WO1999014235A1 - Persephin and related growth factors - Google Patents

Persephin and related growth factors Download PDF

Info

Publication number
WO1999014235A1
WO1999014235A1 PCT/US1998/019163 US9819163W WO9914235A1 WO 1999014235 A1 WO1999014235 A1 WO 1999014235A1 US 9819163 W US9819163 W US 9819163W WO 9914235 A1 WO9914235 A1 WO 9914235A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
persephin
sequence
neurturin
xaa
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1998/019163
Other languages
English (en)
French (fr)
Inventor
Eugene M. Johnson
Jeffrey D. Milbrandt
Paul T. Kotzbauer
Patricia A. Lampe
Robert Klein
Fred Desauvage
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Washington
Washington University in St Louis WUSTL
Original Assignee
University of Washington
Washington University in St Louis WUSTL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Washington, Washington University in St Louis WUSTL filed Critical University of Washington
Priority to EP98948217A priority Critical patent/EP1009768B1/en
Priority to NZ502090A priority patent/NZ502090A/xx
Priority to CA002296045A priority patent/CA2296045A1/en
Priority to AU94838/98A priority patent/AU758011B2/en
Priority to IL13383498A priority patent/IL133834A0/xx
Priority to JP2000511783A priority patent/JP2001516764A/ja
Priority to DE69833211T priority patent/DE69833211T2/de
Publication of WO1999014235A1 publication Critical patent/WO1999014235A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5091Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475Assays involving growth factors
    • G01N2333/4756Neuregulins, i.e. p185erbB2 ligands, glial growth factor, heregulin, ARIA, neu differentiation factor
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S930/00Peptide or protein sequence
    • Y10S930/01Peptide or protein sequence
    • Y10S930/12Growth hormone, growth factor other than t-cell or b-cell growth factor, and growth hormone releasing factor; related peptides

Definitions

  • This invention relates generally to trophic or growth factors and, more particularly, to novel growth factors of the neurturin-GDNF family of growth factors.
  • 2 Description of the Related Art
  • the development and maintenance of tissues in complex organisms requires precise control over the processes of cell proliferation, differentiation, survival and function. A major mechanism whereby these processes are controlled is through the actions of polypeptides known as "growth factors" . These structurally diverse molecules act through specific cell surface receptors to produce these actions .
  • Neurotrophic factors promote the differentiation, growth and survival of neurons and reside in the nervous system or in innervated tissues.
  • Nerve growth factor was the first neurotrophic factor to be identified and characterized (Levi-Montalcini et al . , J. Exp. Zool . 116:321, 1951 which is incorporated by reference).
  • NGF exists as a non-covalently bound homodimer that promotes the survival and growth of sympathetic, neural crest-derived sensory, and basal forebrain cholinergic neurons. In sympathetic neurons this substance produces neurite outgrowth in vitro and increased axonal and dendritic growth in vivo .
  • NGF has effects on cognition and neuronal plasticity, and can promote the survival of neurons that have suffered damage due to a variety of mechanical, chemical, viral, and imrrtunological insults (Snider and Johnson, Ann Neurol 26:489-506, 1989; Hefti, J Neurobiol 25:1418-35, 1994 which are incorporated by reference). NGF also is known to extensively interact with the endocrine system and in immune and inflammatory processes.
  • NGF promotes the survival of mast cells.
  • growth factors fall into classes, i.e. families or superfamilies based upon the similarities in their amino acid sequences. These families include, for example, the fibroblast growth factor family, the neurotrophin family and the transforming growth factor-beta (TGF- ⁇ ) family. As an example of family member sequence similarities,
  • TGF- ⁇ family members have 7 canonical framework cysteine residues which identify members of this superfamily.
  • NGF is the prototype of such a family of growth factors .
  • Brain-derived neurotrophic factor (BDNF ) the second member of this family to be discovered, was shown to be related to NGF by virtue of the conservation of all six cysteines that form the three internal disulfides of the NGF monomer (Barde, Prog Growth Factor Res 2:237-248, 1990 and Liebrock et al . Nature 341:149-152, 1989 which are incorporated by reference).
  • BDNF Brain-derived neurotrophic factor
  • NT-3, NT- 4/5 additional members of this neurotrophin family were rapidly found by several groups (Klein, FRSEB J 8:738-44, 1994 which is incorporated by reference ) .
  • Neurotrophic factors structurally unrelated to NGF have been recently identified. These include factors originally isolated based upon a "neurotrophic action" such as ciliary neurotrophic factor (CNTF) (Lin et al . , Science 246:1023-5 , 1989 which is incorporated by reference) along with others originally isolated as a result of non-neuronal activities (e.g. fibroblast growth factors (Cheng and Mattson Neuron 1:1031-41,1991 which is incorporated by reference), IGF-I (Kanje et al, Brain Res 486:396-398, 1989 which is incorporated by reference) leukemia inhibitory factor (Kotzbauer et al, Neuron 12:763-773, 1994 which is incorporated by reference).
  • CNTF ciliary neurotrophic factor
  • Glial-derived neurotrophic factor is one such neurotrophic factor structurally unrelated to NGF. GDNF was, thus, a unique factor, which, up until now, was not known to be a member of any subfamily of factors.
  • GDNF glial cell conditioned media
  • GDNF Recombinant GDNF produced in bacteria specifically promotes the survival and morphological differentiation of dopaminergic neurons (Lin et al., Science 260:1130-2, 1993); Tomac et al . , Nature 373:335-9, 1995; Beck et al . , Nature 373:339-41, 1995 and Ebendal et al., J Neurosci Res 40:276-84, 1995 which are incorporated by reference) and motor neurons (Henderson et al . , Science 266:1062-4, 1994; Yan et al . , Nature 373:341-4, 1995; and Oppenheim et al., Nature 373:344-6 , 1995 which are incorporated by reference). Overall, GDNF was a more potent factor for promoting the survival of motor neurons than the other factors, and it was the only factor that prevented neuronal atrophy in response to these lesions, thereby positioning it as a promising therapeutic agent for motor neuron diseases.
  • neurotrophic factors regulate many aspects of neuronal function, including survival and development in fetal life, and structural integrity and plasticity in adulthood. Since both acute nervous system injuries as well as chronic neurodegenerative diseases are characterized by structural damage and, possibly, by disease-induced apoptosis, it is likely that neurotrophic factors play some role in these afflictions. Indeed, a considerable body of evidence suggests that neurotrophic factors may be valuable therapeutic agents for treatment of these neurodegenerative conditions, which are perhaps the most socially and economically destructive diseases now afflicting our society.
  • the present invention is directed to the identification and isolation of substantially purified factors that promote the survival and growth of neurons as well as non-neuronal cells. Accordingly, the inventors herein have succeeded in discovering novel protein growth factors belonging to a family of growth factors for which GDNF was the first known member. The first such newly discovered family member was neurturin and this is the subject of copending application serial Number 08/519,777. Based upon the sequence of GDNF and neurturin the inventors herein have discovered another member of the GDNF-Neurturin family of growth factors referenced herein as persephin (PSP).
  • PSP persephin
  • This growth factor is believed to show at least 75% sequence identity among homologous sequences from different mammalian species although sequence homology may be as low as 65% in non-mammalian species such as avian species. Indeed, the mouse, rat and human mature persephin sequences show from about 80% to about 94% sequence identity.
  • Mature persephin proteins identified herein comprise mouse sequences as set forth in SEQ ID NOS: 79 and 187 ( Figure 17B amino acids 66 through 154 and 61 through 156, respectively), rat sequences as set forth in SEQ ID NOS: 82 and 196 ( Figure 18B amino acids 6 through 94 and 1 through 96, respectively), and human sequences as set forth in SEQ ID NOS: 221 and 223 ( Figure 24; amino acids 61-156 and 66-154, respectively).
  • Persephin has been identified and obtained by a method based upon the conserved regions of the GDNF- Neurturin family discovered by the inventors herein.
  • the present invention thus provides both amino acid sequences and nucleotide sequences that encode mouse, rat and human persephin including amino acid sequences of SEQ ID NOS: 79, 82, 187, 196, 221 and 223 and nucleotide sequences of SEQ ID NOS: 183, 193 and 199 and 201 as well as the complements of such nucleotide sequences (SEQ ID NOS: 184, 194, 200 and 202).
  • the present invention includes pre-, pro- and prepro- regions as well as pre-pro persephin amino acid and nucleotide sequences.
  • Expression vectors and stably transformed cells comprising persephin polynucleotides are also within the scope of this invention.
  • the transformed cells can be used in a method for producing persephin.
  • the present invention provides a method for preventing or treating cellular degeneration comprising administering to a patient in need thereof a therapeutically effective amount of persephin.
  • a patient may also be treated by implanting transformed cells which express persephin or a DNA sequence which encodes persephin into a patient, or cells cultured and expanded by growth in persephin.
  • the present invention also provides compositions and methods for detecting persephin.
  • One method is based upon persephin antibodies and other methods are based upon detecting mRNA or cDNA or genomic DNA encoding persephin using recombinant DNA techniques.
  • the present invention includes pan-growth factors comprising a segment of a persephin sequence and a segment of at least one growth factor other than persephin. Also included are polynucleotides encoding the pan-growth factors, vectors containing such polynucleotides and host cells comprising the polynucleotides.
  • a new growth factor, persephin for use in preventing the atrophy, degeneration or death of certain cells, in particular neurons; the provision of human persephin; the provision of other members of the neurturin-persephin-GDNF family of growth factors by making available new methods capable of obtaining other family members; the provision of methods for obtaining persephin by recombinant techniques; the provision of methods for preventing or treating diseases producing cellular degeneration and, particularly neuronal degeneration; the provision of methods that can detect and monitor persephin levels in a patient; and the provision of methods that can detect alterations in the persephin gene.
  • Figure 1 illustrates the purification scheme for preparing neurturin from CHO cells
  • Figure 2 illustrates the characterization of fractions eluted from Mono S column in purifying neurturin showing (a) electrophoresis of each fraction on a SDS-polyacrylamide gel and visualization of the proteins by silver stain and (b) the neurotrophic activity present in each fraction in the superior cervical ganglion survival assay;
  • Figure 3 illustrates the ability of neurturin to maintain survival of superior cervical ganglionic cells in culture showing (a) positive control cells maintained with nerve growth factor ( NGF ) ( b ) negative control cells treated with anti-NGF antibodies showing diminished survival and (c) cells treated with anti-NGF and neurturin ( approximately 3 ng/ml ) showing survival of neurons;
  • NGF nerve growth factor
  • Figure 4 illustrates the concentration-response effect of neurturin in the superior cervical ganglion survival assay
  • Figure 5 illustrates the homology of the amino acid sequences for the mature growth factors, human neurturin (hNTN), mouse neurturin (mNTN), rat GDNF (rGDNF), mouse GDNF (mGDNF) and human GDNF ( hGDNF ) with identical amino acid residues enclosed in boxes;
  • Figure 6 illustrates the tissue distribution of neurturin mRNA and the mRNA for GDNF using RT/PCR analysis on RNA samples obtained from embryonic day 21 (E21) and adult rats;
  • Figure 7 illustrates the cDNA and encoded amino acid sequence of human pre-pro neurturin (SEQ ID NO: 11) showing the pre- region from nucleic acid 1 through 57 (SEQ ID NO: 17), the pro- region from nucleic acid 58 through 285 (SEQ ID NO: 20), human neurturin from nucleic acid 286 through 591 (SEQ ID NO: 9) and the splice site between nucleic acids 169 and 170 which defines the coding sequence portion of two exons from nucleic acids 1 through 169 (SEQ ID NO: 27) and 170 through 594 (SEQ ID NO: 28);
  • Figure 8 illustrates the cDNA and encoded amino acid sequence of mouse pre-pro neurturin (SEQ ID NO: 12) showing the pre- region from nucleic
  • Figure 10 illustrates the percent neuronal survival in E18 rat nodose ganglia neurons treated 24 hours post-plating for NTN, GDNF, BDNF, NGF and AMO;
  • Figure 11 illustrates the nucleotide and amino acid sequence of murine persephin (SEQ ID NOS: 79, 80 and 81; amino acid residues 52 through 140, 47 through 142, and 9 through 142, respectively);
  • Figure 12 illustrates the family member sequence identity in the region between the first and seventh canonical framework cysteine residues aligned beginning with the first canonical framework cysteine for murine GDNF (SEQ ID NO: 87), murine neurturin (NTN) (SEQ ID NO: 88) and murine persephin (PSP) (SEQ ID NO: 89);
  • Figure 13 illustrates the partial sequence of rat persephin cDNA (SEQ ID NO: 97) obtained by the technique of rapid amplification of cDNA ends;
  • Figure 14 illustrates the partial sequence beginning with the first canonical framework cysteine for rat persephin (SEQ ID NO: 83) and the corresponding polynucleotide sequence (SEQ ID NO: 86);
  • Figure 15 shows (A) the family member aligned partial amino acid sequences from the first through the seventh canonical framework cysteine residues illustrating family member sequence homology of the mature growth factors, human GDNF (SEQ ID NO: 240), rat GDNF (SEQ ID NO: 241), mouse GDNF (SEQ ID NO: 242), human neurturin (NTN (human); SEQ ID NO: 31), mouse neurturin (NTN (mouse); SEQ ID NO: 32), rat persephin (PSP (rat); SEQ ID NO: 79), and mouse persephin (PSP(mouse); SEQ ID NO: 82) in which boxes enclose the 28 conserved amino acid residues present in all and (B) the aligned sequences of mature mouse persephin (mPSP; SEQ ID NO: 187), mature rat persephin (mPSP; SEQ ID NO: 198) and mature human persephin (hPSP; SEQ ID NO: 221);
  • Figure 20 illustrates the murine chimeric molecules (A) PSP/NTN containing the persephin fragment (residues 1-63) and the neurturin fragment (residues 68- 100 ) and ( B ) NTN/PSP containing the neurturin fragment (residues 1-67) and the persephin fragment (residues 64- 96) with the arrow indicating the crossover point in each;
  • Figure 21 illustrates the survival promoting effect of persephin in murine embryonic day-14 mesencephalic cells cultured for three days (a) in the absence of persephin where almost all of the cells are dead and (b) in the presence of persephin (100 ng/ml) where substantial neuronal cell survival is evident;
  • Figure 22 illustrates the survival promoting effect of persephin (PSP) in murine embryonic day-14 mesencephalic cells compared to effects of neurturin (NTN) and GDNF, measured by the number of cells stained with tyrosine hydroxylase ( TOH ) ;
  • Figure 23 illustrates RT/PCT survey for persephin expression in adult mouse tissues showing persephin expression by Kidney cells; and
  • Figure 24 illustrates the cDNA sequence of human pre-pro persephin (SEQ ID NO: 203) with two silent mutations indicated at positions 30 and 360 and the encoded amino acid sequence (SEQ ID NO: 217) with the first amino acid of the pro- region indicated by the double asterisks ( ** ) at amino acid position 24 and the first amino acid of mature human persephin indicated by the single asterisk (*) at amino acid position 61.
  • the present invention is based upon the identification, isolation and sequencing of a DNA molecule that encodes a new growth factor, persephin.
  • Persephin promotes cell survival and, in particular, the survival of neuronal cells.
  • persephin Prior to this invention, persephin was unknown and had not been identified as a discrete biological substance nor had it been isolated in pure form.
  • the growth factor, neurturin (NTN) was identified and isolated as set forth in copending application Serial Number 08/519,777 filed August 28, 1995, which is incorporated in its entirety by reference. From the sequence of neurturin and the sequence of the closely related growth factor, glial-derived neurotrophic factor (GDNF), the inventors herein have devised and pursued strategies to find additional related factors.
  • Neurturin is approximately 40% identical to GDNF, but less than 20% identical to any other member of the TGF- ⁇ superfamily.
  • Primers corresponding to the amino acid sequence from conserved regions of neurturin and GDNF were used to amplify a 77 nt fragment from rat genomic DNA. The resulting products were subcloned into the Bluescript KS plasmid and sequenced. The sequence of one of the amplified products predicted amino acid sequence data internal to the PCR primers that was different from that of GDNF or neurturin but had more than 20% identity with GDNF and neurturin, whereas the sequences of other amplified products we obtained corresponded to GDNF or neurturin, as would be expected.
  • the 22 nucleotide sequence (SEQ ID NO: 90) was then aligned with the rat sequences of GDNF and neurturin and found to be unique. This novel sequence, thus, suggested that we had identified a new family member referenced herein as persephin.
  • primers containing the unique 22 nucleotide sequence of the amplified fragment were used in the rapid amplification of cDNA ends (RACE) technique (Frohman, M.A. Methods in Enzymology 218:340-356, 1993) using cDNA obtained from neonatal rat brain.
  • GDNF ACCRPVAFDDDLSFLDD ( aa 60-76) (SEQ ID NO: 98)
  • NTN PCCRPTAYEDEVSFKDV ( a 61-77) (SEQ ID NO: 99)
  • PSP PCCQPTSYAD-VTFLDD ( aa 57-72) (SEQ ID NO: 100) (Amino acid numbering uses the first Cys residue as amino acid 1 ) .
  • Human persephin was obtained in a manner similar to that of mouse persephin. Degenerate PCR primers were used to amplify human genomic DNA and one clone was determined to have a sequence homologous to mouse persephin. Primers based upon the identified sequence were then used to screen cDNA libraries. Positive clones were identified by hybridization with a DNA probe derived from the identified sequence and these clones were then sequenced .
  • nucleotide sequencing of the murine persephin Ncol fragment revealed the nucleotide sequence of the entire murine persephin gene as shown in Figure 17.
  • the entire rat persephin gene has been determined by sequencing a PCR amplified fragment of rat genomic DNA as shown in Figure 18.
  • an open reading frame extends from the sequence coding for an initiator methionine up to a stop codon at positions 244-246.
  • mammalian expression vectors for both murine and rat persephin were prepared.
  • a Pl clone containing the murine persephin gene was used as a template in a PCR assay. Primers were designed such that the resulting fragment would contain the persephin gene extending from the initiator Methionine to the stop codon.
  • the PCR reaction utilized a forward primer M3175 [5' -TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and reverse primer M3156 [5' -CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC] .
  • rat genomic DNA was used as a template in a PCR assay.
  • the PCR reaction utilized a forward primer M3175 [5'- TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and reverse primer M3156 [5' -CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC] .
  • the amplified products were cloned into BSKS and sequenced to verify that the correct clone had been obtained.
  • the rat and murine persephin fragments were excised using Sma I and Hind III and cloned into a Asp718 (blunted) and Hind III sites of the mammalian expression vector pCB6.
  • COS monkey cells were transfected with either the rat or murine persephin expression vectors or the non- recombinant vector (pCB6) itself. Forty eight hr later the cells were lysed, the samples were loaded onto a 15% SDS-polyacrylamide gel, and the proteins were separated by electrophoresis. The proteins were then transferred to nitrocellulose by electroblotting. This nitrocellulose membrane was incubated with anti-persephin antibodies (which we raised to mature persephin produced in bacteria from a pET plasmid) to detect the presence of persephin in the lysates.
  • anti-persephin antibodies which we raised to mature persephin produced in bacteria from a pET plasmid
  • the size of the persephin detected was 10-15 kD, consistent with the size predicted for the processed (i.e. mature form of persephin).
  • Conditioned media harvested from these cells also contained mature persephin.
  • RNA from cells transfected with either rat or murine persephin expression vector was isolated.
  • RT/PCR analysis was performed using primers corresponding to the initiator Met and the stop codon.
  • Both the large and small persephin fragments were cloned and sequenced. As expected, the larger fragment corresponded to the persephin gene.
  • the small fragment corresponded to a spliced version of persephin.
  • the N-terminus of persephin was predicted by reference to the N-terminal regions of neurturin or GDNF. Using neurturin sequence homology and cleavage signals, a characteristic RXXR cleavage motif is present beginning 9 residues upstream of the first canonical framework cysteine of persephin which would suggest that mature murine persephin would contain 5 amino acids (ALAGS) (SEQ ID NO: 103) upstream of this cysteine (as does neurturin). The corresponding 5 amino acids in rat persephin are ALPGL (SEQ ID NO: 112) and those in human persephin are ALSGP (SEQ ID NO: 224). Using these parameters, mature persephin would consist of 96 amino acids and have a predicted molecular mass of 10.4 kD.
  • mature growth factor reference is made to the secreted form of the growth factor in which any pre- or pro- regions have been cleaved and which may exist as a monomer or, by analogy to other members of the TGF- ⁇ superfamily, in the form of a homodimer linked by disulfide bonds.
  • references to persephin herein is intended to be construed to include growth factors of any origin which are substantially homologous to and which are biologically equivalent to the persephin characterized and described herein. Such substantially homologous growth factors may be native to any tissue or species and, similarly, biological activity can be characterized in any of a number of biological assay systems.
  • Reference to pre-pro persephin is intended to be construed to include pre-pro growth factors containing a pre- or leader or signal sequence region, a pro- sequence region and persephin as defined herein.
  • compositions of the present invention are capable of demonstrating some or all of the same growth promoting properties in a similar fashion, although not necessarily to the same degree as the recombinantly produced human, mouse or rat persephin as identified herein.
  • substantially homologous it is meant that the degree of sequence identity of persephin orthologs including human, mouse and rat persephin as well as persephin from any other species, is greater than that between paralogs such as persephin and neurturin or persephin and GDNF, and greater than that reported previously for members of the TGF- ⁇ superfamily (For discussion of homology of TGF- ⁇ superfamily members see Kingsley, Genes and Dev 8:133-46, 1994 which is incorporated by reference ) .
  • Sequence identity or percent identity is intended to mean the percentage of same residues between two sequences.
  • the reference sequence is human persephin when determining percent identity with mouse or rat persephin and with the non-persephin growth factors, human neurturin or human GDNF.
  • the reference sequence is mouse persephin when determining percent identity with mouse GDNF and mouse neurturin and rat persephin when determining percent identity with rat GDNF and rat neurturin. Referencing is to human neurturin when determining percent identity with non-human neurturin and to human GDNF.
  • the two sequences being compared are aligned using the Clustal method (Higgins et al, Cabios 8:189-191, 1992) of multiple sequence alignment in the Lasergene biocomputing software (DNASTAR, INC, Madison, WI ) .
  • multiple alignments are carried out in a progressive manner, in which larger and larger alignment groups are assembled using similarity scores calculated from a series of pairwise alignments.
  • Optimal sequence alignments are obtained by finding the maximum alignment score, which is the average of all scores between the separate residues in the alignment, determined from a residue weight table representing the probability of a given amino acid change occurring in two related proteins over a given evolutionary interval. Penalties for opening and lengthening gaps in the alignment contribute to the score.
  • the residue weight table used for the alignment program is PAM250 (Dayhoff et al . , in Atlas of Protein Sequence and Structure , Dayhoff, Ed., NBRF, Washington, Vol. 5, suppl . 3, p. 345, 1978). Percent conservation is calculated from the above alignment by adding the percentage of identical residues to the percentage of positions at which the two residues represent a conservative substitution (defined as having a log odds value of greater than or equal to 0.3 in the PAM250 residue weight table).
  • preferred conservative amino acid changes are: R-K; E-D, Y-F, L-M; V-I, Q-H.
  • Conservation is referenced to human persephin when determining percent conservation with persephin from other species or with non-persephin growth factors; referenced to human neurturin when determining percent conservation with non-human neurturin or with non-persephin, non-neurturin growth factors.
  • Table 1 shows the calculations of identity ( I ) and conservation (C) for comparisons of mature persephin, mature neurturin and mature GDNF from various species. Comparisons were made between mature human persephin (hPSP) and mature mouse and rat persephin (mPSP and rPSP, respectively) and between mature human persephin and mature human GDNF or neurturin (hGDNF and hNTN respectively). Neurturin comparisons were between mature human and mature mouse neurturin (hNTN and mNTN, respectively) and between each of these and mature human, rat and mouse GDNF (hGDNF, rGDNF and GDNF, respectively) as shown in the table. Table 1.
  • hNTN v. mNTN 90 93 hNTN v. rGDNF 44 53 hNTN v. mGDNF 43 52 hNTN v. hGDNF 43 53 mNTN V. rGDNF 42 52 mNTN V. mGDNF 41 51 mNTN V. hGDNF 41 52
  • the degree of homology between the human persephin and mouse or rat persephin is about 80% whereas the degree of homology between mouse and rat persephin is about 94%.
  • the neurturin comparisons as shown in Table 1 indicate mature mouse and human neurturin proteins have about 90% sequence identity.
  • all persephin and neurturin homologs of non-human mammalian species are believed to similarly have at least about 75% sequence identity with human persephin, human neurturin, or human GDNF.
  • the degree of homology with persephin is at least about 65% identity with human persephin, or neurturin human neurturin or human GDNF.
  • human persephin has about 40% sequence identity and about 43% sequence conservation with human GDNF; and about 49% sequence identity and about 50% sequence conservation with human neurturin.
  • human neurturin has about 40% sequence identity and about 50% sequence conservation with human GDNF.
  • the different family members also have a similar sequence identity of about 40% of that of neurturin, about 40% of that of persephin or about 40% of that of GDNF and within a range of about 30% to about 75% identity with neurturin, within a range of about 30% to about 75% identity with persephin or within a range of about 30% to about 75% sequence identity with GDNF.
  • GDNF-neurturin-persephin family would be expected to have lesser sequence identity with any other family member of the same species than is present in orthologs of that family member in other species just as human GDNF and human neurturin are more closely related to mouse GDNF and mouse neurturin, respectively, than to each other or to GDNF and any given family member would be expected to have greater sequence identity with another family member than to any other known member of the TGF- ⁇ superfamily (Kingsley, supra).
  • homologs of pre-pro persephin in non-human mammalian species can be identified by virtue of the persephin portion of the amino acid sequence having at least about 75% sequence identity with human persephin and homologs of pre-pro persephin in non-mammalian species can be identified by virtue of the persephin portion of the amino acid sequence having at least about 65% identity with human persephin.
  • Persephin as used herein can also include hybrid and modified forms of persephin, respectively, including fusion proteins and persephin fragments and hybrid and modified forms in which certain amino acids have been deleted or replaced and modifications such as where one or more amino acids have been changed to a modified amino acid or unusual amino acid and modifications such as glycosolations so long as the hybrid or modified form retains the biological activity of persephin.
  • retaining the biological activity it is meant that neuronal survival is promoted, although not necessarily at the same level of potency as that of the human, mouse or rat persephin identified herein.
  • any persephin which may be isolated by virtue of cross-reactivity with antibodies to the persephin or whose encoding nucleotide sequences including genomic DNA, mRNA or cDNA may be isolated through hybridization with the complementary sequence of genomic or subgenomic nucleotide sequences or cDNA of the persephin or fragments thereof. It will also be appreciated by one skilled in the art that degenerate DNA sequences can encode human persephin and these are also intended to be included within the present invention as are allelic variants of persephin.
  • Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains.
  • Conservatively substituted amino acids can be grouped according to the chemical properties of their side chains. For example, one grouping of amino acids includes those amino acids have neutral and hydrophobic side chains (A, V, L, I, P, W, F, and M ) ; another grouping is those amino acids having neutral and polar side chains (G, S, T, Y, C, N, and Q); another grouping is those amino acids having basic side chains (K, R, and H); another grouping is those amino acids having acidic side chains (D and E); another grouping is those amino acids having aliphatic side chains (G, A, V, L, and I); another grouping is those amino acids having aliphatic- hydroxyl side chains (S and T); another grouping is those amino acids having amine-containing side chains (N, Q, K, R, and H); another grouping is those amino acids having aromatic side chains (F, Y, and W); and another grouping is those amino acids having sulfur
  • Preferred conservative amino acid substitutions groups are: R-K; E-D, Y-F, L-M; V-I, and Q- H.
  • Q-R-H and A-V are believed to be preferred substitutions for persephin inasmuch as they occur among the human, mouse and rat paralogs of persephin (see Figure 15B).
  • pre-pro neurturin alternatively spliced protein products, resulting from an intron located in the coding sequence of the pro region, may exist.
  • the intron is believed to exist in the genomic sequence at a position corresponding to that between nucleic acids 169 and 170 of the cDNA which, in turn, corresponds to a position within amino acid 57 in both the mouse and human pre-pro neurturin sequences ( see Figures 7 and 8).
  • alternative splicing at this position might produce a sequence that differs from that identified herein for human and mouse pre-pro neurturin (SEQ ID NO: 11 and SEQ ID NO: 12, respectively) at the identified amino acid site by addition and/or deletion of one or more amino acids.
  • any and all alternatively spliced pre-pro neurturin proteins are intended to be included within the terms pre-pro neurturin and, similarly, any and all alternatively spliced pre-pro persephin proteins are also intended to be included within the terms pre-pro persephin as used herein.
  • the human, mouse and rat persephin proteins identified herein as well as homologs from other tissues and species may exist as dimers in their biologically active form in a manner consistent with what is known for other factors of the TGF- ⁇ superfamily.
  • the monomeric units of the dimers of persephin can be used to construct stable growth factor heterodimers or heteromultimers comprising at least one monomer unit derived from persephin. This can be done by dissociating a homodimer of persephin into its component monomeric units and reassociating in the presence of a monomeric unit of a second or subsequent homodimeric growth factor.
  • This second or subsequent homodimeric growth factor can be selected from a variety of growth factors including neurturin, GDNF, a member of the NGF family such as NGF, BDNF, NT-3 and NT-4/5, a member of the TGF- ⁇ superfamily, a vascular endothelial growth factor, a member of the CNTF/LIF family and the like.
  • growth factors including neurturin, GDNF, a member of the NGF family such as NGF, BDNF, NT-3 and NT-4/5, a member of the TGF- ⁇ superfamily, a vascular endothelial growth factor, a member of the CNTF/LIF family and the like.
  • NGF neurotrophic factor
  • BDNF and NT-4/5 bind to trkB receptors
  • NT-3 binds primarily to trkC receptors that possess a distinct distribution within the CNS (Tuszynski et al . , Ann Neurol 35 :S9-S12, 1994).
  • GDNF family also appear to act through specific receptors having distinct distributions as has been shown for other growth factor families. Recently, it was shown that GDNF acts through a multicomponent receptor complex in which a transmembrane signal transducing component, the Ret tyrosine kinase protein (Ret PTK), is activated upon the binding of GDNF with another protein, called GDNF Receptor ⁇ (GDNFR- ⁇ ) which has no transmembrane domain and is attached to the cell surface via a glycosyl- phosphatidylinositol (GPI) linkage ( Durbec et al . , Nature 381:789-793, 1996; Jing et al .
  • Ret PTK Ret tyrosine kinase protein
  • the resultant growth factor would be expected to be able to bind to at least two distinct receptor types preferentially having a different tissue distribution.
  • the resultant heterodimers or heteromultimers would be expected to show a different and, possibly, an enlarged spectrum of cells upon which it could act or to provide greater potency. It is also possible that the heterodimer or heteromultimer might provide synergistic effects not seen with homodimers or homomultimers.
  • Heterodimers can be formed by a number of methods. For example, homodimers can be mixed and subjected to conditions in which dissociation/unfolding occurs, such as in the presence of a dissociation/unfolding agent, followed by subjection to conditions which allow monomer reassociation and formation of heterodimers.
  • Dissociation/unfolding agents include any agent known to promote the dissociation of proteins.
  • Such agents include, but are not limited to, guanidine hydrochloride, urea, potassium thiocyanate, pH lowering agents such as buffered HCl solutions, and polar, water miscible organic solvents such as acetonitrile or alcohols such as propanol or isopropanol.
  • pH lowering agents such as buffered HCl solutions
  • polar, water miscible organic solvents such as acetonitrile or alcohols such as propanol or isopropanol.
  • reducing agents such as dithiothreitol and ⁇ -mercaptoethanol can be used for dissociation/unfolding and for reassociation/refolding .
  • Heterodimers can also be made by transfecting a cell with two or more factors such that the transformed cell produces heterodimers as has been done with the neurotrophins . (Heymach and Schooter, J Biol Chem 270 :12297-12304, 1995).
  • heterodimers Another method of forming heterodimers is by combining persephin homodimers and a homodimer from a second growth factor and incubating the mixture at 37 °C.
  • the heterodimers may then be separated from homodimers using methods available to those skilled in the art such as, for example, by elution from preparative, non-denaturing polyacrylamide gels.
  • heterodimers may be purified using high pressure cation exchange chromatography such as with a Mono S cation exchange column or by sequential immunoaffinity columns.
  • preproteins proteins are synthesized within a cell with a signal sequence at the N-terminus of the mature protein sequence and the protein carrying such a leader sequence is referred to as a preprotein.
  • the pre- portion of the protein is cleaved during cellular processing of the protein.
  • many proteins contain a distinct pro sequence that describes a region on a protein that is a stable precursor of the mature protein. Proteins synthesized with both pre- and pro- regions are referred to as preproproteins .
  • the inventors believe that the form of the persephin protein as synthesized within a cell is the pre-pro persephin.
  • Human pre-pro persephin is believed to contain an N-terminal 23 amino acid signal sequence (human pre- signal sequence, SEQ ID NO: 219, Figure 24, amino acids 1 through 23 encoded by SEQ ID NOS: 208 and 209, Figure 24, nucleic acids 1 through 69).
  • leader sequence is not necessarily required for the sequence to act as a signal sequence and, therefore, within the definition of pre- region of persephin is included fragments thereof, usually N-terminal fragments, that retain the property of being able to act as a signal sequence, that is to facilitate co-translational insertion into the membranes of one or more cellular organelles such as endoplasmic reticulum, mitochondria, golgi, plasma membrane and the like.
  • the persephin signal sequence is followed by a pro- domain which contains an RXXR proteolytic processing site immediately before the N-terminal amino acid sequence for the mature persephin.
  • pro-domain sequence SEQ ID NO: 220, Figure 24, amino acids 24 through 60 encoded by the nucleic acid sequence SEQ ID NO: 211, Figure 24 nucleic acids 70 through 180.
  • the persephin pre- and pro- regions together comprise a pre-pro sequence identified as the human pre- pro region sequence (SEQ ID NO: 219, Figure 24, amino acids 1 through 60 encoded by SEQ ID NOS: 213 and 215, nucleic acids 1 through 285).
  • the pre- region sequences and pro- region sequences as well as the pre-pro region sequences can be identified and obtained for non-human mammalian species and for non-mammalian species by virtue of the sequences being contained within the pre-pro persephin as defined herein.
  • the human persephin cDNA has a 471 bp open reading frame encoding a 156 amino acid long protein (predicted Mr 16.6kDA). Cleavage of the 23 amino acid long predicted signal peptide will lead to a 133 amino acid pro-persephin molecule (Mr 14.2 kDa ) , Proteolytic cleavage of the pro-persephin at a RXXR consensus sequence should yield a 96 amino acid mature protein with a molecular weight of 10.3 kDa. The mature, secreted persephin molecule is likely to form a disulfide linked homodimer by analogy to other members of the TGF- ⁇ family.
  • nucleotide sequences of persephin pre- and/or pro- regions or similar regions that are believed to be associated with persephin DNA can be used to construct chimeric genes with the coding sequences of other growth factors or proteins.
  • Such chimeric proteins can exhibit altered production or expression of the active protein species.
  • a preferred persephin according to the present invention is prepared by recombinant DNA technology although it is believed that persephin can be isolated in purified form from cell-conditioned medium as was done for neurturin.
  • a persephin composition is substantially free of other proteins which are not persephin.
  • a substantially purified persephin composition comprises at least about 50 percent persephin on a molar basis compared to total proteins or other macromolecular species present. More preferably, a substantially purified persephin composition will comprise at least about 80 to about 90 mole percent of the total protein or other macromolecular species present and still more preferably, at least about 95 mole percent or greater.
  • Recombinant persephin may be made by expressing the DNA sequences encoding persephin in a suitable transformed host cell. Using methods well known in the art, the DNA encoding persephin may be linked to an expression vector, transformed into a host cell and conditions established that are suitable for expression of persephin by the transformed cell.
  • Any suitable expression vector may be employed to produce recombinant human persephin such as, for example, the mammalian expression vector pCB6 (Brewer, Meth Cell Biol 43:233-245, 1994) or the E. coli pET expression vectors, specifically, pET-30a ( Studier et al . , Methods Enzymol 185:60-89, 1990 which is incorporated by reference) both of which were used herein.
  • Other suitable expression vectors for expression in mammalian and bacterial cells are known in the art as are expression vectors for use in yeast or insect cells. Baculovirus expression systems can also be employed.
  • Persephin may be expressed in the monomeric units or such monomeric form may be produced by preparation under reducing conditions .
  • refolding and renaturation can be accomplished using one of the agents noted above that is known to promote dissociation/association of proteins.
  • the monomeric form can be incubated with dithiothreitol followed by incubation with oxidized glutathione disodium salt followed by incubation with a buffer containing a refolding agent such as urea.
  • Persephin may exist as a dimer or other multimer and may be glycosylated or chemically modified in other ways. Mature human persephin contains no N-linked glycosylation sites (see Figure 15B and SEQ ID NO: 221). Potential 0- linked glycosylation sites occur in mature human persephin at positions 3, 10, 12, 14, 24, 36, 43, 67, 70 and 88 in SEQ ID NO: 221 ( Figure 15B). As noted above, the human nucleic acid sequence suggests that persephin is initially translated as a pre- pro polypeptide and that proteolytic processing of the signal sequence and the "pro" portion of this molecule results in the mature sequence, referenced herein as "mature persephin" exists in human and in non-human species in homologous form. Therefore, persephin includes any and all "mature persephin” sequences from human and non-human species and any and all pre-pro persephin polypeptides that may be translated from the persephin gene.
  • isoforms of persephin may exist.
  • different possible cleavage sites such as RXXR sites
  • RXXR sites may be present in the pre-pro neurturin sequence so that more than one possible isoform of pre-pro neurturin may exist.
  • the mature neurturin protein may have a variable number of amino acids preceding the first canonical cysteine.
  • Such alternate cleavage sites could be utilized differently among different organisms and among different tissues of the same organism.
  • N-terminal amino acids preceding the first of the seven conserved cysteines in the mature forms of members of the TGF- ⁇ family vary greatly in both length and sequence. Furthermore, insertion of a ten amino acid sequence two residues upstream of the first conserved cysteine does not affect the known biological activities of one family member, dorsalin (Basler et al . , Cell 73:687-702, 1993). By analogy, it is also possible that persephin proteins containing sequences of different lengths preceding the first canonical cysteine may exist or could be made and that these would retain their biological activity.
  • This sequence of human persephin is from cysteine 66 through cysteine 154 as shown in Figure 24 (SEQ ID NO: 223).
  • the comparable sequence for murine persephin as shown in Figure 12 is from cysteine 1 through cysteine 87 (SEQ ID NO: 79) and that for rat persephin as shown in Figure 14, from cysteine 1 through cysteine 87
  • persephin proteins of the present invention are amino acid sequences containing SEQ ID NO: 223, SEQ ID NO: 79 or SEQ ID NO: 82 and nucleic acid molecules containing sequences encoding these amino acid sequences.
  • the present invention also encompasses nucleic acid molecules comprising sequences that encode mouse, rat and human persephin ( Figures 11, 14 and 23). Also included within the scope of this invention are sequences that are substantially the same as the nucleic acid sequences encoding persephin. Such substantially the same sequences may, for example, be substituted with codons more readily expressed in a given host cell such as E. coli according to well known and standard procedures. Such modified nucleic acid sequences are included within the scope of this invention.
  • nucleic acid sequences can be modified by those skilled in the art and, thus, all nucleic acid sequences which encode for the amino acid sequences of pre-pro persephin or the pre- region or the pro- region of persephin can likewise be so modified.
  • the present invention also includes nucleic acid sequence having one or more substitutions, deletions or additions wherein the nucleic acid sequence will hybridize with a persephin nucleic acid sequences -- or complement thereof where appropriate.
  • Specific hybridization is defined herein as the formation of hybrids between a polynucleotide (e.g. a persephin polynucleotide which may include one or more substitutions, deletions, and/or additions) and a specific reference polynucleotide (e.g. polynucleotides encoding mature persephin and having the sequences of SEQ ID NO:183, 184, 194, 195, 199, 200, 201 or 202) wherein the polynucleotide preferentially hybridizes to the specific reference polynucleotide.
  • a polynucleotide e.g. a persephin polynucleotide which may include one or more substitutions, deletions, and/or additions
  • a specific reference polynucleotide e.g. polynucleotides encoding mature persephin and having the sequences of SEQ ID NO:183, 184, 194, 195, 199, 200
  • a polynucleotide encoding a mature persephin will specifically hybridize to a reference persephin polynucleotide (e.g. SEQ ID NO: 183, 184, 194, 195, 199, 200, 201 or 202) and not to a reference neurturin polynucleotide (e.g. SEQ ID NO: 9 or 10 or sequences complementary thereto).
  • a reference persephin polynucleotide e.g. SEQ ID NO: 183, 184, 194, 195, 199, 200, 201 or 202
  • a reference neurturin polynucleotide e.g. SEQ ID NO: 9 or 10 or sequences complementary thereto.
  • Specific hybridization is preferably done under high stringency conditions which is well understood by those skilled in the art to be determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, length of time and concentration of formamide (see for example,
  • the present invention also includes nucleic acid sequences which encode for polypeptides that have survival or growth promoting activity and that are recognized by antibodies that bind to persephin.
  • the present invention also encompasses vectors comprising an expression regulatory element operably linked to any of the nucleic acid sequences included within the scope of the invention.
  • This invention also includes host cells -- of any variety -- that have been transformed with such vectors.
  • Preparation can be by isolation from conditioned medium from a variety of cell types so long as the cell type produces persephin.
  • a second and preferred method involves utilization of recombinant methods by isolating a nucleic acid sequence encoding persephin, cloning the sequence along with appropriate regulatory sequences into suitable vectors and cell types, and expressing the sequence to produce persephin.
  • a mammalian gene family comprised of four neurotrophic factors has been identified including nerve growth factor (NGF), brain derived neurotrophic factor (BDGF), neurotrophin-3 (NT-3), and neurotrophin-4/5 ( NT- 4/5). These factors share approximately 60 percent nucleic acid sequence homology (Tuszynski and Gage, Ann Neurol 35 :S9-S12, 1994 which is incorporated by reference).
  • the persephin protein and the neurturin protein display no significant homology to the NGF family of neurotrophic factors. Either persephin or neurturin shares less than about 20% homology with the TGF- ⁇ superfamily of growth factors.
  • both persephin and neurturin show approximately 40% sequence identity with GDNF and approximately 50% sequence identity with each other.
  • the positions of the seven cysteine residues present in persephin, neurturin and GDNF are nearly exactly conserved.
  • the inventors herein believe that other unidentified genes may exist that encode proteins that have substantial amino acid sequence homology to persephin, neurturin and GDNF and which function as growth factors selective for the same or different tissues and the same or different biological activities and may act at the same or different receptors.
  • the method used for such identification is cross- hybridization using nucleic acid probes derived from one family member to form a stable hybrid duplex molecule with nucleic acid sequence from different members of the gene family or to amplify nucleic acid sequences from different family members, (see for example, Kaisho et al . FEBS Letters 266:187-191, 1990 which is incorporated by reference).
  • the sequence from the different family member may not be identical to the probe, but will, nevertheless be sufficiently related to the probe sequence to hybridize with the probe.
  • PCR using primers from one family member can be used to identify additional family members.
  • the above approaches have not heretofore been successful in identifying other gene family members because only one family member, GDNF was known.
  • Xaa 4 -Gly-Xaa 5 -Cys in which Xaa x is Thr, Glu or lys, Xaa 2 is Val, Leu or Ile, Xaa 3 is Leu or Ile, Xaa 4 is Ala or Ser, and Xaa 5 is Ala or Ser, (SEQ ID NO: 113); and Cys-Cys-Xaa ⁇ Pro-Xaa 2 -Xaa 3 -Xaa 4 -Xaa 5 -Asp-Xaa 6 -Xaa 7 -Xaa 8 -Phe-Leu-Asp-Xaa 9 in which Xaa, ⁇ is Arg or Gin, Xaa 2 is Thr or Val or Ile, Xaa 3 is Ala or Ser, Xaa 4 is Tyr or Phe, Xaa 5 is Glu, Asp or Ala, Xaa 6 is Glu, Asp or no amino acid, X
  • Nucleotide sequences containing a coding sequence for the above conserved sequences or fragments of the above conserved sequences can be used as probes .
  • Additional primers based upon GDNF and neurturin include nucleic acid sequences encoding amino acid sequences, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 40 and SEQ ID NO: 41; primers whose reverse complementary sequences encode SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO 39; and, in particular, nucleic acid sequences, SEQ ID NOS: 42-48.
  • Hybridization using the new probes from conserved regions of the nucleic acid sequences would be performed under reduced stringency conditions. Factors involved in determining stringency conditions are well known in the art (for example, see Sambrook et al . , Molecular Cloning, 2nd Ed . , 1989 which is incorporated by reference). Sources of nucleic acid for screening would include genomic DNA libraries from mammalian species or cDNA libraries constructed using RNA obtained from mammalian cells cloned into any suitable vector.
  • PCR primers would be utilized under PCR conditions of reduced annealing temperature which would allow amplification of sequences from gene family members other than GDNF, neurturin and persephin.
  • Sources of nucleic acid for screening would include genomic DNA libraries from mammalian species cloned into any suitable vector, cDNA transcribed from RNA obtained from mammalian cells, and genomic DNA from mammalian species.
  • DNA sequences identified on the basis of hybridization or PCR assays would be sequenced and compared to GDNF, neurturin and persephin. The DNA sequences encoding the entire sequence of the novel factor would then be obtained in the same manner as described herein. Genomic DNA or libraries of genomic clones can also be used as templates because the intron/exon structures of GDNF and neurturin are conserved and coding sequences of the mature proteins are not interrupted by introns.
  • primers designed from the conserved regions of neurturin and GDNF have been used to identify and obtain the sequence of the new family member described herein, persephin.
  • Degenerate primers designed from persephin, neurturin and GDNF can be further used to identify and obtain additional family members.
  • GDNF-neurturin-persephin family members will have a high degree of sequence identity with one or more of the three identified family- member consensus regions in the portion of the sequence between the first and seventh canonical framework cysteines (see Figure 12).
  • a new family member is anticipated to have at least a 62.5% identity with the consensus region octapeptide, Val-Xaa ⁇ Xaa j -Leu- Gly-Leu-Gly-Tyr where Xaa !
  • Xaa 2 is Ser, Thr or Ala and Xaa 2 is Glu or Asp (SEQ ID NO: 108) or at least a 62.5 percent sequence identity with the consensus region octapeptide, Phe-Arg-Tyr-Cys-Xaa 1 -Gly-Xaa 2 -Cys where Xaa- L and Xaa 2 are alanine or serine (SEQ ID NO: 109) or at least a 50 percent sequence identity with the consensus region octapeptide, Asp-Xaa 1 -Xaa 2 -Xaa 3 -Phe-Leu-Asp-Xaa 4 where Xaa- L is aspartic acid or glutamic acid or no amino acid, Xaa 2 is valine or leucine, Xaa 3 is serine or threonine; and Xaa 4 is valine or aspartic acid (SEQ ID NO: 110).
  • any new family member will have 28 amino acids in the aligned sequence between the first and seventh canonical framework cysteine residues as set forth in Figure 15 with residues numbered from the N-terminal end of the family member aligned sequence being (1) Cys, (3) Leu, (10) Val, (13) Leu, (14) Gly, (15) Leu, (16) Gly, (17) Tyr, (21) Glu, (25) Phe, (26) Arg, (27) Tyr, (28) Cys, (30) Gly, (32) Cys, (44) Leu, (47) Leu, (58) Cys, (59) Cys (61) Pro, (66) Asp, (69) Phe, (70) Leu, (71) Asp, (83) Ser, (84) Ala, (87) Cys, and (89) Cys, however, it is possible that there may be as many as three mismatches.
  • persephin would be expected to promote the survival and growth of neuronal as well as non-neuronal cells.
  • neurturin has been shown to promote the survival of superior cervical ganglion cells as well as nodose sensory ganglia neurons (see Examples 1-3).
  • GDNF has been shown to act on dopaminergic, sympathetic, motor and several sensory neurons ( Henderson et al .
  • persephin will show activity on a variety of different neuronal cells, both peripheral and central, as well as on non-neuronal cells.
  • peripheral neuronal cells the profile of cells for which persephin will show a survival promoting activity appears to be different from that of neurturin or GDNF.
  • persephin In contrast to the survival-promoting activity produced by neurturin and GDNF in sympathetic and sensory neurons, persephin showed no activity in these tissues at concentrations tested. Nevertheless, persephin showed survival-promoting activity in mesencephalic cells obtained from rat embryo brains. Furthermore, persephin activity on any particular target cell type can be determined by routine experimentation using standard reference models. Moreover, the inventors herein have identified brain and heart tissues as tissues expressing persephin, which further supports the conclusion that persephin can act to promote survival and growth in a variety of neuronal and non-neuronal cells.
  • NGF neurotrophic factor
  • mast cells express the trk receptor and respond to NGF such that NGF is a mast cell secretogogue and survival promoting factor (Horigome et al . , J Biol Chem 269:2695-2707 , 1994 which is incorporated by reference).
  • members of the TGF- ⁇ superfamily act on many cell types of different function and embryologic origin.
  • persephin is expressed in a number of other neuronal and non-neuronal tissues.
  • the related family member, neurturin is expressed in a number of non-neuronal tissues including blood, bone marrow, neonatal liver and mast cells. This suggests a role for neurturin in hematopoiesis, inflammation, allergy, and cardiomyopathy .
  • persephin may also have a similar profile of activity.
  • Neurotrophic factors of the NGF family are thought to act through factor-specific high affinity receptors (Tuszynski and Gage, 1994, supra). Only particular portions of the protein acting at a receptor site are required for binding to the receptor.
  • portions or discrete fragments can serve as an agonist where the substance activates a persephin receptor to elicit the promoting action on cell survival and growth and antagonists to persephin where they bind to, but do not activate, the receptor or promote survival and growth.
  • portions or fragments that are agonists and those that are antagonists are also within the scope of the present invention.
  • pan-growth factors can also be constructed by combining the active domains of persephin with the active domains of one or more other non- persephin growth factors.
  • These pan-growth factors would be expected to have the combined activities or other advantageous properties of persephin and the one or more other growth factors.
  • these pan-growth factors are believed to be potent and multispecific growth factors that are useful in the treatment of a wide spectrum of degenerative diseases and conditions including conditions that can be treated by any or all of the parent factors from which the active domains were obtained.
  • Such pan-growth factors might also provide synergistic effects beyond the activities of the parent factors ( Barres et al . , supra ) .
  • Pan-growth factors within the scope of the present invention can include chimeric or hybrid polypeptides that are constructed from portions of fragments of at least two growth factors.
  • Growth factors of the TGF- ⁇ superfamily are structurally related having highly conserved sequence landmarks whereby family members are identified.
  • seven canonical framework cysteine residues are nearly invariant in members of the superfamily (Kingsley, Genes & Dev 8:133-146, 1994 which is incorporated by reference )( see Figure 17).
  • Chimeric polypeptide molecules can, therefore, be constructed from a sequence that is substantially identical to a portion of the persephin molecule, up to one or more crossover points, and one or more sequences each of which is substantially identical with a portion of another TGF- ⁇ superfamily member extending on the other side of the corresponding one or more crossover points.
  • a portion of the amino terminal end of the persephin polypeptide can be combined with a portion of the carboxy terminal end of a neurturin polypeptide or alternatively a portion of the amino terminal end of a neurturin polypeptide can be combined with a portion of the carboxy terminal end of a persephin polypeptide.
  • Such portions of persephin or neurturin polypeptides are preferably from about 5 to about 95, more preferably from about 10 to about 90, still more preferably from about 20 to about 80 and most preferably from about 30 to about 70 contiguous amino acids and such portions of another, non- persephin or, as the case may be, non-neurturin TGF- ⁇ superfamily member are preferably from about 5 to about 95, more preferably from about 10 to about 90, still more preferably from about 20 to about 80 and most preferably from about 30 to about 70 contiguous amino acids.
  • a particular crossover point might be between the third and fourth canonical framework cysteine residues.
  • One such exemplary construct would contain at the 5 ' end a sequence comprised of a persephin sequence from residue 1 through the third canonical framework cysteine residue 37 and up to a cross-over point somewhere between residue 37 and residue 63 but not including the fourth canonical framework cysteine residue 64 (for reference, see mature persephin, SEQ ID NO: 80).
  • the 3 ' end of the hybrid construct would constitute a sequence derived from another TGF- ⁇ superfamily member such as, for example, neurturin which is another TGF- ⁇ superfamily member that is closely related to persephin.
  • the hybrid construct beyond the crossover point would be comprised of a sequence beginning at the desired crossover point in the neurturin sequence between the third canonical framework cysteine residue 37 and the fourth canonical framework cysteine residue 67 of neurturin and continuing through residue 100 at the 3 ' end of neurturin (for alignment, see figure 12).
  • a second exemplary hybrid construct would be comprised of residue 1 through a crossover point between residues 37 and 67 of neurturin contiguously linked with residues from the crossover point between residues 37 and 64 through residue 96 of persephin.
  • TGF- ⁇ family member selected from family members including but not limited to transforming growth factor- ⁇ l ( TGF ⁇ l ) , transforming growth factor- ⁇ 2 ( TGFB2 ) , transforming growth factor- ⁇ 3 (TGFB3), inhibin ⁇ A (INH ⁇ A), inhibin ⁇ B (INH ⁇ B), the nodal gene ( NODAL ) , bone morphogenetic proteins 2 and 4 (BMP2 and BMP4 ) , the Drosophila decapentaplegic gene (dpp), bone morphogenetic proteins 5-8 (BMP5, BMP6, BMP7 and BMP8 ) , the Drosophila 60A gene family (60A), bone morphogenetic protein 3 ( BMP3 ) , the Vgl gene, growth differentiation factors 1 and 3 (GDF1 and GDF3 ) , dorsalin (drsln), inhibin ⁇ (INH
  • TGF ⁇ l transforming growth factor- ⁇ l
  • TGFB2 transforming growth factor
  • crossover point can be any residue between the first and seventh canonical framework cysteines molecules of neurturin and the particular other family member.
  • additional crossover points can be used to incorporate any desired number of persephin portions or fragments with portions or fragments of any one or more other family members.
  • the portions of persephin and portions of the other, non- persephin growth factor are amplified using PCR, mixed and used as template for a PCR reaction using the forward primer from one and the reverse primer from the other of the two component portions of the chimeric molecule.
  • a forward and reverse primers are selected to amplify the portion of persephin from the beginning to the selected crossover point between the third and fourth canonical cysteine residues using a persephin plasmid as template.
  • a forward primer with a 5 ' portion overlapping with the persephin sequence and a reverse primer are then used to amplify the portion of the other, non-persephin growth factor member of the TGF- ⁇ superfamily from the corresponding crossover point through the 3 ' end using a plasmid template containing the coding sequence for the non-persephin TGF- ⁇ family member.
  • the products of the two PCR reactions are gel purified and mixed together and a PCR reaction performed. Using an aliquot of this reaction as template a PCR reaction is performed using the persephin forward primer and the reverse primer for the non-persephin growth factor. The product is then cloned into an expression vector for production of the chimeric molecule.
  • Chimeric growth factors would be expected to be effective in promoting the growth and development of cells and for use in preventing the atrophy, degeneration or death of cells, particular in neurons.
  • the chimeric polypeptides may also act as receptor antagonists of one or both of the full length growth factors from which the chimeric polypeptide was constructed or as an antagonist of any other growth factor that acts at the same receptor or receptors .
  • the present invention also includes therapeutic or pharmaceutical compositions comprising persephin in an effective amount for treating patients with cellular degeneration or dysfunction and a method comprising administering a therapeutically effective amount of persephin. These compositions and methods are useful for treating a number of degenerative diseases.
  • the diseases include, but are not limited to peripheral neuropathy, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, ischemic stroke, acute brain injury, acute spinal chord injury, nervous system tumors, multiple sclerosis, peripheral nerve trauma or injury, exposure to neurotoxins, metabolic diseases such as diabetes or renal dysfunctions and damage caused by infectious agents.
  • peripheral neuropathy amyotrophic lateral sclerosis
  • Alzheimer's disease Parkinson's disease
  • Huntington's disease Huntington's disease
  • ischemic stroke acute brain injury
  • acute spinal chord injury nervous system tumors
  • multiple sclerosis peripheral nerve trauma or injury
  • exposure to neurotoxins such as diabetes or renal dysfunctions and damage caused by infectious agents.
  • persephin to promote survival in mesencephalic cells suggests an applicability of this growth factor in treating neuronal degenerative diseases of the CNS such as Parkinson's disease.
  • the diseases include, but are not limited to disorders of insufficient blood cells such as, for example, leukopenias including eosinopenia and/or basopenia, lymphopenia, monocytopenia, neutropenia, anemias, thrombocytopenia as well as an insufficiency of stem cells for any of the above.
  • the cellular degeneration can also involve myocardial muscle cells in diseases such as cardiomyopathy and congestive heart failure.
  • the above cells and tissues can also be treated for depressed function.
  • the compositions and methods herein can also be useful to prevent degeneration and/or promote survival in other non-neuronal tissues as well.
  • One skilled in the art can readily determine using a variety of assays known in the art for identifying whether persephin would be useful in promoting survival or functioning in a particular cell type.
  • persephin anti-sense oligonucleotides can be made and a method utilized for diminishing the level of expression of persephin, respectively, by a cell comprising administering one or more persephin anti-sense oligonucleotides.
  • persephin anti-sense oligonucleotides reference is made to oligonucleotides that have a nucleotide sequence that interacts through base pairing with a specific complementary nucleic acid sequence involved in the expression of persephin such that the expression of persephin is reduced.
  • the specific nucleic acid sequence involved in the expression of persephin is a genomic DNA molecule or mRNA molecule that contains sequences of the persephin gene.
  • This genomic DNA molecule can comprise flanking regions of the persephin gene, untranslated regions of persephin mRNA, the pre- or pro- portions of the persephin gene or the coding sequence for mature persephin protein.
  • the term complementary to a nucleotide sequence in the context of persephin antisense oligonucleotides and methods therefor means sufficiently complementary to such a sequence as to allow hybridization to that sequence in a cell, i.e., under physiological conditions.
  • the persephin antisense oligonucleotides preferably comprise a sequence containing from about 8 to about 100 nucleotides and more preferably the persephin antisense oligonucleotides comprise from about 15 to about 30 nucleotides.
  • the persephin antisense oligonucleotides can also contain a variety of modifications that confer resistance to nucleolytic degradation such as, for example, modified internucleoside linkages (Uhlmann and Peyman, Chemical Reviews 90:543-548, 1990; Schneider and Banner, Tetrahedron Lett 31:335, 1990 which are incorporated by reference), modified nucleic acid bases and/or sugars and the like.
  • compositions of the present invention can be administered by any suitable route known in the art including for example intravenous, subcutaneous, intramuscular, transdermal, intrathecal or intracerebral .
  • Administration can be either rapid as by injection or over a period of time as by slow infusion or administration of slow release formulation.
  • administration can be by injection or infusion into the cerebrospinal fluid (CSF).
  • CSF cerebrospinal fluid
  • administration can be with one or more agents capable of promoting penetration of persephin across the blood-brain barrier.
  • Persephin can also be linked or conjugated with agents that provide desirable pharmaceutical or pharmacodynamic properties.
  • persephin can be coupled to any substance known in the art to promote penetration or transport across the blood-brain barrier such as an antibody to the transferrin receptor, and administered by intravenous injection.
  • persephin can be stably linked to a polymer such as polyethylene glycol to obtain desirable properties of solubility, stability, half-life and other pharmaceutically advantageous properties.
  • a polymer such as polyethylene glycol
  • compositions are usually employed in the form of pharmaceutical preparations .
  • Such preparations are made in a manner well known in the pharmaceutical art.
  • One preferred preparation utilizes a vehicle of physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers such as physiological concentrations of other non-toxic salts, five percent aqueous glucose solution, sterile water or the like may also be used. It may also be desirable that a suitable buffer be present in the composition.
  • Such solutions can, if desired, be lyophilized and stored in a sterile ampoule ready for reconstitution by the addition of sterile water for ready injection.
  • the primary solvent can be aqueous or alternatively non-aqueous.
  • Persephin can also be incorporated into a solid or semi- solid biologically compatible matrix which can be implanted into tissues requiring treatment.
  • the carrier can also contain other pharmaceutically- acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the carrier may contain still other pharmaceutically-acceptable excipients for modifying or maintaining release or absorption or penetration across the blood-brain barrier.
  • excipients are those substances usually and customarily employed to formulate dosages for parenteral administration in either unit dosage or multi-dose form or for direct infusion into the cerebrospinal fluid by continuous or periodic infusion. Dose administration can be repeated depending upon the pharmacokinetic parameters of the dosage formulation and the route of administration used.
  • formulations containing persephin are to be administered orally.
  • Such formulations are preferably encapsulated and formulated with suitable carriers in solid dosage forms.
  • suitable carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, gelatin, syrup, methyl cellulose, methyl- and propylhydroxybenzoates, talc, magnesium, stearate, water, mineral oil, and the like.
  • the formulations can additionally include lubricating agents, wetting agents, emulsifying and suspending agents, preserving agents, sweetening agents or flavoring agents.
  • the compositions may be formulated so as to provide rapid, sustained, or delayed release of the active ingredients after administration to the patient by employing procedures well known in the art.
  • the formulations can also contain substances that diminish proteolytic degradation and promote absorption such as, for example, surface active agents.
  • the specific dose is calculated according to the approximate body weight or body surface area of the patient or the volume of body space to be occupied. The dose will also be calculated dependent upon the particular route of administration selected. Further refinement of the calculations necessary to determine the appropriate dosage for treatment is routinely made by those of ordinary skill in the art. Such calculations can be made without undue experimentation by one skilled in the art in light of the activity of persephin.
  • the activity of neurturin in target cells data is disclosed herein and in copending application Serial Number 08/519,777 and the concentration of persephin required for activity at the cellular level is believed to be similar to that of neurturin.
  • the activity of persephin on mesencephalic cells is reported in Example 17 below.
  • Persephin activity on a particular target cell type can be determined by routine experimentation. Exact dosages are determined in conjunction with standard dose-response studies. It will be understood that the amount of the composition actually administered will be determined by a practitioner, in the light of the relevant circumstances including the condition or conditions to be treated, the choice of composition to be administered, the age, weight, and response of the individual patient, the severity of the patient's symptoms, and the chosen route of administration.
  • persephin may be therapeutically administered by implanting into patients vectors or cells capable of producing a biologically-active form of persephin or a precursor of persephin, i.e. a molecule that can be readily converted to a biological-active form of persephin by the body.
  • cells that secrete persephin may be encapsulated into semipermeable membranes for implantation into a patient.
  • the cells can be cells that normally express persephin or a precursor of persephin or the cells can be transformed to express persephin or a precursor thereof. It is preferred that the cell be of human origin and that the persephin be human persephin when the patient is human.
  • the formulations and methods herein can be used for veterinary as well as human applications and the term "patient” as used herein is intended to include human and veterinary patients.
  • Cells can be grown ex vivo for use in transplantation or engraftment into patients ( Muench et al .
  • persephin can be used to promote the ex vivo expansion of a cells for transplantation or engraftment.
  • Current methods have used bioreactor culture systems containing factors such as erythropoietin, colony stimulating factors, stem cell factor, and interleukins to expand hematopoietic progenitor cells for erythrocytes, monocytes, neutrophils, and lymphocytes (Verfaillie, Stem Cells 12:466-476, 1994 which is incorporated by reference).
  • These stem cells can be isolated from the marrow of human donors, from human peripheral blood, or from umbilical cord blood cells.
  • the expanded blood cells are used to treat patients who lack these cells as a result of specific disease conditions or as a result of high dose chemotherapy for treatment of malignancy (George, Stem Cells 12 ( Suppl 1J:249-255, 1994 which is incorporated by reference).
  • autologous transplants can be performed by removing bone marrow cells before chemotherapy, expanding the cells ex vivo using methods that also function to purge malignant cells, and transplanting the expanded cells back into the patient following chemotherapy (for review see Rummel and Van Zant, J Hematotherapy 3:213-218, 1994 which is incorporated by reference).
  • persephin and the related growth factor, neurturin may be expressed in the developing animal in particular tissues where proliferation and differentiation of progenitor cells occur, it is believed that persephin can function to regulate the proliferation of hematopoietic stem cells and the differentiation of mature hematopoietic cells.
  • persephin can function to regulate the proliferation of hematopoietic stem cells and the differentiation of mature hematopoietic cells.
  • persephin to culture systems used for ex vivo expansion of cells could stimulate the rate at which certain populations of cells multiply or differentiate, and improve the effectiveness of these expansion systems in generating cells needed for transplant. It is also believed that persephin can be used for the ex vivo expansion of precursor cells in the nervous system.
  • Neuronal precursor cells can be obtained from animal or human donors or from human fetal tissue and then expanded in culture using persephin. These cells can then be engrafted into patients where they would function to replace some of the cells lost due to degeneration.
  • persephin could also function in similar ways during the development of the nervous system and could be useful in the ex vivo expansion of neuronal cells. In a number of circumstances it would be desirable to determine the levels of persephin in a patient. The identification of persephin along with the present report that persephin is expressed by certain tissues provides the basis for the conclusion that the presence of persephin serves a normal physiologic function related to cell growth and survival.
  • neurotrophic factors are known to play a role in the function of neuronal and non-neuronal tissues.
  • Endogenously produced persephin may also play a role in certain disease conditions, particularly where there is cellular degeneration such as in neurodegenerative conditions or diseases.
  • Other neurotrophic factors are known to change during disease conditions. For example, in multiple sclerosis, levels of NGF protein in the cerebrospinal fluid are increased during acute phases of the disease (Bracci-Laudiero et al .
  • the present invention also provides methods for detecting the presence of persephin in a sample from a patient.
  • detection as used herein in the context of detecting the presence of persephin in a patient is intended to include the determining of the amount of persephin or the ability to express an amount of persephin in a patient, the distinguishing of persephin from other growth factors, the estimation of prognosis in terms of probable outcome of a degenerative disease and prospect for recovery, the monitoring of the persephin levels over a period of time as a measure of status of the condition, and the monitoring of persephin levels for determining a preferred therapeutic regimen for the patient .
  • a sample is obtained from the patient.
  • the sample can be a tissue biopsy sample or a sample of blood, plasma, serum, CSF or the like.
  • Persephin is expressed in kidney and brain tissues as shown in example 18 and it is believed that persephin is expressed in other tissues not tested as well.
  • Samples for detecting persephin can be taken from any tissue expressing persephin.
  • the sample be a sample of blood, plasma or serum or alternatively from a tissue biopsy sample.
  • a preferred sample is a sample obtained from cerebrospinal fluid.
  • the persephin gene is intact in the patient or in a tissue or cell line within the patient.
  • an intact persephin gene it is meant that there are no alterations in the gene such as point mutations, deletions, insertions, chromosomal breakage, chromosomal rearrangements and the like wherein such alteration might alter production of persephin or alter its biological activity, stability or the like to lead to disease processes or susceptibility to cellular degenerative conditions.
  • a non-intact persephin gene it is meant that such alterations are present.
  • a method is provided for detecting and characterizing any alterations in the persephin gene.
  • the method comprises providing an oligonucleotide that contains the persephin cDNA, genomic DNA or a fragment thereof or a derivative thereof .
  • a derivative of an oligonucleotide it is meant that the derived oligonucleotide is substantially the same as the sequence from which it is derived in that the derived sequence has sufficient sequence complementarily to the sequence from which it is derived to hybridize to the persephin gene.
  • the derived nucleotide sequence is not necessarily physically derived from the nucleotide sequence, but may be generated in any manner including for example, chemical synthesis or DNA replication or reverse transcription or transcription.
  • patient genomic DNA is isolated from a cell sample from the patient and digested with one or more restriction endonucleases such as, for example, TaqI and Alul .
  • restriction endonucleases such as, for example, TaqI and Alul .
  • Hybridization to the persephin gene would involve denaturing the chromosomal DNA to obtain a single- stranded DNA; contacting the single-stranded DNA with a gene probe associated with the persephin gene sequence; and identifying the hybridized DNA-probe to detect chromosomal DNA containing at least a portion of the human persephin gene.
  • probe refers to a structure comprised of a polynucleotide which forms a hybrid structure with a target sequence, due to complementarity of probe sequence with a sequence in the target region.
  • the probes need not reflect the exact sequence of the target sequence, but must be sufficiently complementary to selectively hybridize with the strand being amplified.
  • selective hybridization or specific hybridization it is meant that a polynucleotide preferentially hybridizes to a target polynucleotide.
  • Oligomers suitable for use as probes may contain a minimum of about 8-12 contiguous nucleotides which are complementary to the targeted sequence and preferably a minimum of about 15 nucleotides although polynucleotide probes up to about 20 nucleotides and up to about 100 nucleotides or even greater are within the scope of this invention.
  • the persephin gene probes of the present invention can be DNA or RNA oligonucleotides and can be made by any method known in the art such as, for example, excision, transcription or chemical synthesis. Probes may be labelled with any detectable label known in the art such as, for example, radioactive or fluorescent labels or enzymatic marker. Labeling of the probe can be accomplished by any method known in the art such as by PCR, random priming, end labelling, nick translation or the like. One skilled in the art will also recognize that other methods not employing a labelled probe can be used to determine the hybridization. Examples of methods that can be used for detecting hybridization include Southern blotting, fluorescence in situ hybridization, and single-strand conformation polymorphism with PCR amplification.
  • Hybridization is typically carried out at 25-45 °C, more preferably at 32-40°C and more preferably at 37- 38 °C.
  • the time required for hybridization is from about 0.25 to about 96 hours, more preferably from about one to about 72 hours, and most preferably from about 4 to about 24 hours.
  • Persephin gene abnormalities can also be detected by using the PCR method and primers that flank or lie within the persephin gene.
  • the PCR method is well known in the art. Briefly, this method is performed using two oligonucleotide primers which are capable of hybridizing to the nucleic acid sequences flanking a target sequence that lies within a persephin gene and amplifying the target sequence.
  • oligonucleotide primer refers to a short strand of DNA or RNA typically ranging in length from about 8 to about 30 bases.
  • the upstream and downstream primers are preferably a minimum of from about 15 nucleotides to about 20 nucleotides and up to about 30 nucleotides or even greater in length.
  • the primers can hybridize to the flanking regions for replication of the nucleotide sequence.
  • the polymerization is catalyzed by a DNA- polymerase in the presence of deoxynucleotide triphosphates or nucleotide analogs to produce double- stranded DNA molecules.
  • the double strands are then separated by any denaturing method including physical, chemical or enzymatic. Commonly, the method of physical denaturation is used involving heating the nucleic acid, typically to temperatures from about 80 °C to 105 °C for times ranging from about 1 to about 10 minutes. The process is repeated for the desired number of cycles.
  • the primers are selected to be substantially complementary to the strand of DNA being amplified.
  • the primers need not reflect the exact sequence of the template, but must be sufficiently complementary to selectively hybridize or specifically hybridize with the strand being amplified.
  • selective hybridization or specific hybridization it is meant that a polynucleotide preferentially hybridizes to a target polynucleotide.
  • the DNA sequence comprising persephin or pre-pro persephin or a fragment thereof is then directly sequenced and analyzed by comparison of the sequence with the sequences disclosed herein to identify alterations which might change activity or expression levels or the like.
  • a method for detecting persephin is provided based upon an analysis of tissue expressing the persephin gene. Certain tissues such as those identified below in example 18 have been found to express the persephin gene. The method comprises hybridizing a polynucleotide probe to mRNA from a sample of tissues that normally express the persephin gene or from a cDNA produced from the mRNA of the sample.
  • the sample is obtained from a patient suspected of having an abnormality in the persephin gene or from a particular patient tissue or cell type suspected of having an abnormality in the persephin gene.
  • the reference persephin polynucleotide probe can comprise SEQ ID NO:179, SEQ ID N0:180, SEQ ID N0:190, SEQ ID N0:191, SEQ ID NOS: 203-206 or derivatives thereof or fragments thereof so long as such derivatives or fragments specifically hybridize to persephin mRNA or from a cDNA produced from a persephin mRNA.
  • a sample is obtained from a patient.
  • the sample can be from blood or from a tissue biopsy sample.
  • the sample may be treated to extract the nucleic acids contained therein.
  • the resulting nucleic acid from the sample is subjected to gel electrophoresis or other size separation techniques.
  • the mRNA of the sample is contacted with a nucleic acid serving as a probe to form hybrid duplexes.
  • a nucleic acid serving as a probe to form hybrid duplexes.
  • high stringency conditions can be used in order to prevent false positives, that is the hybridization and apparent detection of persephin nucleotide sequences when in fact an intact and functioning persephin gene is not present.
  • sequences derived from the persephin cDNA less stringent conditions could be used, however, this would be a less preferred approach because of the likelihood of false positives.
  • the stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, length of time and concentration of formamide. These factors are outlined in, for example, Sambrook et al . (Sambrook, et al . , 1989, supra ) .
  • RT/PCR reverse transcription/polymerization chain reaction
  • the method of RT/PCR is well known in the art (see example 9 and figure 6 below).
  • the RT/PCR method can be performed as follows. Total cellular RNA is isolated by, for example, the standard guanidium isothiocyanate method and the total RNA is reverse transcribed.
  • the reverse transcription method involves synthesis of DNA on a template of RNA using a reverse transcriptase enzyme and a 3' end primer. Typically, the primer contains an oligo(dT) sequence.
  • the cDNA thus produced is then amplified using the PCR method and persephin specific primers.
  • the polymerase chain reaction method is performed as described above using two oligonucleotide primers that are substantially complementary to the two flanking regions of the DNA segment to be amplified.
  • the PCR product is then electrophoresed and detected by ethidium bromide staining or by phosphoimaging .
  • the present invention further provides for methods to detect the presence of the persephin protein in a sample obtained from a patient.
  • Any method known in the art for detecting proteins can be used. Such methods include, but are not limited to immunodiffusion, immunoelectrophoresis, immunochemical methods, binder- ligand assays, immunohistochemical techniques, agglutination and complement assays. (for example see Basic and Clinical immunology , Sites and Terr, eds., Appleton & Lange, Norwalk, Conn, pp 217-262, 1991 which is incorporated by reference).
  • binder- ligand immunoassay methods including reacting antibodies with an epitope or epitopes of the persephin protein or derivative thereof and competitively displacing the labeled persephin protein or derivative thereof.
  • a derivative of persephin protein is intended to include a polypeptide in which certain amino acids have been deleted or replaced with other amino acids or changed to modified or unusual amino acids wherein the persephin derivative is biologically equivalent to persephin and/or wherein the polypeptide derivative cross-reacts with antibodies raised against the persephin protein.
  • cross-reaction it is meant that an antibody reacts with an antigen other than the one that induced its formation.
  • Antibodies employed in such assays may be unlabeled, for example as used in agglutination tests, or labeled for use in a wide variety of assay methods.
  • Labels that can be used include radionuclides, enzymes, fluorescers, chemiluminescers, enzyme substrates or co-factors, enzyme inhibitors, particles, dyes and the like for use in radioimmunoassay (RIA), enzyme immunoassays, e.g., enzyme-linked immunosorbent assay (ELISA), fluorescent immunoassays and the like.
  • polyclonal or monoclonal antibodies to the persephin protein or to an epitope thereof can be made for use in immunoassays by any of a number of methods known in the art.
  • epitope reference is made to an antigenic determinant of a polypeptide.
  • the term epitope can also include persephin-specific B cell epitopes or T helper cell epitopes.
  • An epitope could comprise 3 amino acids in a spacial conformation which is unique to the epitope. Generally an epitope consists of at least 5 such amino acids. Methods of determining the spatial conformation of amino acids are known in the art, and include, for example, x-ray crystallography and 2 dimensional nuclear magnetic resonance.
  • One approach for preparing antibodies to a protein is the selection and preparation of an amino acid sequence of all or part of the protein, chemically synthesizing the sequence and injecting it into an appropriate animal, usually a rabbit or a mouse (See Example 10 ) .
  • Oligopeptides can be selected as candidates for the production of an antibody to the persephin protein based upon the oligopeptides lying in hydrophilic regions, which are thus likely to be exposed in the mature protein.
  • Antibodies to persephin can also be raised against oligopeptides that include one or more of the conserved regions identified herein such that the antibody can cross-react with other family members. Such antibodies can be used to identify and isolate the other family members .
  • Methods for preparation of the persephin protein or an epitope thereof include, but are not limited to chemical synthesis, recombinant DNA techniques or isolation from biological samples. Chemical synthesis of a peptide can be performed, for example, by the classical Merrifeld method of solid phase peptide synthesis (Merrifeld, J Am Chem Soc 85:2149, 1963 which is incorporated by reference) or the FMOC strategy on a
  • Polyclonal antibodies can be prepared by immunizing rabbits or other animals by injecting antigen followed by subsequent boosts at appropriate intervals. The animals are bled and sera assayed against purified persephin protein usually by ELISA or by bioassay based upon the ability to block the action of persephin. When using avian species, e.g. chicken, turkey and the like, the antibody can be isolated from the yolk of the egg.
  • Monoclonal antibodies can be prepared after the method of Milstein and Kohler by fusing splenocytes from immunized mice with continuously replicating tumor cells such as myeloma or lymphoma cells. (Milstein and Kohler Nature 256:495-497, 1975; Gulfre and Milstein, Methods in
  • Another aspect of the present invention provides for a method for preventing or treating diseases involving over expression of the persephin protein by treatment of a patient with specific antibodies to the persephin protein.
  • Specific antibodies, either polyclonal or monoclonal, to the persephin protein can be produced by any suitable method known in the art as discussed above.
  • murine or human monoclonal antibodies can be produced by hybridoma technology or, alternatively, the persephin protein, or an immunologically active fragment thereof, or an anti-idiotypic antibody, or fragment thereof can be administered to an animal to elicit the production of antibodies capable of recognizing and binding to the persephin protein.
  • Such antibodies can be from any class of antibodies including, but not limited to IgG, IgA, IgM, IgD, and IgE or in the case of avian species, IgY and from any subclass of antibodies.
  • Example 1 This example illustrates the isolation and purification of neurturin from CHO cell conditioned medium.
  • DG44CH0-pHSP-NGFI-B CHO cells
  • the inventors herein have also obtained neurturin in partially purified form from other derivatives of DG44 Chinese hamster ovary cells.
  • the CHO cells were maintained in 20 ml medium containing minimum essential medium (MEM) alpha (Gibco-BRL No. 12561, Gaithersburg, MD ) containing 10% fetal calf serum
  • Cells were then knocked off the flask surface, 8 ml of medium were added and cells were triturated several times with a pipette. The cells were split 1:5 or 1:10, incubated at 37 °C under an atmosphere of 5% C0 2 in air and grown to confluence for 3-4 days.
  • the cell culture was then expanded into 850 cm 2 roller bottles (Becton Dickinson, Bedford, MA).
  • a confluent 150 cm 2 flask was trypsinized and seeded into one roller bottle containing 240 ml of the above modified MEM medium without methotrexate.
  • the pH was maintained either by blanketing the medium with 5% C0 2 in air or by preparing the medium with 25 mM HEPES pH 7.4 (Sigma, St. Louis, MO).
  • the roller bottles were rotated at 0.8-1.0 revolutions per minute. Cells reached confluence in 4 days.
  • SF-CHO serum-free CHO cell
  • DME/F12 base medium which was prepared by mixing 1:1 (v/v) DMEM (Gibco-BRL product No. 11965, Gibco-BRL, Gaithersburg, MD) with Ham's F12 (Gibco-BRL product No. 11765).
  • the final SF-CHO medium contained 15 mM HEPES pH 7.4 (Sigma, St. Louis, MO), 0.5 mg/ml bovine serum albumin (BSA, Sigma, St. Louis MO), 25 ⁇ g/ml heparin,
  • IX insulin-transferrin-selenite supplement (bovine insulin, 5 ⁇ g/ml; human transferrin, 5 ⁇ g/ml; sodium selenite, 5 ng/ml; Sigma, St. Louis, MO), 2 mM l-glutamine, 100 U/ml penicillin, and 100 ⁇ g/ml streptomycin.
  • the medium from the confluent roller bottles was removed and the cells washed once with 30 ml SF-CHO medium to remove serum proteins. Cells were then incubated at 37 °C for 16-24 hrs in 80 ml SF-CHO medium to further remove serum proteins. The 80 ml medium was removed and discarded. A volume of 120 ml of SF-CHO medium was added to the flask and the cells incubated at 37 °C. Every 48 hrs thereafter, 120 ml was collected and replaced with the same volume of SF-CHO medium.
  • Collected media was pooled and centrifuged at 4°C in polypropylene conical tubes to remove cellular debris and the supernatant stored at -70 °C. Media was collected 5 times over 10 days to yield a total of approximately 600 ml conditioned medium per roller bottle.
  • the neurotrophic activity of CHO conditioned medium starting material and at various stages of purification was assessed using the superior cervical ganglion survival assay system previously reported (Martin, et al J of Cell Biology 106:829-844; Deckwerth and Johnson, J Cell Bio 123:1207-1222, 1993 which are incorporated by reference).
  • Primary cultures of sympathetic neurons from superior cervical ganglion ( SCG ) were prepared by dissecting tissue from Day 20-21 rat embryo (E20-E21).
  • the SCG's were placed in Leibovitz ' s L15 with l-glutamine medium (Cat #11415-023 Gibco-BRL, Gaithersburg, MD), digested for 30 minutes with 1 mg/ml collagenase (Cat #4188 Worthington Biochemical, Freehold, NJ) in Leibovitz ' s L15 medium at 37°C, followed by a 30 minute digestion in trypsin-lyophilized & irradiated (Type
  • TRLVMF Cat #4454 Worthington Biochemical, Freehold, NJ which was resuspended in modified Hanks' Balanced Salt Solution (Cat #H-8389 Sigma Chemical Co., St. Louis, MO).
  • the digestion was stopped using AM50 which contains Minimum Essential Medium with Earle ' s salts and without l-glutamine (Cat #11090-016 Gibco-BRL), 10% fetal calf serum (Cat #1115 Hyclone Laboratories, Logan, UT ) , 2mM 1- glutamine (Cat #G5763 Sigma Chemical Co., St. Louis, MO), 20 ⁇ M FuDr (F-0503 Sigma Chemical Co., St. Louis, MO), 20 ⁇ M Uridine (Cat #3003 Sigma Chemical Co., St.
  • the cells were dissociated into a suspension of single cells using a silanized and flame-polished Pasteur pipet. After filtration of the suspension through a nitex filter (size 3-20/14, Tetko Inc., Elmsford, NY), the cells were placed in AM50 medium as above and preplated on a 100 mm Falcon or Primaria culture dish (Becton Dickinson Labware, Lincoln Park, NJ ) to reduce the number of non-neuronal cells.
  • a silanized and flame-polished Pasteur pipet After filtration of the suspension through a nitex filter (size 3-20/14, Tetko Inc., Elmsford, NY), the cells were placed in AM50 medium as above and preplated on a 100 mm Falcon or Primaria culture dish (Becton Dickinson Labware, Lincoln Park, NJ ) to reduce the number of non-neuronal cells.
  • the medium containing the unattached neuronal cells was removed from these dishes and triturated again through a silanized and flame-polished Pasteur pipet.
  • the single cell suspension was plated on 24-well tissue culture plates (Costar, Wilmington, MA) that have been previously coated with a double layer of collagen, one layer of collagen that had been ammoniated and a second layer of collagen that had been air dried. They were allowed to attach for 30 minutes to 2 hours.
  • a specific number of viable cells usually about 1200 to about 3000 total cells per well, or a specific percentage of the ganglion, usually 25% of the cells obtained per ganglion were plated into each well.
  • survival unit The total survival units in a sample were defined as the minimal volume of an aliquot of the sample which produced maximal survival divided into the total volume of that sample. Specific activity was calculated as the survival units divided by the mg total protein. Survival units were determined in an assay using approximately 1200 viable neurons in a 0.5 ml culture assay and a culture period of 48 hours following addition of the fraction. Survival was assessed visually after the 48 hours. Intrinsic activity as shown in Figure 4 was determined in an assay using approximately 2700 neurons and a culture period of 72 hours. Survival was assessed by fixing the neurons and counting the number of surviving neurons.
  • the intrinsic activity measurement would be expected to be lower than that predicted by Specific Activity determinations.
  • the intrinsic activity measurement would also be expected to be lower than that predicted by specific activity because the survival was measured after 72 hours instead of 48 hours .
  • conditioned medium was filtered through 0.2 ⁇ l pore bottle-top filters (cellulose acetate membrane, Corning Inc., Corning, NY). Typically 50 liters of conditioned medium was used and processed in 25 liter batches. Each 25 liter batch was introduced at a rate of 20 ml/min onto a 5 x 5 cm column containing 100 ml heparin-agarose (Sigma, St. Louis, MO) equilibrated with 25 mM HEPES, pH 7.4 buffer with 150 mM NaCl.
  • heparin-agarose Sigma, St. Louis, MO
  • the column was then washed with approximately 1000 ml 25 mM HEPES, pH 7.4 buffer containing 0.5 M NaCl at 20 ml/min and the activity was then eluted with 25 mM HEPES, pH 7.4 buffer containing 1.0 M NaCl. After switching to the 1. OM NaCL elution buffer, the first 50 ml of buffer was discarded and, thereafter, one 300 ml fraction was collected.
  • the column was then washed with 160 ml 25 mM HEPES, pH 7.4 buffer containing 0.5 M NaCl and 0.02% TWEEN 20 and the activity was eluted with 25 mM HEPES, pH 7.4 buffer containing 1.0 M NaCl and 0.02%
  • TWEEN 20 at a flow rate of 2 ml/min. One 50 ml fraction was collected after the first 7 ml of eluate from the column.
  • the bound proteins were eluted with a linear gradient of increasing glycine concentration (0-300 mM) in 25 mM HEPES, pH 7.4 buffer containing 1.0 M NaCl at a rate of 1.0 ml/min.
  • the gradient was produced by a Pharmacia FPLC system using an LCC-500 controller and P-500 pumps to establish a 0-300 mM glycine gradient in 40 ml at 1.0 ml/min, thus increasing the gradient by 7.5 mM glucine per min.
  • One ml fractions were collected and assayed for SCG survival promotion. Peak activity was observed in fractions 17- 20, i.e. 17-20 min or ml from the start of the gradient.
  • Absorbance measurements at 280 nM by an in-line UV monitor indicated that most proteins eluted prior to the survival activity in fractions 17-20. Thus, significant purification was achieved at this step.
  • a 25 kD band co- purified with the survival activity.
  • the combined eluted fractions from the CtX superose column were diluted to 0.45 M NaCl using 25 mM HEPES pH 7.4 buffer containing 0.02% TWEEN 20 and introduced into a Mono S HR 5/5 cation exchange column (Pharmacia, Piscataway, NJ ) for further FPLC purification.
  • the column had been equilibrated with 25 mM HEPES pH 7.4 buffer containing 0.45 M NaCl containing 0.02% TWEEN 20. Bound proteins were eluted with a linear gradient of increasing NaCl concentration (0.45-1.0 M).
  • FIG. 1 A 25 kD band appeared in fractions 25-30, a 28 kD protein elutes earlier in the gradient and an 18 kD elutes later in the gradient.
  • Figure 2 illustrates the survival activity in each of the fractions. The survival activity is noted to correspond with the presence and apparent intensity of the 25 kD protein in fractions 25- 30.
  • the 25 kD protein was eluted from the polyacrylamide gel after electrophoresis and assayed for survival activity in the SCG assay.
  • electrophoresis 150 ⁇ l of the SP SEPHAROSE® 1.0 M NaCl fraction in one lane of a non-reducing 14% SDS- polyacrylamide gel as above, the lane was cut into 12 slices and each slice was crushed and eluted by diffusion with rocking in buffer containing 25 mM HEPES, pH 7.4, 0.5 M NaCl, 0.02% Tween-20 for 18 hr at 25 °C.
  • BSA was added to the eluate to a final concentration of 200 ⁇ g/ml and the eluate was filtered through a 0.45 micron filter to remove acrylamide gel fragments. The filtrate was then added to a SP SEPHAROSE® column to concentrate and purify the sample. Before eluting the sample, the column was washed once in 400 ⁇ l 25 mM HEPES, pH 7.4 buffer containing 0.5 M NaCl, 0.02% Tween-20 and 200 ⁇ g BSA per ml and once in 400 ⁇ l 25 mM HEPES, pH 7.4 buffer containing 0.02% Tween-20 and 200 ⁇ g BSA per ml.
  • the column was then washed again in 400 ⁇ l of 25 mM HEPES, pH 7.4 buffer containing 0.5 M NaCl, 0.02% TWEEN 20 and 200 ug BSA per ml.
  • the sample was eluted with 25 mM HEPES, pH 7.4 buffer containing 1.0 M NaCl, 0.02% Tween-20 and 200 ⁇ g BSA per ml .
  • Samples were then analyzed for survival activity. Only the slice corresponding to the 25 kD band showed evidence of survival activity.
  • the 25 kD protein purified from CHO cell conditioned media is believed to be a homodimer.
  • the yield from the purification above was typically 1-1.5 ⁇ g from 50 liters of CHO cell conditioned medium. Overall recovery is estimated to be 10-30%, resulting in a purification of approximately 390,000 fold.
  • the progressive purification using the above steps s shown in table 2.
  • a. mg protein was determined using the dye binding method of Bradford (Anal Biochem 72:248, 1976).
  • the total activity units or survival units in a sample were defined as the minimal volume of an aliquot of the sample which produced maximal survival divided into the total volume of that sample.
  • c. Activity for Conditioned Medium was derived from the assumption that 100% of the activity was recovered in the heparin agarose fraction because the activity of conditioned medium was too low to be directly assayed.
  • d. Specific Activity was the Activity units divided by the mg total protein.
  • Example 2 This example illustrates the characterization of neurturin and several members of the TGF- ⁇ family of growth factors in the SCG assay and the lack of cross reactivity of anti-GDNF antibodies with neurturin.
  • the SCG assay of the purified protein indicated that the factor is maximally active at a concentration of approximately 3 ng/ml or approximately 100 pM and the EC 50 was approximately 1.5 ng/ml or approximately 50 pM in the expected range for a diffusible peptide growth factor ( Figure 4 ) .
  • TGF- ⁇ Several members of the TGF- ⁇ family influence neuropeptide gene expression in sympathetic neurons, while others promote survival of different neuronal populations.
  • Neurturin which is a distant member of this family of proteins, is capable of promoting virtually complete survival of sympathetic neurons for 3 days.
  • further culturing of the SCG cells revealed that neurturin could continue to maintain these neurons for at least 10 days after withdrawal of NGF.
  • TGF- ⁇ family We tested several other members of the TGF- ⁇ family for their ability to promote survival in the SCG assay including TGF- ⁇ l, activin, BMP-2, BMP-4, BMP-6 and GDNF. Of these factors, only GDNF had survival promoting activity, however, the activity of GDNF was much less potent than neurturin in this activity showing an EC 50 of 2-4 nM in the 3-day survival assay.
  • the GDNF tested in this assay was rhGDNF produced in E. Coli obtained from Prepro Tech, Inc., Rocky Hill, N.J.
  • SCG neurons that had been dissected and plated as described in Example 1 were treated on Day 6 with 1 ng/ml, 3 ng/ml, 10 ng/ml, or 30 ng/ml GDNF ( Prepro Tech, Inc, Rocky Hill, N.J.) in the presence of anti-NGF alone, or in the presence of anti-NGF and anti-GDNF (goat IgG antibody to E. coli-derived rhGDNF, R & D Systems, Minneapolis, Minn).
  • a partially purified 1.0 M SP Sepharose fraction of neurturin was used in the assay at the approximate concentrations of 375 pg/ml, 750 pg/ml, 1.5 ng/ml and 3 ng/ml .
  • This fraction was tested in the presence of anti-NGF alone, and in the presence of anti-NGF and anti-GDNF.
  • the anti-GDNF antibody blocked the survival promoting activity of GDNF at a concentration up to 30 ng/ml, but did not block the survival promoting activity of neurturin.
  • This example illustrates the effect of neurturin on sensory neurons in a nodose ganglion survival assay.
  • CHO cell conditioned media that had been partially purified on the SP Sepharose column was assayed for neurotrophic activity on sensory neurons using nodose ganglia.
  • the survival assay is a modification of that previously reported above for superior cervical ganglia.
  • Primary dissociated cultures of nodose ganglia were prepared by dissecting tissue from E18 Sprague Dawley rat pups. The nodose ganglia were placed in Leibovitz ' s L15 with 2 mM l-glutamine (Cat# 11415-023, GIBCO-BRL.
  • the digestion was stopped using AM0-BDNF100, a medium containing Minimum Essential Medium with Earle ' s salts and without l-glutamine (#11090-016 GIBCO-BRL), 10% fetal Calf Serum (Cat#1115, Hyclone Laboratories, Logan, UT), 2 mM l-glutamine (Cat#G5763 Sigma Chemical Co., St. Louis, Mo.), 20 ⁇ M FuDr (F-0503, Sigma Chemical Co.), 20 ⁇ M Uridine (Cat #3003, Sigma Chemical Co., St. Louis, Mo.) 100 U/ml penicillin, 100 ⁇ g/ml Streptomycin, and 100 ng Brain Derived Neurotropic Factor (BDNF, Amgen, Thousand Oaks, CA).
  • AM0-BDNF100 a medium containing Minimum Essential Medium with Earle ' s salts and without l-glutamine
  • 10% fetal Calf Serum Cat#1115, Hyclone Laboratories, Logan, UT
  • the cells were dissociated into a suspension of single cells using a silanized and flame-polished Pasteur pipet in the AMO-BDNF100 medium, and preplated on a 100 mm Falcon or Primaria culture dish ( Becton Dickinson Labware, Lincoln Park, NJ ) to remove non-neuronal cells. After 2 hours, the medium containing the unattached neuronal cells was removed from these dishes and triturated again through a silanized and flame-polished Pasteur pipet.
  • the single cell suspension was plated on 24-well tissue culture plates (Costar, Wilmington, MA) that have been previously coated with a double layer of collagen, one layer of which had been ammoniated and a second layer that had been air dried.
  • Ganglia from ten E18 rat embryos were dissociated into 2.5 mis of media and 100 ⁇ l of this suspension was added to each well.
  • the cells were allowed to attach for 30 min in a 37 °C incubator with 5% C02/95% air.
  • the wells were fed with AM0-BDNF100 media overnight.
  • the cells were washed 3 times for 20 min each time with AM0 medium containing no BDNF.
  • the wells were fed with 0.5 ml of this media alone or this media containing either 50 ng/ml NGF, 100 ng/ml BDNF
  • Nodose ganglia that had no trophic support (AMO) showed 20%-30% survival, as did neurons that were cultured in the presence of 50 ng/ml NGF.
  • Neurons cultured in the presence of 3 ng/ml neurturin and absence of BDNF showed survival similar to those neurons cultured in the presence of BDNF ( 100 ng/ml ) .
  • GDNF at a concentration of 100 ng/ml promoted greater survival of nodose neurons than did BDNF ( 100 ng/ml ) .
  • Similar findings with GDNF were recently reported for sensory neurons from chicken (Ebendal, T. et al, J Neurosci Res 40:276-284 1995 which is incorporated by reference).
  • Example 4 This example illustrates the determination of partial amino acid sequences of neurturin isolated from CHO cell conditioned medium.
  • the Mono S fractions 26-29 containing the peak of activity were concentrated to 25 ⁇ l by centrifuge ultrafiltration in a microcon-3 concentrators (Amicon, Inc., Beverley, MA) and loaded onto a non-reducing 14% SDS polyacrylamide gel . After electrophoretic separation, proteins were electroblotted to a PVDF membrane (Bio-Rad, Hercules, CA ) and stained with 0.1% Coomassie Blue. The 25 kD band was excised and inserted into the reaction cartridge of an automated sequencer (Model 476, Applied Biosystems (Foster City, CA).
  • Two N-terminal sequencing runs were performed from two 50 liter purification preparations.
  • 1 ⁇ g of protein in 3 pooled fractions of 1.5 ml total volume were concentrated to 25 ⁇ l and electroblotted at 100V for 2 hrs at 25 °C using an electroblot buffer of 10 mM CAPS pH 11.0 buffer (Sigma, St. Louis, MO) containing 5% methanol.
  • the amino acid sequence was obtained from 13 cycles of Edman degradation and the sequencing yield was 4 pmoles as above.
  • neurturin 20-23 containing neurturin were concentrated to 25 ⁇ l by ultrafiltration (Amicon microcon 3, Amicon, Beverley, MA) and loaded on a non-reducing SDS polyacrylamide gel. After electrophoresis, the gel was stained with Coomassie blue and the 25 kD neurturin band was excised. Neurturin was digested in the gel slice with endoproteinase Lys-C, and the eluted proteolytic fragments were purified by reverse phase HPLC. Only one peak was observed upon HPLC separation of the eluted peptides, which yielded amino acid sequence information for 23 cycles at the 1 pmole signal level using the automated sequencer, (internal fragment P2, SEQ ID N0:5).
  • Example 5 The in situ digestion, elution and purification of peptides, and peptide sequencing was performed by the W.M. Keck Foundation Biotechnology Resource Laboratory at Yale University according to standard protocols for this service.
  • Example 5 The following example illustrates the isolation and sequence analysis of mouse and human neurturin cDNA clones. Degenerate oligonucleotides corresponding to various stretches of confident amino acid sequence data were synthesized and used as primers in the polymerase chain reaction (PCR) to amplify cDNA sequences from reverse transcribed mRNA.
  • PCR polymerase chain reaction
  • a forward primer (M1676; 5' -CCNACNGCNTAYGARGA, SEQ ID NO: 50) corresponding to peptide sequence P2 Xaa 1 -Xaa 2 -Val-Glu-Ala-Lys-Pro-Cys-Cys- Gly-Pro-Thr-Ala-Tyr-Glu-Asp-Xaa 3 -Val-Ser-Phe-Leu-Ser-Val where Xaa 1 and Xaa 2 were unknown, Xaa 3 was Gin or Glu (SEQ ID NO: 5) in combination with a reverse primer (M1677; 5 ' -ARYTCYTGNARNGTRTGRTA (SEQ ID NO: 52) corresponding to peptide sequence P3
  • Primers corresponding to the amplified sequence were used in combination with the degenerate primers in the rapid amplification of cDNA ends (RACE) technique (Frohman, M.A. Methods in Enzymology 218:340-356, 1993) using the Marathon RACE kit (CLONTECH, Palo Alto, CA) per the manufacturer's instructions, except that first strand cDNA synthesis was carried out at 50 °C using Superscript II reverse transcriptase (Gibco-BRL). Briefly, a double stranded adaptor oligonucleotide was ligated to the ends of double stranded cDNA synthesized from postnatal day 1 rat brain mRNA.
  • RACE rapid amplification of cDNA ends
  • neurturin PCR primers M1676; 5 ' -CCNACNGCNTAYGARGA, SEQ ID NO: 50 and 1678; 5'-GACGAGGGTCCTTCCTGGACGTACACA, SEQ ID NO: 53
  • the 3' end of the neurturin cDNA was amplified by two successive PCR reactions (1st: M1676 and API, using 94°C for 30 sec, 55°C for 30 sec and 72°C for 2 min for 35 cycles; 2nd: M1678 and AP2 using 94°C for 30 sec and 68 °C for 2 min for 35 cycles).
  • a 5' portion of the rat neurturin cDNA was obtained by two successive PCR reactions using the linkered cDNA as template.
  • the 1st reaction utilized primers M1677 (SEQ ID NO: 52) and API; using 94 °C for 30 sec; 55 °C for 30 sec; and 72 °C for 2 min for 35 cycles.
  • the 2nd reaction used M1679 5 ' -TAGCGGCTGTGTACGTCCAGGAAGGACACCTCGT (SEQ ID NO: 54) and AP2 at 94 °C for 30 sec and 68 °C for 2 min for 35 cycles.
  • Primers (#467921 5'-CAGCGACGACGCGTGCGCAAAGAGCG, SEQ ID NO: 55; and M1679 (SEQ ID NO: 54) corresponding to the partial rat cDNA sequence were used (PCR parameters 94 °C for 30 sec and 68 °C for 1 min for 35 cycles) to amplify a 101 nucleotide PCR product from mouse genomic DNA which was homologous to rat neurturin cDNA sequence. These primers were then used to obtain murine neurturin genomic clones by amplifying gene fragments in a mouse 129/Sv library in a Pl bacteriophage vector (library screening service of Genome Systems, Inc., St. Louis, MO). A 1.6 kb Neo I fragment from this Pl clone containing the neurturin gene was identified by hybridization with primer (#465782;
  • Neo I fragment was sequenced and found to contain a stretch of coding sequence corresponding to the N-terminal and internal amino acid sequences obtained from sequencing the active protein isolated from CHO cell conditioned media. Beginning at the N-terminal amino acid sequence of the purified protein, this nucleotide sequence encodes a 100 amino acid protein with a predicted molecular mass of 11.5 kD.
  • a search of protein and nucleic acid databases identified neurturin as a novel protein that is approximately 40% identical to glial derived neurotrophic factor (GDNF).
  • GDNF was purified and cloned as a factor which promotes the survival of midbrain dopaminergic neurons and is a distantly related member of the TGF- ⁇ superfamily, which now includes more than 25 different genes that possess a wide variety of proliferative and differentative activities.
  • GDNF is less than 20% identical to any other member of the TGF- ⁇ family, it contains the 7 cysteine residues which are conserved across the entire family and believed to be the basis of a conserved cysteine knot structure observed in the crystal structure determination of TGF- ⁇ 2.
  • Neurturin also contains these 7 cysteine residues, but like GDNF is less than 20% homologous to any other member of the TGF- ⁇ family.
  • neurturin and GDNF appear to represent a subfamily of growth factors which have significantly diverged from the rest of the TGF- ⁇ superfamily.
  • the 5' end was obtained using for the 1st reaction primer M1759, 5 ' -CRTAGGCCGTCGGGCGRCARCACGGGT (SEQ ID NO: 58) and API at 94°C for 30 sec; 65°C for 15 sec; and 68°C for 2 min for 35 cycles.
  • the 2nd reaction used primer M1785, 5 ' -GCGCCGAAGGCCCAGGTCGTAGATGCG (SEQ ID NO: 59) and AP2 at 94°C for 30 sec; 65 °C for 15 sec; and 68 °C for 2 min for 20 cycles. Both sets of PCR reactions included 5% DMSO.
  • the 5' and 3' mouse RACE products were subcloned into the plasmid Bluescript KS and sequenced.
  • a 1.0 kb mouse neurturin cDNA sequence can be assembled.
  • This cDNA sequence contains an open reading frame of 585 nucleotides that encodes a protein with a molecular mass of 24 kD.
  • This full length mouse cDNA sequence is shown in Figure 7 (SEQ ID NO: 12).
  • the 24 kD neurturin protein contains an amino terminal 19 amino acid signal sequence followed by a pro-domain which contains an RXXR proteolytic processing site immediately before the N-terminal amino acid sequence obtained when sequencing the protein purified from CHO cell conditioned media.
  • the 11.5 kD mature neurturin molecule is predicted to be 11.5 kD and, by analogy to other members of the TGF- ⁇ family, is predicted to form a disulfide linked homodimer of 23 kD, consistent with the 25 kD mass of the protein purified from CHO cell conditioned media as estimated by SDS-PAGE analysis.
  • primers For isolation of human genomic clones, primers
  • the results of subcloning and sequencing of human genomic fragments were as follows.
  • the Eag I fragment was found to be approximately 6 kb in size with the 3 ' Eag I site located 60 bp downstream from the stop codon.
  • the Pvu II fragment was approximately 3.5 kb in size with the 3' Pvu II site located 250 bp downstream from the stop codon.
  • the Hind III fragment was approximately 4.8 kb in size with the 3' Hind III site located 3kb downstream from the stop codon.
  • the Kpn I fragment was approximately 4.2 kb in size with the 3' Kpn I site located 3.1 kb downstream from the stop codon.
  • the second coding exon was sequenced using these subcloned fragments. In addition, sequence was obtained from 250 bp flanking the 3' side of the second exon. The sequence was also obtained from 1000 bp flanking the 5 ' side of the coding exon. From these flanking sequences, forward primer 30341 ( 5 ' -CTGGCGTCCCAMCAAGGGTCTTCG-3 ' , SEQ ID NO: 71) and reverse primer 30331 (5'-
  • GCCAGTGGTGCCGTCGAGGCGGG-3' SEQ ID NO: 72 were designed so that the entire coding sequence of the second exon could be amplified by PCR.
  • the first coding exon was not mapped relative to the restriction sites above but was contained in the Eag I fragment.
  • the sequence of this exon was obtained from the subcloned Eag I fragment using the mouse primer
  • 466215 (5' -GGCCCAGGATGAGGCGCTGGAAGG-3' , SEQ ID NO:73), which contains the ATG initiation codon. Further sequence of the first coding exon was obtained with reverse primer 20215 ( 5 ' -CCACTCCACTGCCTGAWATTCWACCCC-3 ' , SEQ ID NO: 74), designed from the sequence obtained with primer 466215.
  • Forward primer 20205 (5'--
  • CCATGTGATTATCGACCATTCGGC-3 ' SEQ ID NO: 75 was designed from sequence obtained with primer 20215.
  • Primers 20205 and 20215 flank the coding sequence of the first coding exon and can be used to amplify this coding sequence using PCR.
  • the human cDNA and inferred amino acid sequence is shown in Figure 7 and the mouse cDNA and inferred amino acid sequence is shown in Figure 8.
  • Example 6 This example illustrates the preparation of expression vectors containing neurturin cDNA.
  • neurturin vector pCMV-NTN-3-1 For expression of recombinant neurturin in mammalian cells the neurturin vector pCMV-NTN-3-1 was constructed. The 585 nucleotide open reading frame of the neurturin cDNA was amplified by PCR using a primer containing the first 27 nucleotides of the neurturin coding sequence
  • the neurturin coding sequence was then excised from this vector using Mlu I ( 5 ' end ) and Bam HI ( 3 ' end ) and inserted downstream of the CMV IE promoter/enhancer in the mammalian expression vector pCB6 (Brewer, C.B. Methods in Cell Biology 43:233-245, 1994) to produce the pCMV-NTN-3-1 vector using these sites.
  • pCB6 Brewer, C.B. Methods in Cell Biology 43:233-245, 1994
  • the mature coding region of mouse neurturin was amplified by PCR using a primer containing the first 7 codons of the mature coding sequence ( 5 ' -GACCATATGCCGGGGGCTCGGCCTTGTGG ) (SEQ ID NO: 65) and a primer containing the last 5 codons and the stop codon
  • the pET-neurturin (pET-NTN) vector codes for an initiator methionine in front of the first amino acid of the mature mouse neurturin protein predicted from the N-terminal amino acid sequence of neurturin purified from the CHO cell conditioned media.
  • Example 7 This example illustrates the transient transfection of NIH3T3 cells with the neurturin expression vector pCMV-NTN-3-1 and that the product of the genomic sequence in Example 5 is biologically active.
  • NIH3T3 cells were plated at a density of 400,000 cells per well (34.6 mm diameter) in 6 well plates (Corning, Corning, NY) 24 hours before transfection.
  • DNA liposome complexes were prepared and added to the cells according to the manufacturer's protocol using 1.5 ⁇ g CMV-neurturin plasmid DNA (isolated and purified using a Qiagen (Chatsworth, CA) tip-500 column according to manufacturer's protocol) and 10 ⁇ l lipofectamine reagent ( Gibco BRL, Gaithersburg, MD ) in 1:1 DME/F12 medium containing 5 ⁇ g/ml insulin, 5 ⁇ g/ml transferrin, and 5 ng/ml sodium selenite (Sigma, St. Louis, M0). Five hours after the addition of DNA liposome complexes in 1 ml medium per well, 1 ml DME medium containing 20% calf serum was added to each well.
  • the 2 ml medium above was replaced with 1 ml DME medium containing 10% calf serum, 2 mM glutamine, 100 U/ml penicillin, 100 ⁇ /ml streptomycin, and 25 ug/ml heparin.
  • the cells were incubated for an additional 24 hours before the conditioned medium was harvested, centrifuged to remove cellular debris, and frozen.
  • NIH3T3 cells were transfected as above using 1.5 ⁇ g CMV-neo expression plasmid (containing no cDNA insert ) in place of the 1.5 ⁇ g CMV-neurturin plasmid.
  • Conditioned medium from NIH3T3 cells transfected with either control plasmid or CMV-neurturin plasmid was assayed by direct addition to the SCG culture medium at the time of NGF deprivation. Addition of 0.25 ml conditioned medium from CMV-neurturin-transfected cells promoted 70% survival of sympathetic neurons, and >90% survival could be obtained with 0.45 ml of this conditioned medium. No significant survival promoting activity was detected in the conditioned medium of control transfected NIH3T3 cells.
  • Example 8 This example illustrates the preparation of Chinese hamster ovary cells stably transformed with neurturin cDNA.
  • DG44 cells a Chinese hamster ovary cell derivative that is deficient in dihydrofolate reductase (DHFR) (Urlaub et al Cell 3:405-412, 1983 which is incorporated by reference), were stably co-transfected with expression plasmid (pCMV-NTN-3-1 ) and a DHFR expression plasmid ( HLD ) (McArthur, and Stanners J. Biol . Chem. 266:6000-6005, 1991 which is incorporated by reference ) .
  • DHFR dihydrofolate reductase
  • DG44 cells were plated at lxlO 6 cells per 10 cm plate in Ham's F12 medium with 10% fetal calf serum (FCS). This density must not be exceeded or cells will overgrow before selection media is added on day 5.
  • FCS fetal calf serum
  • cells were transfected with a 9:1 ratio of pCMV-NTN to DHFR expression plasmid using the calcium phosphate method (10 ug DNA /10 cm plate) (Chen and Okayama, Mol Cell Biol 7:2745-2752, 1987 which is incorporated by reference ) .
  • the transfected cells were washed with Ham's F12 medium and fed Ham's F12 with 10% FCS.
  • MEM alpha medium On day 5 the cells were washed with MEM alpha medium and fed selection medium, which is MEM alpha with 10% FCS and 400 ug/ml G418. The cells were maintained in selection media, feeding every 4 days. Colonies began to appear approximately 14 days after transfection. Colonies growing in selection media were then transferred to a 24 well plate and trypsinized the next day to disperse the cells. The cells were grown to confluence in either 24 well or 6 well plates in order to screen the cells for expression of recombinant protein. Expression of neurturin was examined in 10 clonal lines and two high expressing lines were detected using the SCG survival assay.
  • clonal lines were expanded and expression in these selected cell lines was amplified by selection in 50 nM methotrexate (MTX).
  • MTX methotrexate
  • cells were grown to 50% confluence in a 150 cm 2 flask in selection medium. The medium was changed to MEM alpha containing 50 nM MTX concentration ( it was not necessary to use G418 during MTX amplification). After placement in 50 nM MTX, the majority of cells died and colonies of resistant cells reappeared in 1-2 weeks. At this time, the cells were trypsinized to disperse colonies and are split when cells reach confluence. Cells eventually reached the same growth rate as before. The selected cells were screened for expression of recombinant protein. A 2-3 fold increase in expression was observed after selection in 50 nM MTX. Frozen stocks were kept for cell lines obtained from the original selection and the 50 nM MTX selection. Further selection could be continued in increasing MTX until desired levels of expression are obtained.
  • RNA samples were obtained from various tissues and PCR products were detected either by autoradiography after incorporation of ⁇ - 32 P-dCTP in the PCR and electrophoresis on a polyacrylamide gel ( Figure 6) or by ethidium bromide staining of DNA after electrophoresis on agarose gels (Tables 3 and 4).
  • the neurturin fragment of 101 base pairs was obtained using the forward primer CAGCGACGACGCGTGCGCAAAGAGCG (SEQ ID NO: 67) and reverse primer TAGCGGCTGTGTACGTCCAGGAAGGACACCTCGT (SEQ ID NO: 68) and the GDNF fragment of 194 base pairs was obtained using the forward primer AAAAATCGGGGGTGYGTCTTA (SEQ ID NO: 69) and the reverse primer CATGCCTGGCCTACYTTGTCA (SEQ ID NO: 70).
  • neurturin or GDNF mRNA was detected at the earliest embryonic age (embryonic day 10, E10) surveyed. In neonates (postnatal day 1, Pl ) both transcripts were expressed in many tissues although neurturin tended to show a greater expression in most tissues than did GDNF. (see table 3) . Table 3.
  • neurturin was found to be expressed in brain and spinal cord as well as in blood and bone marrow where no GDNF was detected.
  • the level of expression of neurturin in brain and blood was, however, less than that detected in neonatal tissue.
  • Neurturin was also highly expressed in freshly isolated rat peritoneal mast cells, whereas GDNF showed little or no expression.
  • Example 10 This example illustrates the preparation of antisera to neurturin by immunization of rabbits with a neurturin peptide.
  • the peptide sequence corresponding to amino acids 73-87 of the mature murine neurturin protein was synthesized and coupled to keyhole limpet hemocyanin (KLH) as described earlier (Harlow and Lane, Antibodies : a laboratory manual , 1988. Cold Spring Harbor Laboratory, New York, NY. p. 72-81 which is incorporated by reference).
  • KLH-coupled peptide was submitted to Caltag, Inc. and each of two rabbits were immunized. Immunization was by subcutaneous injection at 7-10 sites.
  • the first injection was with 150 ⁇ g KLH-coupled peptide which was resuspended in 0.5 ml saline and emulsified with 0.5 ml complete Freund's adjuvant.
  • Boost injections were begun 4 weeks after the initial injection and were performed once every 7 days as above for a total of 5 injections except that 100 ⁇ g of KLH-coupled peptide and incomplete Freund's adjuvant were used. Serum samples were collected 1 week after the fifth boost.
  • a peptide affinity column was prepared by coupling the above peptide to cyanogen bromide activated Sepharose 4B according to the manufacturers protocol ( Pharmacia Biotech). The serum was diluted 10 fold in 10 mM Tris pH 7.5 buffer and mixed by gentle rocking for 16 hours at
  • the affinity-purified antibodies were used in a western blot to demonstrate specific recognition of recombinant neurturin protein.
  • Ten ml of conditioned medium collected from DG44CH05-3( G418 ) ( pCMV-NTN-3-1 ) cells was purified over SP Sepharose as described in Example 1 and the proteins electrophoresed on a reducing SDS-PAGE gel in the tricine buffer system (Schagger and von Jagow Analytical Biochemistry 166:368-379 , 1987). The proteins were electroblotted to a nitrocellulose membrane in 25 mM Tris, 192 mM glycine, 0.04% SDS, 17% methanol at 4°C for 16 hr.
  • the membrane was incubated with the affinity-purified anti-neurturin peptide antibodies and then with horseradish peroxidase-coupled sheep anti-rabbit IgG (Harlow and Lane, supra , p. 498-510). Bound antibodies were detected with enhanced chemiluminescence ( ECL kit, Amersham, Buckinghamshire, England). The anti-neurturin antibodies recognized a single, approximately 11.5 kD protein band in the conditioned medium of the DG44CH05-3( G418 ) ( pCMV-NTN-3-1 ) cells.
  • neurturin protein could be detected in 10 ml of conditioned medium from DG44CH05-3( G418 ) (pCMV-NTN-3-1 ) cells but could not be detected in 10 ml of medium conditioned with DG44 cells that had not been transformed with the neurturin expression vector.
  • the following example illustrates the identification of additional members of the GDNF/neurturin/persephin gene subfamily.
  • the TGF- ⁇ superfamily currently contains over 25 different gene members (for review see Kingsley, Genes and Development 8 : 133-146, 1994 which is incorporated by reference).
  • the individual family members display varying degrees of homology with each other and several subgroups within the superfamily can be defined by phylogenetic analysis using the Clustal V program
  • Neurturin or persephin is approximately 40% identical to GDNF but less than 20% identical to any other member of the TGF- ⁇ superfamily.
  • Several sequence regions in neurturin can be identified ( Figure 5) that are highly conserved within the GDNF/neurturin/persephin subfamily but not within the TGF- ⁇ superfamily.
  • Xaa 4 -Gly-Xaa 5 -Cys in which Xa ⁇ j is Thr, Glu or lys, Xaa 2 is Val, Leu or Ile, Xaa 3 is Leu or Ile, Xaa 4 is Ala or Ser, and Xaa 5 is Ala or Ser, (SEQ ID NO: 113); and Cys-Cys-Xaa ⁇ Pro-Xaa 2 -Xaa 3 -Xaa 4 -Xaa 5 -Asp-Xaa 6 -Xaa 7 -Xaa 8 -Phe-Leu-Asp-Xaa 9 in which Xaa x is Arg or Gin, Xaa 2 is Thr or Val or Ile, Xaa 3 is Ala or Ser, Xaa 4 is Tyr or Phe, Xaa 5 is Glu, Asp or Ala, Xaa 6 is Glu, Asp or no amino acid, Xa
  • Nucleotide sequences containing a coding sequence for the above conserved sequences or fragments of the above conserved sequences can be used as probes .
  • Exemplary probe and primer sequences which can be designed from these regions are as follows. Forward primers, Primer A (M3119): 5 ' -GTNDGNGANYTGGGNYTGGGNTA (SEQ ID NO: 1 .
  • Primer B (M3123): 5 ' -GANBTNWCNTTYYTNGANG (SEQ ID NO:
  • Primer C (M3126): 5 ' -GANBTNWCNTTYYTNGANGW (SEQ ID NO: 117) 20 nt which codes for the amino acid sequence, Xaa 1 -Xaa 2 -Xaa 3 -Phe-Leu-Xaa 4 -Xaa 5 where Xaa- L is Asp or Glu, Xaa 2 is Val or Leu, Xaa 3 is Thr or Ser, Xaa 4 is Asp or Glu, and Xaa 5 is Asp or Val (SEQ ID NO: 126);
  • Primer D (M3121): 5 ' -TTYMGNTAYTGYDSNGGNDSNTG (SEQ ID NO: 118) 23 nt which codes for the amino acid sequence, Phe-Arg-Tyr-Cys-Xaa 1 -Gly-Xaa 2 -Cys where Xaa x is Ser or Ala and Xaa 2 is Ser or Ala (SEQ ID NO: 127);
  • Primer F (M3176): 5 ' -GTNDGNGANYTGGGNYTGGGNTT (SEQ ID NO: 120) 23 nt which codes for the amino acid sequence, Val-Xaa 1 -Xaa 2 -Leu-Gly-Leu-Gly-Phe where Xaa ! is Thr, Ser or Ala and Xaa 2 is Glu or Asp (SEQ ID NO: 129) .
  • Primer G (M3125): 5 ' -WCNTCNARRAANGWNAVNTC (SEQ ID NO: 121) 20 nt whose reverse complementary sequence codes for the amino acid sequence, Xaa 1 -Xaa 2 -Xaa 3 -Phe-Leu-Xaa 4 -Xaa 5 where Xaa x is Asp or Glu, Xaa 2 is Val or Leu, Xaa 3 is Thr or Ser, Xaa 4 is Asp or Glu, and Xaa 5 is Asp or Val (SEQ ID NO: 126);
  • Primer I (M3120): 5 ' -CANSHNCCNSHRCARTANCKRAA (SEQ ID NO: 123) 23 nt whose reverse complementary sequence codes for the amino acid sequence,
  • Primer J ( M3118 ) : 5 ' -CANSHNCCNSHRCARTANCKRAANA (SEQ ID NO: 124) 25 nt whose reverse complementary sequence codes for the amino acid sequence, Xaa 1 -Phe-Arg-Tyr-Cys-Xaa 2 -Gly-Xaa 3 -Cys where Xaa x is Ile or Leu, Xaa 2 is Ser or Ala and Xaa 3 is Ser or Ala (SEQ ID NO: 130).
  • the following primers are based upon conserved regions in GDNF and neurturin (SEQ ID NOS: 33-35).
  • Primer 1 GTNWSNGANYTNGGNYTNGGNTA (SEQ ID NO: 42) which encodes the amino acid sequence, Val-Xaa x - Xaa 2 -Leu-Gly-Leu-Gly-Tyr where Xaa is Ser or Thr and Xaa 2 is Glu or Asp (SEQ ID NO: 33);
  • Primer 2 TTYMGNTAYTGYDSNGGNDSNTGYGANKCNGC (SEQ ID NO: 43) which encodes amino acid sequence Phe-Arg- Tyr-Cys-Xaa !
  • Primer 3 reverse GCNGMNTCRCANSHNCCNSHRTANCKRAA (SEQ ID NO: 44) whose reverse complementary sequence encodes amino acid sequence Phe-Arg-Tyr- Cys-Xaa ! -Gly-Xaa 2 -Cys-Xaa 3 -Xaa 4 -Ala where Xaa ! is
  • Xaa 2 is Ala or Ser
  • Xaa 3 is Glu or Asp
  • Xaa 4 is Ser or Ala (SEQ ID NO: 37);
  • Primer 4 reverse TCRTCNTCRWANGCNRYNGGNCKCARCA (SEQ ID NO: 45) whose reverse complementary sequence encodes amino acid sequence Cys-Cys-Arg-Pro-Xaa ! - Ala-Xaa 2 -Xaa 3 -Asp-Xaa 4 where Xaa ! is Ile or Thr or Val, Xaa 2 Try or Phe, Xaa 3 is Glu or Asp and Xaa 4 is Glu or Asp (SEQ ID NO: 38);
  • Primer 5 reverse TCNARRAANSWNAVNTCRTCNTCRWANGC (SEQ ID NO: 46) whose reverse complementary sequence encodes amino acid sequence Ala-Xaa ⁇ Xaa 2 -Asp-Xaa 3 -Xaa 4 -Ser-Phe-Leu-Asp where Xaa x is Tyr or Phe, Xaa 2 Glu or Asp, Xaa 3 is Glu or Asp, and Xaa 4 is Val or Leu (SEQ ID NO: 39);
  • Primer 6 GARRMNBTNHTNTTYMGNTAYTG (SEQ ID NO: 47) which encodes amino acid sequence Glu-Xaa,.-Xaa 2 - Xaa 3 -Phe-Arg-Tyr-Cys where Xaa ! is Glu or Thr, Xaa 2 is Leu or Val and Xaa 3 is Ile or Leu (SEQ ID NO: 40);
  • Xaa ! ⁇ s Glu or Thr Xaa 2 is Leu or Val
  • Xaa 3 is Ile or Leu
  • Xaa 4 is Ser or Ala
  • Xaa 5 is Ser or Ala
  • Xaa 6 is Glu or Asp (SEQ ID N0:41).
  • Genomic DNA or libraries of genomic clones can be used as templates because the neurturin, persephin and GDNF coding sequences for the mature proteins are not interrupted by introns .
  • a degenerate oligonucleotide can be synthesized as a mixture of oligonucleotides containing all of the possible nucleotide sequences which code for the conserved amino acid sequence.
  • an inosine or universal base Loakes et al, Nucleic Acids Res 22:4039-43, 1994
  • the inosine or universal base forms base pairs with each of the four normal DNA bases which are less stabilizing than AT and GC base pairs but which are also less destabilizing than mismatches between the normal bases (i.e. AG, AC, TG, TC ) .
  • a primer above can be end labeled with 32 P using T4 polynucleotide kinase and hybridized to libraries of human genomic clones according to standard procedures.
  • a preferred method for isolating family member genes would be to use various combinations of the degenerate primers above as primers in the polymerase chain reaction using genomic DNA as a template.
  • the various combinations of primers can include sequential PCR reactions utilizing nested primers or the use of a forward primer paired with an oligo dT primer.
  • one of the degenerate primers can be used with a vector primer, a single primer can be used in an inverted PCR assay or PCR can be performed with one degenerate primer and a random primer.
  • primer 2 (SEQ ID NO: 43) can be used with primer 4 (SEQ ID NO: 45) in PCR with 1 ug of human genomic DNA and cycling parameters of 94 °C for 30 sec, 50°C for 30 sec, and 72°C for 60 sec.
  • the above PCR conditions are exemplary only and one skilled in the art will readily appreciate that a range of suitable conditions and primer combinations could be used or optimized such as different temperatures and varying salt concentrations in the buffer medium and the like. It is preferred that DMSO be added to the PCR reaction to a final concentration of 5% inasmuch as this was found to be necessary for amplification of this region of the neurturin gene.
  • the PCR reaction when run on an agarose gel, should contain products in the size range of 100-150 base pairs since a one amino acid gap is introduced in the neurturin sequence and a five amino acid gap is introduced in the persephin sequence when either sequence is aligned with GDNF, and thus family member genes might also contain a slightly variable spacing between the conserved sequences of primers 2 and 4.
  • the PCR products in the range of 100-150 base pairs should contain multiple amplified gene products including GDNF, neurturin and persephin as well as previously unisolated family members. To identify sequences of these products, they can be gel purified and ligated into the Bluescript plasmid (Stratagene), and then transformed into the XLl-blue E.
  • Coli host strain Bacterial colonies containing individual subclones can be picked for isolation and plated on nitrocellulose filters in two replicas. Each of the replicate filters can be screened with an oligonucleotide probe for either unique GDNF or unique neurturin or unique persephin sequence in the amplified region. Subclones not hybridizing to either GDNF or neurturin or persephin can be sequenced and if found to encode previously unisolated family members, the sequence can be used to isolate full length cDNA clones and genomic clones as was done for neurturin ( Example 5 ) .
  • the inventors herein believe that the most preferred way to isolate family member genes may be to apply the above PCR procedure as a screening method to isolate individual family member genomic clones from a library. This is because there is only one exon for the coding region of both mature neurturin and GDNF. If, for example, the above PCR reaction with primers 2 and 4 generates products of the appropriate size using human genomic DNA as template, the same reaction can be performed using, as template, pools of genomic clones in the Pl vector according to methods well known in the art, for example that used for isolating neurturin human genomic clones (Example 5).
  • the resulting product was subcloned into the Bluescript KS plasmid and sequenced. All nucleotide sequencing was performed using fluorescent dye terminator technology per manufacturer ' s instructions on an Applied Biosystems automated sequencer Model #373 (Applied Biosystems, Foster City, CA). Plasmid DNA for sequencing was prepared using the Wizard Miniprep kit ( Promega Corp., Madison, WI ) according to the manufacturer ' s instructions .
  • the sequence of one of the amplified products predicted amino acid sequence data internal to the PCR primers that was different from that of GDNF or neurturin but had more than 20% identity with GDNF and neurturin, whereas the sequences of others we obtained corresponded to GDNF or neurturin, as would be expected.
  • the novel sequence was thought to identify a new member of this family which we named persephin.
  • LGLGYETKEELIFRYC GDNF (rat) (SEQ ID NO: 92)
  • LGLGYTSDETVLFRYC NTN (rat)
  • LGLGYASEEKIIFRYC PSP (rat) (SEQ ID NO: 94)
  • primers containing portions of the unique 22 nt of the amplified fragment above were used in the rapid amplification of cDNA ends (RACE) technique (Frohman, M.A. Methods in Enzymology 218:340-356, 1993) using the Marathon RACE kit (CLONTECH, Palo Alto, CA) per the manufacturer's instructions, except that first strand cDNA synthesis was carried out at 50°C using Superscript II reverse transcriptase (Gibco-BRL). Briefly, a double stranded adaptor oligonucleotide was ligated to the ends of double stranded cDNA synthesized from postnatal day 1 rat brain mRNA. Using nested forward persephin PCR primers,
  • GDNF ACCRPVAFDDDLSFLDD ( aa 60-76) (SEQ ID NO: 98) NTN PCCRPTAYEDEVSFKDV ( aa 61-77) (SEQ ID NO: 99) PSP PCCQPTSYAD-VTFLDD ( aa 57-72) (SEQ ID NO: 100)
  • amino acid numbering uses the first Cys residue as amino acid 1 ) .
  • Restriction fragments (3.4 kb Neo I and a 3.3 kb Bam HI) from this Pl clone containing the persephin gene were identified by hybridization with a 210 nt fragment obtained by PCR using mouse genomic DNA with primers (forward, M2026; SEQ ID NO: 96 and reverse, M3159; 5'- CCACCACAGCCACAAGCTGCGGSTGAGAGCTG, SEQ ID NO: 102) and PCR parameters: 94°C for 30 sec, 55°C for 15 sec and 72°C for 30 sec for 35 cycles.
  • Neo I and Bam HI fragments were sequenced and found to encode a stretch of amino acids corresponding to that present in the rat persephin RACE product, as well as being homologous to the mature regions of both neurturin and GDNF ( Figure 11).
  • An open reading frame extends from the sequence coding for an initiator methionine up to a stop codon at positions 244-246. However, somewhere in this sequence there is an apparent anomaly such that the sequence encoding the RXXR cleavage site (nucleotides at positions 257-268 ) and the sequence corresponding to the mature persephin protein (positions 269-556) are not co- linear with this open reading frame. Instead, a second reading frame encodes the cleavage site and the mature persephin.
  • Rat genomic fragments were amplified by PCR using Klentaq and rat genomic DNA as a template.
  • the forward primer #40266 5 ' -AATCCCCAGGACAGGCAGGGAAT; SEQ ID NO: 137
  • a reverse primer M3156 5'- CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC, SEQ ID NO: 138
  • a region within the mature rat persephin sequence were used with the following parameters (95°C for 15 sec, 55°C for 15 sec, 68°C for 45 sec x 30 cycles).
  • the amplified product was kinased with T4 polynucleotide kinase, the ends were blunted with E. coli DNA polymerase I ( Klenow fragment ) , and cloned into BSKS plasmid.
  • Nucleotide sequencing was performed to establish the sequence of the entire rat persephin gene (SEQ ID NO: 134; Figure 18A). An open reading frame was found to extend from the sequence coding for an initiator methionine up to a stop codon at positions 244-246 as was seen with murine persephin. As was also seen with murine persephin, an anomaly was found to occur between the sequence encoding the initiator methionine and that encoding the cleavage site for the mature rat persephin such that two cogent reading frames exist. Irrespective of this anomaly, mammalian cells were found to express persephin from either the murine or rat full length genomic sequence as illustrated below (see Example 14).
  • rat persephin a Pl clone containing the murine persephin gene was used as a template in a PCR assay. Primers were designed such that the resulting fragment would contain the persephin gene extending from the initiator Methionine to the stop codon.
  • the PCR reaction utilized a forward primer M3175 [5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and reverse primer M3156 [ 5 ' -CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC] .
  • analogous rat plasmid rat genomic DNA was used as a template in a PCR assay.
  • the PCR reaction utilized a forward primer M3175 [5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA]
  • COS monkey cells were transfected with either the rat or murine persephin expression vectors or the non- recombinant vector (pCB6) itself. Forty eight hr later the cells were lysed, the samples were loaded onto a 15% SDS-polyacrylamide gel, and the proteins were separated by electrophoresis. The proteins were then transferred to nitrocellulose by electroblotting . This nitrocellulose membrane was incubated with anti-persephin antibodies (which we raised to mature persephin produced in bacteria from a pET plasmid) to detect the presence of persephin in the lysates.
  • anti-persephin antibodies which we raised to mature persephin produced in bacteria from a pET plasmid
  • the size of the persephin detected was 10-15 kD, consistent with the size predicted for the processed (i.e. mature form of persephin).
  • Conditioned media harvested from these cells also contained mature persephin.
  • RT/PCR analysis was performed using primers corresponding to the initiator Met and the stop codon. We detected two fragments: one corresponding to the predicted size of the persephin gene and the other somewhat smaller, suggesting that RNA splicing had occurred. We confirmed this with a number of other primer pairs. Both the large and small persephin fragments were cloned and sequenced. As expected, the larger fragment corresponded to the persephin gene. The small fragment corresponded to a spliced version of persephin. A small 88 nt intron within the pro-domain (situated 154 nt downstream of the start codon) had been spliced out. After this splicing event, the "frameshift" was no longer present (i.e. the initiator Met and the mature region are in-frame) in either rat or mouse persephin (see Figures 17B and 18B).
  • Example 13 This example illustrates the preparation of a bacterial expression vector for murine persephin and its introduction into an E. Coli for expression of recombinant mature persephin.
  • the persephin polynucleotide encoding the mature murine persephin protein which begins 5 amino acids upstream of the first framework Cys residue (SEQ ID NO: 1
  • GGACTATCATATGGCCCACCACCACCACCACCACCACCACCACCACCACCACGACGACGACGACAAGGC CTTGGCTGGTTCATGCCGA SEQ ID NO: 139
  • a reverse primer M3156 5'- CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC, SEQ ID NO: 138
  • the PCR reaction conditions were 95 °C for 15 sec, 55 °C for 15 sec, 68 °C for 60 sec x 25 cycles.
  • This PCR product was subcloned into the EcoRV site of BSKS plasmid and sequenced to verify that it contained no mutations.
  • the persephin sequence was then excised from this vector using Nde I and Bgl II and cloned into the Nde I (5 ' ) and Bgl II (3') sites of the bacterial expression vector pET30a (Novagen, Madison, WI ) .
  • This expression vector would, therefore, produce the mature form of the persephin protein possessing an amino terminal tag consisting of 8 histidine residues followed directly by an enterokinase site.
  • the plasmid was introduced into E.coli strain BL21 (DE3).
  • bacteria harboring this plasmid were grown for 16 hr, harvested, and lysed using 6M guanidine-HCl, 0.1 M NaH 2 P0 4 , 0.01 M Tris at pH 8.0, and recombinant persephin protein was purified from these lysates via chromatography over a Ni-NTA resin (Qiagen). The protein was eluted using 3 column volumes of Buffer E containing 8 M urea, 0.1 M NaH 2 P0 4 , 0.01 M Tris, at pH 4.5.
  • the persephin was then renatured by dialysis in renaturation buffer consisting of 0.1 M NaH 2 P0 4 , 0.01 M Tris at pH 8.3, 0.15 M NaCl, 3 mM cysteine, 0.02% Tween- 20, 10% glycerol and containing decreasing concentrations of urea beginning with 4 M for 16 hr, followed by 2 M for 16 hr, IM for 72 hr, and 0.5 M for 16 hr.
  • the persephin concentration was then determined using a Dot Metric assay (Geno Technology, St. Louis, MO) and stored at 4°C. This bacterially produced recombinant persephin was used as an immunogen in rabbits to produce antibodies to mature persephin.
  • Example 14 This example illustrates the preparation of mammalian expression vectors containing the murine or rat persephin genes and their incorporation into mammalian cell lines for the production of mature persephin.
  • a Pl clone containing the murine persephin gene was used as a template in a PCR assay. Primers were designed such that the resulting polynucleotide would contain the persephin gene extending from the initiator Methionine codon to the stop codon 3 ' to the mature persephin coding sequence (SEQ ID NO: 131).
  • the PCR reaction utilized a forward primer M3175 (5'- TGCTGTCACCATGGCTGCAGGAAGACTTCGGA, SEQ ID NO: 140) and reverse primer M3156 (5'- CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC, SEQ ID NO: 138).
  • rat genomic DNA was used as a template in a PCR assay.
  • the PCR reaction utilized a forward primer M3175 (5 ' -
  • Both PCR reactions were carried out using Klentaq and the following parameters: 95°C for 15 sec, 55°C for 15 sec, 68 "C for 45 sec x 25 cycles.
  • the amplified products were kinased with T4 polynucleotide kinase, the ends were blunted with E. coli DNA polymerase I (Klenow fragment), and cloned into BSKS plasmid. Nucleotide sequencing was performed to verify that the correct clone was obtained.
  • the rat and murine persephin polynucleotides were excised using Sma I and Hind III and each cloned into a Asp718 (blunted) and Hind III sites of the mammalian expression vector pCB6.
  • COS monkey cells were transfected with either the rat or murine persephin expression vectors ( 16 ⁇ g per 5 x 10 5 cells) or the non-recombinant vector ( pCB6 ) itself using the calcium phosphate precipitation method ( Chen and Okayama, Mol Cell Biol 7:2745-2752, 1987 which is incorporated by reference ) . Forty eight hr later the cells were lysed in IP buffer containing 50 mM Tris at pH 7.5, 300 mM NaCl, 1% Triton X-100, 1% deoxycholate, 10 mM EDTA, 0.1% SDS, 5 ⁇ g/ml leupeptin, 7 ⁇ g/ml pepstatin, and 250 ⁇ M PMSF.
  • IP buffer containing 50 mM Tris at pH 7.5, 300 mM NaCl, 1% Triton X-100, 1% deoxycholate, 10 mM EDTA, 0.1% SDS, 5 ⁇ g/ml le
  • the samples were loaded onto a 15% SDS- polyacrylamide gel and the proteins were separated by electrophoresis. The proteins were then transferred to nitrocellulose by electroblotting. This nitrocellulose membrane was incubated with anti-persephin antibodies to detect the presence of persephin in the lysates.
  • the size of the persephin detected was approximately 14 kD which is consistent with the size predicted for the processed, i.e. mature form of persephin. This demonstrates that both the murine and rat persephin genes are capable of directing the synthesis of a properly processed persephin molecule.
  • Example 15 The following example illustrates the isolation and identification of human persephin.
  • degenerate PCR primers were designed based on the human Neurturin and GDNF sequences and used to amplify human genomic DNA. The following primers were used (SEQ ID N0S:225-228):
  • DhNeurturinl (DN1) GTSASYGASYTGGGYCTGGGCTAY REF-.B-46Z
  • DhNeurturin2 ( DN2 ) TTYMGSTACTGCRSMGGCKCYTGC REF:B-46X
  • DhNeurturin3r ( DN3 ) RWAGGCSRTSGGKCKGCARCAKGS REF:B-46V
  • DhNeurturin4r ( DN4 ) MKCRTCYARRAASGACASSTC REF:B-46W
  • Human genomic DNA ( Clontech 6550-1 O.l ⁇ g/ ⁇ l) was amplified with all 4 possible primer combinations (DN1- DN3r, DNl-DN4r, DN2-DN3r, DN2-DN4r).
  • Reaction mixtures contained 5 ⁇ l of lOx Klentaq buffer, 0.5 ⁇ l dNTP (20mM); 1 ⁇ l human genomic DNA, 0.6 ⁇ l Klentaq (Clontech) and 1.5 ⁇ l of each primers (0.1 OD/ ⁇ l ) in a total volume of 50 ⁇ l.
  • the DNA was amplified by touchdown PCR on Perkin Elmer Gene AMP 9600 in the following conditions: initial denaturation at 98 °C for 2', then 5 cycles [98°C 30", 72°C 1.5'], 5 cycles [98°C 30", 70°C 1.5'] and 25 cycles [98°C 30', 68°C 1.5'] followed by a last extension step at 68°C for 5' .
  • PCR products of approximately 130 to 200 bp were identified after electrophoresis on agarose gel, purified and cloned into pCR 2.1 vector using In Vitrogen TA cloning kit (Cat # K2000-01 ) .
  • Clones containing a 130- 200bp insert (after EcoRI digestion) were sequenced and one of them (clone A3) obtained with the primer pair DN1- DN3r had a sequence homologous to mouse persephin and corresponded to human persephin.
  • the partial sequence of the human persephin genomic DNA in clone A3 is shown below (SEQ ID NO: 229): CGGCTTGTGACCGAGCTGGGCCTGGGCTACGCCTCAGAGGAGAAGGTCATCTTCCGC TACTGCCGGCAGCTGCCCCCGTGGTGCCCGCACCCAGCATGGCCTGGCGCTGGCC CGGCTGCAGGGCCAGGGCCGAGCCCACGGCGGGCCCTGCTGCCGCCCCATGGCC
  • cDNA libraries were screened by PCR using exact match primers designed based on the genomic DNA sequence described above.
  • Two sets of human persephin specific primers were prepared (SEQ ID NOS: 230-233 ) , hPSP-5'.l GAGGAGAAGGTCATCTTCCG REF:B-95K hPSP-3'.l GCCGTGGGCTCGGCCCTGGC REF:B-95L and hPSP-5'.3 AGAGGAGAAGGTCATCTTCCGCTA REF:C-62Y hPSP-3'.4 CTCGGCCCTGGCCCTGCAGC REF:C-62X
  • PCR products of the expected size (108 bp for hPSP-5'1 with hPSP-3 ' .1 and 101 bp for hPSP-5'.3 with hPSP-3'.4) were detected in fetal lung, fetal liver, fetal kidney, small intestine, retina, cerebellum and hT+13 Lymphoblast.
  • pRK5 libraries from human tissues were enriched for persephin cDNA clones by extension of single stranded DNA from plasmid libraries grown in a dut " /ung " -host using either of the following primers (SEQ ID NOS: 233-234 ) :
  • hPSP-3'.2 TGCAGCCGGGCCAGCGCCAG REF:D-68T hPSP-3'.4 CTCGGCCCTGGCCCTGCAGC REF:C-62X
  • Human persephin clones were isolated from fetal lung, fetal kidney and fetal liver libraries. All such persephin clones isolated belong to two categories: unspliced (10 clones) or chimeric (6 clones). Unspliced clones were ⁇ 900bp long and contain a region encoding a fragment corresponding to human persephin. However there is no initiation methionine and signal peptide present in that reading frame (Frame +2). A potential upstream initiation codon (ATG) is present in another reading frame (+1) and is followed by a hydrophobic sequence corresponding to a potential signal peptide.
  • a potential upstream initiation codon A potential upstream initiation codon (ATG) is present in another reading frame (+1) and is followed by a hydrophobic sequence corresponding to a potential signal peptide.
  • cDNAs are incompletely spliced and that an intron remains between the exons encoding the signal peptide and the persephin protein.
  • Consensus splice donor and acceptor sequences can actually be identified at position 340 and 425, respectively. Splicing of an intron located between these positions would lead to a cDNA where the persephin coding sequence is "in frame" with the initiation methionine.
  • aberrant chimeric clones were identified resulting from the joining of a cDNA encoding the predicted exon 2 of persephin exactly at the splice acceptor site present at position 425. The corresponding transcript was probably generated by aberrant splicing but confirms the presence of a splice acceptor site at position 425.
  • the filters were prehybridized for 2h then hybridized overnight at 42 °C in 50% formamide, 5xSSC, lOxDenhardt ' s, 0.05M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, 50 ⁇ g/ml of sonicated salmon sperm DNA. Filters were then rinsed in 2xSSC and washed once in O.lxSSC, 0.1% SDS at 60°C. Filters were exposed overnight to Kodak X Ray films. Four positive clones (Cere 1.1, 1.2, 6.1, 6.2) were picked and plaque purified.
  • the plasmid contained within the lambda ZAP phage arms was rescued as described per manufacturer's instructions using Ex Assist helper phage. Sequencing of the four clones indicated that these clones were siblings and contained 2 silent mutations when compared to the human persephin clones isolated from the pRK5 library described above. These silent mutations occur at positions 30 (T ⁇ C) and 360 (T ⁇ C) of the sequence shown in Figure 24. Direct sequencing of the human persephin gene revealed that these silent mutations are actual allelic variations in the gene.
  • constructs were generated where the sequence encoding a Flag tag was inserted just before the stop codon present at position 685 ( frame + 1 ) or at position 746 ( frame +2 ) starting from an ATG codon present at position 46 or 193. All four possible constructs were generated by PCR using the following primers (SEQ ID NOS : 235-238 ) :
  • the Cere 1.2 clone was used as template and amplified with Pfu polymerase on a Stratagene Robocyler gradient cycler 96.
  • PCR conditions were 95°C for 2', 30 cycles of [95°C 30", 1' at 52, 56, 60 or 63°C, 72°C for 2 min] followed by a last extension of 5 min at 72°C.
  • Forward primers have a Bam HI site and the reverse primers have Hind III restriction site.
  • the PCR products digested with Bam HI and Hind III and were subcloned into these sites in pRK5.
  • DNA from each of the construct was transfected overnight into 293 cells using CaP04 method. Serum containing media was conditioned for 24h then harvested. Cells were also harvested and divided in two; 1/4 of each plate for RT-PCR and the remaining 3/4 of each plate for immunoprecipitation.
  • the cell pellet was lysed in 1 ml of lysis buffer (50 mM Tris pH 8.0, 150 M NaCl, 1 mM EDTA, 1% NP40, Aprotinin, Leupeptin, PMSF, 1 mM NaF and 1 mM Sodium Vanadate ) for 20 min at 4°C.
  • the extract was spun for 10 min at 10K rpm and then the supernatant was transferred to a new tube and precleared with 20 ⁇ l Protein A Sepharose for lh. From here, 1 ml of the conditioned media was processed in parallel.
  • the protein A sepharose was spun down and 1 ⁇ l of anti-Flag antibody (3.6 ⁇ g ) was added to each tube. After overnight incubation at 4°C, 30 ⁇ l of Protein G sepharose were added and the tubes incubated at 4°C for 1 hour. The protein G beads were then spun down for 1 min, washed 3 times with lysis buffer, resuspended in 20 ⁇ l of Laemli buffer in the presence of ⁇ -mercapto-ethanol . Samples were denatured for 5 min at 100 °C then loaded on a 16% polyacrylamide gel.
  • Proteins were then transferred to nitrocellulose and analyzed by Western blot using the same anti-Flag antibody overnight at l ⁇ g/ml in blocking buffer (PBS + 0.5% tween + 5% nonfat dry milk +3% Goat serum). Following this an anti-mouse HRP.ECL was used for the detection and the membrane was exposed for 90 sec to X-Ray film. A specific band of 16 kDa was detected in the cell pellet of cells transfected with the construct starting at ATG 193 of frame +1 and with the flag inserted in frame +2 and a specific band of approximately 10 kDa could be detected in the corresponding supernatant . No Flag tagged protein could be detected in any other transfection or in mock transfected cells.
  • RNAzol B Tel-Test Inc.
  • RNAzol B Tel-Test Inc.
  • RNAasy column Promega
  • First strand cDNA was synthesized on 4 ⁇ l RNA using superscript RT (GIBCO-BRL) for lh at 37°C then 5' at 95° to inactivate.
  • PCR conditions were 98°C for 1.5', 28 cycles of [98°C for 30", anneal 1' between 60 °C and 76 °C, 72 °C for 1.5'] followed by a last extension of 5 min at 72 °C.
  • PCR product on agarose gel indicates that PCR using the pRK5.hPSP-FLAG.2 plasmid as template gave the expected product of about 570 bp while the RT PCR product, using RNA from cells transfected with this construct as template, was smaller than 500 bp.
  • PCR product from the latter reaction was subcloned into the pCR 2.1 vector using In Vitrogen TA cloning kit (cat #K2000-01 ) and sequenced. Sequence analysis revealed that the predicted 84 bp intron has been spliced out of the transcript.
  • the human persephin cDNA has a 471 bp open reading frame encoding a 156 amino acid long protein (predicted Mr 16.6kDA). Cleavage of the 23 amino acid long predicted signal peptide will lead to a 133 amino acid pro-persephin molecule (Mr 14.2 kDa); proteolytic cleavage of the pro-persephin at a RXXR consensus sequence should yield a 96 amino acid mature protein with a molecular weight of 10.3 kDa. This predicted size corresponds to the size of the Flag-tagged protein immunoprecipitated from the conditioned media of transfected 293 cells.
  • amino terminal sequencing of Flag-tagged persephin purified from conditioned media of 293 transfected cells confirmed that the first residue of the mature form is Ala 61. Alignment between human persephin and human Neurturin indicates 38% similarity between the two molecules ( 50% for the mature region) and that human persephin is 30% similar to human GDNF (40% in the mature region).
  • Example 16 This example illustrates the preparation of chimeric or hybrid polypeptide molecules that contain portions derived from persephin (PSP) and portions derived from neurturin ( NTN ) .
  • PSP persephin
  • NTN neurturin
  • each of persephin and neurturin is predicted to have a very similar overall structure, yet while neurturin promotes the survival of sympathetic neurons, the closely related persephin does not .
  • Two chimeras were produced by essentially replacing portions of persephin with neurturin, with the crossover point located between the two adjacent, highly conserved third and fourth cysteine residues.
  • the first chimera named PSP/NTN (SEQ ID NO: 141, Figure 20), contains the first 63 residues of mature murine persephin combined with residues 68 through 100 of mature murine neurturin (using E. coli preferred codons).
  • two PCR reactions were performed: 1) using the forward primer M2012 (5'- TAATACGACTCACTATAGGGGAA, SEQ ID NO: 142) and reverse primer M2188 ( 5 ' -
  • the second chimera encodes the converse molecule. It contains the first 67 residues of mature murine neurturin (using E.coli preferred codons) combined with residues 64 to 96 of mature murine persephin.
  • the purified proteins were assayed for their ability to promote survival in the SCG sympathetic neuron assay.
  • the NTN/PSP protein did not promote survival
  • the PSP/NTN protein promoted the survival of sympathetic neurons similar to that observed for neurturin itself.
  • This example illustrates the neuronal survival promoting activity of persephin in mesencephalic cells.
  • the profile of survival promoting activity of persephin is different from that of neurturin and GDNF. In contrast to the survival promoting activity produced by neurturin and GDNF in sympathetic and sensory neurons, persephin showed no survival promoting activity in these tissues.
  • the neuronal survival promoting activity of persephin in mesencephalic cells Timed-pregnant Sprague-Dawley rats were purchased from Harlan Sprague-Dawley. The mesencephalon was taken from rats measuring 1.2 to 1.4 cm in length and time dated to be embryonic day 14. The cranium was removed and the entire mesencephalon was placed in cold L15.
  • the pooled mesencephalic tissue was resuspended in a serum- free medium consisting of DME/Hams F12 (#11330-032, Life Technologies) 1 mg/ml BSA, Fraction V (A-6793, Sigma Chemical Co.,), 5 ⁇ M Insulin (1-5500, Sigma), 10 nM progesterone (P0130, Sigma), 100 ⁇ M putrescine, (p7505, Sigma), 30 nM Selenium (S07150, Pflatz & Bauer), 10 ng/ml rat transferrin (012-000-050, Jackson Chrompure ) , 100 U/ml penicillin, and 100 U/ml of streptomycin.
  • the pooled mesencephalic tissues were triturated approximately 80 times using a bent-tip pipette and the cells were plated in a 24-well dish (CoStar) at a density of 15,000 cells in a 100- ⁇ l drop.
  • the dishes were coated with 125 ng/ml poly-d-lysine (p-7280, Sigma) and 25 ng/ml laminin (#40232, Collaborative Biomedical Products). These dissociated cells were allowed to attach for 2 hours at 37 °C in 5% C0 2 and then fed with another 500 ⁇ l of the above serum-free medium with or without approximately 100 ng/ml of recombinant Persephin. These cells were photographed after 3 days of culture.
  • FIG. 22 shows the mean cell counts for untreated and treated cells.
  • Persephin ( PSP ) , neurturin ( NTN ) and GDNF promoted survival of mesencephalic neuronal cells to a comparable extent.
  • Example 18 This example illustrates the expression of persephin in various tissues.
  • a survey of persephin expression was performed in adult mouse tissues using semi-quantitative RT/PCR (see Example 9).
  • Poly A RNA was isolated from brain, cerebellum, kidney, lung, heart, ovary, sciatic nerve, dorsal root ganglia, blood and spleen. This was then reverse transcribed to produce cDNA (see Kotzbauer et al . Nature 384:467-470, 1996 which is incorporated by reference).
  • PCR primers used were as follows: forward primer: 5 ' -CCTCGGAGGAGAAGGTCATCTTC (SEQ ID NO: 149) and reverse primer: 5 ' TCATCAAGGAAGGTCACATCAGCATA (SEQ ID NO: 101).
  • PCR was done for 26 cycles with an annealing temperature of 60°C.
  • tissue control shown in figure 22 is labeled "Kidney no RT" ) . All the samples were found to be without genomic DNA contamination.
  • a band of the correct size 160 bp
  • a persephin band was also seen in brain.
  • the distribution of expression of persephin in various mouse tissues differs from that of neurturin in rat ( Example 8 ) .
  • MILBRANDT MILBRANDT, JEFFREY D KOTZBAUER, PAUL T LAMPE, PATRICIA A KLEIN, ROBERT DESAUVAGE, FRED
  • MOLECULE TYPE peptide
  • SEQUENCE DESCRIPTION SEQ ID NO : 6 SEQUENCE DESCRIPTION SEQ ID NO : 6 :
  • MOLECULE TYPE protein
  • xi SEQUENCE DESCRIPTION- SEQ ID NO : 8 •
  • GACGTGCACA GCCGCTACCA CACGCTGCAA GAGCTGTCGG CGCGGGAGTG CGCGTGCGTG 300
  • GTCCCGCACC CTGTGCGGTG GCCTCCTCCG GCACGGGGTC CCCGGGTCGC CTCCGGTCCC 240
  • MOLECULE TYPE peptide (Xl) SEQUENCE DESCRIPTION SEQ ID NO: 15.
  • CTACGACGCC CTCCACGCAC CCTGGACGCC CGCATCGCCC GCCTGGCCCA GTATCGCGCT 120

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Polymers With Sulfur, Phosphorus Or Metals In The Main Chain (AREA)
  • Macromolecular Compounds Obtained By Forming Nitrogen-Containing Linkages In General (AREA)
PCT/US1998/019163 1997-09-16 1998-09-15 Persephin and related growth factors Ceased WO1999014235A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP98948217A EP1009768B1 (en) 1997-09-16 1998-09-15 Human persephin
NZ502090A NZ502090A (en) 1997-09-16 1998-09-15 A growth factor persephin related to the GDNF/neurturin family of growth factors useful in treating conditions related to persephin deficiency
CA002296045A CA2296045A1 (en) 1997-09-16 1998-09-15 Persephin and related growth factors
AU94838/98A AU758011B2 (en) 1997-09-16 1998-09-15 Persephin and related growth factors
IL13383498A IL133834A0 (en) 1997-09-16 1998-09-15 Persephin and related growth factors
JP2000511783A JP2001516764A (ja) 1997-09-16 1998-09-15 ペルセフィン及び関連成長因子
DE69833211T DE69833211T2 (de) 1997-09-16 1998-09-15 Humanes persephin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/931,858 US6222022B1 (en) 1996-03-14 1997-09-16 Persephin and related growth factors
US08/931,858 1997-09-16

Publications (1)

Publication Number Publication Date
WO1999014235A1 true WO1999014235A1 (en) 1999-03-25

Family

ID=25461462

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/019163 Ceased WO1999014235A1 (en) 1997-09-16 1998-09-15 Persephin and related growth factors

Country Status (12)

Country Link
US (1) US6222022B1 (https=)
EP (1) EP1009768B1 (https=)
JP (1) JP2001516764A (https=)
AT (1) ATE315581T1 (https=)
AU (1) AU758011B2 (https=)
CA (1) CA2296045A1 (https=)
DE (1) DE69833211T2 (https=)
ES (1) ES2259458T3 (https=)
IL (1) IL133834A0 (https=)
NZ (1) NZ502090A (https=)
PT (1) PT1009768E (https=)
WO (1) WO1999014235A1 (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000006731A3 (en) * 1998-07-31 2000-08-03 Univ Washington Persephin arf, a protein encoded by unspliced persephin mrna
WO2001002557A1 (en) * 1999-06-29 2001-01-11 Janssen Pharmaceutica N.V. Neurotrophic factor receptor
WO2001019851A3 (en) * 1999-09-16 2001-09-20 Neurotrophic Bioscience Inc Opaminergic neuronal survival-promoting factors and uses thereof
WO2001085981A3 (en) * 2000-05-05 2002-03-14 Res Foundation Of City Univers Methods for stimulating nervous system regeneration and repair by regulating arginase i and polyamine synthesis
EP1463530A4 (en) * 2001-12-19 2006-09-06 Lijun Wang ADENO-ASSOCIATED VIRUS-RELATED DELIVERY OF GDNF TO SKELETAL MUSCLES
EP2180057A1 (en) 2000-10-06 2010-04-28 Oxford Biomedica (UK) Limited Vector system
EP2269628A2 (en) 2002-05-29 2011-01-05 DeveloGen Aktiengesellschaft Pancreas-specific proteins

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6716600B1 (en) * 1996-03-14 2004-04-06 Washington University Persephin and related growth factors
AUPQ974900A0 (en) * 2000-08-29 2000-09-21 Macquarie Research Limited Degenerate oligonucleotide gene-shuffling
US6376640B1 (en) * 2001-01-12 2002-04-23 General Electric Company Melt polycarbonate catalyst systems
US20060239966A1 (en) * 2003-10-20 2006-10-26 Tornoee Jens In vivo gene therapy of parkinson's disease

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993006116A1 (en) * 1991-09-20 1993-04-01 Syntex-Synergen Neuroscience Joint Venture Glial derived neurotrophic factor
WO1995017203A1 (en) * 1993-12-22 1995-06-29 The University Of Medicine And Dentistry Of New Jersey Novel nucleic acid sequences isolated from glial cells

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5141856A (en) 1989-01-05 1992-08-25 Synergen, Inc. Expression of purified ciliary neurotrophic factor
US5011914A (en) 1989-01-05 1991-04-30 Collins Franklin D Purified ciliary neurotrophic factor
US5260417A (en) 1989-04-03 1993-11-09 Genetics Institute, Inc. Megakaryocyte growth promoting activity protein
US5235043A (en) 1990-04-06 1993-08-10 Synergen, Inc. Production of biologically active, recombinant members of the ngf/bdnf family of neurotrophic proteins
WO1995006662A1 (en) 1993-09-01 1995-03-09 Start Technology Partnership Neuron regulatory factor for promoting neuron survival
US5739307A (en) 1995-08-28 1998-04-14 Washington University Polynucleotide encoding neurturin neurotrophic factor
NZ329482A (en) * 1996-03-14 2000-05-26 Univ Washington A growth factor persephin related to the GDNF/neurturin family of growth factors Methods of treating conditions related to persephin deficiency detecting gene alterations and identifying other members of the family are included
WO2000006731A2 (en) * 1998-07-31 2000-02-10 Washington University PERSEPHIN ARF, A PROTEIN ENCODED BY UNSPLICED PERSEPHIN mRNA

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993006116A1 (en) * 1991-09-20 1993-04-01 Syntex-Synergen Neuroscience Joint Venture Glial derived neurotrophic factor
WO1995017203A1 (en) * 1993-12-22 1995-06-29 The University Of Medicine And Dentistry Of New Jersey Novel nucleic acid sequences isolated from glial cells

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KOTZBAUER P T, ET AL.: "NEURTURIN, A RELATIVE OF GLIAL-CELL-LINE-DERIVED NEUROTROPHIC FACTOR", NATURE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 384, no. 6608, 5 December 1996 (1996-12-05), United Kingdom, pages 467 - 470, XP002915839, ISSN: 0028-0836, DOI: 10.1038/384467a0 *
SPRINGER J E, ET AL.: "CDNA SEQUENCE AND DIFFERENTIAL MRNA REGULATION OF TWO FORMS OF GLIAL CELL LINE-DERIVED NEUROTROPHIC FACTOR IN SCHWANN CELLS AND RAT SKELETAL MUSCLE", EXPERIMENTAL NEUROLOGY, ACADEMIC PRESS, NEW YORK, NY, US, vol. 131, no. 01, 1 January 1995 (1995-01-01), US, pages 47 - 52, XP002915838, ISSN: 0014-4886, DOI: 10.1016/0014-4886(95)90006-3 *
TRUPP M., ET AL.: "PERIPHERAL EXPRESSION AND BIOLOGICAL ACTIVITIES OF GDNF, A NEW NEUROTROPHIC FACTOR FOR AVIAN AND MAMMALIAN PERIPHERAL NEURONS.", THE JOURNAL OF CELL BIOLOGY : JCB, THE ROCKEFELLER UNIVERSITY PRESS, US, vol. 130., no. 01., 1 July 1995 (1995-07-01), US, pages 137 - 148., XP002915840, ISSN: 0021-9525, DOI: 10.1083/jcb.130.1.137 *
WATABE K., ET AL.: "SPONTANEOUSLY IMMORTALIZED ADULT MOUSE SCHWANN CELLS SECRETE AUTOCRINE AND PARACRINE GROWTH-PROMOTING ACTIVITIES.", JOURNAL OF NEUROSCIENCE RESEARCH., WILEY-LISS., US, vol. 41., no. 02., 1 June 1995 (1995-06-01), US, pages 279 - 290., XP002915837, ISSN: 0360-4012, DOI: 10.1002/jnr.490410215 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000006731A3 (en) * 1998-07-31 2000-08-03 Univ Washington Persephin arf, a protein encoded by unspliced persephin mrna
WO2001002557A1 (en) * 1999-06-29 2001-01-11 Janssen Pharmaceutica N.V. Neurotrophic factor receptor
US7022818B1 (en) 1999-06-29 2006-04-04 Janssen Pharmaceutica N.V. Rat neurotrophic factor receptor, GFRα-4
US7476720B2 (en) 1999-06-29 2009-01-13 Janssen Pharmaceutica N.V. Rat neurotrophic factor receptor, GFR α-4
WO2001019851A3 (en) * 1999-09-16 2001-09-20 Neurotrophic Bioscience Inc Opaminergic neuronal survival-promoting factors and uses thereof
WO2001085981A3 (en) * 2000-05-05 2002-03-14 Res Foundation Of City Univers Methods for stimulating nervous system regeneration and repair by regulating arginase i and polyamine synthesis
US7741310B2 (en) 2000-05-05 2010-06-22 Research Foundation Of The City University Of New York Methods for stimulating nervous system regeneration and repair by regulating arginase I and polyamine synthesis
US8673594B2 (en) 2000-05-05 2014-03-18 Research Foundation Of City University Of New York Methods for stimulating nervous system regeneration and repair by regulating arginase I and polyamine synthesis
EP2180057A1 (en) 2000-10-06 2010-04-28 Oxford Biomedica (UK) Limited Vector system
EP1463530A4 (en) * 2001-12-19 2006-09-06 Lijun Wang ADENO-ASSOCIATED VIRUS-RELATED DELIVERY OF GDNF TO SKELETAL MUSCLES
EP2269628A2 (en) 2002-05-29 2011-01-05 DeveloGen Aktiengesellschaft Pancreas-specific proteins
EP2275118A2 (en) 2002-05-29 2011-01-19 DeveloGen Aktiengesellschaft Pancreas-specific proteins

Also Published As

Publication number Publication date
AU758011B2 (en) 2003-03-13
US6222022B1 (en) 2001-04-24
CA2296045A1 (en) 1999-03-25
EP1009768B1 (en) 2006-01-11
PT1009768E (pt) 2006-06-30
EP1009768A1 (en) 2000-06-21
ATE315581T1 (de) 2006-02-15
NZ502090A (en) 2002-10-25
DE69833211T2 (de) 2006-09-21
IL133834A0 (en) 2001-04-30
JP2001516764A (ja) 2001-10-02
AU9483898A (en) 1999-04-05
EP1009768A4 (en) 2002-06-12
DE69833211D1 (de) 2006-04-06
ES2259458T3 (es) 2006-10-01

Similar Documents

Publication Publication Date Title
AU714107B2 (en) Neurturin and related growth factors
US6284540B1 (en) Artemin, a novel neurotrophic factor
AU716846B2 (en) Persephin and related growth factors
US6222022B1 (en) Persephin and related growth factors
US6743628B1 (en) Method of cell culture using neurturin
US6716600B1 (en) Persephin and related growth factors
MXPA00002779A (en) Persephin and related growth factors

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 133834

Country of ref document: IL

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 502090

Country of ref document: NZ

Ref document number: 1998948217

Country of ref document: EP

Ref document number: 94838/98

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2296045

Country of ref document: CA

Kind code of ref document: A

Country of ref document: CA

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

ENP Entry into the national phase

Ref document number: 2000 511783

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: PA/a/2000/002779

Country of ref document: MX

WWP Wipo information: published in national office

Ref document number: 1998948217

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 94838/98

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 1998948217

Country of ref document: EP