WO2023062363A1

WO2023062363A1 - Lentiviral vectors

Info

Publication number: WO2023062363A1
Application number: PCT/GB2022/052582
Authority: WO
Inventors: Daniel Farley; Jordan Wright
Original assignee: Oxford Biomedica (Uk) Limited
Priority date: 2021-10-12
Filing date: 2022-10-12
Publication date: 2023-04-20
Also published as: GB202114528D0

Abstract

The invention relates to production of lentiviral vectors. More specifically, the present invention relates to nucleotide sequences comprising a lentiviral genome expression cassette. The expression cassette comprises a rev/RRE-independent lentiviral vector genome which comprises an intron. Methods and uses of such nucleotide sequences are also encompassed by the invention.

Description

LENTIVIRAL VECTORS

FIELD OF THE INVENTION

The invention relates to production of lentiviral vectors. More specifically, the present invention relates to nucleotide sequences comprising a lentiviral genome expression cassette. The expression cassette comprises a rev/RRE-independent lentiviral vector genome which comprises an intron (a “vector intron” or “VI”). Methods and uses of such nucleotide sequences are also encompassed by the invention.

BACKGROUND TO THE INVENTION

The development and manufacture of viral vectors towards vaccines and human gene therapy over the last several decades is well documented in scientific journals and in patents. The use of engineered viruses to deliver transgenes for therapeutic effect is wide-ranging. Contemporary gene therapy vectors based on RNA viruses such as y-retrovi ruses and lentiviruses (Muhlebach, M.D. et al., 2010, Retroviruses: Molecular Biology, Genomics and Pathogenesis, 13:347-370; Antoniou, M.N., Skipper, K.A. & Anakok, O., 2013, Hum. Gene Ther, 24:363-374), and DNA viruses such as adenovirus (Capasso, C. et al., 2014, Viruses, 6:832-855) and adeno-associated virus (AAV) (Kotterman, M.A. & Schaffer, D.V., 2014, Nat. Rev. Genet., 15:445-451) have shown promise in a growing number of human disease indications. These include ex vivo modification of patient cells for hematological conditions (Morgan, R.A. & Kakarla, S., 2014, Cancer J., 20:145-150; Touzot, F. et al., 2014, Expert Opin. Biol. Ther, 14:789-798), and in vivo treatment of ophthalmic (Balaggan, K.S. & Ali, R.R., 2012, Gene Ther, 19:145-153), cardiovascular (Katz, M.G. et al., 2013, Hum. Gene Ther, 24:914-927), neurodegenerative diseases (Coune, P.G., Schneider, B.L. & Aebischer, P., 2012, Cold Spring Harb. Perspect. Med., 4:a009431) and tumor therapy (Pazarentzos, E. & Mazarakis, N.D., 2014, Adv. Exp. Med Biol., 818:255-280).

However, as both the size of the transgenes used for therapeutic effect increases and as the desire to deliver more functionality to the genetic payload, e.g. beyond a single gene, within vector genomes increases, so too does the need for increased capacity of the viral vectors. The current ‘limits’ of lentiviral vector capacity have not changed significantly over the last 20 years, and remain in the region of ~7kb of transgene space when employing standard genome c/s-acting sequences such as the typical packaging sequence, rev-response element (RRE) and post-transcriptional regulatory elements (PREs), such as that from the woodchuck hepatitis virus (wPRE). Limits on vector capacity are, in part, determined by the size of the wild type HIV-1 genomes from which the vector systems are derived, which are ~9.5kb. Generally, the specific titres of lentiviral vectors diminish substantially in proportion to their payload size over-and-above the current size ‘limit’. Several aspects of lentiviral vectorology are likely to contribute to the limit: [1] the steady-state pool of vector genomic RNA (vRNA) in the production cell, [2] the efficiency of conversion of vRNA to dsDNA by reverse transcriptase, and [3] the efficiency of nuclear import and/or integration into host DNA.

Thus, there is a desire to decrease or minimize the ‘backbone’ sequences of lentiviral vectors such that titres of vectors containing larger payloads can be maintained or increased. Such vectors with increased payload capacity should improve the utility of a gene therapy product and the likelihood that such a product is commercially viable. Therefore, there is an ongoing need in the art to increase the capacity of the viral vectors, i.e. the size of the transgene (or payload) that the viral vector can deliver, whilst maintaining suitable titre and safety profiles.

SUMMARY OF THE INVENTION

The present invention is based on the concept of introducing an intron into the vector genome expression cassette in order to enable reduction of the viral backbone sequence. In this regard, the inventors have surprisingly found that introduction of such an intron facilitates removal of the rev-response element (RRE), which allows for more transgene capacity in the vector.

As the resulting vector genomic RNA (vRNA) packaged into vector virions does not contain the intronic sequence, this so-called ‘Vector-Intron’ (VI) is not counted against available ‘space’ on the vRNA. Thus, more space is available for transgene sequences. This new lentivirus (LV) genome configuration is simple to employ, surprisingly does not require rev or an exogenous vRNA-export factor, and may be a more attractive option in moving away from current LV genomes, since most other aspects of LV genome biology remains the same. Additionally, VI may be of further benefit as it is expected that, since the VI is not present in the final integrated LV genome, the potential for mobilisation of vRNA will be reduced compared to RRE-containing LVs, thereby improving the safety profile of the vector.

As described herein, another aspect of the invention is the functional ablation of the major splice donor (MSD) site within the packaging sequence, and preferably at least one cryptic splice donor site nearby. The major splice donor site (MSD) present within lentiviral vector genomes is typically embedded within the packaging region containing highly structured RNA towards the 5’ region of the RNA.

Splice donor sites within retrovirus genomes are important for viral RNA (vRNA) stability within the production cell. The present inventors have previously shown that the activity of the MSD within lentiviral vector genome expression cassettes can be highly promiscuous, and can very efficiently splice to strong or even weak cryptic splice acceptor sites within the internal expression cassette that are typically located >1350bp downstream (WO 2021/160993). Surprisingly, as much as 95% of the detectable cytoplasmic mRNA derived from the external promoter driving vRNA production is spliced depending on internal sequences.

For efficient vector production, unspliced packageable vRNA is the most desirable product. This vector component is typically the limiting factor both in transient and stable transfection vector production settings. Moreover, if such aberrantly spliced mRNA encodes for the transgene of interest (for example splicing into the internal promoter-UTR sequence), the mRNA will be exported and will be capable of being efficiently translated during vector production; this will occur independently of whether the internal promoter is a weak/silent (tissue specific) promoter.

The presence of the MSD in the vector backbone delivered in transduced (patient) cells has been shown by others to be utilised by the splicing machinery, when read-through transcription from upstream cellular promoters occurs (lentiviral vectors target active transcription sites), leading to potential aberrant splice-products with cellular exons. Therefore, there are several reasons why it is desirable to functionally mutate the MSD site from lentiviral vector genomes.

Others have generated early generation lentiviral vectors harbouring mutations within the MSD site but these vectors contained the inherent U3 promoter to drive transcription of the vRNA, and were therefore dependent on transactivation by tat, supplied in trans. Third generation lentiviral vectors replaced the U3 promoter with heterologous promoter elements, and do not require tat for transcription. The U3/tat-independence of 3^rd generation vectors is seen as an important advance in safety by regulators because tat is a transactivator of cellular genes and can play a role in oncogenesis.

The Inventors have previously shown (see WO 2021/160993) that the MSD and cryptic splice donor (crSD) in stem loop 2 (SL2) of the HIV-1 packaging sequence can be extremely promiscuous, leading to aberrant splicing into transgene sequences and resulting in reduction in production of full length vRNA. Functional ablation of the MSD and crSD appeared to ablate most of this aberrant splicing.

The same functional ablation of this aberrant splicing may be employed in the present invention in order to avoid unwanted spliced products (e.g. MSD to the VI splice acceptor). Moreover, it is surprisingly found that the ability of the VI to impart full RRE-independence of LV genomes is improved by the MSD mutation.

It has been found previously that potential titre losses associated with such mutations can be recovered by supplying a modified U1 snRNA that targets the packaging sequence of the vRNA (WO 2021/160993). Surprisingly, the present inventors also show that the VI is sufficient to recover LV titres without the need to employ the modified U1 snRNA. Therefore, the invention also encompasses use of the VI to increase titres of MSD-mutated LVs. Surprisingly, therefore, it appears that the VI feature and MSD/crSD mutations are functionally symbiotic in generating RRE-deleted LVs. Moreover, the previous finding that MSD-mutated LVs are less prone to transcriptional read-in from cellular gene transcription at the sites of integration is likely to be synergized with the reduced ability for mobilization of VI LV sequences as a consequence of the VI not being present in the final integrated cassette.

The invention is further described below.

In one aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron. In some embodiments, the vector intron comprises one or more transgene mRNA selfdestabilization element(s), transgene mRNA self-decay element(s) or transgene mRNA nuclear retention signal(s).

In some preferred embodiments, the vector intron comprises one or more transgene mRNA self-destabilization or self-decay element(s).

In some embodiments, the lenitiviral vector genome expression cassette comprises codon- optimised sequences encoding Gag/Pol.

In some embodiments, the cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette is inactivated.

In some embodiments, when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette: a) the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and/or b) the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT; and/or c) the 3’ UTR of the transgene expression cassette comprises the vector intron.

In some embodiments, the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and: a) the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and/or b) the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT; and/or c) the 3’ UTR of the transgene expression cassette comprises the vector intron.

Accordingly, in an aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) a) When the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette: i. the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and/or ii. the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequence CAGACA, and/or GTGGAGACT; and/or iii. the 3’ UTR of the transgene expression cassette comprises the vector intron; and/or b) the vector intron comprises one or more transgene mRNA self-destabilization element(s), transgene mRNA self-decay element(s) or transgene mRNA nuclear retention signal(s); and/or c) the cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette is inactivated.

In some embodiments, the 3’ UTR of the transgene expression cassette comprises the vector intron encoded in antisense with respect to the transgene expression cassette.

In an aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the vector intron is not located between the promoter of the transgene expression cassette and the transgene.

In another aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lenti viral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

In another aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; and iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron, and iv) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the 3’ UTR of the transgene expression cassette comprises the vector intron.

In another aspect, the the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: a) the major splice donor site and cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette are inactivated; b) the lentiviral vector genome expression cassette does not comprise a rev-response element; c) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron.

In some aspects, the vector intron according to the invention is a synthetic vector intron.

In some aspects, the vector intron according to the invention is a synthetic vector intron, wherein said synthetic intron comprises the HIV-1 GAR splicing element. In some aspects, the vector intron according to the invention comprises a splice donor sequence, wherein said splice donor sequence comprises from 7 to 11 nucleotides which are complementary to a portion of the U1 snRNA sequence.

In some aspects, the vector intron according to the invention is a synthetic vector intron, wherein said synthetic intron comprises the HIV-1 guanosine-adenosine rich splicing element upstream of the splice donor sequence.

In some embodiments, the vector intron comprises one or more transgene mRNA selfdestabilizing element(s), transgene mRNA self-decay element(s) or transgene mRNA nuclear retention signal(s).

In some embodiments, the vector intron comprises a transgene mRNA self-destabilizing or self-decay element.

The vector intron according to the invention, in at least one aspect, comprises a transgene mRNA self-destabilizing or self-decay element encoded in the antisense orientation with respect to the lentiviral vector genome expression cassette.

In one aspect, the vector intron is a synthetic intron comprising the branch site and splice acceptor of the human beta-globin intron-2.

In some embodiments, the vector intron comprises a transgene mRNA self-destabilizing or self-decay element, wherein said transgene mRNA self-destabilization or self-decay element comprises at least one of the following: a) a self-cleaving ribozyme; b) an All-rich element; and/or c) an interfering RNA, preferably a miRNA or shRNA which targets the inverted transgene mRNA.

The vector intron according to the invention, in at least one aspect, comprises a transgene mRNA self-destabilizing or self-decay element encoded in the antisense orientation with respect to the lentiviral vector genome expression cassette, wherein said transgene mRNA self-destabilization or self-decay element comprises at least one of the following:

(a) a self-cleaving ribozyme

(b) an All-rich element; and/or (c) an interfering RNA, preferably a miRNA or shRNA which targets mRNA encoding the transgene.

In one aspect, the vector intron is not located between the promoter of the transgene expression cassette and the transgene.

In one aspect, the nucleotide sequence of the lentiviral vector genome expression cassette of the invention comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

In one aspect, when the transgene expression cassette is in the forward orientation with respect to the lentiviral vector genome expression cassette, the vector intron is located 5’ of the transgene or the transgene expression cassette.

In another aspect the invention provides an expression cassette, wherein the transgene is inverted with respect to the vector genome expression cassette i.e. the internal transgene promoter and gene sequences oppose the vector genome cassette promoter. Such inverted transgene expression cassettes are able to retain an intron within the transgene cassette, in contrast to non-inverted cassettes (i.e. on the ‘top’ strand), wherein the transgene cassette would be spliced out together with the VI. Furthermore, the inverted transgene expression cassettes of the invention make use of the VI to reduce transgene mRNA expression, since an mRNA destabilizing or decay c/s-element can be inserted within the 3’ UTR of the inverted transgene cassette, such that it is also encompassed by the VI on the top strand. Thus, transgene mRNA is destabilized and/or degraded within vector production cells, but upon splicing-out of the VI, the c/s-element(s) is also be removed from the packaged vRNA such that the transgene mRNA will lack such c/s-element(s) in transduced cells.

Hence, the vector intron can be inverted or non-inverted with respect to the lentiviral vector genome cassette.

In one aspect the transgene expression cassette is inverted with respect to the lentiviral vector genome cassette.

In one aspect the transgene expression cassette is not inverted with respect to the lentiviral vector genome cassette, i.e. the transgene expression cassette is in the same orientation as the lentiviral vector genome cassette. Thus, in one aspect, the transgene expression cassette is encoded in the sense orientation. In one aspect the transgene expression cassette is inverted with respect to the lentiviral vector genome cassette and the vector intron is not located between the promoter of the transgene expression cassette and the transgene.

In one aspect the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

In one aspect the transgene expression cassette is inverted with respect to the lentiviral vector genome cassette and the 3’ UTR of the transgene expression cassette comprises the vector intron. Therefore, in one aspect, the vector intron is in the antisense orientation with respect to the lentiviral vector genome expression cassette.

A further preferred but optional feature of the invention is the minimization of gag sequences included within the packaging sequences used in combination with the aforementioned features. The amount of gag typically included within HIV-1 lentiviral vector packaging sequences can be reduced by at least 270 nucleotides, but may be reduced by up to the entire gag sequence. The deleted gag nucleotide sequence may be that of the gag-p17 instability sequence. Deletion of the gag-p17 instability sequence typically results in reduced vector titers unless, the first ATG codon of the remaining gag sequence is mutated.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 80 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 70 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 60 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 50 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 40 nucleotides of gag remain. In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 30 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 20 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein only the first 10 nucleotides of gag remain.

In some aspects the reduced packaging sequences comprise deleted gag sequences wherein no nucleotides of gag remain.

In some aspects, nucleotide sequences of the invention comprise ablated gag sequences wherein the gag sequences comprise only up to the first 10, up to the first 20, up to the first 30, up to the first 40, up to the first 50, up to the first 60, up to the first 70, or up to the first 80 nucleotides of gag.

Accordingly, in at least some aspects, the first (i.e. the 5’) ATG sequence within the gag nucleotide sequence of the lentiviral vector is mutated. Mutation of the 5’ ATG of the gag nucleotide sequence reduces losses in vector titre that are associated with deletions of the gag sequence.

In one aspect, the nucleotide sequence of the lentiviral vector genome expression cassette comprises a modified nucleotide sequence encoding gag, wherein at least one internal open reading frame (ORF) in the modified nucleotide sequence encoding gag is disrupted.

In some embodiments, the lentiviral vector genome expression cassette comprises at least one modified viral c/s-acting sequence, wherein at least one internal open reading frame (ORF) in the viral c/s-acting sequence is disrupted.

In some embodiments, the at least one viral c/s-acting sequence is a Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE).

In one aspect, the at least one internal ORF is disrupted by mutating at least one ATG sequence within the nucleotide sequence encoding gag and/or within the viral c/s-acting sequence. In one aspect, the at least one ATG sequence that is mutated is the first ATG sequence.

In one aspect, the at least one ATG sequence that is mutated is the 5’ ATG sequence.

In one aspect, the nucleotide sequence of the lentiviral vector genome expression cassette lacks (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17.

In one aspect, the nucleotide sequence of the lentiviral vector genome expression cassette lacks a fragment of a nucleotide sequence encoding Gag-p17, wherein the fragment of a nucleotide sequence encoding Gag-p17 comprises a nucleotide sequence encoding the p17 instability element.

In one aspect, the nucleotide sequence of the lentiviral vector genome expression cassette does not express Gag-p17 or a fragment thereof.

In one aspect, the nucleotide sequence of the lentiviral vector genome expression cassette does not express Gag-p17 ora fragment thereof, wherein said fragment of Gag-p17 comprises the p17 instability element.

In one aspect the nucleotide sequence according to the invention is for use in a U3 or tat- independent lentiviral vector system. In one aspect the lentiviral vector system may be a 3^rd generation lentiviral vector system as described herein.

As referred to herein, the cryptic splice donor site is the first cryptic splice donor site or sequence 3’ to the major splice donor site. In one aspect the cryptic splice donor site or sequence is within 6 nucleotides of the major splice donor site. The major splice donor site and cryptic splice donor site may be mutated or deleted.

In an aspect, the invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site and cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette are inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron.

In one aspect, the nucleotide sequence prior to inactivation of the splice sites comprises a sequence as set forth in any of SEQ ID NOs: 1 , and/or 5, and/or the sequences TG/GTRAGT, /GTGA/GTA, TGAGT, and/or CTGGT. The nucleotide sequence may comprise a sequence with a mutation or deletion relative to the sequence as set forth in any of SEQ ID NOs: 1 , and/or 5, and/or the sequence TG/GTRAGT, /GTGA/GTA, TGAGT, and/or CTGGT. In one aspect the sequence comprises /GTGA/GTA.

In one aspect the inactivated major splice donor site would otherwise have a cleavage site immediately upstream of nucleotide 1 of the major splice donor region (/GTGA/GTA).

In one aspect the inactivated major splice donor site and inactivated cryptic splice donor site would otherwise have a cleavage site immediately upstream of nucleotide 1 , as well as between nucleotides 4 and 5 corresponding to nucleotides of the major splice donor region (/GTGA/GTA).

In one aspect the inactivated major splice donor site would otherwise have a cleavage site between nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO: 1.

In another aspect the nucleotide sequence of the major splice donor site prior to inactivation comprises the sequence CTGGT. In one aspect the cryptic splice donor site prior to inactivation comprises the sequence TGAGT.

In some embodiments, the inactivated cryptic splice donor site would otherwise have a cleavage site between nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO: 1.

In one aspect the nucleotide sequence according to the invention comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7 and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

In a preferred aspect the nucleotide sequence comprises a sequence as set forth in SEQ ID NO: 8.

In a further aspect the nucleotide sequence does not comprise a sequence as set forth in SEQ ID NO: 5. Splicing activity from the major splice donor site and cryptic splice donor site of the RNA genome of the lentiviral vector may be suppressed or ablated, for example in transfected cells or in transduced cells.

In one aspect nucleotide sequence may be suitable for use in a lentiviral vector in a U3 or tat- independent system for vector production. As described herein, 3^rd generation lentiviral vectors are U3/tat-independent, and the nucleotide sequences according to the present invention may be used in the context of a 3^rd generation lentiviral vector. In one aspect of the invention tat is not provided in the lentiviral vector production system, for example tat is not provided in trans. In one aspect the cell or vector or vector production system as described herein does not comprise the tat protein. In one aspect of the invention HIV-1 U3 is not present in the lentiviral vector production system, for example HIV-1 U3 is not provided in cis to drive transcription of vector genome expression cassette.

In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence is for use in a tat-independent lentiviral vector.

In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence is produced in the absence of tat.

In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence has been transcribed independently of tat.

In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence is for use in a U3-independent lentiviral vector.

In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence has been transcribed independently of the U3 promoter. In one aspect the major splice donor site in the RNA genome of the lentiviral vector is inactivated and the cryptic splice donor site 3’ to the major splice donor site is inactivated, and said nucleotide sequence has been transcribed by a heterologous promoter.

In one aspect, transcription of the nucleotide sequence as described herein is not dependent on the presence of U3. The nucleotide sequence may be derived from a U3-independent transcription event. The nucleotide sequence may be derived from a heterologous promoter. A nucleotide sequence as described herein may not comprise a native U3 promoter.

In one aspect, the nucleotide sequence as described herein may optionally further comprise a mutation in a cryptic splice donor site within the SL4 loop of the packaging sequence. In one aspect a GT dinucleotide in said cryptic splice donor site within the SL4 loop of the packaging sequence is mutated to GC.

In one aspect the transgene gives rise to a therapeutic effect.

In another aspect the nucleotide sequence further comprises a tryptophan RNA-binding attenuation protein (TRAP) binding site, and also may comprise a Kozak sequence, wherein said TRAP binding site overlaps the Kozak sequence, or wherein said Kozak sequence comprises a portion of a TRAP binding site. The nucleotide sequence may also further comprise a multiple cloning site and a Kozak sequence, wherein said multiple cloning site is overlapping with or located downstream to the 3’ KAGN2-3 repeat of the TRAP binding site and upstream of the Kozak sequence. The nucleotide of interest (i.e. transgene) may be operably linked to the TRAP binding site or the portion thereof.

In one aspect the nucleotide sequence further comprises a tryptophan RNA-binding attenuation protein (TRAP) binding site, wherein the TRAP binding site overlaps with the transgene start codon ATG.

Any disclosures herein relating to a Kozak sequence/overlapping Kozak sequence are equally applicable (where appropriate) to equivalent aspects referring to the ATG of the start codon and overlap therewith.

In another aspect, the nucleotide sequence further comprises a Kozak sequence, wherein said Kozak sequence comprises a portion of a tryptophan RNA-binding attenuation protein (TRAP) binding site. In one aspect the nucleotide sequence further comprises a TRAP binding site, wherein the TRAP binding site comprises a portion of the transgene start codon ATG or vice versa.

The invention also provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein the lentiviral vector genome expression cassette comprises:

(a) a transgene expression cassette which is inverted with respect to the lentiviral vector genome expression cassette; and

(b) a vector intron comprising a nucleotide expression cassette encoding a miRNA; wherein the miRNA targets mRNA encoding the transgene. The guide strand of the miRNA may be fully complementary to the mRNA encoding the transgene (i.e. fully complementary to the mRNA transcript of the transgene).

In some embodiments, the nucleotide sequence is for use in a lentiviral vector production cell.

In some embodiments, the miRNA does not target the vector genome RNA. The passenger strand of the miRNA may therefore comprise at least one mismatch with any potential target sequences within the vector genome RNA. Thus, in some embodiments, the passenger strand of the miRNA comprises at least one mismatch with its target sequence in the vector genome RNA.

The invention also provides a viral vector production system comprising a set of nucleotide sequences, wherein the nucleotide sequences encode vector components including gag-pol, env, and the nucleotide sequence of the invention.

In some embodiments, the viral vector production system does not comprise a nucleotide sequence encoding rev.

In one aspect the invention also provides a cell comprising the nucleotide sequence of the invention or the viral vector production system as defined herein.

In a further aspect, the invention provides a cell for producing lentiviral vectors comprising:

(i) a) nucleotide sequences encoding gag-pol and env, and and the nucleotide sequence of the invention; or b) the viral vector production system defined herein; and (ii) optionally, a nucleotide sequence encoding TRAP.

In one aspect, the cell does not comprise a nucleotide sequence encoding rev.

In the cell the splicing activity from the major splice donor site and/or splice donor region of the RNA genome of the lentiviral vector may be suppressed or ablated, for example during lentiviral vector production. In one aspect translation of the nucleotide of interest is repressed during lentiviral vector production.

The invention also provides a method for producing a lentiviral vector, comprising the steps of:

(i) introducing: a) i. nucleotide sequences gag-pol and env, andthe nucleotide sequence of the invention; or ii. the viral vector production system of the invention; and b) optionally, a nucleotide sequence encoding TRAP into a cell;

(ii) optionally, selecting for a cell which comprises the nucleotide sequences encoding gag-pol and env and the nucleotide sequence of the invention; and

(iii) culturing the cell under conditions suitable for the production of the lentiviral vector.

In one aspect, the cell does not comprise a nucleotide sequence encoding rev.

In a further aspect, the invention also provides a lentiviral vector produced by any of the methods as described herein. The lentiviral vector may comprise a splice junction sequence. The splice junction sequence may be as set forth in SEQ ID NO: 19.

In one aspect the invention provides use of the nucleotide sequence as defined herein, the viral vector production system as defined herein, or the cell as defined herein for producing a lentiviral vector. DESCRIPTION OF THE FIGURES

Figure 1 : A schematic comparing DNA expression cassettes for standard and Vector- Intron containing LV genomes and the mRNAs transcribed therefrom.

The general structure of typical standard 3^rd generation LV genomes is shown, containing: a U3-deleted, tat-independent heterologous promoter driving transcription (Pro), the broad packaging sequence from R-U5 to the gag region, the RRE, the central polypurine tract (cppt), an internal transgene expression cassette (Pro-GOI), a post-transcriptional regulatory element (PRE) and a self-inactivating 3’LTR. The SL1 loop of the broad packaging sequence contains the MSD and adjacent crDS. The core packaging motif (^P) is within SL3. The amount of retained gag sequence can vary but is typically between -340 and -690 nts from the primary ATG codon of gag, and includes the p17 instability element (p17-INS). The RRE is typically in the region of 780bp, and includes the splice acceptor 7’ site (sa7) from HIV-1. For standard LV genome cassettes, apart from the main transgene mRNA (assuming the internal promoter is active in production cells), the primary transcript produced and exported to steady-state levels in the cytoplasm by rev was thought to be the full length vRNA. However, the inventors have shown elsewhere that promiscuous or aberrant splicing from the MSD or the crSD in the SL2 loop occurs to (cryptic) splice acceptors downstream of sa7 even in the presence of rev. The amount of spliced product compared to full length vRNA can be 20: 1 , especially when the transgene cassette contains a strong splice acceptor such as the one present in the EF1a promoter. The novel LV genome of the present invention replaces the RRE entirely with a single intron in order to increase transgene payload, since the intronic sequence will be absent from the full length vRNA. The MSD/crSD mutation ensures that no aberrant splicing from SL2 can occur with the VI splice acceptor. Surprisingly, not only does the act of splicing out of the VI allow vRNA to be stabilized in a rev/RRE-independent manner, it also abrogates the attenuating effect of MSD/crSD mutation on LV titres. Further, it is shown that RRE-deleted VI genomes achieve greatest titres in a rev-independent manner when the MSD/crSD is mutated. The novel LV genome may also incorporate a deletion of the p17-INS, therefore also increasing transgene capacity by a total of ~1 kb.

Figure 2: Rev/RRE-independent HIV-1 based LVs containing a Vector-Intron are improved by mutation of the major splice donor and cryptic splice donor sites in SL2 of the packaging signal.

HIV-1 based LV genomes (with an internal CMV-GFP cassette) were generated containing various combinations of either standard or mutated/deleted c/s-acting elements (STD-MSD or MSD-2KO, ±RRE, ± Vector- Intron; see Figure 1). These genome plasmids were used to produce LV-CMV-GFP vectors in either adherent (A) or suspension [serum-free] (B) HEK293T cells in the presence or absence of a rev-expression plasmid. Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and vector titres plotted on a Iog10 scale.

Figure 3: Analysis of vector cassette-derived RNA in adherent production cells and in resulting vector particles for variant genomes containing a Vector-Intron in combination with other c/s-elements/mutations.

Total extracted RNA from production cells and vector particles from the adherent cell production run of Vector-Intron (Vl_v1.1) genomes described for Figure 2A was subjected to RT-PCR to assess the species produced by each genome variant (panel B). The DNA, pre- RNA and main splicing products for these four Vector-Intron genome variants is shown schematically in panel A. The splicing of the Vector-Intron is denoted as well as the potential aberrant splicing of the MSD to the VI splice acceptor. The optional presence of the RRE is also denoted, as well as the positions of the PCR primers (grey arrows) used for the RT-PCR analysis (oligo-dT primer was used for the cDNA step).

Figure 4: A schematic showing the core features of exon-inton-exon sequences important for splicing.

The schematic shows a representative single intron (grey block) between two exons (black blocks), indicating the position of key consensus sequences required for splicing-out of the intron, as well as the position of enhancers. The termini of the intron are defined by GT-AG dinucleotides at the 5’ and 3’ ends respectively. The GT dinucleotide is the least variable sequence of the broader splice donor consensus sequence; the consensus sequence is the target of U1 snRNA, which anneals to the donor site early on during exon/intron boundary recognition. The AG dinucleotide is the least variable sequence of the broader splice acceptor consensus sequence, which typically comprises a polypurine tract of ~12-to-20 nts upstream. The Branch site (consensus = TNCTRAC, wherein “N” means any nucleotide and “R” means A or G) is located 20-to-35 nts upstream of the spliced acceptor site and is the target of U2 snRNA, which anneals to the branch site during the splicing reaction. The Branch site is also the anchor point for the linkage of the 5’ end of the intron to form the lariat structure. The length of the intron can be short or many thousands of nucleotides, and may contain other c/s-acting elements, with some partaking in enhancing or regulating splicing efficiency. Intronic splicing enhancers (ISEs) may be located closer to the ends of the intron so as to be in close proximity to the core elements described above. Exonic splicing enhancers (ESEs) may also be located close to the exon-intron junction in order to mediate effects. In the present invention, a number of these functional elements from different organisms were evaluated towards the optimization of the Vector-Intron approach.

Figure 5: Assessment of initial Vector-Intron variants in HIV-1 based LVs in adherent HEK293T production cells.

Genome plasmids harbouring an EFS-GFP transgene cassette but lacking the RRE were constructed to contain the MSD-2KO mutations and six variant Vector-Introns, as per Table 1. These were based on native introns from the EF1a or Ubiquitin (UBC) promoter-introns, or the CAG promoter- intron or the small chimeric intron (Syn) from the pCI series of expression plasmids by Promega. These genome plasmids were used to produce LV-EFS-GFP vectors in adherent HEK293T cells in the absence of a rev-expression plasmid, whereas a standard LV vector was made +/- rev. Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and vector titres plotted on a Iog10 scale.

Figure 6. Further development of Vector-Intron variants based on a chimeric intron in HIV-1 based LVs in suspension (serum-free) HEK293T production cells.

Genome plasmids harbouring an EFS-GFP transgene cassette but lacking the RRE were constructed to contain the MSD-2KO mutations and seven variant Vector- Introns VI_v4.2-4.8, as per Table 1. These were based on the small chimeric intron from the pCI series of expression plasmids by Promega but varied mainly in the presence/type of upstream ESE and/or splice donor sequence. These genome plasmids were used to produce LV-EFS-GFP vectors in suspension (serum-free) HEK293T cells in the absence of a rev-expression plasmid, whereas a standard LV vector was made +/- rev. Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and vector titres plotted on a Iog10 scale.

Figure 7. Further development of Vector-Intron variants based on the human p-globin intron-2 in HIV-1 based LVs in suspension (serum-free) HEK293T production cells.

Genome plasmids harbouring an EFS-GFP transgene cassette but lacking the RRE were constructed to contain the MSD-2KO mutations and two Vector-Introns Vl_v5.1/5.2 based on the second (truncated) intron of the human p-globin gene, as per Table 1. These were compared to two of the previous Vector-Intron variants based on the chimeric intron from the pCI series of Promega plasmids (VI_4.2/4.8). These genome plasmids were used to produce LV-EFS-GFP vectors in suspension (serum-free) HEK293T cells in the presence/absence of a rev-expression plasmid, whereas a standard LV vector was made +rev. Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and vector titres plotted on a log 10 scale.

Figure 8. Testing of LV genomes with Vector-Introns in combination with different MSD-mutations and p17-INS(gag) deletion.

Vector-Intron variants from two series (v4 [pCI] and v5 [hu p-Globin]) were tested in LV genomes in the context of two different MSD-mutation variants (‘MSD-2KO’ and ‘MSD- 2KOm5’), and additionally with the p17-INS deleted from the gag region of the packaging sequence. These genome plasmids were used to produce LV-EFS-GFP vectors in suspension (serum-free) HEK293T cells in the absence of a rev-expression plasmid, whereas a standard LV vector was made +/-rev. Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and titres normalized to the Standard LV-GFP vector prep made with rev.

Figure 9. Evaluation of titre increase by Prostratin on Vector-Intron LV genomes.

Standard or Vector-lntron/MSD-2KO/ARREAp17-INS genome plasmids were used to produce LV-EFS-GFP vectors in suspension (serum-free) HEK293T cells in the absence of a rev- expression plasmid, whereas a standard LV vector was made +/- rev. Vectors were made in the presence or absence of 11 pM Prostratin ~20 hours post-transfection (at sodium butyrate induction step). Clarified vector supernatants were titrated on adherent HEK293T cells using flow cytometry, and vector titres plotted on a linear scale.

Figure 10. Rev-independent production of Vector-Intron LVs containing different transgene promoters.

HIV-1 based LVs containing CMV/EFS driven transgene cassettes within either standard or Vector-Intron backbones were produced to high titres in suspension (serum-free) HEK293T cells, in the presence or absence of rev, respectively. Vector titres are plotted on a log 10 scale.

Figure 11. Utilisation of LV genome cassettes containing inverted transgene cassettes expressed during LV production leads to suppression of de novo vector component protein expression via a cytoplasmic dsRNA sensing mechanism.

Standard RRE-containing LV genome plasmids (STD RRE-LV) or Vector-Intron genome plasmids (MSD-2KOm5/ARRE/Ap17-INS+VI_v5.5) [both 3G TSS constructs unless indicated] were generated with either forward (Fwd) or inverted (Invert) EFS-GFP transgene cassettes, and used to produce LV harvest supernatants in suspension (serum-free) HEK293T cells. Packaging plasmids (pGagPol and pVSVG) were co-transfected together with or without pRev were indicated. Supernatants were analysed by SDS-PAGE/immunoblotting to VSVG and p24 (capsid). The data indicate that inverted transgene cassettes induce suppression of de novo LV component synthesis, consistent with a cytoplasmic dsRNA sensing mechanism e.g. PKR.

Figure 12. A schematic showing an example of a Vector-Intron LV genome with inverted transgene cassette.

A Vector-Intron LV genome with a reverse facing transgene cassette containing an intron is shown. Since the VI stimulates intron loss only from the vRNA (top strand-copied), the transgene cassette will retain its own intron. Depending on the strength of the transgene cassette promoter, a significant amount of double-stranded RNA may form between the vRNA and the transgene mRNA during LV production. This can potentially lead to a PKR response, cleavage by Dicer or deamination by ADAR; any or all of these mechanisms can contribute to reduced vector titres. This can be avoided by utilizing the unique features of the VI by inserting into it c/s-acting element(s) (X) within the 3’UTR of the inverted transgene cassette. Such cisacting elements are those that would reduce the abundance of only the transgene mRNA e.g. AU-rich [instability] elements (AREs), miRNAs, and/or self-cleaving ribozymes. The action of these reduce the amount of transgene mRNA available for pairing with the complementary vRNA to generate dsRNA. In addition, reduced transgene mRNA (and resultant protein) can be advantageous for LV production. Importantly, the c/s-acting element(s) will not be present within the final integrated transgene cassette due to out-splicing of the VI, and therefore transgene mRNA stability in the transduced cell will be efficient.

Figure 13. A schematic showing an example of a Vector-Intron LV genome with inverted transgene cassette and further details of cis-acting elements within the 3’UTR of the transgene cassette that mediate transgene mRNA degradation.

A Vector-Intron LV genome with a reverse facing transgene cassette containing an intron is shown during LV production. The use of ‘functional’ cis-acting elements (‘X’) within the 3’UTR of the transgene cassette - and located within the anti-sense VI sequence - can be used to achieve transgene repression and to avoid dsRNA responses during LV production. Two examples of functional cis-acting sequences are shown. Firstly, one or multiple self-cleaving ribozymes (‘Z’) can be inserted within the anti-sense VI sequence of the 3’UTR, leading to self-cleavage of pre-mRNA, resulting in RNA lacking a polyA tail and degradation in the nucleus. Secondly, one or multiple pre-miRNAs (‘m’) can be inserted within the anti-sense VI sequence of the 3’UTR, leading to pre-miRNA cleavage/processing resulting in cleavage of the pre-mRNA. Importantly, the miRNAs can be targeted to the transgene mRNA so that any mRNA that does locate to the cytoplasm is a target for microRNA-mediated cleavage (the guide strand should be 100% matched to its target). The vRNA will not be targeted by the guide strand. The passenger strand should be mis-matched with regard to the vRNA sequence to avoid cleavage of the vRNA should the passenger strand become a legitimate microRNA effector. Thus, both of these examples can be used to reduce/eliminate transgene mRNA (and dsRNA) only in LV production, since these functional cis-acting elements will be lost from the packaged vRNA due to loss of the VI.

Figure 14. Use of self-cleaving ribozymes within the 3’UTR of inverted transgene cassettes to enhance LV virion production.

LV genome cassettes containing an inverted EF1a-GFP transgene with or without ‘functionalized’ 3’ UTRs were used to produce LVs in suspension (serum-free) HEK293Ts, and vector proteins components within clarified harvest material analysed (panel A). Levels of vRNA were assessed by RT-PCR in both post-production cells (‘C’) or vector supernatant harvest (‘V’). Expression of an inverted transgene cassette during LV production leads to double-stranded (ds) RNA, since the mRNA will be complementary to the majority of the LV vRNA. dsRNA is likely triggering at least one sensing mechanism during production (e.g. PKR), leading to a substantial reduction in detectable VSVG and p24 (capsid) in harvest material (panel A) and vRNA (panel C) - see ‘Empty’ lanes. Four different self-cleaving ribozymes were tested within the Vector-Intron (VI) region of the 3’UTR of the inverted transgene cassette: Hammerhead ribozyme (HH_RZ), Hepatitis delta virus ribozyme (HDV- AG), and modified Schistosoma mansoni hammerhead ribozymes (T3H38/T3H48) (see panel [B] for schematics and [A, C for data]. Additionally, variants were made harbouring the ‘negative regulator of splicing’ (NRS) element from RSV, or a splice donor site, as these have been shown to impart destabilization effects on mRNA. Other variants included several of these cis-acting elements in the same 3’UTR, with upstream/downstream positions noted as [1] or [2] respectively. (The positions of the forward [f] and reverse [r] primers for RT-PCR analysis is indicated in panel B; other features such as cppt and wPRE are not shown). These elements were cloned into an LV genome containing the Vl_5.7 variant, the MSD-2KOm5 modification and deletions in the gag-Psi and RRE (full deletion) regions. Vectors were produced alongside the standard, RRE/rev-dependent LV genome containing the cassette in the forward direction, which produces aberrant splice products (see panel C). The data show that use of self-cleaving ribozymes enables recovery of VSVG, p24 and vRNA with LV supernatants. Figure 15. Use of self-cleaving ribozymes within the 3’UTR of inverted transgene cassettes to enhance LV titres.

LV harvest supernatants described in Example 7 and Figure 14 were titrated by integration assay in HEK293T cells. The data demonstrated that titres of VL LV genomes harbouring active inverted transgene cassettes are ~1000-fold lower than STD RRE-LVs containing the same transgene in the forward (fwd) orientation (see ‘Empty’). However, the use of selfcleaving ribozymes within the 3’ UTR of the inverted transgene cassette enables ~100-fold recovery in titres. The presence of other cis-elements NSR and a splice donor site had no/minimal effect on titres.

Figure 16. Use of minimal gag sequences as part of the packaging signal within Vector-Intron LV genomes.

The retained gag sequence within the packaging region of Vector-Intron genomes (reduced to 81 in other examples) was further minimized, resulting in constructs harbouring 57, 31 , 14 or zero nucleotides of gag. All constructs harboured an ATG>ACG mutation in the primary initiation codon of retained gag sequence. All variants were presented within an MSD-2KOm5 LV genome containing Vl_5.5 in place of the RRE. The standard LV genome contained the MSD, RRE and the first 340 nucleotides of gag (including the p17INS). LVs were produced in suspension (serum-free) HEK293T cells by transient transfection, and clarified harvests titrated on adherent HEK293T cells followed by flow cytometry.

Figure 17. Optimisation of rev-independent production of Vector-Intron LVs: fine- tuning of vector component input levels.

A. Clarified standard (STD) or Vector-Intron (VI) LV vector supernatants (duplicate) were immunoblotted using antibodies to VSVG (white) or p24/capsid (black). M = molecular weight markers (kDa). B. A Design-of-Experiment (DoE) multivariate analysis experiment was performed using an MSD-2KOm5/Ap17INS/VI_5.5 LV genome encoding EFS-GFP. The control/centre point set of ratios (genome:gagPol:VSVG of 950:100:70 ng/mL) was the optimized ratio used for standard RRE/rev-dependent LVs (and all previous examples assessing VI LVs). LVs were produced LVs were produced in suspension (serum-free) HEK293T cells by transient transfection, and vector was harvested at the time points (hours) stated post-induction with sodium butyrate. Clarified harvests titrated on adherent HEK293T cells followed by flow cytometry. Figure 18. Vector-Intron LVs harbouring self-cleaving elements within the transgene 3’UTR: use of production cell derived microRNA target sites.

The figure displays a similar LV production system to that described in Figures 12 and 13. The inverted transgene cassette comprises self-cleaving elements within the 3’UTR sequence that is encompassed by the Vector-Intron sequence on the top strand, and thus such elements are spliced out of packaged vRNA and not delivered to target cells. Self-cleaving elements (such as ribozymes [Z]) eliminate transgene mRNA, and therefore avoid triggering dsRNA-sensing pathways that otherwise reduce LV titres, as well as leading to suppression of transgene protein expression that might otherwise impact on LV titres. In this case, one or more microRNA target sequences are inserted into the 3’UTR, optionally with other self-cleaving elements such as ribozymes. These target sequences may be synthetic, and be targeted by a miRNA expressed exogenously (e.g. by a U6-driven cassette introduced into the production cell) or by endogenous miRNAs.

Figure 19. Production cell transgene expression and output titres of Vector-Intron LVs harbouring self-cleaving elements within the transgene 3’UTR: use of production cell derived microRNA target sites.

Vector-Intron LVs harbouring an inverted EF1a-GFP cassette were generated in a similar format as per Figure 18. Specifically, the 3’UTR of the inverted transgene that is encompassed by the VI on the top strand had 1x or 3x copies of three different target sequences of miRNAs found to be endogenously expressed in HEK293(T) cells (miR17-5p, miR20a and mi106a). Two sets of variants were produced in which the ribozymes T3H38 and HDV_AG were additionally present within the Vl-encompassed 3’UTR region (at positions [1] and [2] respectively). For the variants containing both ribozymes and miRNA target sequence(s), the miRNA target sequences were positioned between the two ribozymes. A third variant type was generated in which a single copy of all three miRNAs were present between the ribozymes (17-5p/20a/106a). LVs were produced in suspension (serum-free) HEK293T cells alongside a standard LV, containing the EF1a-GFP cassette in the forward orientation. Post-production cells were analysed by flow cytometry to generate GFP Expression scores (%GFP x MFI), and resultant vector supernatants were titrated on adherent HEK293T cells by flow cytometry to yield GFP TU/mL values. Titre values and GFP expression scores were normalised to that attained by the standard LV (set to 100%). Figure 20. Vector-Intron LVs harbouring self-cleaving elements within the transgene 3’UTR: use of Vector-Intron embedded pre-microRNAs.

The figure displays a similar LV production system to that described in Figures 12 and 13. The inverted transgene cassette comprises self-cleaving elements within the 3’UTR sequence that is encompassed by the Vector-Intron sequence on the top strand, and thus such elements are spliced out of packaged vRNA and not delivered to target cells. Self-cleaving elements (such as ribozymes [Z]) eliminate transgene mRNA, and therefore avoid triggering dsRNA-sensing pathways that otherwise reduce LV titres, as well as leading to suppression of transgene protein expression that might otherwise impact on LV titres. In this case, one or more pre- microRNA cassettes are inserted into the 3’UTR (processing of which will cleave the transgene mRNA), and optionally the miRNAs produced from processing target sites within the transgene mRNA (in this case 3’UTR sequence). Optionally, these miRs/miRNA targets are combined with other self-cleaving elements such as ribozymes.

Figure 21. High titre production of an LV encoding a chimeric antigen receptor (CAR) transgene cassette using an optimised Vector-Intron efficiently spliced out of packaged vRNA.

[A] RT-PCR analysis of vRNA-derived species within production cells (total and cytoplasmic) and resultant LV virions (V) for four different types of LV vector backbone expression cassettes. ‘STD’ refers to standard 3^rd Gen LVs, harbouring all the typical cis-acting elements, including the major splice donor (MSD) and rev-response element (RRE). ‘2KO’ refers to newer generation LVs wherein the MSD has been mutated; these also contain the RRE and require expression of a modified U1 snRNA (256U1) molecule to fully restore output titres. 256U1 used with STD LVs also increases packaged vRNA and titres, see [B], The ‘MaxPax’ LV contains the v5.6 variant of the Vector-Intron of the present invention, and harbours both mutation in the MSD and deletion of the RRE and gag-p17INS sequences. Promoters used were either EF1a or the short EF1a (EFS). The RT-PCR use primers upstream of the MSD (fwd) and downstream within the GFP transgene so that aberrant or ‘correct’ VI splicing could be monitored. The presence of packageable/packaged vRNA is shown (i -vRNA); note that the size of RT-PCR product reflects the size of promoter (EFS is ~1 kb shorter than EF1a; see 2KO-EF1a vs 2KO-EFS) and the increase in capacity of the Vl-derived vRNA of ~1kb (see 2KO-EFS vs MaxPax-EFS). An RT-PCR to actin mRNA was used as a positive control. Panel B displays the output titres of the vectors descrive in A; both integration and ‘biological’ (scFV) titres are shown against the assay reference control (stripes). Vl-derived MaxPax LVs were produced in the absence of rev. DETAILED DESCRIPTION OF THE INVENTION

Vector Intron

In one aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; and iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron.

Accordingly, in one aspect, the the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site and cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette are inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron.

The vector intron is in the sense orientation (i.e. forward orientation) with respect to the lentiviral vector genome expression cassette.

In some embodiments, the vector intron comprises one or more transgene mRNA selfdestabilization or self-decay element(s).

In some embodiments, the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and: a) the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and b) the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT; and c) the 3’ UTR of the transgene expression cassette comprises the vector intron.

In some embodiments, the 3’ UTR of the transgene expression cassette comprises the vector intron encoded in antisense with respect to the transgene expression cassette. Thus, when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette and the 3’ UTR of the transgene expression cassette comprises the vector intron; the vector intron is in an antisense orientation with respect to the lentiviral vector genome expression cassette.

In some embodiments, the nucleotide sequence comprises a lentiviral vector genome expression cassette, wherein: i) the major splice donor site and cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette are inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) a) When the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette: i. the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and ii. the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequence CAGACA, and/or GTGGAGACT; and iii. the 3’ UTR of the transgene expression cassette comprises the vector intron; and b) the vector intron comprises one or more transgene mRNA self-destabilization or selfdecay element(s).

As described herein, the present inventors surprisingly found that the VI enabled deletion of the RRE and resulted in a rev/RRE-independent LV genome (see Example 1). Since the VI sequence is removed from the LV vRNA prior to appearance in the cytoplasm, this allows for increased transgene capacity of LVs by ~780nts. In other Examples herein, the inventors show that at least a further ~260nts can be liberated by deletion of the gag-p17 instability (p17-INS) element from the gag sequence typically retained as part of the packaging sequence.

Even more surprising was that to achieve the highest LV titres using the VI in a RRE-deleted LV genome, the MSD-2KO feature appeared to be beneficial (see Example 1). Therefore, the MSD-2KO and VI features of these new class of rev/RRE-independent LV genomes may be mutually ‘symbiotic’, i.e. mutually beneficial, at the molecular level. The VI may rescue the negative impact of the MSD-2KO mutation on LV vRNA production/titres, and the MSD-2KO mutation may stop aberrant splicing to internal splice acceptors (including that of the VI) and to allow for maximal titres of Vl-containing, RRE-deleted LV genomes.

The VI according to the present invention may be any suitable functional intron.

As such, VI may comprise any nucleotide sequence recognizable as an intron. Introns are well known in the art. Typically, an intron is a nucleotide sequence within a gene that is spliced- out, i.e. removed by RNA splicing, before the RNA molecule is translated into protein. Introns may be identified by a number of features, e.g. the presence of splice sites and/or a branch point.

Thus, the VI according to the present invention may comprise a splice donor site, a splice acceptor site and a branch point.

As used herein, the term “branch point” refers to a nucleotide, which initiates a nucleophilic attack on the splice donor site during RNA splicing. The resulting free 3’ end of the upstream exon may then initiate a second nucleophilic attack on the splice acceptor site, releasing the intron as an RNA lariat and covalently combining the two sequences flanking the intron (e.g. the upstream and downstream exons).

Illustrative splice donor and splice acceptor sequences suitable for use according to the invention are provided in Table 3 below.

Table 3. Illustrative splice donor and splice acceptor sequences.

In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127.

In some embodiments, the vector intron according to the invention comprises a sequence selected from SEQ ID NOs: 128-133.

In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127 and a sequence selected from SEQ ID NOs: 128-133.

In one preferred embodiment, the vector intron according to the invention comprises the sequence as set forth in SEQ ID NO: 126 and the sequence as set forth in SEQ ID NO: 132.

Native splice donor sequences may not adhere fully to the core splice donor consensus sequence described herein (i.e. to MAGGURR; wherein M is A or C and R is A or G). For example, the splice donor sequence of SEQ ID NO: 126 does not fully adhere to the core splice donor consensus sequence. Such native splice donor sequences may be modified to increase the conformity, or to fully conform with, with the core splice donor consensus sequence without deleterious effect on the function of the resulting modified splice donor sequence and/or vector intron comprising the resulting modified splice donor sequence. Methods to modify a nucleotide sequence are known in the art. Modifying a splice donor sequence as described above to increase its conformity with the core splice donor consensus sequence is within the ambit of the skilled person.

The VI according to the present invention may be a naturally occurring intron.

The VI according to the present invention may be synthetic, or derived wholly or partially from any suitable organism. In one embodiment the intron is from EF1a. In one embodiment, the intron is the intron of EF1a.

In one embodiment the intron is from human p-globin intron-2. In one embodiment the intron is human p-globin intron-2.

Further, the VI may be optimized to improve vector titre by use of the following sequences: [1] short exonic splicing enhancers (ESEs) upstream of the VI splice donor site, [2] optimal splice donor sites (typically with maximal annealing potential to U1 snRNA), [3] use of optimal branch and splice acceptor sites, and [4] the use of short exonic splicing enhancers (ESEs) downstream of the VI splice acceptor site. Examples of the most optimal VI variants were composite sequences from HIV-1 and cellular introns such as human p-globin intron-2 (Example 5).

The VI according to the present invention may be a chimeric or modular intron comprising sequences, such as functional sequences, from different introns. Thus, the VI of the invention may be designed to comprise a composite of different sequences, such as functional sequences, from more than one intron, such sequences may comprise, for example, a splice donor site sequence, a splice acceptor site sequence, a branch point sequence (see Table 1). The branch point and splice acceptor site sequence may together be referred to as the “branch-splice acceptor sequence” herein.

The VI according to the invention may be furnished with upstream exonic splicing enhancer (ESE) elements, for example hESE, hESE2 and hGAR from HIV-1 (see Table 1). The sequences of hESE, hESE2 and hGAR are provided below. hESE (underlined = hESE):

G T C G AC TGAT CT TC GACCT GGAGGAGG G T T GAGGGACAAT T GAT GCATCTCGAGC ( SEQ ID NO : 134 ) hESE2, shown downstream of cppt/CTS (underlined = hESE2; bold = cppt/CTS):

AAATTGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGG GGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTA CAAAAATTCAAAATTTTCGGGTTTCACGTGACGCGTCTGCAGCCGAAGGAATAGAAGAAGAA GGTGGAGAGAGAGACAGAGACCTGCAGACG ( SEQ ID NO : 135 ) GAR (underlined = GAR):

TGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAA ( SEQ ID NO : 136 )

In one embodiment, the VI of the invention comprises a sequence as set forth in SEQ ID NO: 134, 135 or 136.

In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127 and a sequence selected from SEQ ID NOs: 134-136.

In some embodiments, the vector intron according to the invention comprises a sequence selected from SEQ ID NOs: 128-133 and a sequence selected from SEQ ID NOs: 134-136.

In some embodiments, the vector intron according to the invention comprises a sequence selected from MAGGURR, MAGGUAAGU and SEQ ID NOs: 119-127, and a sequence selected from SEQ ID NOs: 128-133 and a sequence selected from SEQ ID NOs: 134-136.

In one preferred embodiment, the vector intron according to the invention comprises the sequences as set forth in SEQ ID NO: 126, SEQ ID NO: 132 and SEQ ID NO: 135.

In one preferred embodiment, the vector intron according to the invention comprises the sequences as set forth in SEQ ID NO: 126, SEQ ID NO: 132 and SEQ ID NO: 136.

In one preferred embodiment, the vector intron according to the invention comprises the sequences as set forth in SEQ ID NO: 126, SEQ ID NO: 132, SEQ ID NO: 135 and SEQ ID NO: 136.

In one embodiment, the VI of the invention is operably linked to an upstream exonic splicing enhancer (ESE) element, such as hESE, hESE2 or hGAR.

In one embodiment, the VI of the invention is a synthetic vector intron comprising the HIV-1 guanosine-adenosine rich (GAR) splicing element

In one embodiment, the VI of the invention is a synthetic vector intron comprising the HIV-1 guanosine-adenosine rich (GAR) splicing element upstream of the splice donor sequence. In one embodiment, the VI of the invention is is a synthetic vector intron comprising the hESE2 downstream of the splice acceptor.

In one embodiment, the VI of the invention is is a synthetic vector intron comprising the hESE2 downstream of the splice acceptor and the cppt/CTS sequence of the vector genome.

In one embodiment, the lentiviral vector genome expression cassette comprises a hGAR upstream enhancer element and a VI comprising or consisting of a HIV SD4 splice donor sequence, and a human p-globin intron-2 derived sequence containing a branch-splice acceptor sequence.

In one embodiment, the lentiviral vector genome expression cassette comprises a hGAR upstream enhancer element and a VI comprising or consisting of a HIV SD4 splice donor sequence, a human p-globin intron-2 derived sequence containing a branch-splice acceptor sequence, and hESE2 downstream of the cppt/CTS.

In one embodiment, the VI of the invention comprises any of the features disclosed in Table 1 . In another embodiment, the VI of the invention comprises an intron and (where applicable) an upstream enhancer element with the combination of features described for any one of Vl_v1.1 , Vl_v1.2, Vl_v2.1, Vl_v2.2, Vl_v3.1 , Vl_v4.1 , Vl_v4.2, Vl_v4.3, Vl_v4.4, Vl_v4.5, Vl_v4.6, Vl_v4.7, Vl_v4.8, Vl_v4.9, VI_v4.10, Vl_v4.11 , Vl_v4.12, Vl_v5.1 , Vl_v5.2, Vl_v5.3, Vl_v5.4, Vl_v5.5, Vl_v5.7. In a preferred embodiment the VI of the invention comprises the features of Vl_v5.5.

Illustrative examples of vector intron sequences are provided below.

Vl_4.12 (bold = GAR; underlined = HIV-1 splice donor 4; italics = chimeric intron-branch-splice acceptor sequence; plain text = exon/intron/exon):

TTTTGGTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACT AGTCAGACTCATCAAGCTTCTCTATCAAAGCA/GTAAGTAGTACATGTAACAAGGrrACAAG ACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCT GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG/GTGTCCACTC CCAGTTC ( SEQ ID NO : 137 )

Vl_5.5 (bold = GAR; underlined = HIV-1 splice donor 4; italics = human p-globin [intron 2] splice acceptor; plain text = exon/intron/exon)

TTTTGGTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACT AGTCAGACTCATCAAGCTTCTCTATCAAAGCA/GTAAGTAGTACATGTAAGAGrerArGGGA CCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAA GTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGC TTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCT TTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGA TAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTT

ATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCAT GTTCATACCTCTTATCTTCCTCCCACAG/GTGTCCACTCCCAGTTC ( SEQ ID NO : 138 )

Vl_5.6 (bold = GAR; underlined = HIV-1 splice donor 4; italics = human p-globin [intron 2] splice acceptor; plain text = exon/intron/exon; boxed = cppt/CTS; bold italics = hESE2)

TTTTGGTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACT AGTCAGACTCATCAAGCTTCTCTATCAAAGCA/GTAAGTAGTACATGTAAGAG TC TA TGGGA CCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAA GTAACAGGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGC TTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCT TTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGA TAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGT AACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTT ATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCAT GTTCATACCTCTTATCTTCCTCCCACAG/GTGTCCACTCCCAGTTCCTGCAGGCACGTGAAT^ |TTGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGA| |AAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAA| |AAATTCAAAATTTTCGGGTTT|CACGTGACGCGTCTGCAGCCGAAGGAATAGAAGAAGAAGGT GGAGAGAGAGACAGAGACCTGCAGACGCGT ( SEQ ID NO : 139 )

In one embodiment, the vector intron of the invention comprises the sequence as set forth in SEQ ID NO: 137.

In a preferred embodiment, the vector intron of the invention comprises the sequence as set forth in SEQ ID NO: 138.

In one embodiment, the vector intron of the invention comprises the sequence as set forth in SEQ ID NO: 139.

As illustrative example of a nucleotide sequence encoding a lentiviral vector genome sequence comprising a vector intron of the invention is provided below:

LV-MSD2KOm5-Ap17INS-ARRE-VI_5.6 (shown is the 5’ R to internal transgene cassette: bold italics = MSD2KOm5; underlined = gagAp17INS; bold = Vl_5.6; boxed = cppt/CTS):

GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACT GCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTG ACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGC GCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGG C T T GC T G AAGC GC GC AC GGC AAG AGGC GAG GGGAAGGCAACAGATAAATATGCCTTAAAAT T T T GAG T AGO GG AGGC TAGAAGGAGAGAGACGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAG AATTAGATCGCGATTGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGACTCGAGCAATTTTG GTCGTGAGGCACTGGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACTAGTCA GACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAAGAGTCTATGGGACCCTTG ATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACA GGGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTT CTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGG GCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTT CTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGA TGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTA TGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCAT

GAGACAGAGACCTGCAGACGCGT ( SEQ ID NO : 140 )

Transgene sequences followed by the 3’ SIN-LTR may be located at the 3’ end of SEQ ID NO: 140.

In one embodiment, the nucleotide sequence encoding the lentiviral vector genome of the invention comprises the sequence as set forth in SEQ ID NO: 140.

As out-splicing of other introns is stimulated by the presence of VI (and absence of rev/RRE system), transgene cassettes encoding their own intron(s) (e.g. the EF1a promoter) will lose these introns from the vRNA. To avoid this, the transgene cassette may be inverted. Inverting the transgene cassette allows the embedded introns to not be lost from the resultant vRNA since they will not function as introns within the LV genome expression cassette. A drawback of this configuration is a reduction in LV titres due to production of double-stranded RNA (dsRNA) species that are formed as a result of annealing between the vRNA and transgene mRNA. Sensing of dsRNA can trigger cellular responses such as the PKR response, cleavage by Dicer, or deamination by ADAR. This may not be the case for transgene cassettes driven by tissue specific promoters that are minimally active in LV production cells, such as HEK293T cells.

Hence, in one aspect, the lentiviral vector genome expression cassette of the invention may utilise tissue specific promoters to reduce the negative effects, e.g. titre reduction, incurred as a result of the formation of dsRNA species. The VI intron of the present invention facilitates the use of LV genomes comprising additional desirable features, e.g. MSD-2KO and RRE-deletions. Hence, use of MSD-2KO, RRE-deleted LV genomes containing VI advantageously enables: [1] increased transgene capacity, [2] ablation of aberrant splicing from the packaging sequence, [3] removal of rev from the production system, [4] reduced transcriptional read-in in target cells, and [5] use of inverted transgene cassettes with 3’ UTR c/s-elements to repress transgene expression during LV production. All of the aforementioned contribute to improved safety of the vector genome expression cassettes of the invention.

In an aspect, the invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein the major splice donor site in the lentiviral vector genome expression cassette is inactivated; the lentiviral vector genome expression cassette does not comprise a rev-response element; and the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron.

In an aspect, the vector intron is a synthetic vector intron.

In an aspect, the synthetic vector intron comprises the HIV-1 GAR splicing element.

In an aspect, the vector intron comprises a splice donor sequence, wherein said splice donor sequence comprises from 7 to 11 nucleotides which are complementary to a portion of the U1 snRNA sequence.

In a further aspect, the synthetic vector intron comprises the HIV-1 guanosine-adenosine rich splicing element upstream of the splice donor sequence.

In an aspect, the synthetic vector intron comprises the branch site and splice acceptor of the human beta-globin intron-2.

Since introns, such as a the VI according to the invention, may be spliced out of a given nucleotide sequence, such as the nucleotide sequences comprising the lentiviral vector genome expression cassettes according to the invention, it is to be understood that products of such nucleotides, e.g. nucleotide products and cells or particles comprising the same, may not comprise the VI. Such nucleotides, cells, and/or particles may comprise a residual sequence, such as a splice junction sequence, by virtue of splicing of the VI. The junctional sequence may correspond to SEQ ID NO: 19. The terms “EF1a” and “EF1a” are used interchangeably herein.

Transgene mRNA self-destabilization or self-decay elements

The formation of dsRNA species has undesirable titre-reducing effects. As described herein, dsRNA species may be formed during production of viral vectors comprising an inverted transgene expression cassette. The present invention solves this problem by providing LV genome expression cassettes that comprise transgene mRNA self-destabilization or selfdecay elements, or transgene mRNA nuclear retention signals, that function to reduce the amount of dsRNA formed when the LV genome expression cassette comprises an inverted transgene expression cassette. Preferably, such functional c/s-acting transgene mRNA selfdestabilization or self-decay elements, or functional c/s-acting transgene mRNA nuclear retention signals, are positioned within the 3’IITR of the transgene cassette and within the VI sequence, and are used to achieve transgene repression in order to avoid dsRNA responses during LV production, which have deleterious effects on titre.

Preferably, the vector intron is in the antisense orientation with respect to the transgene expression cassette. Suitably, the VI may comprise the transgene mRNA self-destabilisation or self-decay element in or reverse (i.e. antisense) orientation with respect to the lentiviral vector genome expression cassette. Suitably, when the transgene mRNA self-destabilisation or self-decay element is an miRNA, the VI may comprise the miRNA in the forward (i.e. sense) orientation or reverse (i.e. antisense) with respect to the lentiviral vector genome expression cassette. The reverse orientation of the miRNA provides the advantage that use is made of the miRNA processing step, resulting in transgene mRNA cleavage in generation of the pre- miRNA in addition to subsequent miRNA-mediated transgene mRNA cleavage . Use of a transgene mRNA-targeting miRNA cassette in the forward orientation within the VI with respect to the lentiviral vector genome cassette would result in the pre-miRNA being processed within the VI RNA (i.e. derived from (pre-) vRNA) and not the transgene mRNA. Thus, the miRNA may be provided in either the forward or the reverse orientation within the VI.

Thus, the inventors herein provide a solution to the problems associated with the formation of dsRNA, namely modifying the configuration or orientation of the VI with respect to the transgene expression cassette. By positioning the 3’ UTR of the inverted transgene cassette such that the VI sits within it, c/s-elements can be inserted within the 3’ UTR sequence encompassed by the VI (preferably in antisense orientation with respect to the vector genome expression cassette unless the c/s-element is a miRNA, which can be in either orientation), which destabilize the transgene mRNA or induce its decay or degradation. These can be known destabilization elements or self-destabilization or self-decay elements, and comprise elements such as All-rich element (AREs), self-cleaving ribozymes, microRNAs, microRNA target sequences and pre-miR, which can be processed and ‘self-target’ the transgene mRNA.

An alternative or additional type of element that can be used are target sequences for miRNAs expressed during lentiviral vector production; these miRNAs expressed during lentiviral vector production can either be endogenously expressed miRNAs by the host cell or by exogenously expressed miRNAs (e.g. by co-transfection of a U6-driven mi/shRNA cassette). This concept is described in Figure 18. miRNAs are transcribed as primary miRNA (pri-miRNA) that can be several kilobases long. These transcripts are processed in the nucleus to 60-90 nt long precursor-miRNA hairpins (pre-miRs or pre-miRNAs, used interchangeably herein) by the Microprocessor complex. Thus, pre-miRs refer to the hairpin precursors of miRNAs formed by the cleavage of primary miRNAs by DCGR8 and Drosha.

A further example of the use of miRNA to degrade transgene mRNA when using Vector-Intron lentiviral vectors harbouring an inverted transgene cassette, is the use of the 3’IITR sequence encompassed by the VI on the top strand to contain one or more pre-miRs, such that processing of such pre-miRs leads to cleavage of the 3’IITR by Drosha/Pasha. Optionally, the miRNA generated by such pre-miR cassettes could then target other sequences across the transgene mRNA. Again, critically these self-cleaving sequences are removed by splicing out of the VI to generate packaged vRNA, and are therefore not present in the target cell. This concept is presented in Figure 20, and expands on the concept presented in Figures 12 and 13.

Alternatively, the c/s-elements may be functional nuclear retention signals such as those in long non-coding RNAs (IncRNAs) such as Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT1) (Miyagwa etal. (2012), RNA 18: 738-751), maternally expressed gene 3 (MEG3) (Azam et al. (2019), RNA Biol. 16: 1001-1009), and the SINE-derived nuclear RNA LOcalizatloN (SIRLION) element (Lubelsky and Ulitsky (2018), Nature 555: 107-111 ; Lubelsky et al. (2021), EMBO J. 40: e106357).

By utilizing such elements in the LV genome expression cassettes of the invention, the amount of transgene mRNA produced to be available for forming dsRNA with the vRNA can be reduced, minimizing the impact on LV titres. Critically, these elements are only active during LV production because they are lost from the packaged vRNA by splicing-out of the VI.

Hence, these c/s-acting element(s) will not be present within the final integrated transgene cassette due to out-splicing of the VI, and therefore transgene mRNA stability and/or localisation in the transduced cell will be unaffected.

The terms “self-destabilisation” and “self-decay” as used in relation to the aforementioned c/s- acting element(s) refers to the ability of said elements to act upon nucleotides, i.e. transgene mRNA, that comprise sequences encoding said elements. For example, an intron which is inverted with respect to the lentiviral vector genome expression cassette may encode a c/s- acting element that facilitates the destabilisation or decay of transgene mRNA encoding the intron.

All-rich elements (AREs) may facilitate the recruitment of RNA-binding proteins that destabilise the mRNA in which they are present, either directly or via the recruitment of additional factors.

Self-cleaving ribozymes are well known in the art (Jimenez, R., M., et al. “Chemistry and Biology of Self-Cleaving Ribozymes.” Trends in biochemical sciences vol. 40,11 (2015): 648- 661. doi: 10.1016/j.tibs.2O15.09.001). Ribozymes can be found in diverse genomic contexts in a vast array of organisms wherein they belong to families that are defined by structure and active site. Ribozymes catalyse trans-esterification reactions and typically mediated selfcleavage via general acid-base catalysis. Such self-cleavage reactions result in scission of the nucleotide comprising the ribozyme.

Interfering RNAs are also well known in the art. Interfering RNAs (e.g. miRNAs) may promote cleavage of the target RNA (van den Berg etal. (2008), Biochim Biophys Acta 1779: 668-677).

The terms “self-destabilisation” and “self-decay” as used herein encompasses mechanisms that contribute to the overall quantitative reduction or functional attenuation of target RNA, e.g. through processes such as ribozyme-mediated or enzyme-mediated cleavage.

Nuclear retention signals are RNA sequences that lead to the reduction in transport of the target RNA from the nucleus to the cytoplasm after initial transcription. Target RNAs (such as the transgene mRNA) may further be located to nuclear speckles. Thus, the one or more transgene mRNA nuclear retention signals for use according to the invention facilitates the nuclear retention of mRNA encoding the transgene.

A further advantage of this novel feature is that it also provides a mechanism for transgene repression during LV production, which has previously shown to be an effective way of rescuing LV titres for genomes encoding toxic or ‘problematic’ transgene proteins.

In some embodiments, the 3’ UTR of the inverted transgene expression cassette comprises the vector intron. Thus, one or more transgene mRNA self-destabilisation or self-decay element(s), or one or more transgene mRNA nuclear retentions signal(s), may be present within the 3’IITR sequence, wherein the 3’ UTR sequence encompasses the vector intron encoded in antisense orientation with respect to the transgene expression cassette.

In an aspect, the synthetic vector intron comprises one or more transgene mRNA selfdestabilizing or self-decay element(s) or one or more transgene mRNA nuclear retention signals. The one or more transgene mRNA self-destabilizing elements(s), self-decay element(s) or nuclear retention signal(s) may be of the same type or a different type.

In one aspect, the one or more transgene mRNA self-destabilization or self-decay element(s) of the invention promotes cleavage of target nucleotides. In another aspect, said cleavage is performed by cellular mediators, preferably the RISC complex.

In a further aspect, the synthetic vector intron comprises one or more transgene mRNA selfdestabilization or self-decay element(s) selected from a list comprising:

(a) a self-cleaving ribozyme; and/or

(b) an AU-rich element; and/or

(c) an interfering RNA, preferably a miRNA, siRNA or shRNA which targets the transgene mRNA; and/or

(d) a target sequence for an interfering RNA, preferably for a miRNA; and/or

(e) a pre-miR.

In one embodiment, the synthetic vector intron comprises one or more transgene mRNA selfdestabilization or self-decay element(s) selected from a list comprising:

(a) a self-cleaving ribozyme; and/or

(b) an interfering RNA, preferably a miRNA, siRNA or shRNA which targets the transgene mRNA. Thus, in one aspect, the one or more transgene mRNA self-destabilization or self-decay element(s) is an interfering RNA.

In some preferred embodiments, the interfering RNA is specific for mRNA encoding the transgene.

As used herein, the term “is specific for” means that the interfering RNA preferentially binds to mRNA encoding the transgene over an mRNA molecule which does not encode the transgene. Thus, the interfering RNA targets the mRNA encoding the transgene.

The interfering RNA may be specific for a sequence within the 5’ UTR and/or coding-region and/or 3’IITR of the transgene expression cassette (i.e. the 5’ UTR and/or coding-region and/or 3’UTR of the transgene expression cassette comprises a target nucleotide sequence). Suitably, the target nucleotide sequence may be within the 5’ UTR of the transgene expression cassette. Alternatively, the target nucleotide sequence may be within the 3’ UTR. If a plurality of interfering RNAs are employed, the target nucleotide sequences may be within the 3’ UTR and the 5’ UTR of the transgene expression cassette.

In some embodiments, the 3’ UTR or the 5’ UTR of the transgene expression cassette comprises at least one target nucleotide sequence.

In some embodiments, the transgene expression cassette is genetically engineered to comprise at least one target nucleotide sequence within the 3’ UTR or 5’ UTR. The at least one target nucleotide sequence may be at least one predetermined heterologous target nucleotide sequence for which efficient interfering RNAs are already available.

Molecular cloning methods to introduce a nucleotide sequence into a target sequence are known in the art. For example, conventional techniques of molecular biology (described elsewhere herein) may be employed.

In some embodiments, the interfering RNA is specific for the at least one target nucleotide sequence.

As used herein, the term “target nucleotide sequence” means a sequence within the transgene expression cassette to which the interfering RNA binds. Suitably, the target nucleotide sequence is 100% complementary to the guide strand of the interfering RNA, which is preferably a miRNA. In one aspect, the one or more transgene mRNA self-destabilization or self-decay element(s) is an All-rich element; a siRNA; a shRNA; a tRNA-shRNA; a miRNA; a pre-miRNA; a pri- miRNA mimic; a pri-miRNA mimic cluster; and/or combinations thereof.

In a preferred embodiment, the one or more transgene mRNA self-destabilization or self-decay element(s) is a miRNA, siRNA or shRNA.

In a preferred embodiment, the one or more transgene mRNA self-destabilization or self-decay element(s) is a miRNA or shRNA.

Preferably, the one or more transgene mRNA self-destabilization or self-decay element(s) is a miRNA.

One or more pre-miRs can be inserted within the antisense VI sequence, i.e. the inverted VI. miRNAs can be targeted to the transgene mRNA so that any mRNA that does locate to the cytoplasm is a target for miRNA-mediated degradation/cleavage. In this instance, the guide strand is preferably 100% matched, i.e. 100% complementary, to its target. The vRNA will not be targeted by the guide strand. The passenger strand should be mis-matched, i.e. not 100% complementary, to the vRNA sequence, in order to avoid cleavage of the vRNA, should the passenger strand become a legitimate microRNA effector.

In one aspect, the one or more transgene mRNA self-destabilization or self-decay element(s) comprises an interfering RNA, preferably an miRNA, wherein the guide strand of the miRNA does not comprise a mismatch with the target transgene mRNA sequence.

In another aspect, the passenger strand of the miRNA according to the invention imperfectly matches its target vector genome sequence resulting in a central bulge.

In another aspect, the one or more transgene mRNA self-destabilization or self-decay element(s) comprises an interfering RNA, preferably an miRNA, wherein the passenger strand comprises at least one mismatch (suitably, at least two or at least three) - preferably at position 2, 9, 10 or 11 - with its target vector genome sequence.

In an aspect, the invention provides a nucleotide sequence comprising a nucleotide expression cassette for use in a lentiviral vector production cell, wherein the expression cassette comprises a sequence encoding a an intron (or VI) which encodes a miRNA; wherein the miRNA has no mis-match between the guide strand and its target mRNA; and wherein the miRNA targets mRNA corresponding to an inverted transgene according to the invention, but not the vector genome RNA.

The aforementioned transgene mRNA self-destabilization or self-decay element(s) (e.g. miRNA) may comprise a plurality of RNA self-destabilization or self-decay element(s) that may also target a plurality of nucleic acid sequences. Conversely, the aforementioned RNA selfdestabilization or self-decay element(s) (e.g. miRNA) may comprise a single RNA selfdestabilization or self-decay element that targets a single nucleic acid sequence.

The terms “microRNA” and “miRNA” are used interchangeably herein.

In one embodiment, the VI of the invention comprises any of the features disclosed in Table 4.

In one embodiment, the VI of the invention comprises a sequence as set forth in any of SEQ ID NOs: 146-163.

Illustrative Vector-Intron sequences, and in combination with embedded ‘self- cleavinq/tarqetinq’ element (shown in antisense) for inverted transqene cassettes.

Illustrative sequences for use according to the invention are provided in Table 4 below: Key for the following sequences:

• Sequences are all presented 5’ to 3’ in vector RNA sense (top strand) configuration, including the encompassed elements that are present within the 3’ UTR of the inverted transgene cassette (i.e. ‘self-cleaving’, ‘self-targeting’ elements are shown in antisense).

• The Vector-Intron splice donor and splice acceptor core sequences are boxed.

• The Guanosine-Adenosine Rich upstream splicing enhancer (GAR) is indicated in bold/underline.

• The HDV_AG ribozyme is indicated in italics.

• The T3H38 ribozyme is underlined and italicised.

• cPPT sequences are indicated in bold italics.

• The downstream splice enhancer sequence is indicated in bold, underlined italics.

• The sequence highlighted in bold only were replaced with the miRNA target sites.

• The pre-miRNA cassette was inserted in the underlined bracketed region. TABLE 4

RNA interference (RNAi)

Post-transcriptional gene silencing (PTGS) mediated by double-stranded RNA (dsRNA) is a conserved cellular defence mechanism for controlling the expression of foreign genes. It is thought that the random integration of elements such as transposons or viruses causes the expression of dsRNA which activates sequence-specific degradation of homologous singlestranded mRNA or viral genomic RNA. The silencing effect is known as RNA interference (RNAi). RNAi has also been exploited to modulate the expression of a target nucleotide sequence.

RNAi is a biological process in which RNA molecules inhibit gene expression or translation, by inhibiting targeted mRNA molecules (Ralph et al. 2005, Nat. Medicine 11 : 429-433). The mechanism of RNAi involves the processing of long dsRNAs into duplexes of about 21-25 nucleotide (nt) RNAs. These products are called small interfering or silencing RNAs (siRNAs) which are the sequence-specific mediators of mRNA degradation. shRNAs consist of short inverted RNA repeats separated by a small loop sequence. These are rapidly processed by the cellular machinery into 19-22 nt siRNAs, thereby suppressing the target gene expression.

Micro-RNAs (miRNAs) are small (22-25 nucleotides in length) noncoding RNAs that can effectively reduce the translation of target mRNAs by binding to their 3’ untranslated region (UTR). Micro-RNAs are a very large group of small RNAs produced naturally in organisms, at least some of which regulate the expression of target genes. Founding members of the micro- RNA family are let-7 and lin-4. The let-7 gene encodes a small, highly conserved RNA species that regulates the expression of endogenous protein-coding genes during worm development. The active RNA species is transcribed initially as a ~70 nt precursor, which is post- transcriptionally processed into a mature ~21 nt form. Both let-7 and lin-4 are transcribed as hairpin RNA precursors which are processed to their mature forms by Dicer enzyme. Subsequently, the mature forms may be loaded into the RISC complex such that further cleavage of the target mRNAs can occur.

Methods for the design of interfering RNA to modulate the expression of a target nucleotide sequence are well known in the art.

Interfering RNAs may be, for example, a siRNA; a sisiRNA; a tsiRNA; a RNA-DNA chimeric duplex; a tkRNA; a Dicer-substrate dsRNA; a shRNA; a tRNA-shRNA; an aiRNA; a pre- miRNA; a pri-miRNA mimic; a pri-miRNA mimic cluster; a transcriptional gene silencing (TGS); and combinations thereof. Suitably, the interfering RNA for use according to the invention is an siRNA, shRNA or miRNA. Preferably, the interfering RNA for use according to the invention is a miRNA. Rev response element (RRE)

The rev-response element (RRE) in HIV-1 is an approximately 350 nucleotide, highly structured, cis-acting RNA element usually essential for viral replication. It is located in the env coding region of the viral genome and is extremely well conserved across different HIV-1 isolates. It is present on all partially spliced and unspliced viral mRNA transcripts, and serves as an RNA framework onto which multiple molecules of the viral protein Rev assemble. The Rev-RRE oligomeric complex mediates the export of these messages from the nucleus to the cytoplasm, where they are translated to produce essential viral proteins and/or packaged as genomes for new virions. The RRE serves as a specific RNA scaffold that coordinates the assembly of a unique homo-oligomeric ribonucleoprotein (RNP) complex to mediate the nuclear export of essential, intron-containing, viral messages. The Rev protein is a transactivating protein that is essential to the regulation of HIV-1 (and other lentiviral) protein expression. A nuclear localization signal is encoded in the rev gene, which allows the Rev protein to be localized to the nucleus, where it is involved in the export of unspliced and incompletely spliced mRNAs.

As described herein, the present inventors surprisingly found that inclusion of a Vector-Intron negated the need for the RRE to be present.

As such, in an aspect, the nucleotide sequence comprising a lentiviral vector genome expression cassette according to the invention does not comprise a rev-response element.

In one aspect the rev-response element may have been removed, or deleted, or otherwise inactivated in the nucleotide sequence. Suitable methods for such removal, deletion or inactivation will be known to those of skill in the art.

RNA Splicing

The present invention, as disclosed herein, may be combined with major splice donor (MSD) site knock out lentiviral vector genomes. The invention may employ lentiviral vector genomes in which the major splice donor site, and optionally the cryptic splice donor site 3’ to the major splice donor site, are inactivated. Thus, in some embodiments of the nucleotide sequence of the invention, the major splice donor site in the genome of the lentiviral vector and the cryptic splice donor site 3’ to the major splice donor site in the genome of the lentiviral vector are inactivated.

Such inactivated splice sites are described in WO 2021/160993 and incorporated herein by reference.

RNA splicing is catalysed by a large RNA-protein complex called the spliceosome, which is comprised of five small nuclear ribonucleoproteins (snRNPs). The borders between introns and exons are marked by specific nucleotide sequences within a pre-mRNA, which delineate where splicing will occur. Such boundaries are referred to as "splice sites." The term "splice site” refers to polynucleotides that are capable of being recognized by the splicing machinery of a eukaryotic cell as suitable for being cut and/or ligated to another splice site.

Splice sites allow for the excision of introns present in a pre-mRNA transcript. Typically, the 5' splice boundary is referred to as the "splice donor site" or the "5' splice site," and the 3' splice boundary is referred to as the "splice acceptor site" or the "3' splice site." Splice sites include, for example, naturally occurring splice sites, engineered or synthetic splice sites, canonical or consensus splice sites, and/or non-canonical splice sites, for example, cryptic splice sites.

Splice acceptor sites generally consist of three separate sequence elements: the branch point or branch site, a polypyrimidine tract and the acceptor consensus sequence. The branch point consensus sequence in eukaryotes is YNYTRAC (where Y is a pyrimidine, N is any nucleotide, and R is a purine). The 3' acceptor splice site consensus sequence is YAG (where Y is a pyrimidine) (see, e.g., Griffiths et al., eds., Modern Genetic Analysis, 2nd edition, W.H. Freeman and Company, New York (2002)). The 3' splice acceptor site typically is located at the 3' end of an intron.

The terms "canonical splice site" or "consensus splice site" may be used interchangeably and refer to splice sites that are conserved across species.

Consensus sequences for the 5' donor splice site and the 3' acceptor splice site used in eukaryotic RNA splicing are well known in the art. These consensus sequences include nearly invariant dinucleotides at each end of the intron: GT at the 5' end of the intron, and AG at the 3' end of an intron. The canonical splice donor site consensus sequence may be (for DNA) AG/GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is a purine and

indicates the cleavage site). This conforms to the more general splice donor consensus sequence MAGGURR described herein. It is well known in the art that a splice donor may deviate from this consensus, especially in viral genomes where other constraints bear on the same sequence, such as secondary structure for example within a vRNA packaging region. Non- canonical splice sites are also well known in the art, albeit they occur rarely compared to the canonical splice donor consensus sequence.

By “major splice donor site” is meant the first (dominant) splice donor site in the viral vector genome, encoded and embedded within the native viral RNA packaging sequence typically located in the 5’ region of the viral vector nucleotide sequence.

In one aspect the nucleotide sequence does not contain an active major splice donor site, that is splicing does not occur from the major splice donor site in said nucleotide sequence, and splicing activity from the major splice donor site is ablated.

The major splice donor site is located in the 5’ packaging region of a lentiviral genome.

In the case of the HIV-1 virus, the major splice donor consensus sequence is (for DNA) TG/GTRAGT (where A is adenosine, T is thymine, G is guanine, C is cytosine, R is a purine and indicates the cleavage site).

In one aspect of the invention, the splice donor region, i.e. the region of the vector genome which comprises the major splice donor site prior to mutation may have the following sequence:

GGGGCGGCGACTGGTGAGTACGCCAAAAAT ( SEQ ID NO : 1 )

In one aspect of the invention the mutated splice donor region may comprise the sequence: GGGGCGGCGACTGCAGACAACGCCAAAAAT ( SEQ ID NO : 2 - MSD-2KO )

In one aspect of the invention the mutated splice donor region may comprise the sequence: GGGGCGGCGAGTGGAGACTACGCCAAAAAT ( SEQ ID NO : 6 - MSD-2KOv2 )

In one aspect of the invention the mutated splice donor region may preferably comprise the sequence:

GGGGAAGGCAACAGATAAATATGCCTTAAAAT ( SEQ ID NO : 7 - MSD-2KOm5 ) In one aspect of the invention prior to modification the splice donor region may comprise the sequence:

GGCGACTGGTGAGTACGCC ( SEQ ID NO : 5 )

This sequence is also referred to herein as the “stem loop 2” region (SL2). This sequence may form a stem loop structure in the splice donor region of the vector genome. In one aspect of the invention this sequence (SL2) may have been deleted from the nucleotide sequence according to the invention as described herein.

As such, the invention encompasses a nucleotide sequence that does not comprise SL2. The invention encompasses a nucleotide sequence that does not comprise a sequence according to SEQ ID NO:5.

In one aspect of the invention the major splice donor site may have the following consensus sequence, wherein R is a purine and "/" is the cleavage site:

TG/GTRAGT

In one aspect, R may be guanine (G).

In one aspect of the invention, the major splice donor and cryptic splice donor region may have the following core sequence, wherein "/" are the cleavage sites at the major splice donor and cryptic splice donor sites:

/GTGA/GTA .

In one aspect of the invention the MSD-mutated vector genome may have at least two mutations in the major splice donor and cryptic splice donor ‘region’ (/GTGA/GTA), wherein the first and second ‘GT’ nucleotides are the immediately 3’ of the major splice donor and cryptic splice donor nucleotides respectively.

In one aspect of the invention the major splice donor consensus sequence is CTGGT. The major splice donor site may contain the sequence CTGGT.

In one aspect the nucleotide sequence, prior to inactivation of the splice sites, comprises the sequence as set forth in any of SEQ ID NOs: 1 , and/or 5, and/or the sequences TG/GTRAGT, /GTGA/GTA, TGAGT, and/or CTGGT. In one aspect the nucleotide sequence comprises an inactivated major splice donor site which would otherwise have a cleavage site between nucleotides corresponding to nucleotides 13 and 14 of SEQ ID NO:1.

According to the invention as described herein, the nucleotide sequence may also contain an inactive cryptic splice donor site. In one aspect the nucleotide sequence does not contain an active cryptic splice donor site adjacent to (3’ of) the major splice donor site, that is to say that splicing does not occur from the adjacent cryptic splice donor site, and splicing from the cryptic splice donor site is ablated.

The term "cryptic splice donor site" refers to a nucleic acid sequence which does not normally function as a splice donor site or is utilised less efficiently as a splice donor site due to the adjacent sequence context (e.g. the presence of a nearby ‘preferred’ splice donor), but can be activated to become a more efficient functioning splice donor site by mutation of the adjacent sequence (e.g. mutation of the nearby ‘preferred’ splice donor).

In one aspect the cryptic splice donor site is the first cryptic splice donor site 3’ of the major splice donor.

In one aspect the cryptic splice donor site is within 6 nucleotides of the major splice donor site on the 3’ side of the major splice donor site. Preferably the cryptic splice donor site is within 4 or 5, preferably 4, nucleotides of the major splice donor cleavage site.

In one aspect of the invention the cryptic splice donor site has the consensus sequence TGAGT .

In one aspect the nucleotide sequence comprises an inactivated cryptic splice donor site which would otherwise have a cleavage site between nucleotides corresponding to nucleotides 17 and 18 of SEQ ID NO:1.

In one aspect of the invention the major splice donor site and/or adjacent cryptic splice donor site contain a “GT” motif. In one aspect of the invention both the major splice donor site and adjacent cryptic splice donor site contain a “GT” motif which is mutated. The mutated GT motifs may inactivate splice activity from both the major splice donor site and adjacent cryptic splice donor site. An example of such a mutation is referred to herein as “MSD-2KO”. In one aspect the splice donor region may comprise the following sequence:

CAGACA

For example, in one aspect the mutated splice donor region may comprise the following sequence:

GGCGACTGCAGACAACGCC ( SEQ ID NO : 3 )

A further example of an inactivating mutation is referred to herein as “MSD-2KOv2”.

In one aspect the mutated splice donor region may comprise the following sequence: GTGGAGACT

GGCGAGTGGAGACTACGCC ( SEQ ID NO : 4 )

AAGGCAACAGATAAATATGCCTT ( SEQ ID NO : 8 )

In one aspect the stem loop 2 region as described above may be deleted from the splice donor region, resulting in inactivation of both the major splice donor site and the adjacent cryptic splice donor site. Such a deletion is referred to herein as “ASL2”.

A variety of different types of mutations can be introduced into the nucleic acid sequence in order to inactivate the major and adjacent cryptic splice donor sites.

In one aspect the mutation is a functional mutation to ablate or suppress splicing activity in the splice region. The nucleotide sequence as described herein may contain a mutation or deletion in any of the nucleotides in any of SEQ ID NOs: 1 , and/or 5, and/or the sequence TG/GTRAGT, /GTGA/GTA, TGAGT, and/or CTGGT. Suitable mutations will be known to one skilled in the art, and are described herein.

For example, a point mutation can be introduced into the nucleic acid sequence. The term "point mutation," as used herein, refers to any change to a single nucleotide. Point mutations include, for example, deletions, transitions, and transversions; these can be classified as nonsense mutations, missense mutations, or silent mutations when present within protein coding sequence. A "nonsense" mutation produces a stop codon. A "missense" mutation produces a codon that encodes a different amino acid. A "silent" mutation produces a codon that encodes either the same amino acid or a different amino acid that does not alter the function of the protein. One or more point mutations can be introduced into the nucleic acid sequence comprising the cryptic splice donor site. For example, the nucleic acid sequence comprising the cryptic splice site can be mutated by introducing two or more point mutations therein.

At least two point mutations can be introduced in several locations within the nucleic acid sequence comprising the major splice donor and cryptic splice donor sites to achieve attenuation of splicing from the splice donor region. In one aspect the mutations may be within the four nucleotides at the splice donor cleavage site; in the canonical splice donor consensus sequence this is A¹G²/G³T⁴, wherein "/" is the cleavage site. It is well known in the art that a splice donor cleavage site may deviate from this consensus, especially in viral genomes where other constraints bear on the same sequence, such as secondary structure for example within a vRNA packaging region. It is well known that the G³T⁴ dinucleotide is generally the least variable sequence within the canonical splice donor consensus sequence, and mutations to the G³ and or T⁴ will most likely achieve the greatest attenuating effect. For example, for the major splice donor site in HIV-1 viral vector genomes this can be T¹G²/G³T⁴, wherein "/" is the cleavage site. For example, for the cryptic splice donor site in HIV-1 viral vector genomes this can be G¹A²/G³T⁴, wherein "/" is the cleavage site. Additionally, the point mutation(s) can be introduced adjacent to a splice donor site. For example, the point mutation can be introduced upstream or downstream of a splice donor site. In aspects where the nucleic acid sequence comprising a major and/or cryptic splice donor site is mutated by introducing multiple point mutations therein, the point mutations can be introduced upstream and/or downstream of the cryptic splice donor site.

The nucleotide sequence encoding the RNA genome of the lentiviral vector according to the invention may optionally further comprise a mutation in a cryptic splice donor site within the SL4 loop of the packaging sequence. In one aspect a GT dinucleotide in said cryptic splice donor site within the SL4 loop of the packaging sequence is mutated to GC.

Construction of Splice Site Mutants

Splice site mutants of the present invention may be constructed using a variety of techniques. For example, mutations may be introduced at particular loci by synthesising oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence comprises a derivative having the desired nucleotide insertion, substitution, or deletion. By way of further example, splice site mutants may be constructed as described in WO 2021/160993.

Other known techniques allowing alterations of DNA sequence include recombination approaches such as Gibson assembly, Golden-gate cloning and In-fusion.

Alternatively, oligonucleotide-directed site-specific (or segment specific) mutagenesis procedures may be employed to provide an altered sequence according to the substitution, deletion, or insertion required. Deletion or truncation derivatives of splice site mutants may also be constructed by utilising convenient restriction endonuclease sites adjacent to the desired deletion. Subsequent to restriction, overhangs may be filled in, and the DNA religated. Exemplary methods of making the alterations set forth above are disclosed by Sambrook et al. (Molecular cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, 1989).

Splice site mutants may also be constructed utilising techniques of PCR mutagenesis, chemical mutagenesis, chemical mutagenesis (Drinkwater and Klinedinst, 1986) by forced nucleotide misincorporation (e.g., Liao and Wise, 1990), or by use of randomly mutagenised oligonucleotides (Horwitz et al., 1989).

The present invention also provides a method for producing a lentiviral vector nucleotide sequence, comprising the steps of: providing a nucleotide sequence encoding the RNA genome of a lentiviral vector as described herein; and mutating the major splice donor site and cryptic splice donor site as described herein in said nucleotide sequence.

Vector-Intron Improves Vector Titre Losses Associated With Mutated MSD

MSD mutated lentiviral vectors (e.g. ‘MSD-2KO’) are preferable to current standard lentiviral vectors for use as gene therapy vectors due to their reduced capacity to partake in aberrant splicing events both during LV production and in target cells. However, until the present invention, the production of MSD mutated vectors has either relied upon supply of the HIV-1 tat protein (1^st and 2^nd generation U3-dependent lentiviral vectors), has been of lower efficiency due to the destabilising effect of mutating the MSD on vector RNA levels (in 3^rd generation vectors), or, as discovered by the present inventors, is improved by co-expression of modified U1 snRNA. The present inventors have previously found that MSD-mutated, 3^rd generation (i.e. U3/tat-independent) LVs could be produced to high titre by co-expression of a modified U1 snRNA directed to bind to the 5’packaging region of the vector genome RNA during production.

The amount of vRNA produced from so-called MSD-mutated (e.g. MSD-2KO) lentiviral vector genomes is typically substantially reduced, leading to lower vector titres. It is theorized that an ‘early’ interaction with the MSD and U1 snRNA (prior to splicing decisions) is important for transcription elongation from the external promoter. One previous solution to this problem was to provide a modified U1 snRNA in trans during LV production to stabilize the vRNA (seeWO 2021/014157 and WO 2021/160993). However, surprisingly the inventors found in the present invention that the inclusion of a single intron - herein referred to as the ‘Vector-Intron’ (VI) - within MSD-2KO LV genome expression cassettes was able to stabilize the vRNA in an analogous manner to the co-expressed modified U1 snRNA, leading to a recovery in LV titre (e.g. see Example 1). Moreover, it was surprisingly discovered that deletion of the RRE not only improved the titre-boosting effect of the VI but also resulted in a rev/RRE-independent LV genome (see Example 1). Even more surprising was that the MSD-2KO feature appeared to be beneficial, permitting the achievement of the highest LV titres using the VI in a RRE- deleted LV genome (see Example 1). Therefore, the MSD-2KO and VI features of these new class of rev/RRE-independent LV genomes are mutually ‘symbiotic’, i.e. mutually beneficial, at the molecular level. In this regard, the VI rescues the negative impact of the MSD-2KO mutation on LV vRNA production/titres, and the MSD-2KO mutation stops aberrant splicing to internal splice acceptors (including that of the VI) and to allow for maximal titres of VI- containing, RRE-deleted LV genomes.

Hence, the Inventors show that the VI is sufficient to recover LV titres without the need to employ the modified U1 snRNA disclosed in WO 2021/014157 and WO 2021/160993. Therefore, the invention herein also concerns the novel use of VI to increase titres of MSD- 2KO mutated LVs. Surprisingly therefore, the VI feature and MSD/crSD mutations are functionally mutually beneficial in generating RRE-deleted LVs.

In one aspect the present invention provides a lentiviral vector genome comprising a vector intron as described herein, wherein said vector intron has the surprising effect of compensating for or recovering vector titre losses incurred due to the presence of modified MSD and adjacent cryptic splice donor (crSD) (e.g. MSD-2KO). Hence, in another aspect, the present invention provides lentiviral vector genomes comprising any combination of VI and MSD-2KO as defined herein.

U1 snRNA

Splicing and polyadenylation are key processes for mRNA maturation, particularly in higher eukaryotes where most protein-coding transcripts contain multiple introns. The elements within a pre-mRNA that are required for splicing include the 5' splice donor signal, the sequence surrounding the branch point and the 3' splice acceptor signal. Interacting with these three elements is the spliceosome, which is formed by five small nuclear RNAs (snRNAs), including U1 snRNA, and associated nuclear proteins (snRNP). U1 snRNA is expressed by a polymerase II promoter and is present in most eukaryotic cells (Lund et al., 1984, J. Biol. Chem., 259:2013-2021). Human U1 snRNA (small nuclear RNA) is 164 nt long with a well-defined structure consisting of four stem-loops (West, S., 2012, Biochemical Society Transactions, 40:846-849). U1 snRNA contains a short sequence at its 5’-end that is broadly complementary to the 5’ splice donor sites at exon-intron junctions. U1 snRNA participates in splice-site selection and spliceosome assembly by base pairing to the 5’ splice donor site. A known function for U1 snRNA outside splicing is in the regulation of 3’-end mRNA processing: it suppresses premature polyadenylation (polyA) at early polyA signals (particularly within introns).

Human U1 snRNA (small nuclear RNA) is 164 nt long with a well-defined structure consisting of four stem-loops (see Figure 1). The endogenous non-coding RNA, U1 snRNA, binds to the consensus 5’ splice donor site (e.g. 5’-MAGGURR-3’, wherein M is A or C and R is A or G) via the native splice donor annealing sequence (e.g. 5’-ACUUACCUG-3’) during early steps of intron splicing. Stem loop I binds to U1A-70K protein that has been shown to be important for polyA suppression. Stem loop II binds to U1A protein, and the 5’-AUUUGUGG- 3’ sequence binds to Sm proteins, which together with Stem loop IV, is important for U1 snRNA processing.

Viral c/s-acting sequences

ORFs present in the vector backbone delivered in transduced (e.g. patient) cells could be transcribed, for example, when read-through transcription from upstream cellular promoters occurs (lentiviral vectors target active transcription sites), leading to potential aberrant transcription of genetic material located in the vector backbone in patient cells. This potential aberrant transcription of genetic material located in the vector backbone following read- through transcription could also occur during lentiviral vector production in production cells.

The viral c/s-acting sequence present within lentiviral vector genomes may contain multiple internal ORFs. These internal ORFs may be found between an internal ATG sequence of the viral c/s-acting sequence and the stop codon immediately 3’ to the ATG sequence.

Modifications in a viral c/s-acting sequence to disrupt at least one internal ORF, for example by mutating the ATG sequence which denotes the start of the at least one internal ORF, are tolerated. Thus, the modified viral c/s-acting sequence described herein retains its function.

Accordingly, in some embodiments of the present invention, the lentiviral vector genome comprises at least one modified viral c/s-acting sequence, wherein at least one internal open reading frame (ORF) in the viral c/s-acting sequence is disrupted (see WO 2021/181108, incorporated herein by reference in its entirety). The at least one internal ORF may be disrupted by mutating at least one ATG sequence as described herein (ATG sequences may function as translation initiation codons).

In some embodiments of the present invention, the lentiviral vector genome comprises a modified nucleotide sequence encoding gag, wherein at least one internal ORF in the modified nucleotide sequence encoding gag is disrupted (see WO 2021/181108, incorporated herein by reference in its entirety). The at least one internal ORF in the modified nucleotide sequence encoding gag may be disrupted by mutating at least one ATG sequence as described herein.

Suitable modified viral c/s-acting sequences and modified nucleotide sequences encoding gag for use according to the present invention are described in WO 2021/181108 and are incorporated herein by reference.

In some embodiments, the lentiviral vector genome comprises at least two (suitably at least three, at least four, at least five, at least six, at least seven) modified viral c/s-acting sequences.

In some embodiments, at least two (suitably at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen or at least twenty) internal ORFs in the at least one viral c/s-acting sequence and/or in the nucleotide sequence encoding gag may be disrupted. In some embodiments, at least three internal ORFs in the at least one viral c/s-acting sequence and/or in the nucleotide sequence encoding gag may be disrupted.

In some embodiments, one (suitably, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen or twenty) internal ORFs in the at least one viral c/s-acting sequence and/or in the nucleotide sequence encoding gag may be disrupted.

In some embodiments, the at least one internal ORF may be disrupted such that the internal ORF is not expressed. In some embodiments, the at least one internal ORF may be disrupted such that the internal ORF is not translated. In some embodiments, the at least one internal ORF may be disrupted such that no protein is expressed from the internal ORF. In some embodiments, the at least one internal ORF may be disrupted such that no protein is translated from the internal ORF. Thus, the at least one internal ORF present in the modified viral c/s- acting sequence and/or in the modified nucleotide sequence encoding gag in the vector backbone delivered in transduced cells may be disrupted such that aberrant transcription of the internal ORF is prevented when there is read-through transcription from upstream cellular promoters.

In one embodiment, the at least one internal ORF may be disrupted by mutating at least one ATG sequence. A “mutation” of an ATG sequence may comprise one or more nucleotide deletions, additions, or substitutions.

In one embodiment, the at least one ATG sequence may be mutated in the modified viral c/s- acting sequence and/or in the nucleotide sequence encoding gag to a sequence selected from the group consisting of: a) an ATTG sequence; b) an ACG sequence; c) an A-G sequence; d) an AAG sequence; e) a TTG sequence; and/or f) an ATT sequence.

The at least one ATG sequence may be mutated to an ATTG sequence in the modified viral c/s-acting sequence and/or in the modified nucleotide sequence encoding gag. The at least one ATG sequence may be mutated to an ACG sequence in the modified viral c/s-acting sequence and/or in the modified nucleotide sequence encoding gag. The at least one ATG sequence may be mutated to an A-G sequence in the modified viral c/s-acting sequence and/or in the modified nucleotide sequence encoding gag. The at least one ATG sequence may be mutated to an AAG sequence in the modified viral c/s-acting sequence and/or in the modified nucleotide sequence encoding gag. The at least one ATG sequence may be mutated to a TTG sequence in the modified viral c/s-acting sequence and/or in the modified nucleotide sequence encoding gag. The at least one ATG sequence may be mutated to an ATT sequence in the modified viral c/s-acting sequence and/or in the modified nucleotide sequence encoding gag.

In one embodiment, the at least one modified viral c/s-acting element and/or the modified nucleotide sequence encoding gag may lack ATG sequences.

In some embodiments, all ATG sequences within viral c/s-acting sequences and/or within the nucleotide sequence encoding gag in the lentiviral vector genome are mutated.

Lentiviral vectors typically comprise multiple viral c/s-acting sequences. Example viral c/s- acting sequences include gag-p17, central polypurine tract (cppt) and Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE).

In some embodiments, the at least one viral c/s-acting sequence may be at least one lentiviral c/s-acting sequence. Example lentiviral c/s-acting sequences include the cppt.

In some embodiments, the at least one viral c/s-acting sequence may be at least one non- lentiviral c/s-acting sequence.

In some embodiments, the at least one viral c/s-acting sequence may be at least one lentiviral c/s-acting sequence and at least one non-lentiviral c/s-acting sequence.

In some embodiments, the at least one viral c/s-acting sequence is: a) gag-p17;and/or b) a Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE).

In some embodiments, the at least one viral c/s-acting sequence is gag-p17.

In some embodiments, the at least one viral c/s-acting sequence is a WPRE. In some embodiments, the lentiviral vector genome comprises at least two (suitably, at least 3, at least 4, at least 5) modified viral c/s-acting sequences.

In some embodiments, the lentiviral vector genome comprises a modified WPRE as described herein.

In one embodiment, the lentiviral vector genome as described herein lacks ATG sequences in the backbone of the vector genome. In one embodiment, the lentiviral vector genome as described herein lacks ATG sequences except in the NOI (transgene).

In one embodiment, the lentiviral vector genome comprises at least one modified viral c/s- acting sequence and/or a modified nucleotide sequence encoding gag, wherein at least one internal open reading frame (ORF) in the viral c/s-acting sequence or in the nucleotide sequence encoding gag is ablated.

In one embodiment, the lentiviral vector genome comprises at least one modified viral c/s- acting sequence and/or a modified nucleotide sequence encoding gag, wherein at least one internal open reading frame (ORF) in the viral c/s-acting sequence or in the nucleotide sequence encoding gag is silenced.

Modified gag and viral Gag-p17 protein

The nucleotide sequence encoding gag may be a truncated nucleotide sequence encoding a part of gag. The nucleotide sequence encoding gag may be a minimal truncated nucleotide sequence encoding a part of gag. The part of gag may be a contiguous sequence. The truncated nucleotide sequence or minimal truncated nucleotide sequence encoding a part of gag may also contain at least one frameshift mutation.

An example truncated nucleotide sequence encoding a part of gag and which contains a frameshift mutation at position 45-46 is as follows:

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGG CCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGC AGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCC TTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAA AGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGGAGAGCAAAACAAAAGTAAGA

( SEQ ID NO : 9 ) . An example minimal truncated nucleotide sequence encoding a part of gag and which contains a frameshift mutation at position 45-46 is as follows:

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAGG CCAGGGGGAAAGA ( SEQ ID NO : 10 ) .

The nucleotide sequence encoding gag may, for example, comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 9; or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 10.

The modified nucleotide sequence encoding gag may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 9; or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 10.

The modified nucleotide sequence encoding gag may comprise the sequence as set forth in SEQ ID NO: 9 or SEQ ID NO: 10, or a sequence having at least 80% identity (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) thereto, wherein at least one ATG sequence selected from (a) to (c) is mutated: a) ATG corresponding to positions 1-3 of SEQ ID NO: 9; b) ATG corresponding to positions 47-49 of SEQ ID NO: 9; and/or c) ATG corresponding to positions 107-109 of SEQ ID NO: 9.

An example modified truncated nucleotide sequence encoding part of gag and which contains a frameshift mutation is as follows:

ACGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATTGGGAAAAAATTCGGTTAAG

GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATTGGGCAAGCAGGGAGCTAGAACGATTC GCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATC

CCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATC AAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGGAGAGCAAAACAAAAGTAAG A ( SEQ ID NO : 11 ) .

An example modified minimal truncated nucleotide sequence encoding a part of gag and which contains a frameshift mutation is as follows:

ACGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATTGGGAAAAAATTCGGTTAAG GCCAGGGGGAAAGA ( SED ID NO : 12 ) .

The modified nucleotide sequence encoding gag may comprise the sequence as set forth in SEQ ID NO: 11 , or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than three (suitably less than two or less than one) ATG sequences.

The modified nucleotide sequence encoding gag may comprise the sequence as set forth in SEQ ID NO: 12, or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than two (suitably less than one) ATG sequences.

The modified nucleotide sequence encoding gag may comprise less than three ATG sequences. Suitably, the modified nucleotide sequence encoding gag may comprise less than two or less than one ATG sequence(s). The modified nucleotide sequence encoding gag may lack an ATG sequence.

Lentiviral vector genomes lacking a nucleotide sequence encoding Gag-p17 or a fragment thereof are described in WO 2021/181108, incorporated herein by reference in its entirety. Such lentiviral vector genomes as described in WO 2021/181108 are suitable for use according to the present invention.

The lentiviral vector genome as described herein may lack a nucleotide sequence encoding Gag-p17 or a fragment thereof. The lentiviral vector genome may, for example, not express Gag-p17 or a fragment thereof. In one embodiment, the lentiviral vector genome may lack the sequence as set forth in SEQ ID NO: 13. The viral protein Gag-p17 surrounds the capsid of the lentiviral vector particle, and is in turn surrounded by the envelope protein. A nucleotide sequence encoding Gag-p17 has historically been included in lentiviral vector genomes for the production of therapeutic lentiviral vectors. The nucleotide sequence encoding Gag-p17 present within lentiviral vector genomes is typically embedded within the packaging region containing highly structured RNA towards the 5’ region of the RNA (the 5’IITR). The nucleotide sequence encoding Gag-p17 typically comprises an RNA instability sequence (INS), herein referred to as p17-INS.

Deletion of p17-INS from the backbone of the lentiviral vector genome does not significantly impact vector titres during lentiviral vector production.

The lentiviral vector genome lacking a nucleotide sequence encoding Gag-p17 or p17-INS is of a smaller size compared to a lentiviral vector genome comprising a nucleotide sequence encoding Gag-p17 or p17-INS. Thus, the amount of viral DNA contained within the viral vector backbone delivered in transduced cells is reduced when a lentiviral vector genome lacking a nucleotide sequence encoding Gag-p17 or p17-INS is used. Further, the lentiviral vector genome lacking a nucleotide sequence encoding Gag-p17 or p17-INS may be used to deliver a transgene of larger size than the transgenes which can be delivered using a lentiviral vector genome containing a nucleotide sequence encoding Gag-p17 or p17-INS. Therefore, there are several reasons why it may be desirable to delete nucleotide sequence encoding Gag-p17 or p17-INS within the vector backbone.

In some embodiments, the lentiviral vector genome lacks either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17.

In some embodiments, the lentiviral vector genome lacks a nucleotide sequence encoding p17-INS or a fragment thereof.

An example p17-INS is as follows:

AAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGC CTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATC AGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAA AAGACACCAAGGAAGCTTTAGACAAGATAGAGGGAGAGCAAAACAAAAGTA ( SEQ ID NO : 13 ) .

In one embodiment, the lentiviral vector genome may lack the sequence as set forth in SEQ ID NO: 13. In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 is a part of a full-length nucleotide sequence encoding Gag-p17. In one embodiment, the fragment comprises or consists of at least about 10 nucleotides (suitably at least about 20, at least about 30, at least about 40, at least about 50, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350 nucleotides).

In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is between 1 % and 99% of full-length nucleotide sequence encoding Gag-p17. Suitably, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is at least about 10% (suitably at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%) of a full-length nucleotide sequence encoding Gag-p17, such as a native nucleotide sequence encoding Gagpl 7. The fragment may be a contiguous region of a full-length nucleotide sequence encoding Gag-p17, such as a native nucleotide sequence encoding Gag-p17.

In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is between 1% and 99% of full-length nucleotide sequence encoding p17-INS. Suitably, the fragment of a nucleotide sequence encoding Gag-p17 may have a length which is at least about 10% (suitably at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%) of a full-length nucleotide sequence encoding p17-INS, such as a native nucleotide sequence encoding p17- INS (e.g. SEQ ID NO: 13). The fragment may be a contiguous region of a full-length nucleotide sequence encoding p17-INS, such as a native nucleotide sequence encoding p17-INS (e.g. SEQ ID NO: 13).

In one embodiment, the fragment of a nucleotide sequence encoding Gag-p17 comprises or consists of the INS located in the nucleotide sequence encoding Gag-p17.

In one embodiment, the lentiviral vector genome lacking either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17 comprises at least one modified viral c/s-acting sequence as described herein. In one embodiment, the lentiviral vector genome lacking either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17 may comprise a modified WPRE and/or a modified nucleotide sequence encoding gag as described herein.

In one embodiment, the lentiviral vector genome lacking either (i) a nucleotide sequence encoding Gag-p17 or (ii) a fragment of a nucleotide sequence encoding Gag-p17 may comprise a modified WPRE as described herein and a modified nucleotide sequence encoding gag as described herein.

Deletion of gag sequences in order to reduce lentiviral vector genome sequences has been reported (Sertkaya, H., et al., Sci Rep 11 , 12067 (2021)). However, the reported genomes required RRE (and WPRE) for optimal vector titre and transgene expression, in contrast to the advantageous rev-independence of the present invention. The configuration of the RRE- dependent genomes reported by Sertkaya, H., et al. (2021) leads to the omission of the RRE being reverse transcribed into cDNA and effectively increasestransgene capacity, However, the presence of the RRE on the vector genome RNA still contributes towards vector genome RNA length, and consequently also to constraints on [1] steady state pools of vector genome RNA during vector production, and [2] on packaging efficiency. As such, the combination of gag-deletions in the packaging signal as described herein with the VI of the current invention provides a better solution to both of these points, as well as increasing ‘delivered’ transgene capacity.

Modified Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE)

In some embodiments, the lentiviral vector genome comprises a modified Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE), wherein at least one internal open reading frame (ORF) in the WPRE is disrupted as described herein.

The WPRE can enhance expression from a number of different vector types including lentiviral vectors (U.S. Patent Nos. 6,136,597; 6,287,814; Zufferey, R., et al. (1999) J. Virol. 73: 2886- 92). Without wanting to be bound by theory, this enhancement is thought to be due to improved RNA processing at the post-transcriptional level, resulting in increased levels of nuclear transcripts. A two-fold increase in mRNA stability also contributes to this enhancement (Zufferey, R., et al. ibid). The level of enhancement of protein expression from transcripts containing the WPRE versus those without the WPRE has been reported to be around 2-to-5 fold, and correlates well with the increase in transcript levels. This has been demonstrated with a number of different transgenes (Zufferey, R., et al. ibid).

The WPRE contains three c/s-acting sequences important for its function in enhancing expression levels. In addition, it contains a fragment of approximately 180 bp comprising the 5’-end of the WHV X protein ORF (full length ORF is 425bp), together with its associated promoter. The full-length X protein has been implicated in tumorigenesis (Flajolet, M. et al, (1998) J. Virol. 72: 6175-6180). Translation from transcripts initiated from the X promoter results in formation of a protein representing the NH2-terminal 60 amino acids of the X protein. This truncated X protein can promote tumorigenesis, particularly if the truncated X protein sequence is integrated into the host cell genome at specific loci (Balsano, C. et al, (1991) Biochem. Biophys Res. Commun. 176: 985-92; Flajolet, M. et al, (1998) J. Virol. 72: 6175-80; Zheng, Y.W., et al, (1994) J. Biol. Chem. 269: 22593-8; Runkel, L., et al, (1993) Virology 197: 529-36). Therefore, expression of the truncated X protein could promote tumorigenesis if delivered to cells of interest, precluding safe use of wild-type WPRE sequences.

US 2005/0002907 discloses that mutation of a region of the WPRE corresponding to the X protein ORF ablates the tumorigenic activity of the X protein, thereby allowing the WPRE to be used safely in retroviral and lentiviral expression vectors to enhance expression levels of heterologous genes or nucleotides of interest.

As used herein, the “X region” of the WPRE is defined as comprising at least the first 60-amino acids of the X protein ORF, including the translation initiation codon, and its associated promoter. A “functional” X protein is defined herein as a truncated X protein that is capable of promoting tumorigenesis, or a transformed phenotype, when expressed in cells of interest. A “non-functional” X protein in the context of this application is defined as an X protein that is incapable of promoting tumorigenesis in cells of interest.

The modified WPREs described herein retain the capacity to enhance expression from the lentiviral vector.

The modified WPRE may comprise less than seven ATG sequences. The modified WPRE may comprise less than six ATG sequences.

Accordingly, in some embodiments, the lentiviral vector genome comprises a modified Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE), wherein the modified WPRE comprises less than seven ATG sequences, preferably less than six ATG sequences.

Suitably, the modified WPRE may comprise less than seven, less than six, less than five, less than four, less than three, less than two or less than one ATG sequence(s). The modified WPRE may lack ATG sequences.

In some embodiments, at least one ATG sequence in the X region of the WPRE is mutated, whereby expression of a functional X protein is prevented. In preferred embodiments, the mutation is in the translation initiation codon of the X region. As a result of the mutation of the at least one ATG sequence, the X protein may not be expressed.

In some embodiments, the modified WPRE does not comprise a mutation in an ATG sequence in the X region of the WPRE.

An example WPRE sequence is as follows:

AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCT TTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCT GCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTT CCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCC TTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC ( SEQ ID NO : 14 ) .

An example WPRE sequence which contains a disrupted X-protein ORF is as follows:

AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCT TTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCT GCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTT CCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCC TTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC ( SEQ ID NO : 15 ) . The WPRE may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 14; and/or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 15.

The modified WPRE may comprise: a) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 14; and/or b) a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to SEQ ID NO: 15.

The modified WPRE may comprise the sequence as set forth in SEQ ID NO: 14 or SEQ ID NO: 15, or a sequence having at least 80% identity (suitably at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) thereto, wherein at least one ATG sequence selected from the group (a)-(g) is mutated: a) ATG corresponding to positions 53-55 of SEQ ID NO: 14; b) ATG corresponding to positions 72-74 of SEQ ID NO: 14; c) ATG corresponding to positions 91-93 of SEQ ID NO: 14; d) ATG corresponding to positions 104-106 of SEQ ID NO: 14; e) ATG corresponding to positions 121-123 of SEQ ID NO: 14; f) ATG corresponding to positions 170-172 of SEQ ID NO: 14; and/or g) ATG corresponding to positions 411-413 of SEQ ID NO: 14.

The WRPE typically contains a retained Pol ORF. An example retained Pol ORF sequence is as follows:

ATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCAC TGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCA

CGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAAT TCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCT

GCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGC TGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCC GCCTCC ( SEQ ID NO : 16 ) .

In one embodiment, at least one (suitably at least two or at least three) ATG sequence within the retained Pol ORF sequence in the WPRE is mutated. In one embodiment, all ATG sequences within the retained Pol ORF sequence in the WPRE are mutated.

In one embodiment, the modified WPRE comprises less than three (suitably less than two or less than one) ATG sequences in the retained Pol ORF sequence in the WPRE. In one embodiment, the modified WPRE lacks an ATG sequence in the retained Pol ORF sequence in the WPRE.

An example modified WPRE sequence in which all ATG codons within the retained Pol ORF are mutated is as follows:

AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATTGCTATTGCTTCCCGTATGGCTTTCATTTTC TCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATTGAGGAGTTGTGGCCCGTTGTCAGGCAACGTG GCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTC CTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCG CTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCT TTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCG GCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCG CCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC ( SEQ ID NO : 17 ) .

An example of a modified WPRE sequence lacking an ATG sequence is as follows:

AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATtGTTGCTCCTTTTA CGCTATtGTGGATACGCTGCTTTAATtGCCTTTGTATCATtGCTATTGCTTCCCGTATtGGCTTTCAT TTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATtGAGGAGTTGTGGCCCGTTGTCAGGCAA CGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCA GCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTG CCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCG TCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCC TTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTC TTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCC ( SEQ ID NO : 18 ) . The modified WPRE may comprise the sequence as set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a sequence having at least 80% (suitably at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity thereto. The sequence may comprise less than six (suitably less than five, less than four, less than three, less than two or less than one) ATG sequences.

Vector / Expression Cassette

A vector is a tool that allows or facilitates the transfer of an entity from one environment to another. In accordance with the present invention, and by way of example, some vectors used in recombinant nucleic acid techniques allow entities, such as a segment of nucleic acid (e.g. a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into and expressed by a target cell. The vector may facilitate the integration of the nucleotide sequence encoding a viral vector component to maintain the nucleotide sequence encoding the viral vector component and its expression within the target cell.

The vector may be or may include an expression cassette (also termed an expression construct). Expression cassettes as described herein comprise regions of nucleic acid containing sequences capable of being transcribed. Thus, sequences encoding mRNA, tRNA and rRNA are included within this definition.

The vector may contain one or more selectable marker genes (e.g. a neomycin resistance gene) and/or traceable marker gene(s) (e.g. a gene encoding green fluorescent protein (GFP)). Vectors may be used, for example, to infect and/or transduce a target cell. The vector may further comprise a nucleotide sequence enabling the vector to replicate in the host cell in question, such as a conditionally replicating oncolytic vector.

The term "cassette" - which is synonymous with terms such as "conjugate", "construct" and "hybrid" - includes a polynucleotide sequence directly or indirectly attached to a promoter. Preferably the cassette comprises at least a polynucleotide sequence operably linked to a promoter. For example, expression cassettes for use in the invention may comprise a promoter for the expression of the nucleotide sequence encoding a viral vector component and optionally a regulator of the nucleotide sequence encoding the viral vector component.

The choice of expression cassette, e.g. plasmid, cosmid, virus or phage vector, will often depend on the host cell into which it is to be introduced. The expression cassette can be a DNA plasmid (supercoiled, nicked or linearised), minicircle DNA (linear or supercoiled), plasmid DNA containing just the regions of interest by removal of the plasmid backbone by restriction enzyme digestion and purification, DNA generated using an enzymatic DNA amplification platform e.g. doggybone DNA (dbDNA™) where the final DNA used is in a closed ligated form or where it has been prepared (e.g. restriction enzyme digestion) to have open cut ends.

Lentiviral Vector Production Systems and Cells

A lentiviral vector production system comprises a set of nucleotide sequences encoding the components required for production of the lentiviral vector. Accordingly, a vector production system comprises a set of nucleotide sequences which encode the viral vector components necessary to generate lentiviral vector particles.

In some aspects, particles produced by the sequences and methods herein comprises a splice junction sequence, preferably corresponding to SEQ ID NO: 19. Such particles comprise said junctional sequence by virtue of splicing of the VI.

An illustrative splice junction sequence is provided below (bold denotes the CAG from the splice donor and the GT from the splice acceptor; 7” denotes the junction site):

GAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACTAGTCAGACTCATCAAGCTTCTCTATCAAAG CAG/GTGTCCACTCCCAGTT ( SEQ ID NO : 19 ) .

“Viral vector production system” or “vector production system” or “production system” is to be understood as a system comprising the necessary components for lentiviral vector production.

In one aspect, the viral vector production system comprises nucleotide sequences encoding Gag and Gag/Pol proteins, and an Env protein and the vector genome sequence.

In one aspect, the viral vector production system comprises modular nucleic acid constructs (modular constructs). A modular construct is a DNA expression construct comprising two or more nucleic acids used in the production of lentiviral vectors. A modular construct can be a DNA plasmid comprising two or more nucleic acids used in the production of lentiviral vectors. The plasmid may be a bacterial plasmid. The nucleic acids can encode for example, gag-pol, env, vector genome. In addition, modular constructs designed for generation of packaging and producer cell lines may additionally need to encode transcriptional regulatory proteins (e.g. TetR, CymR) and/or translational repression proteins (e.g. TRAP) and selectable markers (e.g. Zeocin™, hygromycin, blasticidin, puromycin, neomycin resistance genes). Suitable modular constructs for use in the present invention are described in EP 3502260, which is hereby incorporated by reference in its entirety.

As the modular constructs for use in accordance with the present invention contain nucleic acid sequences encoding two or more of the retroviral components on one construct, the safety profile of these modular constructs has been considered and additional safety features directly engineered into the constructs. These features include the use of insulators for multiple open reading frames of retroviral vector components and/or the specific orientation and arrangement of the retroviral genes in the modular constructs. It is believed that by using these features the direct read-through to generate replication-competent viral particles will be prevented.

The nucleic acid sequences encoding the viral vector components may be in reverse and/or alternating transcriptional orientations in the modular construct. Thus, the nucleic acid sequences encoding the viral vector components are not presented in the same 5’ to 3’ orientation, such that the viral vector components cannot be produced from the same mRNA molecule. The reverse orientation may mean that at least two coding sequences for different vector components are presented in the ‘head-to-head’ and ‘tail-to-tail’ transcriptional orientations. This may be achieved by providing the coding sequence for one vector component, e.g. env, on one strand and the coding sequence for another vector component, e.g. rev, on the opposing strand of the modular construct. Preferably, when coding sequences for more than two vector components are present in the modular construct, at least two of the coding sequences are present in the reverse transcriptional orientation. Accordingly, when coding sequences for more than two vector components are present in the modular construct, each component may be orientated such that it is present in the opposite 5’ to 3’ orientation to all of the adjacent coding sequence(s) for other vector components to which it is adjacent, i.e. alternating 5’ to 3’ (or transcriptional) orientations for each coding sequence may be employed.

The modular construct for use according to the present invention may comprise nucleic acid sequences encoding two or more of the following vector components: gag-pol, env, vector genome. The modular construct may comprise nucleic acid sequences encoding any combination of the vector components. In one aspect, the modular construct may comprise nucleic acid sequences encoding: i) the RNA genome of the retroviral vector and gag-pol; ii) the RNA genome of the retroviral vector and env; iii) gag-pol and env; iv) the RNA genome of the retroviral vector, gag-pol and env; or wherein the nucleic acid sequences are in reverse and/or alternating orientations.

In one aspect, a cell for producing retroviral vectors may comprise nucleic acid sequences encoding any one of the combinations i) to iv) above, wherein the nucleic acid sequences are located at the same genetic locus and are in reverse and/or alternating orientations. The same genetic locus may refer to a single extrachromosomal locus in the cell, e.g. a single plasmid, or a single locus (i.e. a single insertion site) in the genome of the cell. The cell may be a stable or transient cell for producing retroviral vectors, e.g. lentiviral vectors. In one aspect the cell does not comprise tat.

The DNA expression construct can be a DNA plasmid (supercoiled, nicked or linearised), minicircle DNA (linear or supercoiled), plasmid DNA containing just the regions of interest by removal of the plasmid backbone by restriction enzyme digestion and purification, DNA generated using an enzymatic DNA amplification platform e.g. doggybone DNA (dbDNA™) where the final DNA used is in a closed ligated form or where it has been prepared (e.g restriction enzyme digestion) to have open cut ends.

In one aspect, the lentiviral vector as described herein is derived from HIV-1 , HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus.

A “viral vector production cell”, “vector production cell”, or “production cell” is to be understood as a cell that is capable of producing a lentiviral vector or lentiviral vector particle. Lentiviral vector production cells may be “producer cells” or “packaging cells”. One or more DNA constructs of the viral vector system may be either stably integrated or episomally maintained within the viral vector production cell. Alternatively, all the DNA components of the viral vector system may be transiently transfected into the viral vector production cell. In yet another alternative, a production cell stably expressing some of the components may be transiently transfected with the remaining components required for vector production.

As used herein, the term “packaging cell” refers to a cell which contains the elements necessary for production of lentiviral vector particles but which lacks the vector genome. Optionally, such packaging cells contain one or more expression cassettes which are capable of expressing viral structural proteins (such as gag, gag/pol and env). Producer cells/packaging cells can be of any suitable cell type. Producer cells are generally mammalian cells but can be derived from other organisms, e.g. insect cells.

As used herein, the term “producer cell” or “vector producing/producer cell” refers to a cell which contains all the elements necessary for production of lentiviral vector particles. The producer cell may be either a stable producer cell line or derived transiently or may be a stable packaging cell wherein the retroviral genome is transiently expressed.

In the methods of the invention, the vector components may include gag, env and/or the RNA genome of the lentiviral vector when the viral vector is a lentiviral vector. The nucleotide sequences encoding vector components may be introduced into the cell either simultaneously or sequentially in any order.

The vector production cells may be cells cultured in vitro such as a tissue culture cell line. In some aspects of the methods and uses of the invention, suitable production cells or cells for producing a lentiviral vector are those cells which are capable of producing viral vectors or viral vector particles when cultured under appropriate conditions. Thus, the cells typically comprise nucleotide sequences encoding vector components, which may include gag, envand/or the RNA genome of the lentiviral vector. Suitable cell lines include, but are not limited to, mammalian cells such as murine fibroblast derived cell lines or human cell lines. They are generally mammalian, including human cells, for example HEK293T, HEK293, CAP, CAP-T or CHO cells, but can be, for example, insect cells such as SF9 cells. Preferably, the vector production cells are derived from a human cell line. Accordingly, such suitable production cells may be employed in any of the methods or uses of the present invention.

Methods for introducing nucleotide sequences into cells are well known in the art and have been described previously. Thus, the introduction into a cell of nucleotide sequences encoding vector components including gag, env and/or the RNA genome of the lentiviral vector, using conventional techniques in molecular and cell biology is within the capabilities of a person skilled in the art.

Stable production cells may be packaging or producer cells. To generate producer cells from packaging cells the vector genome DNA construct may be introduced stably or transiently. Packaging/producer cells can be generated by transducing a suitable cell line with a retroviral vector which expresses one of the components of the vector, i.e. a genome, the gag-pol components and an envelope as described in WO 2004/022761. Alternatively, the nucleotide sequence can be transfected into cells and then integration into the production cell genome occurs infrequently and randomly. The transfection methods may be performed using methods well known in the art. For example, a stable transfection process may employ constructs which have been engineered to aid concatemerisation. In another example, the transfection process may be performed using calcium phosphate or commercially available formulations such as Lipofectamine™ 2000CD (Invitrogen, CA), FuGENE® HD or polyethylenimine (PEI). Alternatively nucleotide sequences may be introduced into the production cell via electroporation. The skilled person will be aware of methods to encourage integration of the nucleotide sequences into production cells. For example, linearising a nucleic acid construct can help if it is naturally circular. Less random integration methodologies may involve the nucleic acid construct comprising of areas of shared homology with the endogenous chromosomes of the mammalian host cell to guide integration to a selected site within the endogenous genome. Furthermore, if recombination sites are present on the construct then these can be used for targeted recombination. For example, the nucleic acid construct may contain a loxP site which allows for targeted integration when combined with Cre recombinase (i.e. using the Cre/lox system derived from P1 bacteriophage). Alternatively or additionally, the recombination site is an att site (e.g. from A phage), wherein the att site permits site-directed integration in the presence of a lambda integrase. This would allow the lentiviral genes to be targeted to a locus within the host cellular genome which allows for high and/or stable expression.

Other methods of targeted integration are well known in the art. For example, methods of inducing targeted cleavage of genomic DNA can be used to encourage targeted recombination at a selected chromosomal locus. These methods often involve the use of methods or systems to induce a double strand break (DSB) e.g. a nick in the endogenous genome to induce repair of the break by physiological mechanisms such as non-homologous end joining (NHEJ). Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription-activator like effector nucleases (TALENs), using CRISPR/Cas9 systems with an engineered crRNA/tracr RNA ('single guide RNA') to guide specific cleavage, and/or using nucleases based on the Argonaute system (e.g., from T. thermophilus).

Packaging/producer cell lines can be generated by integration of nucleotide sequences using methods of just lentiviral transduction or just nucleic acid transfection, or a combination of both can be used. Methods for generating retroviral vectors from production cells and in particular the processing of retroviral vectors are described in WO 2009/153563.

In one aspect, the production cell may comprise the RNA-binding protein (e.g. tryptophan RNA-binding attenuation protein, TRAP) and/or the Tet Repressor (TetR) protein or alternative regulatory proteins (e.g. CymR).

Production of lentiviral vector from production cells can be via transfection methods, from production from stable cell lines which can include induction steps (e.g. doxycycline induction) or via a combination of both. The transfection methods may be performed using methods well known in the art, and examples have been described previously.

Production cells, either packaging or producer cell lines or those transiently transfected with the lentiviral vector encoding components are cultured to increase cell and virus numbers and/or virus titres. Culturing a cell is performed to enable it to metabolize, and/or grow and/or divide and/or produce viral vectors of interest according to the invention. This can be accomplished by methods well known to persons skilled in the art, and includes but is not limited to providing nutrients for the cell, for instance in the appropriate culture media. The methods may comprise growth adhering to surfaces, growth in suspension, or combinations thereof. Culturing can be done for instance in tissue culture flasks, tissue culture multiwell plates, dishes, roller bottles, wave bags or in bioreactors, using batch, fed-batch, continuous systems and the like. In order to achieve large scale production of viral vector through cell culture it is preferred in the art to have cells capable of growing in suspension. Suitable conditions for culturing cells are known (see e.g. Tissue Culture, Academic Press, Kruse and Paterson, editors (1973), and R.l. Freshney, Culture of animal cells: A manual of basic technique, fourth edition (Wiley- Liss Inc., 2000, ISBN 0-471-34889-9).

Preferably cells are initially ‘bulked up’ in tissue culture flasks or bioreactors and subsequently grown in multi-layered culture vessels or large bioreactors (greater than 50L) to generate the vector producing cells for use in the present invention.

Preferably cells are grown in a suspension mode to generate the vector producing cells for use in the present invention. Lentiviral Vectors

Lentiviruses are part of a larger group of retroviruses. A detailed list of lentiviruses may be found in Coffin et al (1997) “Retroviruses” Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763). In brief, lentiviruses can be divided into primate and non-primate groups. Examples of primate lentiviruses include but are not limited to: the human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV). The non-primate lentiviral group includes the prototype “slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV), feline immunodeficiency virus (FIV), Maedi visna virus (MW) and bovine immunodeficiency virus (BIV). In one aspect, the lentiviral vector is derived from HIV-1 , HIV-2, SIV, FIV, BIV, EIAV, CAEV or Visna lentivirus.

The lentivirus family differs from retroviruses in that lentiviruses have the capability to infect both dividing and non-dividing cells (Lewis et al (1992) EM BO J 11 (8): 3053-3058 and Lewis and Emerman (1994) J Virol 68 (1):510-516). In contrast, other retroviruses, such as MLV, are unable to infect non-dividing or slowly dividing cells such as those that make up, for example, muscle, brain, lung and liver tissue.

A lentiviral vector, as used herein, is a vector which comprises at least one component part derivable from a lentivirus. Preferably, that component part is involved in the biological mechanisms by which the vector infects or transduces target cells and expresses NOI.

The lentiviral vector may be used to replicate the NOI in a compatible target cell in vitro. Thus, described herein is a method of making proteins in vitro by introducing a vector of the invention into a compatible target cell in vitro and growing the target cell under conditions which result in expression of the NOI. Protein and NOI may be recovered from the target cell by methods well known in the art. Suitable target cells include mammalian cell lines and other eukaryotic cell lines.

In some aspects the vectors may have “insulators” - genetic sequences that block the interaction between promoters and enhancers, and act as a barrier reducing read-through from an adjacent gene.

In one aspect the insulator is present between one or more of the lentiviral nucleic acid sequences to prevent promoter interference and read-thorough from adjacent genes. If the insulators are present in the vector between one or more of the lentiviral nucleic acid sequences, then each of these insulated genes may be arranged as individual expression units.

The basic structure of retroviral and lentiviral genomes share many common features such as a 5’ LTR and a 3’ LTR, between or within which are located a packaging signal to enable the genome to be packaged, a primer binding site, integration sites to enable integration into a target cell genome and gaglpol and env genes encoding the packaging components - these are polypeptides required for the assembly of viral particles. Lentiviruses have additional features, such as the rev gene and RRE sequences in HIV, which enable the efficient export of RNA transcripts of the integrated provirus from the nucleus to the cytoplasm of an infected target cell.

In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for proviral integration, and transcription. LTRs also serve as enhancer-promoter sequences and can control the expression of the viral genes.

The LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5. U3 is derived from the sequence unique to the 3’ end of the RNA. R is derived from a sequence repeated at both ends of the RNA and U5 is derived from the sequence unique to the 5’ end of the RNA. The sizes of the three elements can vary considerably among different retroviruses.

In a typical lentiviral vector as described herein, at least part of one or more protein coding regions essential for replication may be removed from the virus; for example, gaglpol and env may be absent or not functional. This makes the viral vector replication-defective.

The lentiviral vector may be derived from either a primate lentivirus (e.g. HIV-1) or a nonprimate lentivirus (e.g. EIAV).

In general terms, a typical retroviral vector production system involves the separation of the viral genome from the essential viral packaging functions. These viral vector components are normally provided to the production cells on separate DNA expression cassettes (alternatively known as plasmids, expression plasmids, DNA constructs or expression constructs).

The vector genome comprises the NOI. Vector genomes typically require a packaging signal (qj), the internal expression cassette harbouring the NOI, (optionally) a post-transcriptional element (PRE), typically a central polypurine tract (cppt) and central termination sequence (CTS), the 3’-ppu/ppt and a self-inactivating (SIN) LTR. The R-LI5 regions are required for correct polyadenylation of both the vector genome RNA and NOI mRNA, as well as the process of reverse transcription.

The packaging functions include the gaglpol and env genes. These are required for the production of vector particles by the production cell. Providing these functions in trans to the genome facilitates the production of replication-defective viral vectors.

Production systems for gamma-retroviral vectors are typically 3-component systems requiring genome, gaglpol and env expression constructs. ElAV-based lentiviral vectors do not require rev to be provided in trans if an open-reading frame (ORF) is present within the genome (see WO 2003/064665).

Usually both the “external” promoter (which drives the vector genome cassette) and “internal” promoter (which drives the NOI cassette) encoded within the vector genome cassette are strong eukaryotic or virus promoters, as are those driving the other vector system components. Examples of such promoters include CMV, EF1a, PGK, CAG, TK, SV40 and Ubiquitin promoters. Strong ‘synthetic’ promoters, such as those generated by DNA libraries (e.g. JeT promoter) may also be used to drive transcription. Alternatively, tissue-specific promoters such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone-rod homeobox containing gene (CRX), neural retina-specific leucine zipper protein (NRL), Vitelliform Macular Dystrophy 2 (VMD2), Tyrosine hydroxylase, neuronal-specific neuronal-specific enolase (NSE) promoter, astrocytespecific glial fibrillary acidic protein (GFAP) promoter, human a1 -antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK), liver fatty acid binding protein promoter, Flt-1 promoter, INF-p promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV401 hAlb promoter, SV401 CD43, SV40 I CD45, NSE I RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, Fibronectin promoter, Endoglin promoter, Elastase-1 promoter, Desmin promoter, CD68 promoter, CD14 promoter and B29 promoter may be used to drive transcription.

Production of retroviral vectors involves either the transient co-transfection of the production cells with these DNA components or use of stable production cell lines wherein all the components are stably integrated within the production cell genome (e.g. Stewart HJ, Fong- Wong L, Strickland I, Chipchase D, Kelleher M, Stevenson L, Thoree V, McCarthy J, Ralph GS, Mitrophanous KA and Radcliffe PA. (2011). Hum Gene Ther. Mar; 22 (3):357-69). An alternative approach is to use a stable packaging cell (into which the packaging components are stably integrated) and then transiently transfect in the vector genome plasmid as required (e.g. Stewart, H. J., M. A. Leroux-Carlucci, C. J. Sion, K. A. Mitrophanous and P. A. Radcliffe (2009). Gene Ther. Jun; 16 (6):805-14). It is also feasible that alternative, not complete, packaging cell lines could be generated (just one or two packaging components are stably integrated into the cell lines) and to generate vector the missing components are transiently transfected. The production cell may also express regulatory proteins such as a member of the tet repressor (TetR) protein group of transcription regulators (e.g.T-Rex, Tet-On, and Tet- Off), a member of the cumate inducible switch system group of transcription regulators (e.g. cumate repressor (CymR) protein), or an RNA-binding protein (e.g. TRAP - tryptophan- activated RNA-binding protein).

In one aspect of the present invention, the viral vector is derived from EIAV. El AV has the simplest genomic structure of the lentiviruses and is particularly preferred for use in the present invention. In addition to the gaglpol and env genes, EIAV encodes three other genes: tat, rev, and S2. Tat acts as a transcriptional activator of the viral LTR (Derse and Newbold (1993) Virology 194(2): 530-536 and Maury et al (1994) Virology 200(2):632-642) and rev regulates and coordinates the expression of viral genes through rev-response elements (RRE) (Martarano et al. (1994) J Virol 68(5):3102-3111). The mechanisms of action of these two proteins are thought to be broadly similar to the analogous mechanisms in the primate viruses (Martarano et al. (1994) J Virol 68(5):3102-3111). The function of S2 is unknown. In addition, an EIAV protein, Ttm, has been identified that is encoded by the first exon of tat spliced to the env coding sequence at the start of the transmembrane protein. In an alternative aspect of the present invention the viral vector is derived from HIV: HIV differs from EIAV in that it does not encode S2 but unlike EIAV it encodes vif, vpr, vpu and nef.

The term “recombinant retroviral or lentiviral vector” (RRV) refers to a vector with sufficient retroviral genetic information to allow packaging of an RNA genome, in the presence of packaging components, into a viral particle capable of transducing a target cell. Transduction of the target cell may include reverse transcription and integration into the target cell genome. The RRV carries non-viral coding sequences which are to be delivered by the vector to the target cell. A RRV is incapable of independent replication to produce infectious retroviral particles within the target cell. Usually the RRV lacks a functional gaglpol and/or env gene, and/or other genes essential for replication.

Preferably the RRV vector of the present invention has a minimal viral genome. As used herein, the term “minimal viral genome” means that the viral vector has been manipulated so as to remove the non-essential elements whilst retaining the elements essential to provide the required functionality to infect, transduce and deliver a NOI to a target cell. Further details of this strategy can be found in WO 1998/17815 and WO 99/32646. A minimal El AV vector lacks tat, rev and S2 genes and neither are these genes provided in trans in the production system. A minimal HIV vector lacks vif, vpr, vpu, tat and nef.

The expression plasmid used to produce the vector genome within a production cell may include transcriptional regulatory control sequences operably linked to the retroviral genome to direct transcription of the genome in a production cell/packaging cell. All 3rd generation lentiviral vectors are deleted in the 5’ U3 enhancer-promoter region, and transcription of the vector genome RNA is driven by heterologous promoter such as another viral promoter, for example the CMV promoter, as discussed below. This feature enables vector production independently of tat. Some lentiviral vector genomes require additional sequences for efficient virus production.

SIN Vectors

The lentiviral vectors as described herein may be used in a self-inactivating (SIN) configuration in which the viral enhancer and promoter sequences have been deleted. SIN vectors can be generated and transduce non-dividing target cells in vivo, ex vivo or in vitro with an efficacy similar to that of non-SIN vectors. The transcriptional inactivation of the long terminal repeat (LTR) in the SIN provirus should prevent mobilisation of vRNA, and is a feature that further diminishes the likelihood of formation of replication-competent virus. This should also enable the regulated expression of genes from internal promoters by eliminating any c/s-acting effects of the LTR.

By way of example, self-inactivating retroviral vector systems have been constructed by deleting the transcriptional enhancers or the enhancers and promoter in the U3 region of the 3’ LTR. After a round of vector reverse transcription and integration, these changes are copied into both the 5’ and the 3’ LTRs producing a transcriptionally inactive provirus. However, any promoter(s) internal to the LTRs in such vectors will still be transcriptionally active. This strategy has been employed to eliminate effects of the enhancers and promoters in the viral LTRs on transcription from internally placed genes. Such effects include increased transcription or suppression of transcription. This strategy can also be used to eliminate downstream transcription from the 3’ LTR into genomic DNA. This is of particular concern in human gene therapy where it is important to prevent the adventitious activation of any endogenous oncogene. Yu et al., (1986) PNAS 83: 3194-98; Marty et al., (1990) Biochimie 72: 885-7; Naviaux et al., (1996) J. Virol. 70: 5701-5; Iwakuma et al., (1999) Virol. 261 : 120- 32; Deglon et al., (2000) Human Gene Therapy 11 : 179-90. SIN lentiviral vectors are described in US 6,924,123 and US 7,056,699.

Replication-Defective Lentiviral Vectors

In the genome of a replication-defective lentiviral vector the sequences of gaglpol and/or env may be mutated and/or not functional.

In a typical lentiviral vector as described herein, at least part of one or more coding regions for proteins essential for virus replication may be removed from the vector. This makes the viral vector replication-defective. Portions of the viral genome may also be replaced by a NOI in order to generate a vector comprising an NOI which is capable of transducing a non-dividing target cell and/or integrating its genome into the target cell genome.

In one aspect the lentiviral vectors are non-integrating vectors as described in WO 2006/010834 and WO 2007/071994.

In a further aspect the vectors have the ability to deliver a sequence which is devoid of or lacking viral RNA. In a further aspect a heterologous binding domain (heterologous to gag) located on the RNA to be delivered and a cognate binding domain on Gag or GagPol can be used to ensure packaging of the RNA to be delivered. Both of these vectors are described in WO 2007/072056.

NOI and Polynucleotides

As described herein, the nucleotide sequence comprising a lentiviral vector genome expression cassette according to the present invention may provide additional capacity in for the transgene or nucleotide of interest (NOI). For example, the nucleotide sequence comprising a lentiviral vector genome expression cassette may advantageously provide about 1 kb of additional transgene sequence.

Polynucleotides of the invention may comprise DNA or RNA. They may be single-stranded or double-stranded. It will be understood by a skilled person that numerous different polynucleotides can encode the same polypeptide as a result of the degeneracy of the genetic code. In addition, it is to be understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the invention to reflect the codon usage of any particular host organism in which the polypeptides of the invention are to be expressed.

The polynucleotides may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or lifespan of the polynucleotides of the invention.

Polynucleotides such as DNA polynucleotides may be produced recombinantly, synthetically or by any means available to those of skill in the art. They may also be cloned by standard techniques.

Longer polynucleotides will generally be produced using recombinant means, for example using polymerase chain reaction (PCR) cloning techniques. This will involve making a pair of primers (e.g. of about 15 to 30 nucleotides) flanking the target sequence which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from an animal or human cell, performing PCR under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture with an agarose gel) and recovering the amplified DNA. The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable vector.

Common Retroviral Vector Elements

Promoters and Enhancers

Expression of a NOI and polynucleotide may be controlled using control sequences for example transcription regulation elements or translation repression elements, which include promoters, enhancers and other expression regulation signals (e.g. tet repressor (TetR) system) or the Transgene Repression In vector Production cell system (TRiP) or other regulators of NOIs described herein.

Prokaryotic promoters and promoters functional in eukaryotic cells may be used. Tissuespecific or stimuli-specific promoters may be used. Chimeric promoters may also be used comprising sequence elements from two or more different promoters. Suitable promoting sequences are strong promoters including those derived from the genomes of viruses, such as polyoma virus, adenovirus, fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus (CMV), retrovirus and Simian Virus 40 (SV40), or from heterologous mammalian promoters, such as the actin promoter, EF1a, CAG, TK, SV40, ubiquitin, PGK or ribosomal protein promoter. Alternatively, tissue-specific promoters such as rhodopsin (Rho), rhodopsin kinase (RhoK), cone-rod homeobox containing gene (CRX), neural retina-specific leucine zipper protein (NRL), Vitelliform Macular Dystrophy 2 (VMD2), Tyrosine hydroxylase, neuronal-specific neuronal-specific enolase (NSE) promoter, astrocytespecific glial fibrillary acidic protein (GFAP) promoter, human a1 -antitrypsin (hAAT) promoter, phosphoenolpyruvate carboxykinase (PEPCK), liver fatty acid binding protein promoter, Flt-1 promoter, INF-p promoter, Mb promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV401 hAlb promoter, SV401 CD43, SV401 CD45, NSE I RU5' promoter, ICAM-2 promoter, GPIIb promoter, GFAP promoter, Fibronectin promoter, Endoglin promoter, Elastase-1 promoter, Desmin promoter, CD68 promoter, CD14 promoter and B29 promoter may be used to drive transcription.

Transcription of a NOI may be increased further by inserting an enhancer sequence into the vector. Enhancers are relatively orientation- and position-independent; however, one may employ an enhancer from a eukaryotic cell virus, such as the SV40 enhancer and the CMV early promoter enhancer. The enhancer may be spliced into the vector at a position 5' or 3' to the promoter, but is preferably located at a site 5' from the promoter.

The promoter can additionally include features to ensure or to increase expression in a suitable target cell. For example, the features can be conserved regions e.g. a Pribnow Box or a TATA box. The promoter may contain other sequences to affect (such as to maintain, enhance or decrease) the levels of expression of a nucleotide sequence. Suitable other sequences include the Sh1 -intron or an ADH intron. Other sequences include inducible elements, such as temperature, chemical, light or stress inducible elements. Also, suitable elements to enhance transcription or translation may be present.

Regulators of NOIs

A complicating factor in the generation of retroviral packaging/producer cell lines and retroviral vector production is that constitutive expression of certain retroviral vector components and NOIs are cytotoxic leading to death of cells expressing these components and therefore inability to produce vector. Therefore, the expression of these components (e.g. gag-pol and envelope proteins such as VSV-G) can be regulated. The expression of other non-cytotoxic vector components, e.g. rev, can also be regulated to minimise the metabolic burden on the cell. The modular constructs and/or cells as described herein may comprise cytotoxic and/or non-cytotoxic vector components associated with at least one regulatory element. As used herein, the term “regulatory element” refers to any element capable of affecting, either increasing or decreasing, the expression of an associated gene or protein. A regulatory element includes a gene switch system, transcription regulation element and translation repression element.

A number of prokaryotic regulator systems have been adapted to generate gene switches in mammalian cells. Many retroviral packaging and producer cell lines have been controlled using gene switch systems (e.g. tetracycline and cumate inducible switch systems) thus enabling expression of one or more of the retroviral vector components to be switched on at the time of vector production. Gene switch systems include those of the (TetR) protein group of transcription regulators (e.g.T-Rex, Tet-On, and Tet-Off), those of the cumate inducible switch system group of transcription regulators (e.g. CymR protein) and those involving an RNA-binding protein (e.g. TRAP).

One such tetracycline-inducible system is the tetracycline repressor (TetR) system based on the T-REx™ system. By way of example, in such a system tetracycline operators (TetO2) are placed in a position such that the first nucleotide is 10bp from the 3’ end of the last nucleotide of the TATATAA element of the human cytomegalovirus major immediate early promoter (hCMVp) then TetR alone is capable of acting as a repressor (Yao F, Svensjo T, Winkler T, Lu M, Eriksson C, Eriksson E. Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, regulates inducible gene expression in mammalian cells. 1998. Hum Gene Then, 9: 1939-1950). In such a system the expression of the NOI can be controlled by a CMV promoter into which two copies of the TetO2 sequence have been inserted in tandem. TetR homodimers, in the absence of an inducing agent (tetracycline or its analogue doxycycline [dox]), bind to the TetO2 sequences and physically block transcription from the upstream CMV promoter. When present, the inducing agent binds to the TetR homodimers, causing allosteric changes such that it can no longer bind to the TetO2 sequences, resulting in gene expression. The TetR gene may be codon optimised as this may improve translation efficiency resulting in tighter control of TetO2 controlled gene expression.

The TRiP system is described in WO 2015/092440 and provides another way of repressing expression of the NOI in the production cells during vector production. The TRAP-binding sequence (e.g. TRAP-tbs) interaction forms the basis for a transgene protein repression system for the production of retroviral vectors, when a constitutive and/or strong promoter, including a tissue-specific promoter, driving the transgene is desirable and particularly when expression of the transgene protein in production cells leads to reduction in vector titres and/or elicits an immune response in vivo due to viral vector delivery of transgene-derived protein (Maunder et a/, Nat Commun. (2017) Mar 27; 8).

Briefly, the TRAP-tbs interaction forms a translational block, repressing translation of the transgene protein (Maunder et al, Nat Commun. (2017) Mar 27; 8). The translational block is only effective in production cells and as such does not impede the DNA- or RNA- based vector systems. The TRiP system is able to repress translation when the transgene protein is expressed from a constitutive and/or strong promoter, including a tissue-specific promoter from single- or multi cistronic mRNA. It has been demonstrated that unregulated expression of transgene protein can reduce vector titres and affect vector product quality. Repression of transgene protein for both transient and stable PaCL/PCL vector production systems is beneficial for production cells to prevent a reduction in vector titres: where toxicity or molecular burden issues may lead to cellular stress; where transgene protein elicits an immune response in vivo due to viral vector delivery of transgene-derived protein; where the use of gene-editing transgenes may result in on/off target affects; where the transgene protein may affect vector and/or envelope glycoprotein exclusion.

Envelope and Pseudotyping

In one preferred aspect, the lentiviral vector as described herein has been pseudotyped. In this regard, pseudotyping can confer one or more advantages. For example, the env gene product of the HIV based vectors would restrict these vectors to infecting only cells that express a protein called CD4. But if the env gene in these vectors has been substituted with env sequences from other enveloped viruses, then they may have a broader infectious spectrum (Verma and Somia (1997) Nature 389(6648):239-242). By way of example, workers have pseudotyped an HIV based vector with the glycoprotein from VSV (Verma and Somia (1997) Nature 389(6648):239-242).

In another alternative, the Env protein may be a modified Env protein such as a mutant or engineered Env protein. Modifications may be made or selected to introduce targeting ability or to reduce toxicity or for another purpose (Valsesia-Wittman et al 1996 J Virol 70: 2056-64; Nilson et al (1996) Gene Ther 3(4):280-286; and Fielding et al (1998) Blood 91 (5):1802-1809 and references cited therein).

The vector may be pseudotyped with any molecule of choice.

As used herein, “env” shall mean an endogenous lentiviral envelope or a heterologous envelope, as described herein.

VSV-G

The envelope glycoprotein (G) of Vesicular stomatitis virus (VSV), a rhabdovirus, is an envelope protein that has been shown to be capable of pseudotyping certain enveloped viruses and viral vector virions.

Its ability to pseudotype MoMLV-based retroviral vectors in the absence of any retroviral envelope proteins was first shown by Emi et al. (1991) Journal of Virology 65:1202-1207. WO 1994/294440 teaches that retroviral vectors may be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors may be used to transduce a wide range of mammalian cells. More recently, Abe et al. (1998) J Virol 72(8) 6356-6361 teach that non-infectious retroviral particles can be made infectious by the addition of VSV-G.

Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-7 successfully pseudotyped the retrovirus MLV with VSV-G and this resulted in a vector having an altered host range compared to MLV in its native form. VSV-G pseudotyped vectors have been shown to infect not only mammalian cells, but also cell lines derived from fish, reptiles and insects (Burns et al. (1993) ibid). They have also been shown to be more efficient than traditional amphotropic envelopes for a variety of cell lines (Yee et al., (1994) Proc. Natl. Acad. Sci. USA 91 :9564- 9568, Emi et al. (1991) Journal of Virology 65:1202-1207). VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail is capable of interacting with the retroviral cores.

The provision of a non-retroviral pseudotyping envelope such as VSV-G protein gives the advantage that vector particles can be concentrated to a high titre without loss of infectivity (Akkina et al. (1996) J. Virol. 70:2581-5). Retrovirus envelope proteins are apparently unable to withstand the shearing forces during ultracentrifugation, probably because they consist of two non-covalently linked subunits. The interaction between the subunits may be disrupted by the centrifugation. In comparison the VSV glycoprotein is composed of a single unit. VSV- G protein pseudotyping can therefore offer potential advantages for both efficient target cell infection/transduction and during manufacturing processes.

WO 2000/52188 describes the generation of pseudotyped retroviral vectors, from stable producer cell lines, having vesicular stomatitis virus-G protein (VSV-G) as the membrane- associated viral envelope protein, and provides a gene sequence for the VSV-G protein. oss River Virus

The Ross River viral envelope has been used to pseudotype a non-primate lentiviral vector (FIV) and following systemic administration predominantly transduced the liver (Kang et al., 2002, J. Virol., 76:9378-9388). Efficiency was reported to be 20-fold greater than obtained with VSV-G pseudotyped vector, and caused less cytotoxicity as measured by serum levels of liver enzymes suggestive of hepatotoxicity.

Baculovirus GP64

The baculovirus GP64 protein has been shown to be an alternative to VSV-G for viral vectors used in the large-scale production of high-titre virus required for clinical and commercial applications (Kumar M, Bradow BP, Zimmerberg J (2003) Hum Gene Ther. 14(1):67-77). Compared with VSV-G-pseudotyped vectors, GP64-pseudotyped vectors have a similar broad tropism and similar native titres. Because, GP64 expression does not kill cells, HEK293T- based cell lines constitutively expressing GP64 can be generated.

Alternative Envelopes

Other envelopes which give reasonable titre when used to pseudotype EIAV include Mokola, Rabies, Ebola and LCMV (lymphocytic choriomeningitis virus). Intravenous infusion into mice of lentivirus pseudotyped with 4070A led to maximal gene expression in the liver.

Packaging Sequence

As utilized within the context of the present invention the term “packaging signal”, which is referred to interchangeably as “packaging sequence” or “psi”, is used in reference to the non- coding, c/s-acting sequence required for encapsidation of retroviral RNA strands during viral particle formation. In HIV-1 , this sequence has been mapped to loci extending from upstream of the major splice donor site (SD) to at least the gag start codon (some or all of the 5’ sequence of gag to nucleotide 688 may be included). In EIAV the packaging signal comprises the R region into the 5’ coding region of Gag.

As used herein, the term “extended packaging signal” or “extended packaging sequence” refers to the use of sequences around the psi sequence with further extension into the gag gene. The inclusion of these additional packaging sequences may increase the efficiency of insertion of vector RNA into viral particles.

Feline immunodeficiency virus (FIV) RNA encapsidation determinants have been shown to be discrete and non-continuous, comprising one region at the 5' end of the genomic mRNA (R- U5) and another region that mapped within the proximal 311 nt of gag (Kaye et al., J Virol. Oct;69(10):6588-92 (1995).

Internal Ribosome Entry Site (IRES)

Insertion of IRES elements allows expression of multiple coding regions from a single promoter (Adam et al (as above); Koo et al (1992) Virology 186:669-675; Chen et al 1993 J. Virol 67:2142-2148). IRES elements were first found in the non-translated 5’ ends of picornaviruses where they promote cap-independent translation of viral proteins (Jang et al (1990) Enzyme 44: 292-309). When located between open reading frames in an RNA, IRES elements allow efficient translation of the downstream open reading frame by promoting entry of the ribosome at the IRES element followed by downstream initiation of translation.

A review on IRES is presented by Mountford and Smith (TIG May 1995 vol 11 , No 5:179-184). A number of different IRES sequences are known including those from encephalomyocarditis virus (EMCV) (Ghattas, I.R., et al., Mol. Cell. Biol., 11 :5848-5859 (1991); Bi P protein [Macejak and Sarnow, Nature 353:91 (1991)]; the Antennapedia gene of Drosophila (exons d and e) [Oh, et al., Genes & Development, 6:1643-1653 (1992)] as well as those in polio virus (PV) [Pelletier and Sonenberg, Nature 334: 320-325 (1988); see also Mountford and Smith, TIG 11 , 179-184 (1985)].

IRES elements from PV, EMCV and swine vesicular disease virus have previously been used in retroviral vectors (Coffin et al, as above). The term “IRES” includes any sequence or combination of sequences which work as or improve the function of an IRES. The IRES(s) may be of viral origin (such as EMCV IRES, PV IRES, or FMDV 2A-like sequences) or cellular origin (such as FGF2 IRES, NRF IRES, Notch 2 IRES or EIF4 IRES).

In order for the IRES to be capable of initiating translation of each polynucleotide it should be located between or prior to the polynucleotides in the modular construct.

The nucleotide sequences utilised for development of stable cell lines require the addition of selectable markers for selection of cells where stable integration has occurred. These selectable markers can be expressed as a single transcription unit within the nucleotide sequence or it may be preferable to use IRES elements to initiate translation of the selectable marker in a polycistronic message (Adam et al 1991 J.Virol. 65, 4985).

Genetic Orientation and Insulators

It is well known that nucleic acids are directional and this ultimately affects mechanisms such as transcription and replication in the cell. Thus genes can have relative orientations with respect to one another when part of the same nucleic acid construct.

In certain aspects of the present invention, at least two nucleic acid sequences present at the same locus in the cell or construct can be in a reverse and/or alternating orientations. In other words, in certain aspects of the invention at this particular locus, the pair of sequential genes will not have the same orientation. This can help prevent both transcriptional and translational read-through when the region is expressed within the same physical location of the host cell.

Having the alternating orientations benefits retroviral vector production when the nucleic acids required for vector production are based at the same genetic locus within the cell. This in turn can also improve the safety of the resulting constructs in preventing the generation of replication-competent retroviral vectors.

When nucleic acid sequences are in reverse and/or alternating orientations the use of insulators can prevent inappropriate expression or silencing of a NOI from its genetic surroundings. The term “insulator” refers to a class of DNA sequence elements that when bound to insulatorbinding proteins possess an ability to protect genes from surrounding regulator signals. There are two types of insulators: an enhancer blocking function and a chromatin barrier function. When an insulator is situated between a promoter and an enhancer, the enhancer-blocking function of the insulator shields the promoter from the transcription-enhancing influence of the enhancer (Geyer and Corces 1992; Kellum and Schedl 1992). The chromatin barrier insulators function by preventing the advance of nearby condensed chromatin which would lead to a transcriptionally active chromatin region turning into a transcriptionally inactive chromatin region and resulting in silencing of gene expression. Insulators which inhibit the spread of heterochromatin, and thus gene silencing, recruit enzymes involved in histone modifications to prevent this process (Yang J, Corces VG. 2011 ;110:43-76; Huang, Li et al. 2007; Dhillon, Raab et al. 2009). An insulator can have one or both of these functions and the chicken p-globin insulator (cHS4) is one such example. This insulator is the most extensively studied vertebrate insulator, is highly rich in G+C and has both enhancer-blocking and heterochromatic barrier functions (Chung J H, Whitely M, Felsenfeld G. Cell. 1993;74:505- 514). Other such insulators with enhancer blocking functions are not limited to but include the following: human p-globin insulator s (HS5), human p-globin insulator 1 (HS1), and chicken P-globin insulator (cHS3) (Farrell CM 1 , West AG, Felsenfeld G., Mol Cell Biol. 2002 Jun;22(11):3820-31 ; J Ellis et al. EMBO J. 1996 Feb 1 ; 15(3): 562-568). In addition to reducing unwanted distal interactions the insulators also help to prevent promoter interference (i.e. where the promoter from one transcription unit impairs expression of an adjacent transcription unit) between adjacent retroviral nucleic acid sequences. If the insulators are used between each of the retroviral vector nucleic acid sequences, then the reduction of direct read-through will help prevent the formation of replication-competent retroviral vector particles.

The insulator may be present between each of the retroviral nucleic acid sequences. In one aspect, the use of insulators prevents promoter-enhancer interactions from one NOI expression cassette interacting with another NOI expression cassette in a nucleotide sequence encoding vector components.

An insulator may be present between the vector genome and gag-pol sequences. This therefore limits the likelihood of the production of a replication-competent retroviral vector and ‘wild-type’ like RNA transcripts, improving the safety profile of the construct. The use of insulator elements to improve the expression of stably integrated multigene vectors is cited in Moriarity et al, Nucleic Acids Res. 2013 Apr;41 (8):e92. Vector Titre

The skilled person will understand that there are a number of different methods of determining the titre of lentiviral vectors. Titre is often described as transducing units/mL (TU/rnL). Titre may be increased by increasing the number of vector particles and by increasing the specific activity of a vector preparation.

Therapeutic Use

The lentiviral vector as described herein or a cell or tissue transduced with the lentiviral vector as described herein may be used in medicine.

In addition, the lentiviral vector as described herein, a production cell of the invention or a cell or tissue transduced with the lentiviral vector as described herein may be used for the preparation of a medicament to deliver a nucleotide of interest to a target site in need of the same. Such uses of the lentiviral vector or transduced cell of the invention may be for therapeutic or diagnostic purposes, as described previously.

Accordingly, there is provided a cell transduced by the lentiviral vector as described herein.

A “cell transduced by a viral vector particle” is to be understood as a cell, in particular a target cell, into which the nucleic acid carried by the viral vector particle has been transferred.

Nucleotide of interest

In one embodiment of the invention, the nucleotide of interest is translated in a target cell which lacks TRAP.

“Target cell” is to be understood as a cell in which it is desired to express the NOI. The NOI may be introduced into the target cell using a viral vector of the present invention. Delivery to the target cell may be performed in vivo, ex vivo or in vitro.

In a preferred embodiment, the nucleotide of interest gives rise to a therapeutic effect.

The NOI may have a therapeutic or diagnostic application. Suitable NOIs include, but are not limited to sequences encoding enzymes, co-factors, cytokines, chemokines, hormones, antibodies, anti-oxidant molecules, engineered immunoglobulin-like molecules, single chain antibodies, fusion proteins, immune co-stimulatory molecules, immunomodulatory molecules, chimeric antigen receptors a transdomain negative mutant of a target protein, toxins, conditional toxins, antigens, transcription factors, structural proteins, reporter proteins, subcellular localization signals, tumour suppressor proteins, growth factors, membrane proteins, receptors, vasoactive proteins and peptides, anti-viral proteins and ribozymes, and derivatives thereof (such as derivatives with an associated reporter group). The NOIs may also encode micro-RNA.

In one embodiment, the NOI may be useful in the treatment of a neurodegenerative disorder.

In another embodiment, the NOI may be useful in the treatment of Parkinson’s disease and multiple system atrophy.

In another embodiment, the NOI may encode an enzyme or enzymes involved in dopamine synthesis. For example, the enzyme may be one or more of the following: tyrosine hydroxylase, GTP-cyclohydrolase I and/or aromatic amino acid dopa decarboxylase. The sequences of all three genes are available (GenBank® Accession Nos. X05290, 1119523 and M76180, respectively).

In another embodiment, the NOI may encode the vesicular monoamine transporter 2 (VMAT2). In an alternative embodiment the viral genome may comprise a NOI encoding aromatic amino acid dopa decarboxylase and a NOI encoding VMAT2. Such a genome may be used in the treatment of Parkinson’s disease, in particular in conjunction with peripheral administration of L-DOPA.

In another embodiment the NOI may encode a therapeutic protein or combination of therapeutic proteins.

In another embodiment, the NOI may encode a protein or proteins selected from the group consisting of glial cell derived neurotophic factor (GDNF), brain derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), neurotrophin-3 (NT-3), acidic fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), interleukin-1 beta (I L-1 p), tumor necrosis factor alpha (TNF-a), insulin growth factor-2, VEGF-A, VEGF-B, VEGF-C/VEGF-2, VEGF-D, VEGF-E, PDGF-A, PDGF-B, hetero- and homo-dimers of PDFG-A and PDFG-B.

In another embodiment, the NOI may encode an anti-angiogenic protein or anti-angiogenic proteins selected from the group consisting of angiostatin, endostatin, platelet factor 4, pigment epithelium derived factor (PEDF), placental growth factor, restin, interferon-a, interferon-inducible protein, gro-beta and tubedown-1 , interleukin(IL)-1 , IL-12, retinoic acid, anti-VEGF antibodies or fragments /variants thereof such as aflibercept, thrombospondin, VEGF receptor proteins such as those described in US 5,952,199 and US 6, 100,071 , and anti- VEGF receptor antibodies.

In another embodiment, the NOI may encode anti-inflammatory proteins, antibodies or fragment/variants of proteins or antibodies selected from the group consisting of NF-kB inhibitors, ILI beta inhibitors, TGFbeta inhibitors, IL-6 inhibitors, IL-23 inhibitors, IL-18 inhibitors, Tumour necrosis factor alpha and Tumour necrosis factor beta, Lymphotoxin alpha and Lymphotoxin beta, LIGHT inhibitors, alpha synuclein inhibitors, Tau inhibitors, beta amyloid inhibitors, IL-17 inhibitors, IL-33 inhibitors, IL-33 receptor inhibitors and TSLP inhibitors.

In another embodiment the NOI may encode cystic fibrosis transmembrane conductance regulator (CFTR).

In another embodiment the NOI may encode a protein normally expressed in an ocular cell.

In another embodiment, the NOI may encode a protein normally expressed in a photoreceptor cell and/or retinal pigment epithelium cell.

In another embodiment, the NOI may encode a protein selected from the group comprising RPE65, arylhydrocarbon-interacting receptor protein like 1 (AIPL1), CRB1 , lecithin retinal acetyltransferace (LRAT), photoreceptor-specific homeo box (CRX), retinal guanylate cyclise (GUCY2D), RPGR interacting protein 1 (RPGRIP1), LCA2, LCA3, LCA5, dystrophin, PRPH2, CNTF, ABCR/ABCA4, EMP1 , TIMP3, MERTK, ELOVL4, MYO7A, USH2A, VMD2, RLBP1 , COX-2, FPR, harmonin, Rab escort protein 1 , CNGB2, CNGA3, CEP 290, RPGR, RS1 , RP1 , PRELP, glutathione pathway enzymes and opticin.

In other embodiments, the NOI may encode the human clotting Factor VIII or Factor IX.

In other embodiments, the NOI may encode protein or proteins involved in metabolism selected from the group comprising phenylalanine hydroxylase (PAH), Methylmalonyl CoA mutase, Propionyl CoA carboxylase, Isovaleryl CoA dehydrogenase, Branched chain ketoacid dehydrogenase complex, Glutaryl CoA dehydrogenase, Acetyl CoA carboxylase, propionyl CoA carboxylase, 3 methyl crotonyl CoA carboxylase, pyruvate carboxylase, carbamoyl- phophate synthase ammonia, ornithine transcarbamylase, alpha galactosidase A, glucosylceramidase beta, cystinosin, glucosamine(N-acetyl)-6-sulfatase, N-acetyl-alpha- glucosaminidase, glucose-6-phosphatase, ATP7B, ATP8B1 , ABCB11 , ABCB4, TJP2, N- sulfoglucosamine sulfohydrolase, Galactosamine-6 sulfatase, arylsulfatase A, cytochrome B- 245 beta, ABCD1, ornithine carbamoyltransferase, argininosuccinate synthase, argininosuccinate lysase, arginase 1 , alanine glycoxhylate amino transferase, ATP-binding cassette, sub-family B members.

In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) or a T cell receptor (TCR). In one embodiment, the CAR is an anti-5T4 CAR. In other embodiments, the NOI may encode B-cell maturation antigen (BCMA), CD19, CD22, CD20, CD138, CD30, CD33, CD123, CD70, prostate specific membrane antigen (PSMA), Lewis Y antigen (LeY), Tyrosine-protein kinase transmembrane receptor (ROR1), Mucin 1 , cell surface associated (Muc1), Epithelial cell adhesion molecule (EpCAM), endothelial growth factor receptor (EGFR), insulin, protein tyrosine phosphatase, non-receptor type 22, interleukin 2 receptor, alpha, interferon induced with helicase C domain 1 , human epidermal growth factor receptor (HER2), glypican 3 (GPC3), disialoganglioside (GD2), mesiothelin, vesicular endothelial growth factor receptor 2 (VEGFR2). Smith antigen, Ro60, double stranded DNA, phospholipids, proinsulin, insulinoma antigen 2 (IA-2) , 65 kDa isoform of glutamic acid decarboxylase (GAD65), chromogranin A (CHGA), islet amyloid polypeptide (IAPP), isletspecific glucose-6-phosphatase catalytic subunit-related protein (IGRP), zinc transporter 8 (ZnT8).

In other embodiments, the NOI may encode a chimeric antigen receptor (CAR) against NKG2D ligands selected from the group comprising LILBP1 , 2 and 3, H60, Rae-1 a, b, g, d, MICA, MICB.

In further embodiments the NOI may encode SGSH, SLIMF1 , GAA, the common gamma chain (CD132), adenosine deaminase, WAS protein, globins, alpha galactosidase A, 6- aminolevulinate (ALA) synthase, b-aminolevulinate dehydratase (ALAD), Hydroxymethylbilane (HMB) synthase, Uroporphyrinogen (URO) synthase, Uroporphyrinogen (URO) decarboxylase, Coproporphyrinogen (COPRO) oxidase, Protoporphyrinogen (PROTO) oxidase, Ferrochelatase, a-L-iduronidase, Iduronate sulfatase, Heparan sulfamidase, N-acetylglucosaminidase, Heparan-a-glucosaminide N-acetyltransferase, 3 N- acetylglucosamine 6-sulfatase, Galactose-6-sulfate sulfatase, p-galactosidase, N- acetylgalactosamine-4-sulfatase, p-glucuronidase and Hyaluronidase.

In addition to the NOI the vector may also comprise or encode a siRNA, shRNA, or regulated shRNA. (Dickins et al. (2005) Nature Genetics 37: 1289-1295, Silva et al. (2005) Nature Genetics 37:1281-1288). Indications

The vectors, including retroviral and AAV vectors, according to the present invention may be used to deliver one or more NOI(s) useful in the treatment of the disorders listed in WO 1998/05635, WO 1998/07859, WO 1998/09985. The nucleotide of interest may be DNA or RNA. Examples of such diseases are given below:

A disorder which responds to cytokine and cell proliferation/differentiation activity; immunosuppressant or immunostimulant activity (e.g. for treating immune deficiency, including infection with human immunodeficiency virus, regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumour immunity); regulation of haematopoiesis (e.g. treatment of myeloid or lymphoid diseases); promoting growth of bone, cartilage, tendon, ligament and nerve tissue (e.g. for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration); inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokinetic activity (e.g. for mobilising specific cell types to sites of injury or infection); haemostatic and thrombolytic activity (e.g. for treating haemophilia and stroke); anti-inflammatory activity (for treating, for example, septic shock or Crohn's disease); macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity; anti-immune activity (i.e. inhibitory effects against a cellular and/or humoral immune response, including a response not associated with inflammation); inhibition of the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as up-regulated fas receptor expression in T cells.

Malignancy disorders, including cancer, leukaemia, benign and malignant tumour growth, invasion and spread, angiogenesis, metastases, ascites and malignant pleural effusion.

Autoimmune diseases including arthritis, including rheumatoid arthritis, hypersensitivity, psoriasis, Sjogren's syndrome, allergic reactions, asthma, chronic obstructive pulmonary disease, systemic lupus erythematosus, Type 1 diabetes mellitus, Crohn’s disease, ulcerative colitis, collagen diseases and other diseases.

Vascular diseases including arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome, cardiovascular effects, peripheral vascular disease, migraine and aspirin-dependent anti-thrombosis, stroke, cerebral ischaemia, ischaemic heart disease or other diseases.

Diseases of the gastrointestinal tract including peptic ulcer, ulcerative colitis, Crohn's disease and other diseases.

Hepatic diseases including hepatic fibrosis, liver cirrhosis, amyloidosis.

Inherited metabolic disorders including phenylketonuria PKU, Wilson disease, organic acidemias, glycogen storage diseases, urea cycle disorders, cholestasis, and other diseases, or other diseases.

Renal and urologic diseases including thyroiditis or other glandular diseases, glomerulonephritis, lupus nephritis or other diseases.

Ear, nose and throat disorders including otitis or other oto-rhino-laryngological diseases, dermatitis or other dermal diseases.

Dental and oral disorders including periodontal diseases, periodontitis, gingivitis or other dental/oral diseases.

Testicular diseases including orchitis or epididimo-orchitis, infertility, orchidal trauma or other testicular diseases.

Gynaecological diseases including placental dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-eclampsia, endometriosis and other gynaecological diseases.

Ophthalmologic disorders such as Leber Congenital Amaurosis (LCA) including LCA10, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, glaucoma, including open angle glaucoma and juvenile congenital glaucoma, intraocular inflammation, e.g. retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, macular degeneration including age related macular degeneration (AMD) and juvenile macular degeneration including Best Disease, Best vitelliform macular degeneration, Stargardt’s Disease, Usher’s syndrome, Doyne's honeycomb retinal dystrophy, Sorby’s Macular Dystrophy, Juvenile retinoschisis, Cone-Rod Dystrophy, Corneal Dystrophy, Fuch’s Dystrophy, Leber's congenital amaurosis, Leber’s hereditary optic neuropathy (LHON), Adie syndrome, Oguchi disease, degenerative fondus disease, ocular trauma, ocular inflammation caused by infection, proliferative vitreo- retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g. following glaucoma filtration operation, reaction against ocular implants, corneal transplant graft rejection, and other ophthalmic diseases, such as diabetic macular oedema, retinal vein occlusion, RLBP1 -associated retinal dystrophy, choroideremia and achromatopsia.

Neurological and neurodegenerative disorders including Parkinson's disease, complication and/or side effects from treatment of Parkinson's disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, strokes, post-polio syndrome, psychiatric disorders, myelitis, encephalitis, subacute sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Fabry disease, Gaucher disease, Cystinosis, Pompe disease, metachromatic leukodystrophy, Wiscott Aldrich Syndrome, adrenoleukodystrophy, beta-thalassemia, sickle cell disease, Guillaim-Barre syndrome, Sydenham chorea, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, Frontotemporal dementia, CNS compression or CNS trauma or infections of the CNS, muscular atrophies and dystrophies, diseases, conditions or disorders of the central and peripheral nervous systems, motor neuron disease including amyotropic lateral sclerosis, spinal muscular atropy, spinal cord and avulsion injury.

Other diseases and conditions such as cystic fibrosis, mucopolysaccharidosis including Sanfilipo syndrome A, Sanfilipo syndrome B, Sanfilipo syndrome C, Sanfilipo syndrome D, Hunter syndrome, Hurler-Scheie syndrome, Morquio syndrome, ADA- SCID, X-linked SCID, X-linked chronic granulomatous disease, porphyria, haemophilia A, haemophilia B, post-traumatic inflammation, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, septic shock, infectious diseases, diabetes mellitus, complications or side effects of surgery, bone marrow transplantation or other transplantation complications and/or side effects, complications and side effects of gene therapy, e.g. due to infection with a viral carrier, or AIDS, to suppress or inhibit a humoral and/or cellular immune response, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue. siRNA, micro-RNA and shRNA

In certain other embodiments, the NOI comprises a micro-RNA. The micro-RNA which is the NOI (i.e. transgene) is distinct from the self-destabilisation or self-decay element described herein. Thus, a micro-RNA which is the transgene typically does not target the mRNA encoding the transgene. A micro-RNA which is the transgene may target the mRNA encoding another transgene (i.e. a second transgene) in order to regulate the second transgene mRNA, for example, as part of a gene switch system.

In addition to the NOI, the vector may also comprise or encode a miRNA, siRNA, shRNA, or regulated shRNA (Dickins et al. (2005) Nature Genetics 37: 1289-1295, Silva et al. (2005) Nature Genetics 37:1281-1288). Preferably, the vector may comprise or encode a miRNA or shRNA in addition to the NOI. The additional miRNA, siRNA, shRNA, or regulated shRNA is distinct from the self-destabilisation or self-decay element described herein. Thus, the additional miRNA, siRNA, shRNA, or regulated shRNA does not target the mRNA encoding the transgene.

Pharmaceutical Compositions

The present disclosure provides a pharmaceutical composition comprising the lentiviral vector as described herein or a cell or tissue transduced with the viral vector as described herein, in combination with a pharmaceutically acceptable carrier, diluent or excipient.

The present disclosure provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of a lentiviral vector. The pharmaceutical composition may be for human or animal usage.

The composition may comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient or diluent can be made with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise, or be in addition to, the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s) and other carrier agents that may aid or increase vector entry into the target site (such as for example a lipid delivery system). Where appropriate, the composition can be administered by any one or more of inhalation; in the form of a suppository or pessary; topically in the form of a lotion, solution, cream, ointment or dusting powder; by use of a skin patch; orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents; or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly, intracranially, intraoccularly intraperitoneally, or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration, the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.

The lentiviral vector as described herein may also be used to transduce target cells or target tissue ex vivo prior to transfer of said target cell or tissue into a patient in need of the same. An example of such cell may be autologous T cells and an example of such tissue may be a donor cornea.

Variants, Derivatives, Analogues, Homologues and Fragments

In addition to the specific proteins and nucleotides mentioned herein, the present invention also encompasses the use of variants, derivatives, analogues, homologues and fragments thereof.

In the context of the present invention, a variant of any given sequence is a sequence in which the specific sequence of residues (whether amino acid or nucleic acid residues) has been modified in such a manner that the polypeptide or polynucleotide in question retains at least one of its endogenous functions. A variant sequence can be obtained by addition, deletion, substitution, modification, replacement and/or variation of at least one residue present in the naturally-occurring protein.

The term “derivative” as used herein, in relation to proteins or polypeptides of the present invention includes any substitution of, variation of, modification of, replacement of, deletion of and/or addition of one (or more) amino acid residues from or to the sequence providing that the resultant protein or polypeptide retains at least one of its endogenous functions. The term “analogue” as used herein, in relation to polypeptides or polynucleotides includes any mimetic, that is, a chemical compound that possesses at least one of the endogenous functions of the polypeptides or polynucleotides which it mimics.

Typically, amino acid substitutions may be made, for example from 1 , 2 or 3 to 10 or 20 substitutions provided that the modified sequence retains the required activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues.

Proteins used in the present invention may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent protein. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues as long as the endogenous function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include asparagine, glutamine, serine, threonine and tyrosine.

Conservative substitutions may be made, for example according to the table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

The term “homologue” means an entity having a certain homology with the wild type amino acid sequence and the wild type nucleotide sequence. The term “homology” can be equated with “identity”.

In the present context, a homologous sequence is taken to include an amino acid sequence which may be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95%, 97 or 99% identical to the subject sequence. Typically, the homologues will comprise the same active sites etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.

In the present context, a homologous sequence is taken to include a nucleotide sequence which may be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95%, 97%, 98% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in the context of the present invention it is preferred to express homology in terms of sequence identity.

Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate percentage homology or identity between two or more sequences.

Percentage homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an “ungapped” alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion in the nucleotide sequence may cause the following codons to be put out of alignment, thus potentially resulting in a large reduction in percent homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting “gaps” in the sequence alignment to try to maximise local homology.

However, these more complex methods assign “gap penalties” to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. “Affine gap costs” are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum percentage homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Research 12:387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid - Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al. (1999) ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. Another tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett (1999) 174(2):247-50; FEMS Microbiol Lett (1999) 177(1):187-8).

Although the final percentage homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Once the software has produced an optimal alignment, it is possible to calculate percentage homology, preferably percentage sequence identity. The software usually does this as part of the sequence comparison and generates a numerical result.

“Fragments” are also variants and the term typically refers to a selected region of the polypeptide or polynucleotide that is of interest either functionally or, for example, in an assay. “Fragment” thus refers to an amino acid or nucleic acid sequence that is a portion of a full- length polypeptide or polynucleotide.

Such variants may be prepared using standard recombinant DNA techniques such as site- directed mutagenesis. Where insertions are to be made, synthetic DNA encoding the insertion together with 5' and 3' flanking regions corresponding to the naturally-occurring sequence either side of the insertion site may be made. The flanking regions will contain convenient restriction sites corresponding to sites in the naturally-occurring sequence so that the sequence may be cut with the appropriate enzyme(s) and the synthetic DNA ligated into the break. The DNA is then expressed in accordance with the invention to make the encoded protein. These methods are only illustrative of the numerous standard techniques known in the art for manipulation of DNA sequences and other known techniques may also be used.

All variants, fragments or homologues of the regulatory protein suitable for use in the cells and/or modular constructs of the invention will retain the ability to bind the cognate binding site of the NOI such that translation of the NOI is repressed or prevented in a viral vector production cell.

All variants fragments or homologues of the binding site will retain the ability to bind the cognate RNA-binding protein, such that translation of the NOI is repressed or prevented in a viral vector production cell.

Codon Optimisation

The polynucleotides used in the present invention (including the NOI and/or components of the vector production system) may be codon-optimised. Codon optimisation has previously been described in WO 1999/41397 and WO 2001/79518. Different cells differ in their usage of particular codons. This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence so that they are tailored to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. By the same token, it is possible to decrease expression by deliberately choosing codons for which the corresponding tRNAs are known to be rare in the particular cell type. Thus, an additional degree of translational control is available.

Many viruses, including retroviruses, use a large number of rare codons and changing these to correspond to commonly used mammalian codons, increases expression of a gene of interest, e.g. a NOI or packaging components in mammalian production cells, can be achieved. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms.

Codon optimisation of viral vector packaging components has a number of other advantages. By virtue of alterations in their sequences, the nucleotide sequences encoding the packaging components of the viral particles required for assembly of viral particles in the producer cells/packaging cells have RNA instability sequences (INS) eliminated from them. At the same time, the amino acid sequence coding sequence for the packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the packaging components is not compromised. In lentiviral vector gag/pol expression cassettes codon optimisation also overcomes the Rev/RRE requirement for export, rendering optimised sequences Rev-independent. Codon optimisation also reduces homologous recombination between different constructs within the vector system (for example between the regions of overlap in the gag-pol and env open reading frames). The overall effect of codon optimisation is therefore a notable increase in viral titre and improved safety.

In some preferred embodiments, the sequence encoding Gag/Pol is codon optimised.

In one aspect only codons relating to INS are codon optimised. However, in a much more preferred and practical aspect, the sequences are codon optimised in their entirety, with some exceptions, for example the sequence encompassing the frameshift site of gag-pol (see below).

The gag-pol gene of lentiviral vectors comprises two overlapping reading frames encoding the gag-pol proteins. The expression of both proteins depends on a frameshift during translation. This frameshift occurs as a result of ribosome “slippage” during translation. This slippage is thought to be caused at least in part by ribosome-stalling RNA secondary structures. Such secondary structures exist downstream of the frameshift site in the gag-pol gene. For HIV, the region of overlap extends from nucleotide 1222 downstream of the beginning of gag (wherein nucleotide 1 is the A of the gag ATG) to the end of gag (nt 1503). Consequently, a 281 bp fragment spanning the frameshift site and the overlapping region of the two reading frames is preferably not codon optimised. Retaining this fragment will enable more efficient expression of the Gag-Pol proteins. For EIAV the beginning of the overlap has been taken to be nt 1262 (where nucleotide 1 is the A of the gag ATG) and the end of the overlap to be nt 1461 . In order to ensure that the frameshift site and the gag-pol overlap are preserved, the wild type sequence has been retained from nt 1156 to 1465.

Derivations from optimal codon usage may be made, for example, in order to accommodate convenient restriction sites, and conservative amino acid changes may be introduced into the Gag-Pol proteins. In one aspect, codon optimisation is based on lightly expressed mammalian genes. The third and sometimes the second and third base may be changed.

Due to the degenerate nature of the genetic code, it will be appreciated that numerous gag- pol sequences can be achieved by a skilled worker. Also there are many retroviral variants described which can be used as a starting point for generating a codon-optimised gag-pol sequence. Lentiviral genomes can be quite variable. For example there are many quasispecies of HIV-1 which are still functional. This is also the case for EIAV. These variants may be used to enhance particular parts of the transduction process. Examples of HIV-1 variants may be found at the HIV Databases operated by Los Alamos National Security, LLC at http://hiv-web.lanl.gov. Details of EIAV clones may be found at the National Center for Biotechnology Information (NCBI) database located at http://www.ncbi.nlm.nih.gov.

The strategy for codon-optimised gag-pol sequences can be used in relation to any retrovirus. This would apply to all lentiviruses, including EIAV, FIV, BIV, CAEV, VMR, SIV, HIV-1 and HIV-2. In addition this method could be used to increase expression of genes from HTLV-1 , HTLV-2, HFV, HSRV and human endogenous retroviruses (HERV), MLV and other retroviruses.

TRIP System

The present invention, as disclosed herein, may be combined with the ‘TRIP’ system.

Accordingly, in one aspect, the present invention provides a nucleotide sequence comprising a lentiviral vector genome expression cassette comprising an inactivated major splice donor site, a transgene expression cassette and a vector intron, and optionally, the TRIP system.

W02015/092440 and WO2021/094752, which are incorporated in their entirety herein by reference, disclose the use of a heterologous translation control system in eukaryotic cell cultures to repress the translation of the NOI (repress transgene expression) during viral vector production and thus repress or prevent expression of the protein encoded by the NOI. This system is referred to as the Transgene Repression In vector Production cell system or TRIP system.

In one form, the TRIP system utilises the bacterial trp operon regulation protein, tryptophan RNA-binding attenuation protein (TRAP), and the TRAP binding site/sequence (tbs) to mediate transgene repression. The use of this system does not impede the production of packageable vector genome molecules nor the activity of vector virions, and does not interfere with the long-term expression of the NOI in the target cell.

The term “binding site” is to be understood as a nucleic acid sequence that is capable of interacting with a certain protein.

By “capable of interacting” it is to be understood that the nucleic acid binding site (e.g. tbs or portion thereof) is capable of binding to a protein, for example TRAP, under the conditions that are encountered in a cell, for example a eukaryotic viral vector production cell. Such an interaction with an RNA-binding protein such as TRAP results in the repression or prevention of translation of a NOI to which the nucleic acid binding site (e.g. the tbs or portion thereof) is operably linked.

A consensus TRAP binding site sequence that is capable of binding TRAP is [KAGNN] repeated multiple times (e.g. 6, 7, 8, 9, 10, 11 , 12 or more times); such sequence is found in the native trp operon. In the native context, occasionally AAGNN is tolerated and occasionally additional “spacing” N nucleotides result in a functional sequence. In vitro experiments have demonstrated that at least 6 or more consensus repeats are required for TRAP-RNA binding (Babitzke P, Y. J., Campanelli D. (1996) Journal of Bacteriology 178(17): 5159-5163). Therefore, preferably in one aspect there are 6 or more continuous [KAGN>2] sequences present within the tbs, wherein “K” may be T or G in DNA and II or G in RNA and “N” is to be understood as specifying any nucleotide at that position in the sequence (for example, “N” could be G, A, T, C or II).

In one aspect, the lentiviral vector genome comprises a tbs.

In some embodiments, the nucleotide sequence of the invention further comprises a TRAP binding site (tbs).

Suitable tbs are described in WO2015/092440 and WO2021/094752 and are incorporated herein by reference. Suitably, the nucleotide sequence may further comprise a tbs, and also may comprise a Kozak sequence, wherein said tbs overlaps the Kozak sequence, or wherein said Kozak sequence comprises a portion of a tbs. Suitably, the nucleotide sequence may further comprise a multiple cloning site and a Kozak sequence, wherein said multiple cloning site is overlapping with or located downstream to the 3’ KAGN2-3 repeat of the tbs and upstream of the Kozak sequence. As used herein, a “multiple cloning site” is to be understood as a DNA region which contains several restriction enzyme recognition sites (restriction enzyme sites) very close to each other. In one aspect, the RE sites may be overlapping in the MCS for use in the invention.

As used herein, a “restriction enzyme site” or “restriction enzyme recognition site” is a location on a DNA molecule containing specific sequences of nucleotides, 4-8 nucleotides in length, which are recognised by restriction enzymes. A restriction enzyme recognises a specific RE site (i.e. a specific sequence) and cleaves the DNA molecule within, or nearby, the RE site.

In some aspects of the present invention, the nucleotide of interest (i.e. transgene) is operably linked to the tbs. In some aspects, the nucleotide of interest is translated in a target cell which lacks TRAP.

By “operably linked” it is to be understood that the components described are in a relationship permitting them to function in their intended manner. Therefore a tbs or portion thereof for use in the invention operably linked to a NOI is positioned in such a way that translation of the NOI is modified when as TRAP binds to the tbs or portion thereof.

The tbs may be capable of interacting with TRAP such that translation of the nucleotide of interest is repressed or prevented in a viral vector production cell.

Combinations of Vector Features

It is to be understood that features disclosed herein may be used in combination with one another. Furthermore, it is to be understood that such features may possess different functionalities by virtue of the nucleotide sequence comprising them. For example, in some aspects the vector intron may optionally comprise a transgene mRNA self-destabilization or self-decay element, which facilitates RNA destabilization/decay.

In a preferred aspect, the invention provides the aforementioned lentiviral vector genome expression cassette wherein, in combination with the above, at least one internal open reading frame (ORF) in the modified nucleotide sequence encoding gag is disrupted, as described herein.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements) Current Protocols in Molecular Biology, Ch. 9, 13, and 16, John Wiley & Sons, New York, NY; B. Roe, J. Crabtree, and A. Kahn (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O’D. McGee (1990) In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (ed.) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and, D. M. J. Lilley and J. E. Dahlberg (1992) Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. Each of these general texts is herein incorporated by reference.

This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of aspects of this disclosure. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure.

It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. The terms "comprising", "comprises" and "comprised of' as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms "comprising", "comprises" and "comprised of' also include the term "consisting of.

The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto.

The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention.

It is to be understood that any nucleotide sequence disclosed herein may be a DNA sequence or an RNA sequence. As such, a sequence recited comprising thymine nucleotides is considered disclosed as a corresponding RNA sequence comprising Uracil nucleotides in place of said Thymine nucleotides, and vice versa. Accordingly, DNA sequences contained within the corresponding sequence listing will be understood as also representing an RNA of identical sequence (with Thymines replaced by Uracils), and vice versa.

EXAMPLES

Example 1 : Use of a Vector-Intron within LV genomes harbouring functional mutations within the SL2 loop of the packaging signal to ablate aberrant splicing allow for rev/RRE-independence.

Figure 1 displays the basic configuration of the Vector-Intron LV genome expression cassette in comparison to current, ‘standard’ LV genomes. Both types of genome expression cassettes are driven by powerful, constitutive promoters independently of HIV-1 tat, although the inventors have shown previously that HIV-1 tat can fully recover the titres of LV genomes harbouring a mutation in the MSD. However, contemporary 3^rd generation LV production systems have been purposely developed to remove tat-dependence due to the safety concerns associated with this potent transcriptional activator. Re-instating tat into LV production systems would be seen as a substantial retrograde step in vector development, and it may be difficult to justify to regulators in order to sanction their use for clinical applications. Standard and VI LV genomes both share the same packaging sequence from the 5’ R to SL1 (dimerization loop) but then diverge principally in the SL2 loop, which contains the MSD. For VI genomes the MSD and a cryptic splice donor (crSD) site adjacent to it are both mutated to stop aberrant splicing into downstream positions. The inventors previously developed a substantive modification to the SL2 loop wherein the majority of the HIV-1 sequence is replaced with a heterologous stem loop absent of any splice donor site called ‘MSD-2KOm5’. The MSD-2KOm5 variant is preferred in the present invention as it has a lower impact on LV titres compared to the ‘MSD-2KO’ mutation, which harbours GT>CA mutations at the MSD and crSD sites. Additionally, the MSD-2KOm5 variant also appears to suppress aberrant splicing from another cryptic splice donor site in the SL4 loop of the packaging signal.

Although optional, Vl-containing LV genomes may also be deleted in the p17-INS sequence of the gag region that is typically retained in standard LV genomes as part of the wider packaging sequence. As for standard LV genomes, Vl-containing LV genomes harbor the central poly purine tract (cppt) and a self-inactivating (SIN) 3’LTR. The transgene cassette typically contains a pol-ll promoter and transgene ORF, with the 3’polyA site in the SIN LTR being used for both the vector genome vRNA and the transgene mRNA. The Vl-containing LV genomes differ further from standard LV genomes in that they encode a functional intron in place of the RRE. Contemporary LVs also typically include a post-transcriptional regulatory element (PRE), such as the wPRE to enhance expression of (typically intron-less) transgene cassettes. Other transgenic sequences may also be encoded on the vector such as pol-ll I driven microRNA or gRNA for CRISPR-cas9 approaches. The Vl-containing LV genomes differ further from standard LV genomes in that they encode a functional intron in place of the RRE. When considering the length of the wild type HIV-1 genome of ~9.5kb, the Vl-containing LV in its basic form can package approximately ~1 kb of additional transgene sequence relative to standard LV genomes.

Figure 2 provides evidence that combining both the MSD-2KO feature and the Vector-Intron is beneficial in achieving maximal LV titres in a rev/RRE-independent manner. HIV-CMV-GFP vectors were created from a standard LV genome, containing a wild type packaging signal (with intact MSD) and the RRE. Vectors were produced in both adherent (Figure 2A) and suspension [serum-free] (Figure 2B) mode in HEK293T cells, and efficient out-put titres were shown to be dependent on the presence of rev. Deletion of the RRE from the standard MSD- proficient LV genome resulted in loss of rev-responsiveness (as expected), although interestingly titres produced in the absence of rev increased 10-fold, confirming that the RRE is inherently unstabilising to vRNA. The insertion of a VI (the first variant Vl_1 .1 , is the EF1a intron - see Table 1 below) in place of the deleted RRE had no substantive effect on LV titres. However, the same modifications tested in the context of the MSD-2KO LV genome produced surprisingly different results. Here, the attenuating impact of the MSD-2KO mutation was dramatic for the RRE-containing genome, as titres were three orders of magnitude reduced in the presence of rev. Addition of the VI to this RRE-containing LV genome dramatically increased vector titres independently of the presence of rev, although the highest titres were only realized in the presence of rev. Given the apparent destabilizing effect of the RRE observed previously, the RRE was deleted from the MSD-2KO LV genome containing the VI, which not only increased vector titres to within 2-fold of the standard LV genome (+rev) but this was not dependent on the presence of rev. Thus it was shown that the ability of a Vector- Intron to rescue titres of MSD-2KO modified LV genomes is maximized when the RRE is deleted.

TABLE 1

Table 1 : A list of Vector-Intron variants designed and used to exemplify and optimize the invention, together with a visual representation of the functional sequences utilized in each variant.

Vector-Introns tested included native sequences from the EF1a (v1 series) and Ubiquitin (v2 series) introns, and also widely used chimeric/synthetic introns such as CAG (Chicken Actin + Rabbit beta-globin; v3 series) and the Rabbit beta-globin + human IgG chimeric intron used in the pCI/pSI series of expression plasmids sold by Promega; v4 series). Further Vector- Introns were designed to swap different functional parts of the intron, namely: the splice donor sequence, the branch-splice acceptor sequence, as well as appending upstream exonic splicing enhancer elements from HIV-1 (hESE, hESE2, hGAR). These novel Vector-Introns were improved in either their ability to splice ‘cleanly’ and/or ability to increase LV titre. Example 2: The MSD-2K0 and RRE-deletion work synergistically to generate correctly spliced and packaged LV vRNA when applied to Vl-containing LV genome expression cassettes.

To understand the impact of the MSD-2KO, RRE and rev on the production of Vl-‘derived’ LV vRNA in the cell and in virions, samples from the experiment performed in generating the data in Figure 2A were used (only samples where the VI was present in the LV genome). Total poly-A selected RNA from post-production cell lysates and crude LV harvest material were subjected to RT-PCR analysis using appropriately positioned forward and reverse primers as shown in Figure 3A. The same figure displays the Vl-containing LV DNA expression cassette and the positions of relevant c/s-acting sequences with regard to potential spliced products generated from transcription from the external promoter (here, the transgene mRNA is not shown for clarity). Thus, different sized RT-PCR products might be detected depending on the presence of the RRE and the potential for splicing from the MSD, crSD and the alternative crSD2 (active in MSD-2KO but not MSD-2KOm5 variants; see later Examples) to downstream splice acceptors (including the VI sa).

Figure 3B displays the result of this analysis and provides further support to the data shown in Figure 2. First of note is the stimulation of longer packageable vRNA by rev only when the RRE is resident on the genome. Interestingly, rev/RRE appeared to inhibit splicing-out of the VI by -50%, resulting in a 50:50 mixture of LV vRNA retaining the VI or not. This in itself provided a secondary reason to pursue rev/RRE-independence of VI-LV genomes since it is desirable to generate LV populations with homogeneous vRNAs. Secondly, the results show an extremely large amount of aberrant splicing from the MSD to the VI splice acceptor, analogous to what is typically observed in standard LV genomes containing the EF1 a promoter (with its own intron) as the internal transgene promoter (Vl_v1.1 is the EF1a intron). The MSD- 2KO mutation ablated this aberrant splicing, although this stimulated aberrant splicing from the crSD2 site in SL4 of the packaging signal into the VI splice acceptor. Interestingly, the deletion of the RRE minimized the amount of this specific aberrant splicing activity, although there were other products detected in the cells that were apparently not efficiently packaged. Finally, the MSD-2KO/ARRE VI-LV genome generated the highest levels of Vl-spliced LV vRNA in both cells and vector virions, and this occurred independently of rev. Based on these data, other introns - both natural and synthetic - were evaluated for use as Vector-Introns in the invention as reported in following examples.

Example 3: Initial evaluation of different introns for use as the Vector-Intron

The principals of RNA splicing are well characterized, and the c/s-acting elements required are well understood, as are the factors that interact with them (Bates et al. (2017), Pharmacological Reviews 69: 63-79). Figure 4 provides a basic overview of the core c/s-acting sequences embedded within introns as well as adjacent exonic regions that are known to modulate splicing efficiency. Since intronic sequences are not constrained by protein-coding sequences, they tend to be more divergent from exonic sequences when comparing homologous genes from similar species. To assess the impact of varying the specific intronic sequence used as the Vector-Intron, several initial variants were generated based on well- characterized and/or widely used introns. An overview of the various introns and chimeric introns is shown in Table 1. Initial variants were based on the native intron from the human Ubiquitin gene (UBC), as well as synthetic/chimeric introns of the CAG promoter and the ‘pCI’ series of expression plasmids originally developed by Promega; these were compared to the native intron of the EF1a promoter used in previous Examples (Vl_v1.1).

Figure 5 displays the results of similarly described previous comparisons of standard, MSD/RRE-containing LV vectors and these VI-LV vectors in adherent HEK293T cells. Whilst in this data set the Vl_v1.1 variant did not restore vector titres to the same levels as seen in Figure 2A (perhaps due to some technical variability), the experiment did indicate that the general effect of titre enhancement by a VI appear to be generally independent of any specific intron i.e. the action of splicing was the most important aspect. The UBC intron appeared to be minimally active whereas the chimeric intron from pCI gave the greatest increase in titres in this experiment. It has been reported that splicing of the UBC intron from RRE-containing LV genomes behaves differently to other introns (such as EF1a; Cooper A., R., et al., Nucleic Acids Research, Volume 43, Issue 1, 9 January 2015, Pages 682-690). Given the potential for variable results with the UBC intron, it was not pursued further for further optimisation. Rather, Vl_v4.2, based on the chimeric intron from pCI, was chosen for further optimization, and all subsequent evaluations were performed in suspension (serum-free) HEK293T cells, where more robust comparisons were gained.

Example 4: Optimisation of a Vector-Intron

The following example demonstrates how Vector-Intron sequences (and those flanking it) can be improved towards attaining better titre-enhancing effect. The variant Vl_v4.1 is the chimeric intron from the pCI series of expression plasmids developed by Promega; this contains a fusion between the rabbit beta-globin intron (splice donor and most of the intronic sequence) and the human IgG heavy chain intron branch and splice acceptor sequence. Variant Vl_v4.2 additionally includes a 39bp ‘legacy’ sequence from the RRE that was retained due to cloning restraints; upon in silico analysis this sequence is predicted to bind a number of splicing enhancers and therefore became a sequence of interest in a potential role in enhancing VI splicing. This sequence was found to improve the titre-boosting effect of Vl_4.1 in Example 4 (Figure 5), and is herein referred to as ‘hESE’. To assess how further improvements might be gained, other sequences were added or swapped-in with typical sequences shown in Figure 4, and MSD-2KO/ARRE VL LV genomes containing an EFS-GFP transgene produced in suspension (serum-free) HEK293T cells in the absence of rev (see Table 1 and Figure 6). First, the splice donor of the rabbit beta-globin intron of Vl_4.2 was replaced with the major splice donor (MSD[1]) of HIV-1 in variant Vl_v4.3, which indeed stimulated titre increase. An alternative HIV-1 splice donor sequence was assessed, optionally together with its upstream exonic sequence (VI_v4.4/4.5/4.6); this exon has previously shown to stabilize HIV-1 vRNA (Lutzelberger, M., et al. Journal of Biological Chemistry, Volume 281, Issue 27, 18644 - 18651). Vl_v4.6 additionally harbored ATG mutations to ensure no translation of HIV-1 sequences, and was tested with the rabbit beta-globin splice donor sequence. However, none of these features appeared to provide further benefit in VI LV genomes, and demonstrated that the novel hESE provided substantial benefit to titre increase. Next splice donor 4 (SD4) from HIV-1 was used to replace the rabbit beta-globin splice donor sequence, optionally together with another ESE from HIV-1 called ‘GAR’ (Kammler, S., et al. RNA. 2001;7(3):421- 434. & Caputi, M, et al., J Virol. 2004; 78(12):6517-6526) the GAR-SD4 sequence is principally exon5 of wild type HIV-1. The titre of the Vl_v4.8 variant was the highest of this set of variants tested, indicating that the GAR ESE provided some benefit.

Example 5: Vector Intron variants based on the human beta-globin intron-2

The human beta-globin gene transcription unit contains a well characterized and efficiently spliced intron (the second intron, also known as ‘IVS2’). It is known that this intron is efficiently spliced from lentiviral vector genomes when inserted in the forward orientation, and is only retained when the RRE is inserted within intronic sequence (Uchida, N., et al. Nat Commun 10, 4479. 2019). It was therefore hypothesized that this intron (herein referred to as ‘hu B- Glo’) might form an alternative for optimization as a Vector- Intron. Accordingly, Vl_5.1 was generated, which is the entire hu B-Glo intron together with the hESE. Additionally, Vl_5.2 was also generated, wherein the hu B-Glo splice donorwas replaced with HIV-1 SD4 and the hESE was replaced with the hGAR. These were cloned and tested within an MSD-2KO/ARRE LV- EFS-GFP genomes to produce LV in suspension (serum-free) HEK293T cells in comparison to variants containing VI_v4.2/4.8 (Figure 7). These data show that indeed the hu B-Glo based Vis were indeed capable of producing high titre MSD-2KO/ARRE LV in a rev-independent manner, with Vl_5.2 producing the highest boost in titre. Next, these variant Vis were transferred into an alternative LV backbone wherein the preferred MSD/crSD mutant ‘MSD-2KOm5’ was present and the p17-INS sequence in the retained gag sequence (as part of packaging sequence) has been deleted to further increase capacity (‘Ap17INS’ or ‘gag81’; see Example 8). These variant genomes were compared to previous variants in suspension (serum-free) HEK293T cells in the absence of rev (Figure 8). These results show that the variant Vis are able to produce LV titres of MSD-mutated genomes in a rev/RRE-independent manner irrespectively of the type of ablative mutation of the MSD.

Example 6: MSD-2KO/ARRE Vector-Intron LV production is stimulated by Prostratin

To assess if MSD-2KO/ARRE Vector-Intron LV production is stimulated by Prostratin, suspension (serum-free) HEK293T cells were transfected with LV packaging components and with either a standard LV genome plasmid +/- rev plasmid, or a MSD-2KO/ARRE VI LV genome plasmid, with or without addition of Prostratin post-transfection (Figure 9). The data demonstrates that the rev/RRE-independent production of MSD-2KO/ARRE VI LVs can be stimulated by Prostratin to a similar extent as observed with standard LVs.

Example 7: Use of ‘self-cleaving’ cis-elements within the 3’ UTR of inverted transgene cassettes contained within Vector-Intron LV genome cassettes to rescue LV component expression from dsRNA sensing mechanisms and allow for efficient transgene repression during LV production

The unique features of the Vector-Intron genomes allows for other novel aspects of vector design that are advantageous. Since out-splicing of the VI stimulates splicing of other introns encoded within the transgene cassette, the retention of transgene introns (such as the EF1a promoter intron) when the transgene cassette is facing forward (i.e. encoded on the top strand) is not efficient/possible. Whilst there are good reasons why transgene introns perhaps should not be used in LVs (principally because splicing events into cellular genes can occur), nevertheless they provide a boost to expression in certain target cells. A way of ensuring transgene intron retention within VI LV vRNA is to invert the transgene cassette so that the transgene intron is not recognised as such in the anti-sense direction. If utilising a tissue specific promoter that is not/minimally active during production then this approach requires no further considerations. However, should the transgene promoter generate sufficient levels of transgene mRNA during LV production then the possibility of generating long dsRNA products via vRNA:mRNA annealing increases, and this will trigger innate dsRNA sensing pathways, such as those involving oligoadenylate synthetase-ribonuclease L (OAS-RNase L), protein kinase R (PKR), and interferon (IFN)/ melanoma differentiation-associated protein 5 (MDA- 5). Whilst a number of these pathways are likely to be (partly) defective in HEK293(T) cells (Ferreira, C., B., et. al., Mol Ther Methods Clin Dev. (2019); 17:209-219.), here the inventors provide evidence that generation of cytoplasmic dsRNA results in suppression of de novo protein synthesis. Figure 11 shows a simple experiment where a standard rev/RRE-dependent LV containing an inverted EFS-GFP-polyA cassette was produced in HEK293T cells with or without rev. Only when rev was present - and therefore full length vRNA could be transported to the cytoplasm where it could anneal to the transgene mRNA - was de novo expression of VSV-G/p24 suppressed, indicating that a cytoplasmic dsRNA response (e.g. PKR) was likely triggered. In the same experiment a VI LV genome was tested with the same transgene cassette in forward or inverted orientation without rev, and showed the same phenotype for the inverted variant. Therefore, one solution to avoid this response is to knock-down or knock out endogenous PKR in the LV production cell, or over-express protein factors shown to inhibit dsRNA sensing mechanisms, as indeed others have shown is possible (Hu, P., et. al., Gene Ther. 2018 Oct;25(7):454-472 & Maetzig T., et. al., Gene Ther. (2010);17(3):400-11).

An alternative to the above solutions, which is entirely dependent on the Vector-Intron approach, is to insert functional cis-elements within the 3’ UTR of the inverted transgene cassette such that they are positioned within the VI sequence encoded on the top strand, and therefore are lost from the packaged vRNA and resulting integrated LV cassette (Figure 12). The cis-elements are ‘self-cleaving’ or de-stabilising elements such that the steady-state pool of transgene pre-/mRNA during LV production is reduced, and therefore limiting the amount of dsRNA that can be generated.

For example, the cis-elements can be one or more ‘self-targeting’ microRNA cassettes that are cleaved from the 3’ UTR of the transgene mRNA (thus removing the polyA tail of the mRNA, leading to destabilisation), and then are processed by DROSHA/Dicer and loaded into the RISC complex to target 5’ UTR and/or coding-region and/or 3’UTR sequences within the transgene mRNA such that further cleavage can occur. Preferably, the microRNAs are designed such that guide strand is fully matched to the target sequence in the transgene mRNA (allowing the further efficient cleavage) and the passenger strand is mis-matched, such that if the passenger strand was occasionally loaded as the guide strand it would only anneal to the vRNA and not efficiently cleave it (Figure 13).

For example, the cis-elements can be one or more ‘self-cleaving’ ribozymes that once transcribed in the pre-mRNA efficiently result in cleavage of the 3’ UTR and loss of the polyA tail, and will therefore limit the amount of transgene mRNA being transported to the cytoplasm (Figure 13). The invention provides several examples of how self-cleaving ribozymes can be used to accomplish this in Figure 14. A VI LV genome containing an inverted EF1a-GFP-polyA cassette, as well as the MSD-2KOm5 modification, the gag-p17 deletion in Psi and the Vl_v5.7 in place of the RRE, was generated to harbour various combinations of cis-acting elements within the 3’ UTR of the inverted transgene cassette, and also embedded within the anti-sense VI sequence (see Figure 14B). These were ribozymes based on: Hammerhead ribozyme (HH_RZ), Hepatitis delta virus ribozyme (HDV-AG), and two modified Schistosoma mansoni hammerhead ribozymes (T3H38/T3H48) (De la Pena, M., et. al., EMBO J. (2003);22(20):5561-70; Webb, C., H., & Luptak, A., RNA Biol. (2011);8(5):719-27; & Zhong, G., et. al., Nat Biotechnol. (2020);38(2): 169-175.). Additionally, other cis-elements tested were the ‘negative regulator of splicing’ (NRS) element from RSV, or a splice donor site, as these have been shown to modulate mRNA stability and/or nuclear retention via recruitment of U1 snRNA (Cochrane, A., W., et. al., Retrovirology 3, 18 (2006); and Lee, E., S., et. al., PLoS One. (2015);10(3):e0122743). These genomes plasmids were used to make LVs in suspension (serum-free) HEK293T cells, and VSVG/p24 levels or vRNA levels assessed in harvest supernatants (Figure 14A and 14C respectively). In summary, Figure 14A shows that a single, and preferably two ribozymes inserted within the 3’ UTR of the inverted transgene cassette enables full reversal of the effect of dsRNA sensing on LV virion component protein expression levels in harvest supernatants. Figure 14C not only demonstrates that both 1x and 2x ribozymes within the 3’ UTR of the inverted transgene results in substantial amount of vRNA packaged into LVs but also that the VI is still ‘cleanly’ spliced-out from the vRNA, since a single RT-PCR band of the expected size is generated. The impact of the self-cleaving ribozymes was a ~100-fold increase in LV titres (Figure 15).

The ‘Transgene Repression In vector Production’ (TRiP) system was previously developed to stop unwanted impacts of transgene protein on vector output titre during LV production. This is achieved by co-expressing the bacterial protein TRAP and inserting its target sequence (tbs) close to the transgene Kozak sequence; the TRAP/tbs complex functions to block translation initiation. In employing this system, LV titres can be substantially rescued from the impacts of the transgene proteins they encode. In the present invention, the novel configuration of ‘sense’ encoded VI and the use of self-cleaving ribozymes within the 3’UTR of an inverted transgene cassette allows for very efficient transgene repression during LV production in a manner independent of protein-encoded factors. During production of the described VI LV genomes, the GFP expression was assessed in post-production cells by flow cytometry, and Expression Scores (ES) generated by multiplying the % GFP positive by the median fluorescence intensity (Arb units). Figure 15 also shows this data and indicates that the utilisation of these novel, inverted transgene VI LV genome cassettes, transgene expression is suppressed by over 1000-fold. Example 8: Further truncation of minimal gag sequences within the packaging region in combination with Vector-Intron

Previous examples utilised the ‘Ap17INS’ feature wherein the p17 instability element within retained gag sequences had been removed (to leave ~80 nucleotides of gag), and showed that this modification does not impact LV titres of genomes harbouring a Vector- Intron. Here, further variants of an MSD-2KO LV genome harbouring Vl_5.5 were generated wherein the retained gag sequence (as part of extended packaging signal) was further reduced to 57, 31 , 14 and essentially zero gag sequence. These sequences (including Ap17INS/gag81) also harboured an ATG>ACG mutation in the primary initiation codon of gag - a further safety feature to eliminate any possible expression of gag peptide in transduced cells should vector backbone sequences be mobilised by transcription read-in from cellular promoters. Figure 16 displays the results of producing these vectors in suspension (serum-free) HEK293T cells, and indicate that retained gag sequences can be minimised to ~30 nucleotides without affecting output titres of Vector-Intron containing LV genome cassettes.

Example 9: Optimisation of Vector-Intron LV production in suspension (serum-free) HEK293T cells in the absence of rev by Design-of-Experiment

Previous examples demonstrated that the use of optimised Vis enabled production of RRE- deleted LVs in the absence of rev to within 60-100% of standard, RRE/rev-dependent LVs. These studies used the same plasmid ratios for both standard and VI LV production, except that pRev was not included with VI LV transfections (pBluescript was used to ensure total DNA transfected was the same in comparisons). Interestingly and surprisingly, when concentrated preparations of VI LV and standard vectors (both encoding a CMV-GFP transgene cassette) were assessed for VSVG and capsid (p24) levels by immunoblotting, the VI LV vector sample appeared to contain substantially higher VSVG and capsid protein compared to the standard LV sample (Figure 17A), despite both vector samples having the very similar integrating titres of 2.2 x 10⁷ and 1.7 x 10⁷ TU/mL respectively. This indicated that the plasmid ratios previously optimised for standard RRE/rev-dependent LVs may not be optimal for rev-independent, VI LVs. Given that for the standard RRE/rev-dependent LVs the pRev represents just 5% of the pDNA mix in the optimised ratio, this also suggested that rev has some direct/indirect impact on the expression levels of GagPol and VSVG, as well as rev-dependent LV genomic RNA. Without wishing to be bound by theory, it is conceivable that rev may have some low level suppressive effect on expression cassettes containing introns (as both pGagPol and pVSVG did in this work), and that in the absence of rev (i.e. during VI LV production) the GagPol/VSVG expression levels are greater compared to standard LVs, even though the same pGagPol/pVSVG input levels were used. The inventors therefore sought to optimise plasmid input ratio levels of VI LV genome plasmid, pGagPol and pVSVG, as well as assessing optimal harvest time post-sodium butyrate induction using a multifactorial approach (Design-of-Experiment, DoE). Figure 17B displays the results of this optimisation experiment performed in suspension (serum-free) HEK293T cells using lipofectamine, where the ‘centre point’ for the analysis was the standard plasmid ratios used in previous examples (950 ng/mL pVI-Genome, 100 ng/mL pGagPol and 70ng/mL pVSVG). It was surprisingly found that the optimal ratios for Vl-containing RRE/rev- independent LV genome production differed substantially compared to previously optimised ratios for standard RRE/rev-dependent LVs. The titres of VI LVs could be increased 2-to-3 fold, compared to the centre point, and therefore indicated that in previous examples, where VI LV titres appeared to be slightly lower (i.e. within 2-fold) than standard LVs, this was likely to be due to the use of non-optimal plasmid ratios rather than any deficiency of the VI LV genomes themselves.

Thus, by use of optimal plasmid ratios, Vector-Intron LV genomes can be made to equivalent output titres compared to standard LVs but have the advantage of: [1] 1kb increased capacity (RRE eliminated and gag reduced to ~30 nucleotides), [2] simplified production (no pRev plasmid required for optimisation/implementation) and [3] the benefits of the MSD-2KO mutation i.e. no aberrant splicing during production, and reduced read-in from upstream chromatin as demonstrated elsewhere.

Example 10: Use of production cell-derived miRs to target the transgene mRNA derived from a Vector-Intron LV harbouring an inverted transgene cassette.

Other examples within the present invention demonstrate that ribozymes can be used as ‘selfcleaving’ elements with the 3’UTR of inverted transgene cassettes on-boarded to Vector- Intron LVs, in order to recover LV output titres. The lower output titre of these types of vectors containing inverted transgenes is likely due to the production of dsRNA, and resultant dsRNA- sensing pathways, for example leading to triggering of PKR. Thus, negation of dsRNA by degradation of transgene mRNA by use of ‘self-cleaving’ 3’UTR elements block this potential signalling. Embedding such elements within the 3’UTR of the inverted transgene that is encompassed by the Vector-Intron on the top strand, ensures that packaged vRNA will not contain these self-cleaving elements. An alternative or additional type of element that can be used are target sequences for miRNAs expressed during LV production; these can either be endogenously expressed miRNAs by the host cell or by exogenously expressed miRNAs (e.g. by co-transfection of a U6-driven mi/shRNA cassette). This concept is described in Figure 18. The feasibility of this approach was carried out by producing Vector-Intron LVs (specifically, MSD-2KOm5/ARRE/Ap17INS + Vl_v5.5) harbouring an inverted EF1a-GFP cassette, with endogenous miRNA target sequences (as 1x or 3x copies) within the 3’UTR. Two sets of variants were generated in which the ribozymes T3H38 and HDV_AG were optionally present (when present, the miRNA target sequences were between the two ribozymes). A third variant was generated (+ribozymes), wherein a single copy of each type of miRNA target sequence was present. LVs were produced in suspension (serum-free) HEK293T cells and GFP Expression scores generated (%GFP x MFI), and vector supernatants titrated on adherent HEK293T cells. These data are presented in Figure 19, and show that indeed endogenous miRNA target sequences can be used to rescue inverted transgene LV output titres, albeit to a lower extent than the ribozymes. Whilst the maximal recovery in output titres was observed with the ribozymes alone (i.e. miRNA paired with ribozymes offered no further boost to titres), this demonstrated that other elements of quite different sequence, structure and functional class could be used within the Vl-encompassed portion of the inverted 3’IITR to boost titres.

Example 11 : A side-by-side comparison of a standard LV, a ‘2KO-LV’ and a ‘MaxPax’ LV (Vector-lntron-dependent) encoding a therapeutically relevant transgene: splicing profiles in production cells and virions, and output titres.

Example 11 demonstrates the following features of the present invention:;

[1] the use of the Vector-Intron to mitigate against the attenuating effect of the mutation of the major splice donor site in the packaging region,

[2] use of the Vector-Intron in combination with further deletions in the gag-Psi region increase the capacity of the LV vector, and

[3] the use of the MSD-mutation to enable both ablation of aberrant splicing from the packaging region, and allow clean splicing of the Vector-Intron, a side-by-side comparison was performed with a transgene cassette encoding a chimeric antigen receptor (CAR) used for CAR-T therapy. For the purposes of ease of description, LVs containing the new architecture described above, were referred to as ‘MaxPax’ LVs. Accordingly, a standard LV and a ‘2KO-LVs’ (harbouring the 2KOm5 mutation only) encoding an EF1a-CAR-wPRE transgene cassette were generated. In addition, a 2KO-LV and a MaxPax-LV were generated encoding an EFS-CAR-wPRE transgene; this is because MaxPax/Vector-lntron containing LV expression cassettes give rise to vRNA genomes that cannot retain introns encoded in the 5’ to 3’ direction, including the one present within the EF1a promoter (i.e. intron A). Therefore, MaxPax LVs are suited to gene therapy approaches wherein space may be at a premium, and c/s-elements such as introns may be considered superfluous. It should be noted, that in instances where the retention of an intron within the transgene cassette is desirable, the inverted transgene approach (described elsewhere in the invention) may be taken, wherein the ‘self-cleaving’ elements may be utilised within the 3’UTR encompassed by the Vector-Intron sequence. This will depend on the activity of the transgene promoter, for example if a tissue-specific promoter is used that is not (very) active in production cells, then the self-cleaving elements may not be necessary since no/minimal dsRNA will be produced. In any case, the inverted transgene cassette encoded by the vRNA will be able to retain its intron(s) since it will not be functional in the vRNA 5’ to 3’ sense direction.

These LVs were produced in suspension (serum-free) HEK293T cells and post-production cells and resultant LV virions analysed by RT-PCR to assess full length vRNA and truncated vRNA production. These data are displayed in Figure 21 [A], together with the output titres of the produced LVs in Figure 21 [B], The results demonstrate that the MaxPax LVs (much like the 2KO LVs) are packaged as a single major species of vRNA, unlike the standard LVs that generate/package truncated forms. MaxPax LVs however, do not require either rev or the modified U1 snRNA to generate high titres, and also can on-board ~1kb additional space compared to the other vectors, since they lack the RRE (see 2KO-LV-EFS-CAR with MaxPax- EFS-CAR vRNA size difference in Figure 21 [A]).

Materials and Methods

Cell culture conditions

HEK293Ts (HEK293Ts) suspension cells were grown in Freestyle™ 293 Expression Medium (Gibco) supplemented with 0.1 % of Cholesterol Lipid Concentrate (Gibco) and incubated at 37 °C in 5% CO2, in a shaking incubator (25 mm orbit set at 190 RPM).

HEK293T adherent cells were maintained in complete media (Dulbecco's Modified Eagle Medium (DM EM) (Sigma) supplemented with 10% heat-inactivated fetal bovine serum (Gibco), 2 mM L-glutamine (Sigma) and 1 % non-essential amino acids (NEAA) (Sigma)), at 37 °C in 5% CO2.

Suspension cell culture, transfection and lentiviral vector production

Where indicated, vector production was carried out in suspension-adapted (serum-free) HEK293T cells. Cells were seeded at 8 x 10⁵ cells per ml in serum-free media and were incubated at 37 °C in 5% CO2, shaking, throughout vector production. Approximately 24 hours after seeding the cells were transfected using the following mass ratios of plasmids per effective final volume of culture at transfection: 0.95 pg/mL Genome, 0.1 pg/mL Gag-Pol, 0.06 pg/mL Rev (where indicated), 0.07 pg/mL VSV-G. Transfection was mediated by mixing DNA with Lipofectamine 2000CD in Opti-MEM as per manufacturer’s protocol (Life Technologies). Sodium butyrate (Sigma) was added ~18 hrs later to 10 mM final concentration. Typically, vector supernatant was harvested 20-24 hours later, and then filtered (0.22 pm) and frozen at -80 °C.

Total RNA extraction from end-of-production cells and lentiviral vector virions

At the time of vector harvest, approximately 1e6 1.65s cells in 0.5ml Freestyle serum-free media were pelleted by centrifugation at 500g for 3 minutes. Supernatants were removed and filtered through a 0.22um Spin-X filter by centrifugation, and then stored at -80°C until vector titration and virion RNA extraction. The cell pellet was washed in 0.5ml PBS and cells were pelleted once again by centrifugation. RNA was extracted from fresh cell pellets or 125ul of crude vector filtrate using RNAeasy and QIAamp Viral RNA Mini Kits, respectively, according to the manufacturer’s instructions (Qiagen).

Reverse-transcription

500ng of total RNA from cells or 5ul of virion RNA eluate was used as input for reverse transcription. RNA samples were incubated with 1 ul EZDNase (Life Technologies) at 37°C for 2 minutes. 1.1 ul of 0.1M DTT were then added per sample, and reactions were left to incubate at 55°C for a further 5 minutes. DNAse-treated RNA was then subjected to reverse transcription using the Superscript IV first-strand synthesis system (Life Technologies), with OligodT primers being used to primer first-strand synthesis according to the manufacturer’s instructions. Upon completion of reverse-transcription, samples were incubated with 1ul RNAse H (Life Technologies) at 37°C for 20 minutes. Upon completion, samples were diluted 10-fold using nuclease-free water.

Polymerase chain reaction

PCR reactions were performed using CloneAmp polymerase (Takara). 1 ul of diluted cDNA was used as template. Primers were design to span the HIV packaging sequence through to the GFP open reading frame or through to the wPRE. As an endogenous control for cellular RNA primers targeting human actin cDNA were employed. All primers were used at a final concentration of 200nM, and cycling conditions were as follows:

HIV vector genome primers

98°C 3mins, 30 cycles of (98°C 10s; 53.9°C 15s; 72°C 60s), follows by a final incubation at 72°C for 5 minutes.

Human actin cDNA primers

98°C 3mins, 30 cycles of (98°C 10s; 68°C 15s; 72°C 30s), follows by a final incubation at 72°C for 5 minutes. Table 2 - Primers used in this study

Upon completion of reactions, PCR products were visualised by 1 % agarose gel electrophoresis.

Polyacrylamide gel electrophoresis and western blotting

45ul of crude vector was incubated with 15ul of 4X Laemmli buffer (BioRad) containing 25% P-Mercaptoethanol at 100°C for 5 minutes before being placed on ice. 20ul of sample was subjected to polyacrylamide gel electrophoresis using a 4-20% TGX Pre-cast gel (BioRad) and associated Criterion gel running system. Proteins were blotted onto nitrocellulose membrane using the Turbo Transblot system (BioRad). Membranes were blocked in blocking buffer (25mM Tris, 150mM NaCI, 0.1% v/v Tween 20, 5% w/v milk powder) prior to being probed with primary antibodies to VSVG (Thermo, PA1-30138) and HIV p24 (Abeam, ab9071) according to the manufacturer’s instructions. Detection was performed using Starbright Blue 520 and Starbright Blue 700 fluorescent antibodies (BioRad, 12005870 and 12004158). Visualisation was performed using a ChemiDoc MP imager (BioRad).

Lentiviral vector titration by integration assay

For lentiviral vector titration by integration assay, 0.25mL volumes of 1 :10 to 1 :50 diluted vector supernatants were used to transduce 4.5e⁴ HEK293T cells at 24-well scale in the presence of 8pg/mL polybrene. Cultures were passaged for 10 days (1 :5 splits every 2-3 days) before host DNA was extracted from ~1x10⁶ cell pellets using a QIAextractor (Qiagen) according to manufacturer’s instructions. Duplex quantitative PCR was carried out using a FAM primer/probe set to the HIV packaging signal (ip) and to RRP1 , and vector titres (TU/mL) calculated using the following factors: transduction volume, vector dilution, RRP1-normallised HIV-1 ip copies detected per reaction.

Claims

1. A nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) a) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette: i. the vector intron is not located between the promoter of the transgene expression cassette and the transgene; and/or ii. the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT; and/or iii. the 3’ UTR of the transgene expression cassette comprises the vector intron; and/or b) the vector intron comprises one or more transgene mRNA self-destabilization element(s), transgene mRNA self-decay element(s) or transgene mRNA nuclear retention signal(s); and/or c) the cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette is inactivated.

2. A nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the vector intron is not located between the promoter of the transgene expression cassette and the transgene.

3. A nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron; and iv) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

4. A nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site in the lentiviral vector genome expression cassette is inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; and iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron, and iv) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the 3’ UTR of the transgene expression cassette comprises the vector intron.

5. A nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein: i) the major splice donor site and cryptic splice donor site adjacent to the 3’ end of the major splice donor site in the lentiviral vector genome expression cassette are inactivated; ii) the lentiviral vector genome expression cassette does not comprise a rev-response element; iii) the lentiviral vector genome expression cassette comprises a transgene expression cassette and a vector intron.

6. The nucleotide sequence according to any one of claims 2-5, wherein said vector intron comprises one or more transgene mRNA self-destabilization element(s), transgene mRNA self-decay element(s). or transgene mRNA nuclear retention signal(s).

7. The nucleotide sequence according to any one of claims 3-6, wherein, when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the vector intron is not located between the promoter of the transgene expression cassette and the transgene.

8. The nucleotide sequence according to any one of claims 2, or 4-6, wherein, when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7 and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

9. The nucleotide sequence according to any one of claims 2, 3, 5 or 6, wherein, when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the 3’ UTR of the transgene expression cassette comprises the vector intron.

10. The nucleotide sequence according to any one of the preceding claims, wherein the vector intron is not located between the promoter of the transgene expression cassette and the transgene.

11. The nucleotide sequence according to any one of the preceding claims, wherein the nucleotide sequence comprises a sequence as set forth in any of SEQ ID NOs: 2, 3, 4, 6, 7, and/or 8, and/or the sequences CAGACA, and/or GTGGAGACT.

12. The nucleotide sequence according to any one of the preceding claims, wherein:

(a) when the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette, the 3’ UTR of the transgene expression cassette comprises the vector intron; or (b) when the transgene expression cassette is in the forward orientation with respect to the lentiviral vector genome expression cassette, the vector intron is located 5’ of the transgene or the transgene expression cassette.

13. The nucleotide sequence of any one of the preceding claims, wherein the transgene expression cassette is inverted with respect to the lentiviral vector genome expression cassette.

14. The nucleotide sequence of any one of the preceding claims, wherein the transgene expression cassette is in the forward orientation with respect to the lentiviral vector genome expression cassette.

15. The nucleotide sequence according to any one of the preceding claims, wherein the lentiviral vector genome expression cassette comprises at least one modified viral c/s-acting sequence, wherein at least one internal open reading frame (ORF) in the viral c/s-acting sequence is disrupted.

16. The nucleotide sequence according to any one of the preceding claims, wherein the at least one viral c/s-acting sequence is a Woodchuck hepatitis virus (WHV) post-transcriptional regulatory element (WPRE).

17. The nucleotide sequence according to any one of the preceding claims, wherein the lentiviral vector genome expression cassette comprises a modified nucleotide sequence encoding gag, and wherein at least one internal open reading frame (ORF) in the modified nucleotide sequence encoding gag is disrupted.

18. The nucleotide sequence according to any one of claims 15-17, wherein the at least one internal ORF in the modified nucleotide sequence is disrupted by mutating at least one ATG sequence within the nucleotide sequence.

19. The nucleotide sequence according to claim 18, wherein the first ATG sequence within the modified nucleotide sequence is mutated.

20. The nucleotide sequence according to any one of the preceding claims, wherein the lentiviral vector genome expression cassette lacks (i) a nucleotide sequence encoding Gagpl 7 or (ii) a fragment of a nucleotide sequence encoding Gag-p17.

21 . The nucleotide sequence according to claim 20, wherein the fragment of a nucleotide sequence encoding Gag-p17 comprises a nucleotide sequence encoding p17 instability element.

22. The nucleotide sequence according to any one of the preceding claims, wherein the nucleotide sequence comprising a lentiviral vector genome expression cassette does not express Gag-p17 or a fragment thereof.

23. The nucleotide sequence according to claim 22, wherein said fragment of Gag-p17 comprises the p17 instability element.

24. The nucleotide sequence of any one of the preceding claims, wherein said vector intron is a synthetic vector intron.

25. The nucleotide sequence of any one of the preceding claims, wherein said synthetic intron comprises the HIV-1 guanosine-adenosine rich (GAR) splicing element.

26. The nucleotide sequence of any one of the preceding claims, wherein said vector intron comprises a splice donor sequence, wherein said splice donor sequence comprises from 7 to 11 nucleotides which are complementary to a portion of the U1 snRNA sequence.

27. The nucleotide sequence of claim 26, wherein said vector intron is a synthetic vector intron comprising the HIV-1 guanosine-adenosine rich (GAR) splicing element upstream of the splice donor sequence.

28. The nucleotide sequence of any one of the preceding claims, wherein said vector intron is a synthetic intron comprising the branch site and splice acceptor of the human beta-globin intron-2.

29. The nucleotide sequence of any one of claims 1 , 6-8 or 10-28, wherein said transgene mRNA self-destabilization or self-decay element comprises at least one of the following:

(a) a self-cleaving ribozyme;

(b) an All-rich element; and/or

(c) an interfering RNA, preferably a miRNA or shRNA which targets the inverted transgene mRNA.

131

30. A nucleotide sequence comprising a lentiviral vector genome expression cassette, wherein the lentiviral vector genome expression cassette comprises:

(b) a vector intron comprising a nucleotide expression cassette encoding a miRNA; wherein the miRNA targets mRNA encoding the transgene, preferably wherein the guide strand of the miRNA is fully complementary to the mRNA encoding the transgene, optionally wherein the nucleotide sequence is for use in a lentiviral vector production cell.

31. The nucleotide sequence of claim 30, wherein the passenger strand of the miRNA comprises at least one mismatch with its target sequence in the vector genome RNA, preferably wherein the miRNA does not target the vector genome RNA.

32. A viral vector production system comprising a set of nucleotide sequences, wherein the nucleotide sequences encode gag-pol and env, and the nucleotide sequence according to any one of claims 1 to 31.

33. The viral vector production system according to claim 32, wherein the viral vector production system does not comprise a nucleotide sequence encoding rev.

34. A cell comprising the nucleotide sequence according to any one of claims 1 to 31 or the viral vector production system according to claim 32 or claim 33.

35. A cell for producing lentiviral vectors comprising:

(i) a) nucleotide sequences encoding gag-pol and env, and the nucleotide sequence according to any one of claims 1 to 31 ; or b) the viral vector production system according to claim 32 or claim 33; and

(ii) optionally, a nucleotide sequence encoding TRAP.

36. The cell according to claim 35, wherein the cell does not comprise a nucleotide sequence encoding rev.

132

37. A method for producing a lentiviral vector, comprising the steps of:

(i) introducing: a) i. nucleotide sequences gag-pol and env, and the nucleotide sequence according to any one of claims 1 to 31 ; or ii. the viral vector production system according to claim 32 or claim 33; and b) optionally, a nucleotide sequence encoding TRAP into a cell;

(ii) optionally, selecting for a cell which comprises the nucleotide sequences encoding gag-pol and env and the nucleotide sequence according to any one of claims 1 to 31 ; and

38. The method according to claim 37, wherein the cell does not comprise a nucleotide sequence encoding rev.

39. A lentiviral vector produced by the method according to claim 37 or claim 38.

40. A lentiviral vector according to claim 39 wherein the lentiviral vector comprises a splice junction sequence, preferably wherein the splice junction sequence has the sequence set forth inSEQ ID NO: 19

41 . Use of the nucleotide sequence according to any one of claims 1 to 31 , the viral vector production system according to claim 32 or claim 33, or the cell according to any one of claims 34 to 36 for producing a lentiviral vector.

133