of these retroviruses is presented in Coffin et al (1997) ibid. Lentiviruses are part of a larger group of retroviruses. A detailed list of lentiviruses may be found in Coffin et al (1997) “Retroviruses” Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763). In brief, lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include but are not limited to: the human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV). The non-primate lentiviral group includes the prototype “slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV), feline immunodeficiency virus (FIV), Maedi visna virus (MVV) and bovine immunodeficiency virus (BIV). In one aspect, the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus. The lentivirus family differs from retroviruses in that lentiviruses have the capability to infect both dividing and non-dividing cells (Lewis et al (1992) EMBO J 11(8):3053-3058 and Lewis and Emerman (1994) J Virol 68 (1):510-516). In contrast, other retroviruses, such as MLV, are unable to infect non-dividing or slowly dividing cells such as those that make up, for example, muscle, brain, lung and liver tissue. A lentiviral vector, as used herein, is a vector which comprises at least one component part derivable from a lentivirus. Preferably, that component part is involved in the biological mechanisms by which the vector infects or transduces target cells and expresses a nucleotide of interest (NOI), or nucleotides of interest. The lentiviral vector may be used to replicate the NOI in a compatible target cell in vitro. Thus, described herein is a method of making proteins in vitro by introducing a vector of the invention into a compatible target cell in vitro and growing the target cell under conditions which result in expression of the NOI. Protein and NOI may be recovered from the target cell by methods well known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines. In some aspects the vectors may have “insulators” – genetic sequences that block the interaction between promoters and enhancers, and act as a barrier reducing read-through from an adjacent gene. In one aspect the insulator is present between one or more of the lentiviral nucleic acid sequences to prevent promoter interference and read-thorough from adjacent genes. If the insulators are present in the vector between one or more of the lentiviral nucleic acid sequences, then each of these insulated genes may be arranged as individual expression units. The basic structure of retroviral and lentiviral genomes share many common features such as a 5’ LTR and a 3’ LTR, between or within which are located a packaging signal to enable the genome to be packaged, a primer binding site, integration sites to enable integration into a target cell genome and gag/pol and env genes encoding the packaging components - these are polypeptides required for the assembly of viral particles. Lentiviruses have additional features, such as the rev gene and RRE sequences in HIV, which enable the efficient export of RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of an infected target cell. In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for proviral integration, and transcription. LTRs also serve as enhancer-promoter sequences and can control the expression of the viral genes. The LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5. U3 is derived from the sequence unique to the 3’ end of the RNA. R is derived from a sequence repeated at both ends of the RNA and U5 is derived from the sequence unique to the 5’ end of the RNA. The sizes of the three elements can vary considerably among different retroviruses. In a typical retroviral vector as described herein, at least part of one or more protein coding regions essential for replication may be removed from the virus; for example, gag/pol and env may be absent or not functional. This makes the viral vector replication-defective. The lentiviral vector may be derived from either a primate lentivirus (e.g. HIV-1) or a non- primate lentivirus (e.g. EIAV). In general terms, a typical retroviral vector production system involves the separation of the viral genome from the essential viral packaging functions. These viral vector components are normally provided to the production cells on separate DNA expression cassettes (alternatively known as plasmids, expression plasmids, DNA constructs or expression constructs). The vector genome comprises the NOI. Vector genomes typically require a packaging signal (ψ), the internal expression cassette harbouring the NOI, (optionally) a post-transcriptional element (PRE), typically a central polypurine tract (cppt), the 3’-ppu and a self-inactivating (SIN) LTR. The R-U5 regions are required for correct polyadenylation of both the vector genome RNA and NOI mRNA, as well as the process of reverse transcription. The vector genome may optionally include an open reading frame, as described in WO 2003/064665, which allows for vector production in the absence of rev. The packaging functions include the gag/pol and env genes. These are required for the production of vector particles by the production cell. Providing these functions in trans to the genome facilitates the production of replication-defective viral vectors. Production systems for gamma-retroviral vectors are typically 3-component systems requiring genome, gag/pol and env expression constructs. Production systems for HIV-1-based lentiviral vectors may additionally require the accessory gene rev to be provided and for the vector genome to include the rev-responsive element (RRE). EIAV-based lentiviral vectors do not require rev to be provided in trans if an open-reading frame (ORF) is present within the genome (see WO 2003/064665). Usually both the “external” promoter (which drives the vector genome cassette) and “internal” promoter (which drives the NOI cassette) encoded within the vector genome cassette are strong eukaryotic or virus promoters, as are those driving the other vector system components. Examples of such promoters include CMV, EF1α, PGK, CAG, TK, SV40 and Ubiquitin promoters. Strong ‘synthetic’ promoters, such as those generated by DNA libraries (e.g. JeT promoter) may also be used to drive transcription. Alternatively, tissue-specific promoters such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone-rod homeobox containing gene (CRX), neural retina-specific leucine zipper protein (NRL), Vitelliform Macular Dystrophy 2 (VMD2), Tyrosine hydroxylase, neuronal-speciﬁc neuronal-speciﬁc enolase (NSE) promoter, astrocyte- speciﬁc glialﬁbrillary acidic protein (GFAP) promoter, human α1-antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK), liver fatty acid binding protein promoter, Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5′ promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, Fibronectin promoter, Endoglin promoter, Elastase-1 promoter, Desmin promoter, CD68 promoter, CD14 promoter and B29 promoter may be used to drive transcription. Production of retroviral vectors involves either the transient co-transfection of the production cells with these DNA components or use of stable production cell lines wherein all the components are stably integrated within the production cell genome (e.g. Stewart HJ, Fong- Wong L, Strickland I, Chipchase D, Kelleher M, Stevenson L, Thoree V, McCarthy J, Ralph GS, Mitrophanous KA and Radcliffe PA. (2011). Hum Gene Ther. Mar; 22 (3):357-69). An alternative approach is to use a stable packaging cell (into which the packaging components are stably integrated) and then transiently transfect in the vector genome plasmid as required (e.g. Stewart, H. J., M. A. Leroux-Carlucci, C. J. Sion, K. A. Mitrophanous and P. A. Radcliffe (2009). Gene Ther. Jun; 16 (6):805-14). It is also feasible that alternative, not complete, packaging cell lines could be generated (just one or two packaging components are stably integrated into the cell lines) and to generate vector the missing components are transiently transfected. The production cell may also express regulatory proteins such as a member of the tet repressor (TetR) protein group of transcription regulators (e.g.T-Rex, Tet-On, and Tet- Off), a member of the cumate inducible switch system group of transcription regulators (e.g. cumate repressor (CymR) protein), or an RNA-binding protein (e.g. TRAP - tryptophan- activated RNA-binding protein). In one aspect of the present invention, the viral vector is derived from EIAV. EIAV has the simplest genomic structure of the lentiviruses and is particularly preferred for use in the present invention. In addition to the gag/pol and env genes, EIAV encodes three other genes: tat, rev, and S2. Tat acts as a transcriptional activator of the viral LTR (Derse and Newbold (1993) Virology 194(2):530-536 and Maury et al (1994) Virology 200(2):632-642) and rev regulates and coordinates the expression of viral genes through rev-response elements (RRE) (Martarano et al. (1994) J Virol 68(5):3102-3111). The mechanisms of action of these two proteins are thought to be broadly similar to the analogous mechanisms in the primate viruses (Martarano et al. (1994) J Virol 68(5):3102-3111). S2 is a viral immunological and infectivity regulator, known to antagonise SERINC3/5).. In addition, an EIAV protein, Ttm, has been identified that is encoded by the first exon of tat spliced to the env coding sequence at the start of the transmembrane protein. In an alternative aspect of the present invention the viral vector is derived from HIV: HIV differs from EIAV in that it does not encode S2 but unlike EIAV it encodes vif, vpr, vpu and nef. The term “recombinant retroviral or lentiviral vector” (RRV) refers to a vector with sufficient retroviral genetic information to allow packaging of an RNA genome, in the presence of packaging components, into a viral particle capable of transducing a target cell. Transduction of the target cell may include reverse transcription and integration into the target cell genome. The RRV carries non-viral coding sequences which are to be delivered by the vector to the target cell. A RRV is incapable of independent replication to produce infectious retroviral particles within the target cell. Usually the RRV lacks a functional gag/pol and/or env gene, and/or other genes essential for replication. Preferably the RRV vector of the present invention has a minimal viral genome. As used herein, the term “minimal viral genome” means that the viral vector has been manipulated so as to remove the non-essential elements whilst retaining the elements essential to provide the required functionality to infect, transduce and deliver a NOI to a target cell. Further details of this strategy can be found in WO 1998/17815 and WO 99/32646. A minimal EIAV vector lacks tat, rev and S2 genes and neither are these genes provided in trans in the production system. A minimal HIV vector lacks vif, vpr, vpu, tat and nef. The expression plasmid used to produce the vector genome within a production cell may include transcriptional regulatory control sequences operably linked to the retroviral genome to direct transcription of the genome in a production cell/packaging cell. All 3rd generation lentiviral vectors are deleted in the 5’ U3 enhancer-promoter region, and transcription of the vector genome RNA is driven by heterologous promoter such as another viral promoter, for example the CMV promoter, as discussed below. This feature enables vector production independently of tat. Some lentiviral vector genomes require additional sequences for efficient virus production. For example, particularly in the case of HIV, RRE sequences may be included. However the requirement for RRE on the (separate) GagPol cassette (and dependence on rev which is provided in trans) may be reduced or eliminated by codon optimisation of the GagPol ORF. Further details of this strategy can be found in WO 2001/79518. Alternative sequences which perform the same function as the rev/RRE system are also known. For example, a functional analogue of the rev/RRE system is found in the Mason Pfizer monkey virus. This is known as the constitutive transport element (CTE) and comprises an RRE-type sequence in the genome which is believed to interact with a factor in the infected cell. The cellular factor can be thought of as a rev analogue. Thus, CTE may be used as an alternative to the rev/RRE system. Any other functional equivalents of the Rev protein which are known or become available may be relevant to the invention. For example, it is also known that the Rex protein of HTLV-I can functionally replace the Rev protein of HIV-1. Rev and RRE may be absent or non-functional in the vector for use in the methods of the present invention; in the alternative rev and RRE, or functionally equivalent system, may be present. It is therefore understood that ‘rev’ may refer to a sequence encoding the HIV-1 Rev protein or a sequence encoding any functional equivalent thereof. Thus, in an aspect, the invention provides a viral vector production system and/or a cell comprising a set of nucleotide sequences, wherein the nucleotide sequences encode vector components including gag-pol, env, optionally rev, and the nucleotide sequences of any of the preceding claims. As used herein, the term “functional substitute” means a protein or sequence having an alternative sequence which performs the same function as another protein or sequence. The term “functional substitute” is used interchangeably with “functional equivalent” and “functional analogue” herein with the same meaning. SIN Vectors The lentiviral vectors as described herein may be used in a self-inactivating (SIN) configuration in which the viral enhancer and promoter sequences have been deleted. SIN vectors can be generated and transduce non-dividing target cells in vivo, ex vivo or in vitro with an efficacy similar to that of non-SIN vectors. The transcriptional inactivation of the long terminal repeat (LTR) in the SIN provirus should prevent mobilisation of vRNA, and is a feature that further diminishes the likelihood of formation of replication-competent virus. This should also enable the regulated expression of genes from internal promoters by eliminating any cis-acting effects of the LTR. By way of example, self-inactivating retroviral vector systems have been constructed by deleting the transcriptional enhancers or the enhancers and promoter in the U3 region of the 3’ LTR. After a round of vector reverse transcription and integration, these changes are copied into both the 5’ and the 3’ LTRs producing a transcriptionally inactive provirus. However, any promoter(s) internal to the LTRs in such vectors will still be transcriptionally active. This strategy has been employed to eliminate effects of the enhancers and promoters in the viral LTRs on transcription from internally placed genes. Such effects include increased transcription or suppression of transcription. This strategy can also be used to eliminate downstream transcription from the 3’ LTR into genomic DNA. This is of particular concern in human gene therapy where it is important to prevent the adventitious activation of any endogenous oncogene. Yu et al., (1986) PNAS 83: 3194-98; Marty et al., (1990) Biochimie 72: 885-7; Naviaux et al., (1996) J. Virol.70: 5701-5; Iwakuma et al., (1999) Virol.261: 120- 32; Deglon et al., (2000) Human Gene Therapy 11: 179-90. SIN lentiviral vectors are described in US 6,924,123 and US 7,056,699. Replication-Defective Lentiviral Vectors In the genome of a replication-defective lentiviral vector the sequences of gag/pol and/or env may be mutated and/or not functional. In a typical lentiviral vector as described herein, at least part of one or more coding regions for proteins essential for virus replication may be removed from the vector. This makes the viral vector replication-defective. Portions of the viral genome may also be replaced by a NOI in order to generate a vector comprising an NOI which is capable of transducing a non-dividing target cell and/or integrating its genome into the target cell genome. In one aspect the lentiviral vectors are non-integrating vectors as described in WO 2006/010834 and WO 2007/071994. In a further aspect the vectors have the ability to deliver a sequence which is devoid of or lacking viral RNA. In a further aspect a heterologous binding domain (heterologous to gag) located on the RNA to be delivered and a cognate binding domain on Gag or GagPol can be used to ensure packaging of the RNA to be delivered. Both of these vectors are described in WO 2007/072056. NOI and Polynucleotides Polynucleotides of the invention may comprise DNA or RNA. They may be single-stranded or double-stranded. A nucleotide, or nucleotides, of interest is/are commonly referred to as NOI. It will be understood by a skilled person that numerous different polynucleotides can encode the same polypeptide as a result of the degeneracy of the genetic code. In addition, it is to be understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the invention to reflect the codon usage of any particular host organism in which the polypeptides of the invention are to be expressed. The polynucleotides may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or lifespan of the polynucleotides of the invention. Polynucleotides such as DNA polynucleotides may be produced recombinantly, synthetically or by any means available to those of skill in the art. They may also be cloned by standard techniques. Longer polynucleotides will generally be produced using recombinant means, for example using polymerase chain reaction (PCR) cloning techniques. This will involve making a pair of primers (e.g. of about 15 to 30 nucleotides) flanking the target sequence which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from an animal or human cell, performing PCR under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture with an agarose gel) and recovering the amplified DNA. The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable vector. Common Retroviral Vector Elements Promoters and Enhancers Expression of a NOI and polynucleotide may be controlled using control sequences for example transcription regulation elements or translation repression elements, which include promoters, enhancers and other expression regulation signals (e.g. tet repressor (TetR) system) or the Transgene Repression In vector Production cell system (TRiP) or other regulators of NOIs described herein. Prokaryotic promoters and promoters functional in eukaryotic cells may be used. Tissue- specific or stimuli-specific promoters may be used. Chimeric promoters may also be used comprising sequence elements from two or more different promoters. Suitable promoting sequences are strong promoters including those derived from the genomes of viruses, such as polyoma virus, adenovirus, fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus (CMV), retrovirus and Simian Virus 40 (SV40), or from heterologous mammalian promoters, such as the actin promoter, EF1α, CAG, TK, SV40, ubiquitin, PGK or ribosomal protein promoter. Alternatively, tissue-specific promoters such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone-rod homeobox containing gene (CRX), neural retina-specific leucine zipper protein (NRL), Vitelliform Macular Dystrophy 2 (VMD2), Tyrosine hydroxylase, neuronal-speciﬁc neuronal-speciﬁc enolase (NSE) promoter, astrocyte- speciﬁc glialﬁbrillary acidic protein (GFAP) promoter, human α1-antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK), liver fatty acid binding protein promoter, Flt-1 promoter, INF-β promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40 / hAlb promoter, SV40 / CD43, SV40 / CD45, NSE / RU5′ promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, Fibronectin promoter, Endoglin promoter, Elastase-1 promoter, Desmin promoter, CD68 promoter, CD14 promoter and B29 promoter may be used to drive transcription. Transcription of a NOI may be increased further by inserting an enhancer sequence into the vector. Enhancers are relatively orientation- and position-independent; however, one may employ an enhancer from a eukaryotic cell virus, such as the SV40 enhancer and the CMV early promoter enhancer. The enhancer may be spliced into the vector at a position 5' or 3' to the promoter, but is preferably located at a site 5' from the promoter. The promoter can additionally include features to ensure or to increase expression in a suitable target cell. For example, the features can be conserved regions e.g. a Pribnow Box or a TATA box. The promoter may contain other sequences to affect (such as to maintain, enhance or decrease) the levels of expression of a nucleotide sequence. Suitable other sequences include the Sh1-intron or an ADH intron. Other sequences include inducible elements, such as temperature, chemical, light or stress inducible elements. Also, suitable elements to enhance transcription or translation may be present. Regulators of NOIs A complicating factor in the generation of retroviral packaging/producer cell lines and retroviral vector production is that constitutive expression of certain retroviral vector components and NOIs are cytotoxic leading to death of cells expressing these components and therefore inability to produce vector. Therefore, the expression of these components (e.g. gag-pol and envelope proteins such as VSV-G) can be regulated. The expression of other non-cytotoxic vector components, e.g. rev, can also be regulated to minimise the metabolic burden on the cell. The modular constructs and/or cells as described herein may comprise cytotoxic and/or non-cytotoxic vector components associated with at least one regulatory element. As used herein, the term “regulatory element” refers to any element capable of affecting, either increasing or decreasing, the expression of an associated gene or protein. A regulatory element includes a gene switch system, transcription regulation element and translation repression element. A number of prokaryotic regulator systems have been adapted to generate gene switches in mammalian cells. Many retroviral packaging and producer cell lines have been controlled using gene switch systems (e.g. tetracycline and cumate inducible switch systems) thus enabling expression of one or more of the retroviral vector components to be switched on at the time of vector production. Gene switch systems include those of the (TetR) protein group of transcription regulators (e.g.T-Rex, Tet-On, and Tet-Off), those of the cumate inducible switch system group of transcription regulators (e.g. CymR protein) and those involving an RNA-binding protein (e.g. TRAP). One such tetracycline-inducible system is the tetracycline repressor (TetR) system based on the T-REx™ system. By way of example, in such a system tetracycline operators (TetO2) are placed in a position such that the first nucleotide is 10bp from the 3’ end of the last nucleotide of the TATATAA element of the human cytomegalovirus major immediate early promoter (hCMVp) then TetR alone is capable of acting as a repressor (Yao F, Svensjo T, Winkler T, Lu M, Eriksson C, Eriksson E. Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells.1998. Hum Gene Ther; 9: 1939-1950). In such a system the expression of the NOI can be controlled by a CMV promoter into which two copies of the TetO2 sequence have been inserted in tandem. TetR homodimers, in the absence of an inducing agent (tetracycline or its analogue doxycycline [dox]), bind to the TetO2 sequences and physically block transcription from the upstream CMV promoter. When present, the inducing agent binds to the TetR homodimers, causing allosteric changes such that it can no longer bind to the TetO2 sequences, resulting in gene expression. The TetR gene may be codon optimised as this may improve translation efficiency resulting in tighter control of TetO2 controlled gene expression. The TRiP system is described in WO 2015/092440 and provides another way of repressing expression of the NOI in the production cells during vector production. The TRAP-binding sequence (e.g. TRAP-tbs) interaction forms the basis for a transgene protein repression system for the production of retroviral vectors, when a constitutive and/or strong promoter, including a tissue-specific promoter, driving the transgene is desirable and particularly when expression of the transgene protein in production cells leads to reduction in vector titres and/or elicits an immune response in vivo due to viral vector delivery of transgene-derived protein (Maunder et al, Nat Commun. (2017) Mar 27; 8). Briefly, the TRAP-tbs interaction forms a translational block, repressing translation of the transgene protein (Maunder et al, Nat Commun. (2017) Mar 27; 8). The translational block is only effective in production cells and as such does not impede the DNA- or RNA- based vector systems. The TRiP system is able to repress translation when the transgene protein is expressed from a constitutive and/or strong promoter, including a tissue-specific promoter from single- or multi cistronic mRNA. It has been demonstrated that unregulated expression of transgene protein can reduce vector titres and affect vector product quality. Repression of transgene protein for both transient and stable PaCL/PCL vector production systems is beneficial for production cells to prevent a reduction in vector titres: where toxicity or molecular burden issues may lead to cellular stress; where transgene protein elicits an immune response in vivo due to viral vector delivery of transgene-derived protein; where the use of gene-editing transgenes may result in on/off target affects; where the transgene protein may affect vector and/or envelope glycoprotein exclusion. Envelope and Pseudotyping In one preferred aspect, the lentiviral vector as described herein has been pseudotyped. In this regard, pseudotyping can confer one or more advantages. For example, the env gene product of the HIV based vectors would restrict these vectors to infecting only cells that express a protein called CD4. But if the env gene in these vectors has been substituted with env sequences from other enveloped viruses, then they may have a broader infectious spectrum (Verma and Somia (1997) Nature 389(6648):239-242). By way of example, workers have pseudotyped an HIV based vector with the glycoprotein from VSV (Verma and Somia (1997) Nature 389(6648):239-242). Accordingly, alternative sequences which perform the equivalent function as the env gene product of HIV based vectors are also known. In another alternative, the Env protein may be a modified Env protein such as a mutant or engineered Env protein. Modifications may be made or selected to introduce targeting ability or to reduce toxicity or for another purpose (Valsesia-Wittman et al 1996 J Virol 70: 2056-64; Nilson et al (1996) Gene Ther 3(4):280-286; and Fielding et al (1998) Blood 91(5):1802-1809 and references cited therein). The vector may be pseudotyped with any molecule of choice. As used herein, “env” shall mean an endogenous lentiviral envelope or a heterologous envelope, as described herein. Suitably, env may be Env of HIV based vectors or a functional substitute thereof. VSV-G The envelope glycoprotein (G) of Vesicular stomatitis virus (VSV), a rhabdovirus, is an envelope protein that has been shown to be capable of pseudotyping certain enveloped viruses and viral vector virions. Its ability to pseudotype MoMLV-based retroviral vectors in the absence of any retroviral envelope proteins was first shown by Emi et al. (1991) Journal of Virology 65:1202-1207. WO 1994/294440 teaches that retroviral vectors may be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors may be used to transduce a wide range of mammalian cells. More recently, Abe et al. (1998) J Virol 72(8) 6356-6361 teach that non-infectious retroviral particles can be made infectious by the addition of VSV-G. Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-7 successfully pseudotyped the retrovirus MLV with VSV-G and this resulted in a vector having an altered host range compared to MLV in its native form. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells, but also cell lines derived from fish, reptiles and insects (Burns et al. (1993) ibid). They have also been shown to be more efficient than traditional amphotropic envelopes for a variety of cell lines (Yee et al., (1994) Proc. Natl. Acad. Sci. USA 91:9564- 9568, Emi et al. (1991) Journal of Virology 65:1202-1207). VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail is capable of interacting with the retroviral cores. The provision of a non-retroviral pseudotyping envelope such as VSV-G protein gives the advantage that vector particles can be concentrated to a high titre without loss of infectivity (Akkina et al. (1996) J. Virol.70:2581-5). Retrovirus envelope proteins are apparently unable to withstand the shearing forces during ultracentrifugation, probably because they consist of two non-covalently linked subunits. The interaction between the subunits may be disrupted by the centrifugation. In comparison the VSV glycoprotein is composed of a single unit. VSV- G protein pseudotyping can therefore offer potential advantages for both efficient target cell infection/transduction and during manufacturing processes. WO 2000/52188 describes the generation of pseudotyped retroviral vectors, from stable producer cell lines, having vesicular stomatitis virus-G protein (VSV-G) as the membrane- associated viral envelope protein, and provides a gene sequence for the VSV-G protein. Ross River Virus The Ross River viral envelope has been used to pseudotype a non-primate lentiviral vector (FIV) and following systemic administration predominantly transduced the liver (Kang et al., 2002, J. Virol., 76:9378-9388). Efficiency was reported to be 20-fold greater than obtained with VSV-G pseudotyped vector, and caused less cytotoxicity as measured by serum levels of liver enzymes suggestive of hepatotoxicity. Baculovirus GP64 The baculovirus GP64 protein has been shown to be an alternative to VSV-G for viral vectors used in the large-scale production of high-titre virus required for clinical and commercial applications (Kumar M, Bradow BP, Zimmerberg J (2003) Hum Gene Ther. 14(1):67-77). Compared with VSV-G-pseudotyped vectors, GP64-pseudotyped vectors have a similar broad tropism and similar native titres. Because, GP64 expression does not kill cells, HEK293T- based cell lines constitutively expressing GP64 can be generated. Alternative Envelopes Other envelopes which give reasonable titre when used to pseudotype EIAV include Mokola, Rabies, Ebola and LCMV (lymphocytic choriomeningitis virus). Intravenous infusion into mice of lentivirus pseudotyped with 4070A led to maximal gene expression in the liver. Packaging Sequence As utilized within the context of the present invention the term “packaging signal”, which is referred to interchangeably as “packaging sequence” or “psi”, is used in reference to the non- coding, cis-acting sequence required for encapsidation of retroviral RNA strands during viral particle formation. In HIV-1, this sequence has been mapped to loci extending from upstream of the major splice donor site (SD) to at least the gag start codon (some or all of the 5’ sequence of gag to nucleotide 688 may be included). In EIAV the packaging signal comprises the R region into the 5’ coding region of Gag. As used herein, the term “extended packaging signal” or “extended packaging sequence” refers to the use of sequences around the psi sequence with further extension into the gag gene. The inclusion of these additional packaging sequences may increase the efficiency of insertion of vector RNA into viral particles. Feline immunodeficiency virus (FIV) RNA encapsidation determinants have been shown to be discrete and non-continuous, comprising one region at the 5' end of the genomic mRNA (R- U5) and another region that mapped within the proximal 311 nt of gag (Kaye et al., J Virol. Oct;69(10):6588-92 (1995). Internal Ribosome Entry Site (IRES) Insertion of IRES elements allows expression of multiple coding regions from a single promoter (Adam et al (as above); Koo et al (1992) Virology 186:669-675; Chen et al 1993 J. Virol 67:2142-2148). IRES elements were first found in the non-translated 5’ ends of picornaviruses where they promote cap-independent translation of viral proteins (Jang et al (1990) Enzyme 44: 292-309). When located between open reading frames in an RNA, IRES elements allow efficient translation of the downstream open reading frame by promoting entry of the ribosome at the IRES element followed by downstream initiation of translation. A review on IRES is presented by Mountford and Smith (TIG May 1995 vol 11, No 5:179-184). A number of different IRES sequences are known including those from encephalomyocarditis virus (EMCV) (Ghattas, I.R., et al., Mol. Cell. Biol., 11:5848-5859 (1991); BiP protein [Macejak and Sarnow, Nature 353:91 (1991)]; the Antennapedia gene of Drosophila (exons d and e) [Oh, et al., Genes & Development, 6:1643-1653 (1992)] as well as those in polio virus (PV) [Pelletier and Sonenberg, Nature 334: 320-325 (1988); see also Mountford and Smith, TIG 11, 179-184 (1985)]. IRES elements from PV, EMCV and swine vesicular disease virus have previously been used in retroviral vectors (Coffin et al, as above). The term “IRES” includes any sequence or combination of sequences which work as or improve the function of an IRES. The IRES(s) may be of viral origin (such as EMCV IRES, PV IRES, or FMDV 2A-like sequences) or cellular origin (such as FGF2 IRES, NRF IRES, Notch 2 IRES or EIF4 IRES). In order for the IRES to be capable of initiating translation of each polynucleotide it should be located between or prior to the polynucleotides in the modular construct. The nucleotide sequences utilised for development of stable cell lines require the addition of selectable markers for selection of cells where stable integration has occurred. These selectable markers can be expressed as a single transcription unit within the nucleotide sequence or it may be preferable to use IRES elements to initiate translation of the selectable marker in a polycistronic message (Adam et al 1991 J.Virol.65, 4985). Genetic Orientation and Insulators It is well known that nucleic acids are directional and this ultimately affects mechanisms such as transcription and replication in the cell. Thus genes can have relative orientations with respect to one another when part of the same nucleic acid construct. In certain aspects of the present invention, at least two nucleic acid sequences present at the same locus in the cell or construct can be in a reverse and/or alternating orientations. In other words, in certain aspects of the invention at this particular locus, the pair of sequential genes will not have the same orientation. This can help prevent both transcriptional and translational read-through when the region is expressed within the same physical location of the host cell. Having the alternating orientations benefits retroviral vector production when the nucleic acids required for vector production are based at the same genetic locus within the cell. This in turn can also improve the safety of the resulting constructs in preventing the generation of replication-competent retroviral vectors. When nucleic acid sequences are in reverse and/or alternating orientations the use of insulators can prevent inappropriate expression or silencing of a NOI from its genetic surroundings. The term “insulator” refers to a class of nucleotide, e.g.DNA, sequence elements that when bound to insulator-binding proteins possess an ability to protect genes from surrounding regulator signals. There are two types of insulators: an enhancer blocking function and a chromatin barrier function. When an insulator is situated between a promoter and an enhancer, the enhancer-blocking function of the insulator shields the promoter from the transcription-enhancing influence of the enhancer (Geyer and Corces 1992; Kellum and Schedl 1992). The chromatin barrier insulators function by preventing the advance of nearby condensed chromatin which would lead to a transcriptionally active chromatin region turning into a transcriptionally inactive chromatin region and resulting in silencing of gene expression. Insulators which inhibit the spread of heterochromatin, and thus gene silencing, recruit enzymes involved in histone modifications to prevent this process (Yang J, Corces VG. 2011;110:43-76; Huang, Li et al.2007; Dhillon, Raab et al.2009). An insulator can have one or both of these functions and the chicken β-globin insulator (cHS4) is one such example. This insulator is the most extensively studied vertebrate insulator, is highly rich in G+C and has both enhancer-blocking and heterochromatic barrier functions (Chung J H, Whitely M, Felsenfeld G. Cell.1993;74:505–514). Other such insulators with enhancer blocking functions are not limited to but include the following: human β-globin insulator 5 (HS5), human β-globin insulator 1 (HS1), and chicken β-globin insulator (cHS3) (Farrell CM1, West AG, Felsenfeld G., Mol Cell Biol.2002 Jun;22(11):3820-31; J Ellis et al. EMBO J.1996 Feb 1; 15(3): 562– 568). In addition to reducing unwanted distal interactions the insulators also help to prevent promoter interference (i.e. where the promoter from one transcription unit impairs expression of an adjacent transcription unit) between adjacent retroviral nucleic acid sequences. If the insulators are used between each of the retroviral vector nucleic acid sequences, then the reduction of direct read-through will help prevent the formation of replication-competent retroviral vector particles. The insulator may be present between each of the retroviral nucleic acid sequences. In one aspect, the use of insulators prevents promoter-enhancer interactions from one NOI expression cassette interacting with another NOI expression cassette in a nucleotide sequence encoding vector components. An insulator may be present between the vector genome and gag-pol sequences. This therefore limits the likelihood of the production of a replication-competent retroviral vector and ‘wild-type’ like RNA transcripts, improving the safety profile of the construct. The use of insulator elements to improve the expression of stably integrated multigene vectors is cited in Moriarity et al, Nucleic Acids Res.2013 Apr;41(8):e92. Vector Titre The skilled person will understand that there are a number of different methods of determining the titre of lentiviral vectors. Titre is often described as transducing units/mL (TU/mL). Titre may be increased by increasing the number of vector particles and by increasing the specific activity of a vector preparation. Therapeutic Use The lentiviral vector as described herein or a cell or tissue transduced with the lentiviral vector as described herein may be used in medicine. In addition, the lentiviral vector as described herein, a production cell of the invention or a cell or tissue transduced with the lentiviral vector as described herein may be used for the preparation of a medicament to deliver a nucleotide of interest to a target site in need of the same. Such uses of the lentiviral vector or transduced cell of the invention may be for therapeutic or diagnostic purposes, as described previously. Accordingly, there is provided a cell transduced by the lentiviral vector as described herein. A “cell transduced by a viral vector particle” is to be understood as a cell, in particular a target cell, into which the nucleic acid carried by the viral vector particle has been transferred. Nucleotide of interest In one embodiment of the invention, the nucleotide of interest is translated in a target cell which lacks TRAP. “Target cell” is to be understood as a cell in which it is desired to express the NOI. The NOI may be introduced into the target cell using a viral vector of the present invention. Delivery to the target cell may be performed in vivo, ex vivo or in vitro. In a preferred embodiment, the nucleotide of interest gives rise to a therapeutic effect. The NOI may have a therapeutic or diagnostic application. Suitable NOIs include, but are not limited to sequences encoding enzymes, co-factors, cytokines, chemokines, hormones, antibodies, anti-oxidant molecules, engineered immunoglobulin-like molecules, single chain antibodies, fusion proteins, immune co-stimulatory molecules, immunomodulatory molecules, chimeric antigen receptors a transdomain negative mutant of a target protein, toxins, conditional toxins, antigens, transcription factors, structural proteins, reporter proteins, subcellular localization signals, tumour suppressor proteins, growth factors, membrane proteins, receptors, vasoactive proteins and peptides, anti-viral proteins and ribozymes, and derivatives thereof (such as derivatives with an associated reporter group). The NOIs may also encode micro-RNA. In one embodiment, the NOI may be useful in the treatment of a neurodegenerative disorder. In another embodiment, the NOI may be useful in the treatment of Parkinson’s disease and multiple system atrophy. In another embodiment, the NOI may encode an enzyme or enzymes involved in dopamine synthesis. For example, the enzyme may be one or more of the following: tyrosine hydroxylase, GTP-cyclohydrolase I and/or aromatic amino acid dopa decarboxylase. The sequences of all three genes are available (GenBank® Accession Nos. X05290, U19523 and M76180, respectively). In another embodiment, the NOI may encode the vesicular monoamine transporter 2 (VMAT2). In an alternative embodiment the viral genome may comprise a NOI encoding aromatic amino acid dopa decarboxylase and a NOI encoding VMAT2. Such a genome may be used in the treatment of Parkinson’s disease, in particular in conjunction with peripheral administration of L-DOPA. In another embodiment the NOI may encode a therapeutic protein or combination of therapeutic proteins. In another embodiment, the NOI may encode a protein or proteins selected from the group consisting of glial cell derived neurotophic factor (GDNF), brain derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), neurotrophin-3 (NT-3), acidic fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), interleukin-1 beta (IL-1β), tumor necrosis factor alpha (TNF-α), insulin growth factor-2, VEGF-A, VEGF-B, VEGF-C/VEGF-2, VEGF-D, VEGF-E, PDGF-A, PDGF-B, hetero- and homo-dimers of PDFG-A and PDFG-B. In another embodiment, the NOI may encode an anti-angiogenic protein or anti-angiogenic proteins selected from the group consisting of angiostatin, endostatin, platelet factor 4, pigment epithelium derived factor (PEDF), placental growth factor, restin, interferon-α, interferon-inducible protein, gro-beta and tubedown-1, interleukin(IL)-1, IL-12, retinoic acid, anti-VEGF antibodies or fragments /variants thereof such as aflibercept, thrombospondin, VEGF receptor proteins such as those described in US 5,952,199 and US 6,100,071, and anti- VEGF receptor antibodies. In another embodiment, the NOI may encode anti-inflammatory proteins, antibodies or fragment/variants of proteins or antibodies selected from the group consisting of NF-kB inhibitors, IL1beta inhibitors, TGFbeta inhibitors, IL-6 inhibitors, IL-23 inhibitors, IL-18 inhibitors, Tumour necrosis factor alpha and Tumour necrosis factor beta, Lymphotoxin alpha and Lymphotoxin beta, LIGHT inhibitors, alpha synuclein inhibitors, Tau inhibitors, beta amyloid inhibitors, IL-17 inhibitors, IL-33 inhibitors, IL-33 receptor inhibitors and TSLP inhibitors. In another embodiment the NOI may encode cystic fibrosis transmembrane conductance regulator (CFTR). In another embodiment the NOI may encode a protein normally expressed in an ocular cell. In another embodiment, the NOI may encode a protein normally expressed in a photoreceptor cell and/or retinal pigment epithelium cell. In another embodiment, the NOI may encode a protein selected from the group comprising RPE65, arylhydrocarbon-interacting receptor protein like 1 (AIPL1), CRB1, lecithin retinal acetyltransferace (LRAT), photoreceptor-specific homeo box (CRX), retinal guanylate cyclise (GUCY2D), RPGR interacting protein 1 (RPGRIP1), LCA2, LCA3, LCA5, dystrophin, PRPH2, CNTF, ABCR/ABCA4, EMP1, TIMP3, MERTK, ELOVL4, MYO7A, USH2A, VMD2, RLBP1, COX-2, FPR, harmonin, Rab escort protein 1, CNGB2, CNGA3, CEP 290, RPGR, RS1, RP1, PRELP, glutathione pathway enzymes and opticin. In other embodiments, the NOI may encode the human clotting Factor VIII or Factor IX. In other embodiments, the NOI may encode protein or proteins involved in metabolism selected from the group comprising phenylalanine hydroxylase (PAH), Methylmalonyl CoA mutase, Propionyl CoA carboxylase, Isovaleryl CoA dehydrogenase, Branched chain ketoacid dehydrogenase complex, Glutaryl CoA dehydrogenase, Acetyl CoA carboxylase, propionyl CoA carboxylase, 3 methyl crotonyl CoA carboxylase, pyruvate carboxylase, carbamoyl- phophate synthase ammonia, ornithine transcarbamylase, alpha galactosidase A, glucosylceramidase beta, cystinosin, glucosamine(N-acetyl)-6-sulfatase, N-acetyl-alpha- glucosaminidase, glucose-6-phosphatase, ATP7B, ATP8B1, ABCB11, ABCB4, TJP2, N- sulfoglucosamine sulfohydrolase, Galactosamine-6 sulfatase, arylsulfatase A, cytochrome B- 245 beta, ABCD1, ornithine carbamoyltransferase, argininosuccinate synthase, argininosuccinate lysase, arginase 1, alanine glycoxhylate amino transferase, ATP-binding cassette, sub-family B members. In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) or a T cell receptor (TCR). In one embodiment, the CAR is an anti-5T4 CAR. In other embodiments, the NOI may encode B-cell maturation antigen (BCMA), CD19, CD22, CD20, CD138, CD30, CD33, CD123, CD70, prostate specific membrane antigen (PSMA), Lewis Y antigen (LeY), Tyrosine-protein kinase transmembrane receptor (ROR1), Mucin 1, cell surface associated (Muc1), Epithelial cell adhesion molecule (EpCAM), endothelial growth factor receptor (EGFR), insulin, protein tyrosine phosphatase, non-receptor type 22, interleukin 2 receptor, alpha, interferon induced with helicase C domain 1, human epidermal growth factor receptor (HER2), glypican 3 (GPC3), disialoganglioside (GD2), mesiothelin, vesicular endothelial growth factor receptor 2 (VEGFR2). Smith antigen, Ro60, double stranded DNA, phospholipids, proinsulin, insulinoma antigen 2 (IA-2) , 65 kDa isoform of glutamic acid decarboxylase (GAD65), chromogranin A (CHGA), islet amyloid polypeptide (IAPP), islet- specific glucose-6-phosphatase catalytic subunit-related protein (IGRP), zinc transporter 8 (ZnT8). In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) against NKG2D ligands selected from the group comprising ULBP1, 2 and 3, H60, Rae-1a, b, g, d, MICA, MICB. In further embodiments the NOI may encode SGSH, SUMF1, GAA, the common gamma chain (CD132), adenosine deaminase, WAS protein, globins, alpha galactosidase A, δ- aminolevulinate (ALA) synthase, δ-aminolevulinate dehydratase (ALAD), Hydroxymethylbilane (HMB) synthase, Uroporphyrinogen (URO) synthase, Uroporphyrinogen (URO) decarboxylase, Coproporphyrinogen (COPRO) oxidase, Protoporphyrinogen (PROTO) oxidase, Ferrochelatase, α-L-iduronidase, Iduronate sulfatase, Heparan sulfamidase, N-acetylglucosaminidase, Heparan-α-glucosaminide N-acetyltransferase, 3 N- acetylglucosamine 6-sulfatase, Galactose-6-sulfate sulfatase, β-galactosidase, N- acetylgalactosamine-4-sulfatase, β-glucuronidase and Hyaluronidase. In addition to the NOI the vector may also comprise or encode a siRNA, shRNA, or regulated shRNA. (Dickins et al. (2005) Nature Genetics 37: 1289-1295, Silva et al. (2005) Nature Genetics 37:1281-1288). Indications The vectors, including retroviral and AAV vectors, according to the present invention may be used to deliver one or more NOI(s) useful in the treatment of the disorders listed in WO 1998/05635, WO 1998/07859, WO 1998/09985. The nucleotide of interest may be DNA or RNA. Examples of such diseases are given below: A disorder which responds to cytokine and cell proliferation/differentiation activity; immunosuppressant or immunostimulant activity (e.g. for treating immune deficiency, including infection with human immunodeficiency virus, regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumour immunity); regulation of haematopoiesis (e.g. treatment of myeloid or lymphoid diseases); promoting growth of bone, cartilage, tendon, ligament and nerve tissue (e.g. for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration); inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokinetic activity (e.g. for mobilising specific cell types to sites of injury or infection); haemostatic and thrombolytic activity (e.g. for treating haemophilia and stroke); anti-inflammatory activity (for treating, for example, septic shock or Crohn's disease); macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity; anti-immune activity (i.e. inhibitory effects against a cellular and/or humoral immune response, including a response not associated with inflammation); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as up-regulated fas receptor expression in T cells. Malignancy disorders, including cancer, leukaemia, benign and malignant tumour growth, invasion and spread, angiogenesis, metastases, ascites and malignant pleural effusion. Autoimmune diseases including arthritis, including rheumatoid arthritis, hypersensitivity, psoriasis, Sjogren's syndrome, allergic reactions, asthma, chronic obstructive pulmonary disease, systemic lupus erythematosus, Type 1 diabetes mellitus, Crohn’s disease, ulcerative colitis, collagen diseases and other diseases. Vascular diseases including arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent anti-thrombosis, stroke, cerebral ischaemia, ischaemic heart disease or other diseases. Diseases of the gastrointestinal tract including peptic ulcer, ulcerative colitis, Crohn's disease and other diseases. Hepatic diseases including hepatic fibrosis, liver cirrhosis, amyloidosis. Inherited metabolic disorders including phenylketonuria PKU, Wilson disease, organic acidemias, glycogen storage diseases, urea cycle disorders, cholestasis, and other diseases, or other diseases. Renal and urologic diseases including thyroiditis or other glandular diseases, glomerulonephritis, lupus nephritis or other diseases. Ear, nose and throat disorders including otitis or other oto-rhino-laryngological diseases, dermatitis or other dermal diseases. Dental and oral disorders including periodontal diseases, periodontitis, gingivitis or other dental/oral diseases. Testicular diseases including orchitis or epididimo-orchitis, infertility, orchidal trauma or other testicular diseases. Gynaecological diseases including placental dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-eclampsia, endometriosis and other gynaecological diseases. Ophthalmologic disorders such as Leber Congenital Amaurosis (LCA) including LCA10, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, glaucoma, including open angle glaucoma and juvenile congenital glaucoma, intraocular inflammation, e.g. retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, macular degeneration including age related macular degeneration (AMD) and juvenile macular degeneration including Best Disease, Best vitelliform macular degeneration, Stargardt’s Disease, Usher’s syndrome, Doyne's honeycomb retinal dystrophy, Sorby’s Macular Dystrophy, Juvenile retinoschisis, Cone-Rod Dystrophy, Corneal Dystrophy, Fuch’s Dystrophy, Leber's congenital amaurosis, Leber’s hereditary optic neuropathy (LHON), Adie syndrome, Oguchi disease, degenerative fondus disease, ocular trauma, ocular inflammation caused by infection, proliferative vitreo- retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g. following glaucoma filtration operation, reaction against ocular implants, corneal transplant graft rejection, and other ophthalmic diseases, such as diabetic macular oedema, retinal vein occlusion, RLBP1-associated retinal dystrophy, choroideremia and achromatopsia. Neurological and neurodegenerative disorders including Parkinson's disease, complication and/or side effects from treatment of Parkinson's disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, strokes, post-polio syndrome, psychiatric disorders, myelitis, encephalitis, subacute sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, Cystinosis, Pompe disease, metachromatic leukodystrophy, Wiscott Aldrich Syndrome, adrenoleukodystrophy, beta-thalassemia, sickle cell disease, Guillaim-Barre syndrome, Sydenham chorea, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, Frontotemporal dementia, CNS compression or CNS trauma or infections of the CNS, muscular atrophies and dystrophies, diseases, conditions or disorders of the central and peripheral nervous systems, motor neuron disease including amyotropic lateral sclerosis, spinal muscular atropy, spinal cord and avulsion injury. Other diseases and conditions such as cystic fibrosis, mucopolysaccharidosis including Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler–Scheie syndrome, Morquio syndrome, ADA- SCID, X-linked SCID, X-linked chronic granulomatous disease, porphyria, haemophilia A, haemophilia B, post-traumatic inflammation, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, septic shock, infectious diseases, diabetes mellitus, complications or side effects of surgery, bone marrow transplantation or other transplantation complications and/or side effects, complications and side effects of gene therapy, e.g. due to infection with a viral carrier, or AIDS, to suppress or inhibit a humoral and/or cellular immune response, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue. siRNA, micro-RNA and shRNA In certain other embodiments, the NOI comprises a micro-RNA. The micro-RNA which is the NOI (i.e. transgene) is distinct from the interfering RNA which is specific for mRNA encoding the transgene described herein. Thus, a micro-RNA which is the transgene typically does not target the mRNA encoding the transgene. A micro-RNA which is the transgene may target the mRNA encoding another transgene (i.e. a second transgene) in order to regulate the second transgene mRNA, for example, as part of a gene switch system. In addition to the NOI, the vector may also comprise or encode a miRNA, siRNA, shRNA, or regulated shRNA (Dickins et al. (2005) Nature Genetics 37: 1289-1295, Silva et al. (2005) Nature Genetics 37:1281-1288). Preferably, the vector may comprise or encode a miRNA or shRNA in addition to the NOI. The additional miRNA, siRNA, shRNA, or regulated shRNA is distinct from interfering RNA which is specific for mRNA encoding the transgene described herein. Thus, the additional miRNA, siRNA, shRNA, or regulated shRNA does not target the mRNA encoding the transgene. Pharmaceutical Compositions The present disclosure provides a pharmaceutical composition comprising the lentiviral vector as described herein or a cell or tissue transduced with the viral vector as described herein, in combination with a pharmaceutically acceptable carrier, diluent or excipient. The present disclosure provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of a lentiviral vector. The pharmaceutical composition may be for human or animal usage. The composition may comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient or diluent can be made with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise, or be in addition to, the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s) and other carrier agents that may aid or increase vector entry into the target site (such as for example a lipid delivery system). Where appropriate, the composition can be administered by any one or more of inhalation; in the form of a suppository or pessary; topically in the form of a lotion, solution, cream, ointment or dusting powder; by use of a skin patch; orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents; or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly, intracranially, intraoccularly intraperitoneally, or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration, the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner. The lentiviral vector as described herein may also be used to transduce target cells or target tissue ex vivo prior to transfer of said target cell or tissue into a patient in need of the same. An example of such cell may be autologous T cells and an example of such tissue may be a donor cornea. Variants, Derivatives, Analogues, Homologues and Fragments In addition to the specific proteins and nucleotides mentioned herein, the present invention also encompasses the use of variants, derivatives, analogues, homologues and fragments thereof. In the context of the present invention, a variant of any given sequence is a sequence in which the specific sequence of residues (whether amino acid or nucleic acid residues) has been modified in such a manner that the polypeptide or polynucleotide in question retains at least one of its endogenous functions. A variant sequence can be obtained by addition, deletion, substitution, modification, replacement and/or variation of at least one residue present in the naturally-occurring protein. The term “derivative” as used herein, in relation to proteins or polypeptides of the present invention includes any substitution of, variation of, modification of, replacement of, deletion of and/or addition of one (or more) amino acid residues from or to the sequence providing that the resultant protein or polypeptide retains at least one of its endogenous functions. The term “analogue” as used herein, in relation to polypeptides or polynucleotides includes any mimetic, that is, a chemical compound that possesses at least one of the endogenous functions of the polypeptides or polynucleotides which it mimics. Typically, amino acid substitutions may be made, for example from 1, 2 or 3 to 10 or 20 substitutions provided that the modified sequence retains the required activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues. Proteins used in the present invention may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent protein. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues as long as the endogenous function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include asparagine, glutamine, serine, threonine and tyrosine. Conservative substitutions may be made, for example according to the table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

The term “homologue” means an entity having a certain homology with the wild type amino acid sequence and the wild type nucleotide sequence. The term “homology” can be equated with “identity”. In the present context, a homologous sequence is taken to include an amino acid sequence which may be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95%, 97 or 99% identical to the subject sequence. Typically, the homologues will comprise the same active sites etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity. In the present context, a homologous sequence is taken to include a nucleotide sequence which may be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95%, 97%, 98% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in the context of the present invention it is preferred to express homology in terms of sequence identity. Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate percentage homology or identity between two or more sequences. Percentage homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an “ungapped” alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues. Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion in the nucleotide sequence may cause the following codons to be put out of alignment, thus potentially resulting in a large reduction in percent homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting “gaps” in the sequence alignment to try to maximise local homology. However, these more complex methods assign “gap penalties” to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. “Affine gap costs” are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension. Calculation of maximum percentage homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Research 12:387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid – Ch.18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al. (1999) ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. Another tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett (1999) 174(2):247-50; FEMS Microbiol Lett (1999) 177(1):187-8). Although the final percentage homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix – the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62. Once the software has produced an optimal alignment, it is possible to calculate percentage homology, preferably percentage sequence identity. The software usually does this as part of the sequence comparison and generates a numerical result. “Fragments” are also variants and the term typically refers to a selected region of the polypeptide or polynucleotide that is of interest either functionally or, for example, in an assay. “Fragment” thus refers to an amino acid or nucleic acid sequence that is a portion of a full- length polypeptide or polynucleotide. Such variants may be prepared using standard recombinant DNA techniques such as site- directed mutagenesis. Where insertions are to be made, synthetic DNA encoding the insertion together with 5' and 3' flanking regions corresponding to the naturally-occurring sequence either side of the insertion site may be made. The flanking regions will contain convenient restriction sites corresponding to sites in the naturally-occurring sequence so that the sequence may be cut with the appropriate enzyme(s) and the synthetic DNA ligated into the break. The DNA is then expressed in accordance with the invention to make the encoded protein. These methods are only illustrative of the numerous standard techniques known in the art for manipulation of DNA sequences and other known techniques may also be used. All variants, fragments or homologues of the regulatory protein suitable for use in the cells and/or modular constructs of the invention will retain the ability to bind the cognate binding site of the NOI such that translation of the NOI is repressed or prevented in a viral vector production cell. All variants fragments or homologues of the binding site will retain the ability to bind the cognate RNA-binding protein, such that translation of the NOI is repressed or prevented in a viral vector production cell. Codon Optimisation The polynucleotides used in the present invention (including the NOI and/or components of the vector production system) may be codon-optimised. Codon optimisation has previously been described in WO 1999/41397 and WO 2001/79518. Different cells differ in their usage of particular codons. This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence so that they are tailored to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. By the same token, it is possible to decrease expression by deliberately choosing codons for which the corresponding tRNAs are known to be rare in the particular cell type. Thus, an additional degree of translational control is available. Many viruses, including retroviruses, use a large number of rare codons and changing these to correspond to commonly used mammalian codons, increases expression of a gene of interest, e.g. a NOI or packaging components in mammalian production cells, can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. Codon optimisation of viral vector packaging components has a number of other advantages. By virtue of alterations in their sequences, the nucleotide sequences encoding the packaging components of the viral particles required for assembly of viral particles in the producer cells/packaging cells have RNA instability sequences (INS) eliminated from them. At the same time, the amino acid sequence coding sequence for the packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the packaging components is not compromised. In lentiviral vector gag/pol expression cassettes codon optimisation also overcomes the Rev/RRE requirement for export, rendering optimised sequences Rev-independent. Codon optimisation also reduces homologous recombination between different constructs within the vector system (for example between the regions of overlap in the gag-pol and env open reading frames). The overall effect of codon optimisation is therefore a notable increase in viral titre and improved safety. In one aspect only codons relating to INS are codon optimised. However, in a much more preferred and practical aspect, the sequences are codon optimised in their entirety, with some exceptions, for example the sequence encompassing the frameshift site of gag-pol (see below). The gag-pol gene of lentiviral vectors comprises two overlapping reading frames encoding the gag-pol proteins. The expression of both proteins depends on a frameshift during translation. This frameshift occurs as a result of ribosome “slippage” during translation. This slippage is thought to be caused at least in part by ribosome-stalling RNA secondary structures. Such secondary structures exist downstream of the frameshift site in the gag-pol gene. For HIV, the region of overlap extends from nucleotide 1222 downstream of the beginning of gag (wherein nucleotide 1 is the A of the gag ATG) to the end of gag (nt 1503). Consequently, a 281 bp fragment spanning the frameshift site and the overlapping region of the two reading frames is preferably not codon optimised. Retaining this fragment will enable more efficient expression of the Gag-Pol proteins. For EIAV the beginning of the overlap has been taken to be nt 1262 (where nucleotide 1 is the A of the gag ATG) and the end of the overlap to be nt 1461. In order to ensure that the frameshift site and the gag-pol overlap are preserved, the wild type sequence has been retained from nt 1156 to 1465. Derivations from optimal codon usage may be made, for example, in order to accommodate convenient restriction sites, and conservative amino acid changes may be introduced into the Gag-Pol proteins. In one aspect, codon optimisation is based on lightly expressed mammalian genes. The third and sometimes the second and third base may be changed. Due to the degenerate nature of the genetic code, it will be appreciated that numerous gag- pol sequences can be achieved by a skilled worker. Also there are many retroviral variants described which can be used as a starting point for generating a codon-optimised gag-pol sequence. Lentiviral genomes can be quite variable. For example there are many quasi- species of HIV-1 which are still functional. This is also the case for EIAV. These variants may be used to enhance particular parts of the transduction process. Examples of HIV-1 variants may be found at the HIV Databases operated by Los Alamos National Security, LLC at http://hiv-web.lanl.gov. Details of EIAV clones may be found at the National Center for Biotechnology Information (NCBI) database located at http://www.ncbi.nlm.nih.gov. The strategy for codon-optimised gag-pol sequences can be used in relation to any retrovirus. This would apply to all lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1 and HIV-2. In addition this method could be used to increase expression of genes from HTLV-1, HTLV-2, HFV, HSRV and human endogenous retroviruses (HERV), MLV and other retroviruses. Codon optimisation can render gag-pol expression Rev-independent. In order to enable the use of anti-rev or RRE factors in the lentiviral vector, however, it would be necessary to render the viral vector generation system totally Rev/RRE-independent. Thus, the genome also needs to be modified. This is achieved by optimising vector genome components. Advantageously, these modifications also lead to the production of a safer system absent of all additional proteins both in the producer and in the transduced cell. It is to be understood that features disclosed herein may be used in combination with one another. Furthermore, it is to be understood that such features may possess different functionalities by virtue of the nucleotide sequence comprising them. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements) Current Protocols in Molecular Biology, Ch.9, 13, and 16, John Wiley & Sons, New York, NY; B. Roe, J. Crabtree, and A. Kahn (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O’D. McGee (1990) In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (ed.) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and, D. M. J. Lilley and J. E. Dahlberg (1992) Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is herein incorporated by reference. This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of aspects of this disclosure. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure. It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. The terms "comprising", "comprises" and "comprised of' as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms "comprising", "comprises" and "comprised of' also include the term "consisting of'. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto. The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention. It is to be understood that any nucleotide sequence disclosed herein may be a DNA sequence or an RNA sequence. As such, a sequence recited comprising thymine nucleotides is considered disclosed as a corresponding RNA sequence comprising Uracil nucleotides in place of said Thymine nucleotides, and vice versa. Accordingly, DNA sequences contained within the corresponding sequence listing will be understood as also representing an RNA of identical sequence (with Thymines replaced by Uracils), and vice versa. EXAMPLES Example 1: Use of a transgene mRNA-targeted siRNA in transient co-transfection to reduce transgene expression as well as recover titres of a vector containing an inverted transgene cassette. Standard RRE/rev-dependent LV genome expression cassettes harbouring the EFS-GFP reporter were generated with transgene cassette in either the forward or inverted orientation. For the inverted transgene cassette a heterlogous polyadenylation sequence was provided to enable efficient transcription termination (see Figure 1). Vector supernatants were produced by transfection of suspension (serum-free) HEK293T cells with the vector component plasmids and optionally with 34pmol/mL (final concentration in the culture media) of ‘Dicer- Substrate Short Interfering RNAs’ (DsiRNAs [27-mer]; IDT) directed to either eGFP (Transgene; IDT Cat# 51-01-05-07) or Luciferase (Control; IDT Cat # 51-01-08-22). A pTK- DsRed-Xprs plasmid was also spiked into the DNA mix as a surrogate marker for dsRNA sensing effects on de novo protein synthesis during LV production. Post-production cells were analysed by flow cytometry to assess the levels of GFP transgene expression, and the level of DsRed-Xprs. Clarified vector supernatants were titrated by transduction of adherent HEK293T cells followed by flow cytometry. Figure 2 shows a simple experiment where a standard rev/RRE-dependent LV containing an inverted EFS-GFP-polyA cassette was produced in HEK293T cells with or without rev. Only when rev was present – and therefore full length vRNA could be transported to the cytoplasm where it could anneal to the transgene mRNA – was de novo expression of VSV-G/p24 suppressed, indicating that a cytoplasmic dsRNA response (e.g. PKR) was likely triggered. The results displayed in Figure 4 show that surprisingly the GFP siRNA led to substantial reduction (100-fold) in transgene expression of the forward facing LV genome without severely impacting LV titres. Moreover, the titres of the inverted transgene LV genome were substantially reduced compared to the forward facing LV genome, and DsRed-Xprs levels were also lower (indicating some potential dsRNA sensing, leading to translation suppression). However, the use of the GFP siRNA recovered titres by 100-fold and DsRed- Xprs level were restored. Strikingly, the level of GFP expression in cells transfected with the inverted transgene LV genome plus the GFP siRNA were 10,000 fold lower than the forward- facing LV genome alone. This demonstrated the utility of microRNA to rescue titres of LV containing inverted transgene cassettes, as well as efficiently suppressing transgene expression during LV production. Example 2: Use of a Vector-Intron within LV genomes harbouring functional mutations within the SL2 loop of the packaging signal to ablate aberrant splicing allow for rev/RRE-independence. Figure 7 displays the basic configuration of the Vector-Intron LV genome expression cassette in comparison to current, ‘standard’ LV genomes. Both types of genome expression cassettes are driven by powerful, constitutive promoters independently of HIV-1 tat, although the inventors have shown previously that HIV-1 tat can fully recover the titres of LV genomes harbouring a mutation in the MSD. However, contemporary 3^rd generation LV production systems have been purposely developed to remove tat-dependence due to the safety concerns associated with this potent transcriptional activator. Re-instating tat into LV production systems would be seen as a substantial retrograde step in vector development, and it may be difficult to justify to regulators in order to sanction their use for clinical applications. Standard and VI LV genomes both share the same packaging sequence from the 5’ R to SL1 (dimerization loop) but then diverge principally in the SL2 loop, which contains the MSD. For VI genomes the MSD and a cryptic splice donor (crSD) site adjacent to it are both mutated to stop aberrant splicing into downstream positions. The inventors previously developed a substantive modification to the SL2 loop wherein the majority of the HIV-1 sequence is replaced with a heterologous stem loop absent of any splice donor site called ‘MSD-2KOm5’. The MSD-2KOm5 variant is preferred in the present invention as it has a lower impact on LV titres compared to the ‘MSD-2KO’ mutation, which harbours GT>CA mutations at the MSD and crSD sites. Additionally, the MSD-2KOm5 variant also appears to suppress aberrant splicing from another cryptic splice donor site in the SL4 loop of the packaging signal. Although optional, VI-containing LV genomes may also be deleted in the p17-INS sequence of the gag region that is typically retained in standard LV genomes as part of the wider packaging sequence. As for standard LV genomes, VI-containing LV genomes harbor the central poly purine tract (cppt) and a self-inactivating (SIN) 3’LTR. The transgene cassette typically contains a pol-II promoter and transgene ORF, with the 3’polyA site in the SIN LTR being used for both the vector genome vRNA and the transgene mRNA. The VI-containing LV genomes differ further from standard LV genomes in that they encode a functional intron in place of the RRE. Contemporary LVs also typically include a post-transcriptional regulatory element (PRE), such as the wPRE to enhance expression of (typically intron-less) transgene cassettes. Other transgenic sequences may also be encoded on the vector such as pol-III driven microRNA or gRNA for CRISPR-cas9 approaches. The VI-containing LV genomes differ further from standard LV genomes in that they encode a functional intron in place of the RRE. When considering the length of the wild type HIV-1 genome of ~9.5kb, the VI-containing LV in its basic form can package approximately ~1kb of additional transgene sequence relative to standard LV genomes. Figure 8 provides evidence that combining both the MSD-2KO feature and the Vector-Intron is beneficial in achieving maximal LV titres in a rev/RRE-independent manner. HIV-CMV-GFP vectors were created from a standard LV genome, containing a wild type packaging signal (with intact MSD) and the RRE. Vectors were produced in both adherent (Figure 8A) and suspension [serum-free] (Figure 8B) mode in HEK293T cells, and efficient out-put titres were shown to be dependent on the presence of rev. Deletion of the RRE from the standard MSD- proficient LV genome resulted in loss of rev-responsiveness (as expected), although interestingly titres produced in the absence of rev increased 10-fold, confirming that the RRE is inherently unstabilising to vRNA. The insertion of a VI (the first variant VI_1.1, is the EF1a intron – see Table 1 below) in place of the deleted RRE had no substantive effect on LV titres. However, the same modifications tested in the context of the MSD-2KO LV genome produced surprisingly different results. Here, the attenuating impact of the MSD-2KO mutation was dramatic for the RRE-containing genome, as titres were three orders of magnitude reduced in the presence of rev. Addition of the VI to this RRE-containing LV genome dramatically increased vector titres independently of the presence of rev, although the highest titres were only realized in the presence of rev. Given the apparent destabilizing effect of the RRE observed previously, the RRE was deleted from the MSD-2KO LV genome containing the VI, which not only increased vector titres to within 2-fold of the standard LV genome (+rev) but this was not dependent on the presence of rev. Thus it was shown that the ability of a Vector- Intron to rescue titres of MSD-2KO modified LV genomes is maximized when the RRE is deleted. TABLE 1 [cppt]

Table 1: A list of Vector-Intron variants designed and used to exemplify and optimize the invention, together with a visual representation of the functional sequences utilized in each variant. Vector-Introns tested included native sequences from the EF1a (v1 series) and Ubiquitin (v2 series) introns, and also widely used chimeric/synthetic introns such as CAG (Chicken Actin + Rabbit beta-globin; v3 series) and the Rabbit beta-globin + human IgG chimeric intron used in the pCI/pSI series of expression plasmids sold by Promega; v4 series). Further Vector- Introns were designed to swap different functional parts of the intron, namely: the splice donor sequence, the branch-splice acceptor sequence, as well as appending upstream exonic splicing enhancer elements from HIV-1 (hESE, hESE2, hGAR). These novel Vector-Introns were improved in either their ability to splice ‘cleanly’ and/or ability to increase LV titre. Example 3: The MSD-2KO and RRE-deletion work synergistically to generate correctly spliced and packaged LV vRNA when applied to VI-containing LV genome expression cassettes. To understand the impact of the MSD-2KO, RRE and rev on the production of VI-‘derived’ LV vRNA in the cell and in virions, samples from the experiment performed in generating the data in Figure 8A were used (only samples where the VI was present in the LV genome). Total poly-A selected RNA from post-production cell lysates and crude LV harvest material were subjected to RT-PCR analysis using appropriately positioned forward and reverse primers as shown in Figure 9A. The same figure displays the VI-containing LV DNA expression cassette and the positions of relevant cis-acting sequences with regard to potential spliced products generated from transcription from the external promoter (here, the transgene mRNA is not shown for clarity). Thus, different sized RT-PCR products might be detected depending on the presence of the RRE and the potential for splicing from the MSD, crSD and the alternative crSD2 (active in MSD-2KO but not MSD-2KOm5 variants; see later Examples) to downstream splice acceptors (including the VI sa). Figure 9B displays the result of this analysis and provides further support to the data shown in Figure 8. First of note is the stimulation of longer packageable vRNA by rev only when the RRE is resident on the genome. Interestingly, rev/RRE appeared to inhibit splicing-out of the VI by ~50%, resulting in a 50:50 mixture of LV vRNA retaining the VI or not. This in itself provided a secondary reason to pursue rev/RRE-independence of VI-LV genomes since it is desirable to generate LV populations with homogeneous vRNAs. Secondly, the results show an extremely large amount of aberrant splicing from the MSD to the VI splice acceptor, analogous to what is typically observed in standard LV genomes containing the EF1a promoter (with its own intron) as the internal transgene promoter (VI_v1.1 is the EF1a intron). The MSD- 2KO mutation ablated this aberrant splicing, although this stimulated aberrant splicing from the crSD2 site in SL4 of the packaging signal into the VI splice acceptor. Interestingly, the deletion of the RRE minimized the amount of this specific aberrant splicing activity, although there were other products detected in the cells that were apparently not efficiently packaged. Finally, the MSD-2KO/∆RRE VI-LV genome generated the highest levels of VI-spliced LV vRNA in both cells and vector virions, and this occurred independently of rev. Based on these data, other introns – both natural and synthetic – were selected for further evaluation. Example 4: Use of production cell-derived miRs to target the transgene mRNA derived from a Vector-Intron LV harbouring an inverted transgene cassette. Other examples within the present invention demonstrate that ribozymes can be used as ‘self- cleaving’ elements with the 3’UTR of inverted transgene cassettes on-boarded to Vector- Intron LVs, in order to recover LV output titres. The lower output titre of these types of vectors containing inverted transgenes is likely due to the production of dsRNA, and resultant dsRNA- sensing pathways, for example leading to triggering of PKR. Thus, negation of dsRNA by degradation of transgene mRNA by use of ‘self-cleaving’ 3’UTR elements block this potential signalling. Embedding such elements within the 3’UTR of the inverted transgene that is encompassed by the Vector-Intron on the top strand, ensures that packaged vRNA will not contain these self-cleaving elements. An alternative or additional type of element that can be used are target sequences for miRNAs expressed during LV production; these can either be endogenously expressed miRNAs by the host cell or by exogenously expressed miRNAs (e.g. by co-transfection of a U6-driven mi/shRNA cassette). This concept is described in Figure 10. The feasibility of this approach was carried out by producing Vector-Intron LVs (specifically, MSD-2KOm5/ΔRRE/Δp17INS + VI_v5.5) harbouring an inverted EF1a-GFP cassette, with endogenous miRNA target sequences (as 1x or 3x copies) within the 3’UTR. Two sets of variants were generated in which the ribozymes T3H38 and HDV_AG were optionally present (when present, the miRNA target sequences were between the two ribozymes). A third variant was generated (+ribozymes), wherein a single copy of each type of miRNA target sequence was present. LVs were produced in suspension (serum-free) HEK293T cells and GFP Expression scores generated (%GFP x MFI), and vector supernatants titrated on adherent HEK293T cells. These data are presented in Figure 11, and show that indeed endogenous miRNA target sequences can be used to rescue inverted transgene LV output titres, albeit to a lower extent than the ribozymes. Whilst the maximal recovery in output titres was observed with the ribozymes alone (i.e. miRNA paired with ribozymes offered no further boost to titres), this demonstrated that other elements of quite different sequence, structure and functional class could be used within the VI-encompassed portion of the inverted 3’UTR to boost titres. Materials and Methods Suspension cell culture, transfection and lentiviral vector production In Example 1, all vector production was carried out in HEK293Ts cell, in 24-well plates (1mL volumes, on a shaking platform).1.65s cells were seeded at 8 x 105 cells per ml in serum- free media and were incubated at 37 °C in 5% CO2, shaking, throughout vector production. Approximately 24 hours after seeding the cells were transfected using the following mass ratios of plasmids per effective final volume of culture at transfection: 0.95 μg/mL Genome, 0.1 μg/mL Gag-Pol, 0.06 μg/mL Rev, 0.07 μg/mL VSV-G, 0.150ug/ml pTK-dsRed, and 54 pmol/mL of siRNA. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM as per manufacturer’s protocol (Life Technologies). Sodium butyrate (Sigma) was added ∼18 hrs later to 10 mM final concentration. Typically, vector supernatant was harvested 20–24 hours later, and then filtered (0.22 μm) and frozen at −80 °C. In all other Examples, where indicated, vector production was carried out in suspension- adapted (serum-free) HEK293T cells. Cells were seeded at 8 x 10⁵ cells per ml in serum-free media and were incubated at 37 °C in 5% CO₂, shaking, throughout vector production. Approximately 24 hours after seeding the cells were transfected using the following mass ratios of plasmids per effective final volume of culture at transfection: 0.95 μg/mL Genome, 0.1 μg/mL Gag-Pol, 0.06 μg/mL Rev (where indicated), 0.07 μg/mL VSV-G. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM as per manufacturer’s protocol (Life Technologies). Sodium butyrate (Sigma) was added ∼18 hrs later to 10 mM final concentration. Typically, vector supernatant was harvested 20–24 hours later, and then filtered (0.22 μm) and frozen at −80 °C. Flow cytometry (production cells) At vector harvest, 200ul of end-of-production cells were assayed for GFP and dsRed expression by flow cytometry using an Attune NxT flow cytometer (Thermo). GFP and dsRed expression was scored by multiplying the median fluorescence intensity by the % of positive cells. Polyacrylamide gel electrophoresis and western blotting 45ul of crude vector was incubated with 15ul of 4X Laemmli buffer (BioRad) containing 25% β-Mercaptoethanol at 100^oC for 5 minutes before being placed on ice. 20ul of sample was subjected to polyacrylamide gel electrophoresis using a 4-20% TGX Pre-cast gel (BioRad) and associated Criterion gel running system. Proteins were blotted onto nitrocellulose membrane using the Turbo Transblot system (BioRad). Membranes were blocked in blocking buffer (25mM Tris, 150mM NaCl, 0.1% v/v Tween 20, 5% w/v milk powder) prior to being probed with primary antibodies to VSVG (Thermo, PA1-30138) and HIV p24 (Abcam, ab9071) according to the manufacturer’s instructions. Detection was performed using Starbright Blue 520 and Starbright Blue 700 fluorescent antibodies (BioRad, 12005870 and 12004158). Visualisation was performed using a ChemiDoc MP imager (BioRad). Cell culture conditions HEK293Ts (HEK293Ts) suspension cells were grown in FreeStyle™ 293 Expression Medium (Gibco) supplemented with 0.1% of Cholesterol Lipid Concentrate (Gibco) and incubated at 37 °C in 5% CO2, in a shaking incubator (25 mm orbit set at 190 RPM). HEK293T adherent cells were maintained in complete media (Dulbecco's Modified Eagle Medium (DMEM) (Sigma) supplemented with 10% heat-inactivated fetal bovine serum (Gibco), 2 mM L-glutamine (Sigma) and 1% non-essential amino acids (NEAA) (Sigma)), at 37 °C in 5% CO2. Total RNA extraction from end-of-production cells and lentiviral vector virions At the time of vector harvest, approximately 1e61.65s cells in 0.5ml Freestyle serum-free media were pelleted by centrifugation at 500g for 3 minutes. Supernatants were removed and filtered through a 0.22um Spin-X filter by centrifugation, and then stored at -80^oC until vector titration and virion RNA extraction. The cell pellet was washed in 0.5ml PBS and cells were pelleted once again by centrifugation. RNA was extracted from fresh cell pellets or 125ul of crude vector filtrate using RNAeasy and QIAamp Viral RNA Mini Kits, respectively, according to the manufacturer’s instructions (Qiagen). Reverse-transcription 500ng of total RNA from cells or 5ul of virion RNA eluate was used as input for reverse transcription. RNA samples were incubated with 1ul EZDNase (Life Technologies) at 37^oC for 2 minutes. 1.1ul of 0.1M DTT were then added per sample, and reactions were left to incubate at 55^oC for a further 5 minutes. DNAse-treated RNA was then subjected to reverse transcription using the Superscript IV first-strand synthesis system (Life Technologies), with OligodT primers being used to primer first-strand synthesis according to the manufacturer’s instructions. Upon completion of reverse-transcription, samples were incubated with 1ul RNAse H (Life Technologies) at 37^oC for 20 minutes. Upon completion, samples were diluted 10-fold using nuclease-free water. Polymerase chain reaction PCR reactions were performed using CloneAmp polymerase (Takara). 1ul of diluted cDNA was used as template. Primers were design to span the HIV packaging sequence through to the GFP open reading frame or through to the wPRE. As an endogenous control for cellular RNA primers targeting human actin cDNA were employed. All primers were used at a final concentration of 200nM, and cycling conditions were as follows: HIV vector genome primers 98^oC 3mins, 30 cycles of (98^oC 10s; 53.9^oC 15s; 72^oC 60s), follows by a final incubation at 72^oC for 5 minutes. Human actin cDNA primers 98^oC 3mins, 30 cycles of (98^oC 10s; 68^oC 15s; 72^oC 30s), follows by a final incubation at 72^oC for 5 minutes. Table 3 – Primers used in this study

Upon completion of reactions, PCR products were visualised by 1% agarose gel electrophoresis. Lentiviral vector titration by integration assay For lentiviral vector titration by integration assay, 0.25mL volumes of 1:10 to 1:50 diluted vector supernatants were used to transduce 4.5e⁴ HEK293T cells at 24-well scale in the presence of 8μg/mL polybrene. Cultures were passaged for 10 days (1:5 splits every 2-3 days) before host DNA was extracted from ~1x10⁶ cell pellets using a QIAextractor (Qiagen) according to manufacturer’s instructions. Duplex quantitative PCR was carried out using a FAM primer/probe set to the HIV packaging signal (ψ) and to RRP1, and vector titres (TU/mL) calculated using the following factors: transduction volume, vector dilution, RRP1-normallised HIV-1 ψ copies detected per reaction.

Claims

CLAIMS 1. A set of nucleic acid sequences for producing a retroviral vector comprising: (i) a nucleic acid sequence encoding the retroviral vector genome, wherein the retroviral vector genome comprises a transgene expression cassette; and (ii) at least one nucleic acid sequence encoding an interfering RNA which is specific for mRNA encoding the transgene.

2. The set of nucleic acid sequences of claim 1, wherein the set of nucleic acid sequences further comprises nucleic acid sequences encoding Gag/pol and env or a functional substitute thereof.

3. The set of nucleic acid sequences of claim 1 or claim 2, wherein the set of nucleic acid sequences further comprises a nucleic acid sequence encoding rev or a functional substitute thereof.

4. The set of nucleic acid sequences of any one of the preceding claims, wherein the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette.

5. The set of nucleic acid sequences of any one of the preceding claims, wherein the transgene expression cassette is in the forward direction with respect to the retroviral vector genome expression cassette.

6. The set of nucleic acid sequences of any one of the preceding claims, wherein the 3’ UTR or the 5’ UTR of the transgene expression cassette comprises at least one target nucleotide sequence.

7. The set of nucleic acid sequences of any one of the preceding claims, wherein the transgene expression cassette is genetically engineered to comprise at least one target nucleotide sequence within the 3’ UTR or 5’ UTR.

8. The set of nucleic acid sequences of claim 6 or claim 7, wherein the interfering RNA is specific for the at least one target nucleotide sequence.

9. The set of nucleic acid sequences of claim 6 or claim 7, wherein the set of nucleic acid sequences comprises multiple nucleic acid sequences encoding a plurality of interfering RNAs specific for multiple target nucleotide sequences.

10. The set of nucleic acid sequences of any one of the preceding claims, wherein the interfering RNA(s) promote cleavage of mRNA encoding the transgene.

11. The set of nucleic acid sequences of any one of the preceding claims, wherein the interfering RNA(s) target mRNA encoding the transgene for cleavage.

12. The set of nucleic acid sequences of any one of the preceding claims, wherein the interfering RNA(s) target mRNA encoding the transgene for cleavage by the RISC.

13. The set of nucleic acid sequences of any one of the preceding claims, wherein the interfering RNA is an siRNA; a sisiRNA; a tsiRNA; a RNA-DNA chimeric duplex; a tkRNA; a Dicer-substrate dsRNA; a shRNA; a tRNA-shRNA; an aiRNA; a miRNA; a pre-miRNA; a pri-miRNA mimic; a pri-miRNA mimic cluster; a transcriptional gene silencing (TGS); and/or combinations thereof.

14. The set of nucleic acid sequences of any one of the preceding claims, wherein the interfering RNA is a siRNA, a shRNA and/or a miRNA.

15. The set of nucleic acid sequences of any one of the preceding claims, wherein the interfering RNA is a miRNA.

16. The set of nucleic acid sequences of any one of claims 13 to 15, wherein the guide strand of the miRNA is fully complementary to the target sequence of the transgene mRNA.

17. The set of nucleic acid sequences of claim 14, wherein the miRNA comprises a passenger strand which comprises at least one mismatch with its complimentary sequence within the RNA genome of the retroviral vector.

18. The set of nucleic acid sequences of any one of the preceding claims, wherein the nucleic acid encoding the retroviral vector genome comprises the nucleic acid sequence encoding the interfering RNA.

19. The set of nucleic acid sequences of any one of the preceding claims, wherein the retroviral vector genome expression cassette further comprises a vector intron.

20. The set of nucleic acid sequences of claim 19, wherein the vector intron comprises the nucleic acid sequence encoding the interfering RNA.

21. The set of nucleic acid sequences of any one of claims 1 to 17, wherein the set of nucleic acid sequences comprises a first nucleic acid sequence encoding the retroviral vector genome and at least a second nucleic acid sequence encoding the interfering RNA.

22. The set of nucleic acid sequences of any one of claims 1 to 17 or 21, wherein the nucleic acid encoding the retroviral vector genome does not comprise the nucleic acid sequence encoding the interfering RNA.

23. The set of nucleic acid sequences of any one of the preceding claims, wherein the retroviral vector genome further comprises a tryptophan RNA-binding attenuation protein (TRAP) binding site.

24. The set of nucleic acid sequences of any one of the preceding claims, wherein the major splice donor site in the retroviral vector genome is inactivated, and optionally wherein the cryptic splice donor site 3’ to the major splice donor site is inactivated.

25. The set of nucleic acid sequences of claim 24, wherein the inactivated major splice donor site has the sequence set forth in SEQ ID NO: 4.

26. The set of nucleic acid sequences of any one of the preceding claims, wherein the set of nucleic acid sequences further comprises a nucleic acid sequence encoding a modified U1 snRNA, wherein the modified U1 snRNA has been modified to bind to a nucleotide sequence within the packaging region of the retroviral vector genome sequence.

27. The set of nucleic acid sequences of any one of the preceding claims, wherein the transgene gives rise to a therapeutic effect.

28. The set of nucleic acid sequences of any one of the preceding claims, wherein the retroviral vector is a lentiviral vector, preferably wherein the lentiviral vector is derived from HIV-1, HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus.

29. The set of nucleic acid sequences of claim 28, wherein the lentiviral vector genome comprises at least one modified viral cis-acting sequence, wherein at least one internal open reading frame (ORF) in the viral cis-acting sequence is disrupted.

30. The set of nucleic acid sequences of claim 29, wherein the at least one viral cis-acting sequence is: (a) a Rev response element (RRE); and/or (b) a Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE).

31. The set of nucleic acid sequences of any one of claims 28 to 30, wherein the lentiviral vector genome expression cassette comprises a modified nucleotide sequence encoding gag, and wherein at least one internal open reading frame (ORF) in the modified nucleotide sequence encoding gag is disrupted.

32. The set of nucleic acid sequences of any one of claims 29 to 31, wherein the at least one internal ORF is disrupted by mutating at least one ATG sequence.

33. The set of nucleic acid sequences according to any one of claims 30 to 32, wherein: (a) the modified RRE comprises less than eight ATG sequences; and/or (b) the modified WPRE comprises less than seven ATG sequences.

34. The set of nucleic acid sequences of claim 31, wherein the first ATG sequence within the nucleotide sequence encoding gag is mutated.

35. The set of nucleic acid sequences of any one of claims 28 to 34, wherein the lentiviral vector genome expression cassette lacks (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17, preferably wherein the fragment of a nucleotide sequence encoding Gag-p17 comprises a nucleotide sequence encoding p17 instability element.

36. The set of nucleic acid sequences of any one of claims 28 to 35, wherein the nucleotide sequence comprising a lentiviral vector genome expression cassette does not express Gag-p17 or a fragment thereof, preferably wherein said fragment of Gag-p17 comprises the p17 instability element.

37. A retroviral vector production system comprising the set of nucleic acid sequences of any one of the preceding claims.

38. A retroviral vector production system comprising a viral vector production cell, wherein the viral vector production cell comprises the set of nucleic acid sequences of any one of claims 1 to 36.

39. An expression cassette encoding a retroviral vector genome comprising: (i) a transgene expression cassette; and (ii) a vector intron comprising at least one interfering RNA as defined in any one of claims 1 to 36.

40. The expression cassette of claim 39, wherein the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette.

41. A nucleotide sequence comprising the expression cassette of claim 39 or claim 40.

42. A retroviral vector genome comprising a transgene expression cassette and a vector intron, optionally wherein the transgene expression cassette is inverted with respect to the retroviral vector genome expression cassette, and wherein the vector intron comprises at least one interfering RNA as defined in any one of claims 1 to 36.

43. A cell comprising the set of nucleic acid sequences of any one of claims 1 to 36, the retroviral vector production system of claim 37, the expression cassette of claim 39 or claim 40, the nucleotide sequence of claim 41 or the retroviral vector genome of claim 42.

44. A cell for producing retroviral vectors comprising: a) the set of nucleic acid sequences of any one of claims 1 to 36, the retroviral vector production system of claim 37, the expression cassette of claim 39 or claim 40, the nucleotide sequence of claim 41 or the retroviral vector genome of claim 42; and b) optionally, a nucleic acid sequence encoding a modified U1 snRNA and/or a nucleic acid sequence encoding TRAP.

45. A method for producing a retroviral vector, comprising the steps of: (i) introducing: a) the set of nucleic acid sequences of any one of claims 1 to 36, the retroviral vector production system of claim 37, the expression cassette of claim 39 or claim 40, the nucleotide sequence of claim 41 or the retroviral vector genome of claim 42; and b) optionally, a nucleic acid sequence encoding a modified U1 snRNA and/or a nucleic acid sequence encoding TRAP into a cell; (ii) optionally, selecting for a cell which comprises the nucleic acid sequences encoding vector components; and (iii) culturing the cell under conditions suitable for the production of the retroviral vector.

46. A method for producing a retroviral vector, comprising the step of culturing the cell of claim 43 or claim 44 under conditions suitable for the production of the retroviral vector.

47. A retroviral vector produced by the method of claim 45 or claim 46.

48. Use of the set of nucleic acid sequences of any one of claims 1 to 36, the retroviral vector production system of claim 37 or claim 38, the expression cassette of claim 39 or claim 40, the nucleotide sequence of claim 41, the retroviral vector genome of claim 42, or the cell of claim 43 or claim 44 for producing a retroviral vector.

49. Use of at least one nucleic acid sequence encoding an interfering RNA as defined in any one of claims 1-36 for repressing expression of a transgene and/or increasing retroviral vector titre during retroviral vector production.