MXPA00002779A - Persephin and related growth factors - Google Patents

Abstract

A novel growth factor, persephin, which belongs to the GDNF/neurturin family of growth factors, is disclosed. The human, mouse and rat amino acid sequences have been identified. Human, mouse and rat persephin genomic DNA sequences have been cloned and sequenced and the respective cDNA sequences identified. In addition, methods for treating degenerative conditions using persephin, methods for detecting persephin gene alterations and methods for detecting and monitoring patient levels of persephin are provided. Methods for identifying additional members of the persephin-neurturin-GDNF family of growth factors are also provided.

Description

PERSEFINA AND RELATED GROWTH FACTORS Reference to government concession This invention was made with government support, under concession numbers NS24679 and CA53524. The government has certain rights in this invention.

Related Requests This application is a partial continuation of the application Serial No. 08/881, 172, filed on June 23, 1997, which is a partial continuation of the application Serial No. 08 / 615,944, filed on March 14 from 1996, and a partial continuation of application PCT / US97 / 03461, filed on March 14, 1997.

BACKGROUND OF THE INVENTION FIELD OF THE INVENTION This application relates generally to trophic or growth factors and, more particularly, to novel growth factors of the neurturin-GDNF family of growth factors DESCRIPTION OF THE PREVIOUS TECHNIQUE The development and maintenance of tissues in complex organisms requires precise control over the proliferation, differentiation, survival and function of the cells. A major mechanism, by which these processes are controlled, is by means of the actions of the polypeptides known as "growth factors". These structurally diverse molecules act through specific receptors on the surface of the cell, to produce these actions. The growth factors, called "neurotrophic factors" promote the differentiation, growth and survival of neurons and reside in the nervous system or in rib tissue. Nerval growth factor (FCN) was the first neurotrophic factor to be identified and characterized (Levi-Montalcini and co-authors, J. Exp. Zool., 116: 321, 1951, which is incorporated herein by this reference). There is FCN as a non-covalently linked homodimer that promotes the survival and growth of cholinergic neurons of the antecerebra, sympathetic, neural, sensory derived from crest and basal. In sympathetic neurons, this substance produces the eruption or emergence of nurita in vitro and increased axonal and dendritic growth in vivo (See Levi-Montalcini and Booker, Proc. Nat'l Acad. Sci., 46: 384-391, 1960; Johnson and co-authors, Science 210: 916-918, 1980; Crowley and co-authors, Cell, 76: 1001-12, 1994, which are incorporated herein by this reference). The FCN has effects on cognitive and neuronal plasticity, and can promote the survival of neurons that have suffered damage due to a variety of mechanical, chemical, viral and immunological aggressions (Snider and Johnson, Ann Neurol., 26: 489-506 , 1989; Hefti, J. Neurobiol., 25: 1418-35, 1994, which are incorporated herein by this reference). It is also known that FCN interacts extensively with the endocrine system and in immunological and inflammatory processes (summarized in Scully and Otten, Cell Biol. Int., 19: 459-469, 1995; Otten and Gadient, Int. J. Dev. Neurosci. ., 13: 147-151, 1995, which are incorporated herein by this reference). For example, FCN promotes the survival of mastoid cells. (Horigome and co-authors, J. Biol. Chem., 269: 2695-2707, 1994 which is incorporated herein by this reference). In recent years it has become clear that growth factors are divided into classes, that is, families or superfamilies, based on the similarities that exist in their amino acid sequences. These families include, for example, the family of the fibroblast growth factor, the neurotrophin family and the transforming growth factor beta family (TGF-β). As an example of the sequence similarities of family members, members of the TGF-ß family have seven canonical frame cysteine residues, which identify the members of this superfamily. The FCN is the prototype of one of these families of growth factors. It was shown that the brain-derived neurotrophic factor (BDNF), the second member of this family to be discovered, was related to the FCN by virtue of retaining the six cysteines that form the three internal disulfides of the FCN monomer (Barde, Prog. Growth Factor Res., 2: 237-248, 1990 and Liebrock and co-authors, Nature 341: 149-152, 1989, which are incorporated herein by this reference). Using the information provided by BDNF of the highly conserved two-factor portions, several groups quickly found other members (NT-3, NT-4/5) of this neurotrophin family, (Klein, FASEB J., 8: 738- 44, 1994, which is incorporated herein by this reference). Recently, neurotrophic factors structurally unrelated to NFC have been identified. These include factors originally isolated based on a "neurotrophic action", such as ciliary neurotrophic factor (CNTF) (Lin and coauthors, Science 246: 1023-5, 1989 which is incorporated herein by this reference), along with others originally isolated as a result of non-neuronal activities (eg, fibroblast growth factors (Cheng and Mattson, Neuron, 1: 1031-41, 1991, which is incorporated herein by this reference), IGF-I (Kanje and co-authors, Brain Res ., 486: 396-398, 1989 which is incorporated herein by this reference); the inhibitory factor of leukemia (Kotzbauer and co-authors, Neuron, 12: 763-773, 1994, which is incorporated herein by this reference). Glial-derived neurotrophic factor (GDNF) is one of these neurotrophic factors, structurally unrelated to NGF. Thus, GDNF was a unique factor that, until now, was not known to be a member of any subfamily of factors. The discovery, purification and cloning of GDNF were the result of a search for crucial factors for the survival of dopaminergic neurons in the midbrain, which degenerate into Parkinson's disease. GDNF was purified from conditioned medium of rat B49 glial cell (Lin and co-authors, Science, 260: 1130-2, 1993 which is incorporated herein by this reference). Sequence analysis revealed that it was a distant member of the TGF-β superfamily of growth factors, which had approximately 20% identity, based primarily on the characteristic alignment of the seven cysteine residues of the canonical framework (Lin and co-authors, Science, 260: 1130-2, 1993, which is incorporated herein by this reference). In this way, GDNF may have possibly represented a new subfamily within the TGF-β superfamily. Recombinant GDNF produced in bacteria specifically promotes the survival and morphological differentiation of dopaminergic neurons (Lin and co-authors, Science, 260: 1130-2, 1993; Tomac and co-authors, Nature, 373-335-9, 1995; Beck and co-authors ,? / afi / re373: 339-41, 1995, and Ebendal and co-authors, J. Neurosci. Res., 40: 277-84, 1995, which are incorporated herein by this reference) and motor neurons (Henderson and co-authors, Science 266: 1062-4, 1994, Yan and co-authors, Nature, 373: 341-4, 1995, and Oppenheim and co-authors, Nature 373: 344-6, 1995, which are incorporated herein by this reference).

Especially GDNF was a more potent factor to promote the survival of motor neurons, than the other factors; and this was the only factor that prevented neuronal atrophy, in response to these lesions, placing it in that way as a promising therapeutic agent for motor neuron diseases. It is now generally believed that neurotrophic factors regulate many aspects of neuronal function, including survival and development in fetal life, and structural integrity and plasticity in adulthood. Since both acute damage to the nervous system and chronic neurodegenerative diseases are characterized by structural damage and, possibly, by disease-induced apoptosis, it is likely that neurotrophic factors play a role in these afflictions. In fact, a considerable body of evidence suggests that neurotrophic factors can be valuable therapeutic agents for the treatment of these neurodegenerative conditions, which are perhaps the most socially and economically destructive diseases that afflict society now. However, because different neurotrophic factors can potentially act preferentially through different receptors and on different types of neuronal or non-neuronal cells, there remains a need to identify new members of the families of neurotrophic factors for use in diagnosis and the treatment of a variety of acute and chronic diseases of the central nervous system.

BRIEF DESCRIPTION OF THE INVENTION Therefore, in a few words, the invention is directed to the identification and isolation of substantially purified factors that promote the survival and growth of neurons, as well as non-neuronal cells. Accordingly, the inventors hereof have succeeded in discovering novel protein growth factors, which belong to a family of growth factors for which GDNF is the first known member. The first member of said newly discovered family was neurturin and this is the objective of the pending patent application of Serial No. of the United States 08 / 519,777. Based on the sequence of GDNF and neurturin, the inventors of the present have discovered another member of the GDNF-neurturin family of growth factors, referred to herein as persephin (PSP). It is believed that this factor shows at least 75% sequence identity between homologous sequences of different mammalian species, although sequence homology can be as low as 65% in non-mammalian species, such as in bird species. In fact, mature mouse, rat and human persephin sequences show approximately 80 percent to 94 percent sequence identity. The mature persephin proteins identified herein comprise mouse sequences, as indicated in SEQ ID NO: 79 and 187 (in Figure 17B, amino acids 66 to 154 and 61 to 156, respectively); rat sequences as indicated in SEQ ID NO: 82 and 196 (in Figure 18B, amino acids 6 to 94 and 1 to 96, respectively), and human sequences that are designated in SEQ ID NO: 221 and 223 (in Figure 24, amino acids 61-156 and 66-154, respectively). The persephin has been identified and has been obtained by a method that is based on the conserved regions of the GDNF-neurturin family discovered by the inventors of the present invention. . Accordingly, a new method has been devised using degenerate sensitizers, constructed from the sequences of these conserved regions, for use in the polymerase chain reaction procedure. By using this method, mouse, rat and human orthologs of the new family member, persephin, have been identified and obtained. Thus, the present invention provides both amino acid sequences and nucleotide sequences that encode mouse persephin, rat and human, which includes the amino acid sequences of SEQ ID NO: 79, 82, 187, 196, 221 and 223, and the nucleotide sequences of SEQ ID NO: 183, 193 and 199 and 201, as well as the complements of said nucleotide sequences (SEQ ID NO: 184, 194, 200 and 202). In addition, the present invention includes "pre", "pro and" prepro "regions, as well as the amino acid and nucleotide sequences of persephin, pre-pro. The expression vectors u and the stably transformed cells comprising the polynucleotides of persephin are also within the scope of this invention.The transformed cells can be used in a method to produce persephin.In another embodiment, the present invention provides a method for preventing or treating cell degeneration, which comprises administering to a patient in need of This is a therapeutically effective amount of persephin A patient can also be treated by implanting transformed cells expressing persephin or a DNA sequence encoding persephin in a patient.; or cells grown and expanded by growth in persephin. The present invention also provides compositions and methods for detecting persephin. One method is based on persephin antibodies and other methods are based on detecting the mRNA and cDNA of the genomic DNA that codes for persephin, using recombinant DNA techniques. In still other embodiments, the present invention includes pan-growth factors that comprise a segment of a persephin sequence and a segment of at least one growth factor different from the persephin. Also included are polynucleotides that encode pan-growth factors; vectors containing said polynucleotides, and host cells comprising the polynucleotides. Among the diverse advantages that can be obtained by the present invention, therefore, one can note the provision of a new growth factor, persephin, for use in preventing atrophy, degeneration or death of certain cells , in particular neurons; the provision of human persephin; the provision of other members of the neurturin-persephin-GDNF family of growth factors, making available new methods capable of obtaining other members of the family; the provision of methods to obtain persephin by recombinant techniques; the provision of methods for preventing or treating diseases that cause cellular degeneration and, in particular, degeneration of neurons; the provision of methods that can detect and monitor persephin levels in a patient, and the provision of methods that can detect alterations in the persephin gene.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates the purification scheme for preparing neurturin from CHO cells. Figure 2 illustrates the characterization of fractions eluted from the Mono S column, in the purification of neurturin, which shows (a) the electrophoresis of each fraction on an SDS-polyacrylamide gel and the visualization of the proteins by staining with silver; and (b) the neurotrophic activity present in each fraction in the survival analysis of the superior cervical ganglion. Figure 3 illustrates the ability of neurturin to maintain the survival of superior cervical ganglion cells in culture, which shows (a) the positive control cells maintained with the nerval growth factor (FCN); (b) negative control cells, treated with anti-FCN antibodies, showing decreased survival; and (c) cells treated with anti-FCN and neurturin (approximately 3 ng / ml), which shows the survival of neurons. Figure 4 illustrates the concentration-response effect of neurturin in the survival analysis of the upper cervical ganglion. Figure 5 illustrates the homology of the amino acid sequences for mature growth factors, human neurturin (hNTN), mouse neurturin (mNTN), rat GDNF (rGDNF), mouse GDNF (mGDNF) and human GDNF (hGDNF), with the identical amino acid residues enclosed in cells. Figure 6 illustrates the tissue distribution of neurturin mRNA and mRNA for GDNF using RT / PCR analysis in RNA samples obtained from day 21 embryonic (E21) and from adult rats. Figure 7 illustrates the cDNA and the encoded amino acid sequence of human pre-pro neurturin (SEQ ID NO: 11), which shows the "pre" region of nucleic acid 1 to 57 (SEQ ID NO: 17), the region " pro "of nucleic acid 58 to 285 (SEQ ID NO: 20); human neurturin of nucleic acid 286 to 591 (SEQ ID NO: 9) and the splicing site between nucleic acids 169 and 170, which defines the coding sequence portion of two exons, from nucleic acids 1 to 169 (SEQ ID NO. : 27) and 170 to 594 (SEQ ID NO: 28). Figure 8 illustrates the cDNA and the encoded amino acid sequence of murine pre-pro neurturin (SEQ ID NO: 12), which shows the "pre" region of nucleic acid 1 to 57 (SEQ ID NO: 18) and the region "pro" from nucleic acid 58 to 285 (SEQ ID NO: 21); mouse neurturin, from nucleic acid 286 to 585 (SEQ ID NO: 10) and the splicing site between nucleic acids 169 and 170, which defines the coding sequence portion of two exons, from nucleic acids 1 to 169 (SEQ ID NO: 29) and 170 to 588 (SEQ ID NO: 30). Figure 9 illustrates the mouse cDNA sequence containing a 5 'non-coding region (SEQ ID NO: 13) and a 3' non-coding region (SEQ ID NO: 14); each of which is contiguous to the coding region of neurturin pre-pro. Figure 10 illustrates the percentage of neuronal survival in rat nodule ganglia E18 neurons, treated 24 hours after application on plates for NTN, GDNF, DNF, FCN and AMO. Figure 11 illustrates the nucleotide and amino acid sequence of murine persephin (SEQ ID NO: 79, 80 and 81, amino acid residues 52 to 140, 47 to 142 and 9 to 142, respectively). Figure 12 illustrates the sequence identity of the family member in the region between the first and seventh cysteine residues of the canonical framework, aligned starting with the first cysteine of the canonical framework for murine GDNF (SEQ ID NO: 87), the murderous neurturin (NTN) (SEQ ID NO: 88) and murine persephin (PSP) (SEQ ID NO: 89). Figure 13 illustrates the partial sequence of rat persephin cDNA (SEQ ID NO: 97), obtained by the rapid amplification technique of the cDNA ends. Figure 14 illustrates the partial sequence beginning with the first canonical framework cysteine for rat persephin (SEQ ID NO: 83) and the corresponding polynucleotide sequence (SEQ ID NO: 86). Figure 15 shows: (A) the partial amino acid sequences, aligned, of family member, from the first to the seventh canonical framework cysteine residues, illustrating the family member sequence homology of mature growth factors , Human GDNF (SEQ ID NO: 240), rat GDNF (SEQ ID NO: 241), human GDNF (SEQ ID NO: 242), human neurturin (NTN (human) SEQ ID NO: 31), mouse neurturin ( NTN (mouse); SEQ ID NO: 32) rat persephin (PSP (rat); SEQ ID NO: 79) and mouse persephin (PSP (mouse); SEQ ID NO: 82), in which the cells enclose the 28 amino acid residues conserved , present in all sequences; and (B) the matched mature mouse persephin sequences (mPSP, SEQ ID NO: 187), mature rat persephin (rPSP; SEQ ID NO: 198) and mature human persephin (h PSP; SEQ ID NO: 221). Figure 16 illustrates the sequences of the members of the TGF-β superfamily, aligned using the Clustal method, from the first canonical frame cysteine to the end of the sequence for the transforming growth factor-β1 (TGFβ1), the ß2 factor of transforming growth (TGFß2), transforming growth factor-3 (TGFβ3), inhibin βA (INHßA), inhibin βB (INHβB), nodal gene (NODAL), morphogenetic proteins 2 and 4 (BMP2 and BMP4) ), the Drosophila decapentaplegic gene (dpp); bone morphogenetic proteins 5-8 (BMP5, BMP6, BMP7 and BMP8), the Drosopilol 60A family of genes (60A); the morphogenetic protein 3 (BMP3), the Vg1 gene, the growth differentiation factors 1 and 3 (GDF1 and GDF3), the dorsaline (drsln), the inhibin alfa (INHa), the MIS gene (MIS), the factor 9 of growth (GDF-9), the neurotropic growth factor derived from glial (GDNF) and neurturin (NTN). Figure 17 illustrates: (A) the full length murine persephin gene (SEQ ID NO: 177); wherein the arrows indicate an 88 nt intron from positions 155-242, and (B) the murine pre-pro persephin nucleotide sequence (SEQ ID NO: 179), which encodes the amino acid sequence (SEQ ID NO. 185). Figure 18 illustrates: (A) the full-length rat persephin gene (SEQ ID NO: 188), the arrows indicating an intron 88 nt from positions 155-242; and (B) the rat pre-pro persephin nucleotide sequence (SEQ ID NO: 190), with the encoded amino acid sequence (SEQ ID NO: 196). Figure 19 illustrates a western blot analysis, which uses anti-persephin antibodies to detect the persephin protein in cell lysates, of COS monkey cells, transfected with the murine persephin gene (lane 2) or the persephin gene of rat (lane 3), compared to cells transfected with the non-recombinant vector only (pCB6, lane 4) and the mature protein produced by E. coli (lane 1). Figure 20 illustrates the murine chimeric molecules (A) PSP / NTN containing the persephin fragment (residues 1-63) and the neurturin fragment (residues 68-100); and (B) NTN / PSP, which contain the neurturin fragment (residues 1-67) and the persephin fragment (residues 64-96), with the arrow indicating the crossing point in each one. Figure 21 illustrates the survival promotion effect of persephin on embryonic mesoencephalic cells of 14 days, cultured for three days 8a) in the absence of persephin, where almost all of the cells die; and (b) in the presence of persephin (100 ng / ml), where the substantial survival of the neurons is evident. Figure 22 illustrates the effect of persephin survival promotion (PSP) on murine embryonic mesoencephalic cells of 14 days, compared to the effects of neurturin (NTN) and GDNF, as measured by the number of cells stained with tyrosine hydroxylase (TO H). Figure 23 illustrates the RT / TCP investigation for the expression of persephin in adult mouse tissues, showing the expression of persephin in Kidney cells; and Figure 24 illustrates the human pre-pro persephin cDNA sequence (SEQ ID NO: 203) with two silent mutations indicated at positions 30 and 360, and the encoded amino acid sequence (SEQ ID NO: 217), with the first amino acid of the "pro" region indicated by the double asterisk (**) at position 24 of the amino acid, and the first amino acid of mature human persephin indicated by a single asterisk (*) at the amino acid position 61 DESCRIPTION OF THE PREFERRED MODALITIES The present invention is based on the identification, isolation and sequencing of a DNA molecule encoding a new growth factor, persephin. The persephin promotes the survival of the cells and, in particular, the survival of the neuronal cells. Prior to this invention, persephin was unknown and had not been identified as a discrete biological substance, nor had it been isolated in pure form. The growth factor, neurturin (NTN) was identified and isolated as indicated in the pending patent application, Serial No. of the United States 08 / 519,777, filed on August 28, 1995, which is incorporated here in its entirety, through this reference. Of the neurturin sequence and the closely related growth factor sequence, the glial derived neurotrophic factor (GDNF), the inventors have devised and followed strategies to find additional related factors. Neurturin is approximately 40% identical to GDNF, but less than 20% identical to any other member of the TGF-β superfamily. Together, these two proteins define a new subfamily within the TGF-β superfamily. Several sequence regions within neurturin and GDNF were identified as highly conserved, so that they will probably be present in any additional members of this subfamily. Therefore, this sequence information can be used to isolate previously unknown members of this subfamily, designating degenerate oligonucleotides to be used as sensitizers in PCR reactions or as probes in hybridization studies. Using the PCR strategy with the new degenerate sensitizer, described in example 11 of the pending application Serial No. of the United States 08 / 519,777, the inventors hereby have succeeded in identifying a third factor, persephin, which is approximately 40 to 50% identical to both GDNF and neurturin. The sensitizers corresponding to the amino acid sequence of the conserved regions of neurturin and GDNF (SEQ ID NO: 42 and SEQ ID NO: 44) were used to amplify a 77 nt fragment of the rat genomic DNA. The resulting products were subcloned into the Bluescript KS plasmid and the sequence was determined. The sequence of one of the amplified products predicted the amino acid sequence data, internal to the PCR sensitizers, which was different from that of GDNF or neurturin, but which had more than 20% identity with GDNF and neurturin; while the sequences of the other amplified products that were obtained corresponded to GDNF or neurturin, as expected. The sequence of 22 nucleotides (SEQ ID NO: 90) was then aligned with the rat sequences of GDNF and neurturin, and found to be unique. This novel sequence, in this way, suggests that a new family member, named in the present persephin, had been identified. To obtain additional persephin sequence information, sensitizers containing the unique sequence of 22 nucleotides, of the amplified fragment, were used in the rapid amplification of the cDNA end technique (RACE) (Frohman, M.A., Methods in Enzymology, 218: 340-356, 1993), using the cDNA obtained from neonatal rat brain.

A fragment of approximately 350 nt was obtained from this PCR reaction, which constituted a partial sequence of rat persephin cDNA, of approximately 350 nucleotides (SEQ ID NO: 106). The predicted amino acid sequence of this cDNA was compared with that of GDNF and neurturin, and it was found to have approximately 40% identity with each of these proteins. It is important that the characteristic separation of cysteine residues from the canonical framework in the members of the TGF-β superfamily was present. Additionally, in addition to the region of similarity encoded by the degenerate sensitizers used to isolate persephin, another region of great homology, shared between GDNF and neurturin, but absent from the other members of the TGF-β superfamily, was also present in persephin: GDNF: ACCRPVAFDDDLSFLDD (aa 60-76) (SEQ ID NO: 98) NTN: PCCRPTAYEDEVSFKDV (aa 61-77) (SEQ ID NO: 99) PSP: PCCQPTSYAD-VTFLDD (aa-57-72) (SEQ ID NO: 100 ) (amino acid numbering uses the first Cys residue as amino acid 1). Upon confirmation that persephin was actually a new member of the GDNF / NTN subfamily, murine genomic clones of persephin were isolated to obtain additional sequence information. Sensors corresponding to the rat cDNA sequence were used in a PCR reaction to amplify a 155 nucleotide (nt) fragment from mouse genomic DNA that was homologous with the rat persephin cDNA sequence. These sensitizers were then used to obtain murine persephin genomic clones from a mouse 129 / Sv bank, in a bacteriophage vector P1 (bank selection service of Genome Systems, Inc., St. Louis, MO, USA). Restriction fragments (Neo I of 3.4 kb and Bam H1 of 3.3 kb) were identified from this clone P1 containing the persephin gene, by hybridization with a 210 nt fragment of persephin, obtained by PCR, using genomic DNA of mice and specific sensitizers for persephin. The Neo I and Bam H1 fragments were sequenced and found to encode a stretch of amino acids corresponding to the present in the rat persephin RACE product, and which was also homologous to the mature regions of both neurturin and GDNF (Figure 11) . Human persephin was obtained in a manner similar to that of mouse persephin. Degenerate PCR sensitizers were used to amplify human genomic DNA and a clone having a homologous sequence with mouse persephin was determined. Then sensitizers were used based on the sequence identified to select the cDNA libraries. Positive clones were identified by hybridization with a DNA probe derived from the identified sequence, and then these clones were sequenced. When the amino acid sequences of mature murine GDNF, NTN and PSP are aligned using the first canonical framework cysteine as the starting point, which is done because of the alterations in the division sites between the members of the family creates variability in the segments located upstream of the first cysteine, the persephin (91 amino acids) is a little lower than the neurturin (95 amino acids) or GDNF (94 amino acids). The overall identity within this region is around 50% with neurturin and about 40% with GDNF (Figure 12). Another nucleotide sequencing of the murine persephin Ncol fragment revealed that the nucleotide sequence of the whole murine persephin gene is as shown in Figure 17. Additionally, the entire rat persephin gene was determined by sequencing a rat genomic DNA fragment, amplified by PCR, which is shown in Figure 18. In both the murine and rat persephin gene, an open reading frame extends from the sequence encoding an initiating methionine, up to a stop codon at positions 244-246. However, at some point in this sequence it was found that an apparent anomaly occurred, of such magnitude that the sequence encoding the RXXR cleavage site (positions 257-268) and the sequence corresponding to the mature persephin protein (positions 269- 556) are not collinear with this open reading frame. Rather, a second reading frame encodes the division site and the persephin matures. Regardless of this apparent abnormality, mammalian cells were found to express persephin from the murine or rat full length genomic sequence (see example 14 below). To search for the genesis of this abnormality, mammalian expression vectors were prepared for both murine and rat persephin. To construct the murine plasmid, a clone P1 containing the murine persephin gene as a template was used in a PCR analysis. Sensitizers were designed such that the resulting fragment contained the persephin gene extending from the starter methionine to the stop codon. The PCR reaction used a positive direction (forward) sensitizer M3175 [5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and a reverse directional sensitizer (inverse) M3156 [5'-CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC]. To construct the analogous rat plasmid, rat genomic DNA was used as a template in a PCR analysis. The PCR reaction used a positive sensitizer M3175 [5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and a reverse sensitizer M3156 [5'-CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC]. The amplified products were cloned into BSKS and sequenced to verify that the correct clone had been obtained. The rat and murine persephin fragments were excised using Sma I and Hind III and cloned into the Asp718 (blunt) and Hind lll sites of the mammalian expression vector pCB6. COS monkey cells were transfected with rat or murine persephin expression vectors, or with the non-recombinant vector itself (pCB6). The cells were lysed forty-eight hours later; Samples were loaded on a 15% SDS-polyacrylamide gel and proteins were separated by electrophoresis. The proteins were then transferred to nitrocellulose, by electrospinning. This nitrocellulose membrane was incubated with anti-persephin antibodies (which were formed against mature persephin produced in bacteria from a pET plasmid), to detect the presence of persephin in the lysates. Lysates from cells transfected with rat or murine persephin expression vectors, but not lysate from cells transfected with pCB6, contain high amounts of persephin. The size of the persephin detected was 10-15 kD, consistent with the predicted size for the processed product (ie, the mature form of persephin). The conditioned media, harvested from t cells, also contained persephin. T results demonstrate that both murine and rat persephin genes are capable of directing the synts of an appropriately processed persephin molecule. To determine the mechanisms by which this occurred, RNA was isolated from cells transfected with the rat or murine persephin expression vector. RT / PCR analysis was carried out using sensitizers corresponding to the initiator Met and the stop codon. Two fragments were detected; one that corresponded to the predicted size of the persephin gene and the other a bit smaller, suggesting that an RNA boost had occurred. This was confirmed with several other pairs of sensitizers. Both large and small fragments of persephin were cloned and sequenced. As expected, the largest fragment corresponded to the persephin gene. The small fragment corresponded to a reinforced version of persephin. A small intron, 88 nt, within the pro domain (located 154 nt downstream of the stop codon) had been reinforced. After this reinforcement event, the "frame shift" (ie, the initiating Met and the mature region were in frame) in both rat and mouse persephin was no longer present. The N-terminus of persephin was predicted by reference to the N-terminal regions of neurturin or GDNF. Using sequence homology with neurturin and division signals, a characteristic RXXR division motif is present, which starts nine residues upstream of the first canonical framework cysteine of persephin, which would suggest that the murine mature persephin would contain five amino acids (ALAGS) (SEQ ID NO: 103) upstream of this cysteine (as neurturin does). The five corresponding amino acids in rat persephin are ALPGL (SEQ ID NO: 112) and those of human persephin are ALSGP (SEQ ID NO: 224). Using t parameters, the mature persephin would consist of 96 amino acids and have a predicted molecular mass of 10.4 kD. For the "mature" growth factor reference is made to the secreted form of the growth factor, in which any "pre" or "pro" region has been detached and which may exist as a monomer or, by analogy with other members of the TGF-β superfamily, in the form of a homodimer linked with disulfide ligands. The discovery of the new growth factor, persephin, as described above, is the result of the previous discovery by the inventors of the present, neurturin. In this way, the experiments that led to the discovery of neurturin are relevant to the current discovery of persephin, as well as to the biological activity of persephin. The isolation, identification and characterization of neurturin are described in detail in the examples 1-5 that come later. It is intended that the reference to the persephin herein be taken including growth factors of any origin, which are substantially homologous with, and which are biologically equivalent to, the persephin characterized and described herein. Said substantially homologous growth factors can be natural for any tissue or species and, similarly, biological activity can be characterized in any of a number of biological analysis systems. It is intended that the reference to the pre-prophylase persephin be taken including the "pre-pro" growth factors that contain a "pre" signal or leader sequence region, a "pro" sequence region and persephin, as define in the present. It is intended that the terms "biologically equivalent" mean that the compositions of the present invention are capable of demonstrating some or all of the same growth promoting properties, similarly, although not necessarily to the same extent as human persephin, of mouse or rat produced recombinantly, which are identified herein. It is intended that by "substantially homologous" it is understood that the degree of sequence identity of persephin orthologs, including human, mouse and rat persephin, as well as persephin of any other species, is greater than between paralogs, such as the persephin and neurturin or the persephin and GDNF, and greater than previously reported for the members of the TGF-β superfamily. (For a discussion of the homology of members of the TGF-ß superfamily see Kingsley, Genes and Dev,., 8: 133-45, 1994), which is incorporated herein by this reference). It is intended that the sequence identity or percent sequence identity means the percentage of the same residues between two sequences. The reference sequence is human persephin, when the percent identity with mouse or rat persephin is determined, and with non-persephin growth factors, human neurturin or human GDNF. The reference sequence is mouse persephin when the percent identity is determined with mouse GDNF, and mouse neurturin and rat persephin when the percent identity is determined with rat GDNF and with rat neurturin. The reference is to human neurturin when the percent identity with non-human neurturin and human GDNF is determined. In all previous comparisons the two sequences being compared are aligned using the Clustal method (Higgins and coauthors, Cabios8: 189-191, 1992) of multiple sequence alignment, in the Lasergene biocomputing application program (DNASTAR, Inc. , Madison, Wl, USA). In this method, multiple alignments are carried out in a progressive manner, in which larger alignment groups are assembled, using similarity scores, calculated from a series of pairs alignments. The optimal sequence alignments are obtained by finding the maximum alignment score, which is the average of all the scores between the residues separated in the alignment, determined from the table of residual weights, which represent the probability of an amino acid change given to occur in two related proteins, in a given evolution interval. The punishments to open and lengthen the intervals in the alignment contribute to the score. The default parameters used with the program are the following: penalty for interval for multiple alignment = 10; penalty for interval length for multiple alignment = 10; k-tuple value in pairwise alignment = 1; punishment per interval in pairwise alignment = 3; window value in the pairwise alignment = 5; diagonals saved in pairwise alignment = 5. The residual weight chart used for the alignment program is PAM250 (Dayhoff and co-authors, in Atlas of Protein Sequence and Structure, Dayhoff, Ed., NBRF, Washington, volume 5, supplement 3, page 345, 1978). The conservation percentage is calculated from the previous alignment, adding the percentage of residuals identical to the percentage of the positions in which the two residues represent a conservative substitution (defined as having a logarithmic probability value greater than or equal to 0.3 in the waste weight chart PAM250). Using this criterion, the preferred conservative amino acid changes are: R-K, E-D, Y-F, L-M, V-1, Q-H. Conservation refers to human persephin when the preservation percentage is determined with the persephin of another species, or with growth factors that are not persephin; refers to human neurturin when determining the percentage of preservation with non-human neurturin, or with growth factors that are not persephin or neurturin. Table 1 shows the identity (I) and conservation © calculations for the comparisons of mature persephin, mature neurturin and mature GDNF of several species. Comparisons were made between mature human persephin (hPSP) and mature mouse and rat persephin (mPSP and rPSP, respectively), and between mature human persephin and mature human GDNF or neurturin (hGDNF and hNTN, respectively) and between each other. these and human, rat and mouse GDNF (hGDNF, rGDNF and mGDNF, respectively), as shown in the table.

TABLE 1 The degree of homology between human persephin and mouse or rat persephin is approximately 80%, while the degree of homology between mouse and rat persephin is approximately 94%. The comparisons of neurturin shown in Table 1 indicate that the mature neurturin proteins of mouse and human have approximately 90% sequence identity. Additionally it is believed that all homologs of persephin and neurturin from non-human mammalian species similarly have at least about 75% sequence identity with human persephin, human neurturin or human GDNF. For non-mammalian species, such as bird species, it is believed that the degree of homology with the persephin is at least about 65% identity with human persephin or human neurturin or human GDNF. By way of comparison, variations between family members of the neurturin-persephin-GDNF family of growth factors can be seen by comparison of persephin and GDNF or neurturin and GDNF. Human persephin has approximately 40% sequence identity and approximately 43% sequence conservation with human GDNF; and approximately 49% sequence identity and approximately 50% sequence conservation with human neurturin. Similarly, human neurturin has approximately 40% sequence identity and approximately 50% sequence conservation with human GDNF. It is believed that the different members of the family also have a sequence identity similar to about 40% with that of neurturin and about 40% with that of persephin or about 40% with that of GDNF, and within an approximate scale of 30% to 75% identity with neurturin; within a range of approximately 30% to 75% identity with persephin; or within a range of approximately 30% to 75% sequence identity with GDNF. Thus, it would be expected that a given member of the GDNF-neurturin-persephin family would have a lower sequence identity with any other family member of the same species that was present in the orthologs of that family member in other species , just as human GDNF and human neurturin are more intimately related to mouse GDNF and mouse neurturin, respectively, than to each other or to GDNF; and it would be expected that any given family member had greater sequence identity with another member of the family than with any other known member of the TGF-β superfamily (Kingsley, supra). Homologs of the "pre-pro" persephin in non-human mammalian species can be identified by virtue of the persephin portion of the amino acid sequence having at least 75% sequence identity with human persephin; and the "pre-pro" persephin homologues in non-mammalian species can be identified by virtue of the fact that the persephin portion of the amino acid sequence has at least about 65% identity with human persephin. As used herein, persephin may also include hybrid and modified forms of persephin, respectively, which include fusion proteins and persephin fragments, and hybrid and modified forms in which certain amino acids and amino acids have been omitted or replaced. modifications such as when one or more amino acids have been changed to a modified amino acid or an unusual amino acid; and modifications, such as glycosylations, as long as the hybrid or modified form retains the biological activity of persephin. By retaining the biological activity it is meant that neuronal survival is promoted, although not necessarily at the same level of potency as that of the human, mouse or rat persephin identified here. Also included within the meaning of "substantially homologous" are any persephin that can be isolated by virtue of cross-reactivity with antibodies to persephin or whose coding nucleotide sequence, including genomic DNA, mRNA or cDNA can be isolated by hybridization with the complementary sequence of the genomic or subgenomic nucleotide sequences, or cDNA of the persephin or its fragments. It will also be appreciated by those skilled in the art that degenerate DNA sequences can encode human persephin and it is intended that they also be included within the present invention, as will the allelic variants of persephin. The preservatively substituted persephin proteins are also within the scope of the present invention. Conservative amino acid substitutions refer to the possibility of exchanging residues having similar side chains. The conservatively substituted amino acids can be grouped according to the chemical properties of their side chains. For example, a grouping of amino acids includes those amino acids that have neutral and hydrophobic side chains (A, V, L, W, F, and M); another grouping is that of the amino acids that have neutral and polar side chains (G, S, T, Y, C, N and Q); another grouping is that of amino acids that have basic side chains (K, R and H); another grouping is that of amino acids that have acid side chains (D and E); another grouping is that of the amino acids that have aliphatic side chains (G, A, V, L and I); another grouping is that of the amino acids that have aliphatic hydroxyl side chains (S and T); another grouping is that of the amino acids that have amine-containing side chains (N, Q, K, R and H); another grouping is that of amino acids that have aromatic side chains (F, Y and W) and gold clustering is that of amino acids that have sulfur-containing side chains (C and M). Preferred conservative amino acid substitution groups are: R-K, E-D, Y-F, L-M, V-1, and Q-H. Furthermore, it is believed that Q-R-H and A-V are preferred substitutions for persephin, as they occur between human, mouse and rat persephin paralogs (see Figure 15B). In the case of neurturin "pre-pro" there may be alternatively reinforced protein products, which are the result of an intron located in the coding sequence of the "pro" region. It is believed that the intron exists in the genomic sequence at a position corresponding to the position between nucleic acids 169 and 170 of the cDNA which, in turn, corresponds to a position within amino acid 57 both in the neurturin sequences " pro "of mouse as of human (see figures 7 and 8). Thus, alternative reinforcement in this position could produce a sequence that was different from that identified here for the human and mouse pre-pro neurturin (SEQ ID NO: 11 and SEQ ID NO: 12, respectively), on the site of amino acid identified by the addition and / or omission of one or more amino acids. It is intended that any and all alternatively reinforced pre-pro neurturin proteins be included within the terms "neurturin pre-pro" and, similarly, that any and all pre-pro proteins, alternatively reinforced, also be included within the terms "persefina pre-pro" that are used here. Although it is not intended that the inventors hereof be restricted by any theory, it is believed that the human, mouse and rat persephin proteins identified herein, as well as the homologs of other tissues and other species, may exist as dimers in their biologically active form, in a manner consistent with what is known for other factors of the TGF-β superfamily. In addition to the homodimers, the monomeric units of the persephin dimers can be used to construct stable heterodimers or heteromultimers of growth factor, comprising at least one monomer unit derived from persephin. This can be done by dissociating a persephin homodimer to its component monomeric units and annealing in the presence of a monomeric unit of a second or subsequent homodimeric growth factor. This second or subsequent homodimeric growth factor may be selected from a variety of growth factors including: neurturin, GDNF, a member of the NGF family, such as NGF, BDNF, NT-3 and NT-4/5; a member of the TGF-β superfamily, a vascular endothelial growth factor, a member of the CNTF / LIF family, and the like. It is believed that growth factors act on specific receptors. For example, receptors for TGF-β and fortune-telling have been identified and constitute a family of transmembrane Ser / Thr-kinase proteins (Kingsley, Genes and Dev., 8: 133-146, 1994; Bexk and co-authors, Nature 373: 339-341, 1995, which are incorporated herein by this reference). In the NGF family, NGF binds to the TrkA receptor in the sensory and sympathetic peripheral neurons, and in the antecerebrous neurons based; BDNF and NT-4/5 bind to the trkB receptors; and NT-3 binds primarily to trkC receptors that have a distinct distribution within the central nervous system (Tuszynski and co-authors, Ann. Neurol., 35: S9-S12, 1994). The members of the family of persephin-neurturin-GDNF also seem to act by means of specific receptors that have different distributions, than those that have been demonstrated for other families of factors. It has recently been shown that GDNF acts by means of a multi-component receptor complex, in which a transmembrane signal transducer component, the Ret-tyrosine kinase protein (Ret PTK) is activated by binding GDNF with another protein, termed GDNF a receptor (GDNFR-a), which has no transmembrane domain, and is bound to the cell surface by means of a glycosyl-phosphatidylinositol (GPI) ligation. (Durbec and co-authors, Nature, 381: 789-793, 1996; Jing and co-authors, Cell, 85: 1113-1124, 1996; Treanor and co-authors, Nature, 382: 80-83, 1996; Trupp and co-authors, Nature, 381 785-789, 1996, which are incorporated herein by this reference). Additionally, neurturin and GDNF signaling through the Ret-tyrosine kinase receptor has been shown to be mediated by a family of co-receptors, including the co-receptor protein GDNFR-a, also called TrnR1, and the co-receptor protein. TmR2 receptor, any of which can form a functional receptor complex with Ret, both for neurturin and for GDNF (Baloh and co-authors, Neuron, 18: 793-802, 1997, which is incorporated herein by this reference). By forming heterodimers or heteromultimers of persephin and one or more growth factors, it would be expected that the resulting growth factor would be capable of binding to at least two different types of receptor, preferably having a different tissue distribution. It would be expected that the resulting heterodimers or heteromultimers would show a different and, possibly, greater aspect of cells on which they could act or provide greater potency. It is also possible that the heterodimer or heteromultimer could provide synergistic effects not contemplated with the homodimers or homomultimers. For example, the combination of factors from different classes has been shown to promote long-term survival of oligodendrocytes; whereas individual factors or combinations of factors within the same class promoted short-term survival (Barres and co-authors, Development, 118: 283-295, 1993). Heterodimers can be formed by many methods. For example, homodimers can be mixed and subjected to conditions in which dissociation / cleavage occurs, such as in the presence of a dissociation / cleavage agent, and can then be subjected to conditions that allow the annealing of monomers and the formation of heterodimers. The cleavage / cleavage agents include any agent known to promote the dissociation of proteins. Such agents include, but are not limited to: guanidine hydrochloride, urea, potassium thiocyanate, pH-reducing agents, such as regulated HCl solutions, and polar organic solvents, miscible with water, such as acetonitrile or alcohols such as propanol or Sopropanol In addition, for homodimers covalently linked by disulfide ligations, as in the case of members of the TGF-β family, reducing agents, such as dithiothreitol and β-mercaptoethanol can be used for dissociation / cleavage and for annealing / refolding. The heterodimers can also be made by transfecting a cell with two or more factors, in such a way that the transformed cell produces heterodimers as has been done with the neurotrophins. (Heymach and Schooter, J. Biol. Chem., 270: 12297-12304, 1995). Another method to form heterodimers is by combining homodimers of persephin and a homodimer of a second growth factor, and incubating the mixture at 37 ° C. When heterodimers are produced from homodimers, the heterodimers can be separated from the homodimers using methods available to those skilled in the art, such as, for example, by elution from preparative non-denaturing polyacrylamide genes. Alternatively, the heterodimers can be purified using cation exchange chromatography, at high pressure, such as with a Mono S cation exchange column, or by sequential immunoaffinity columns. It is well known in the art that many proteins are synthesized within a cell with a signal sequence at the N-terminus of the mature protein sequence and the protein carrying said leader sequence is known as preprotein. The "pre" portion of the protein is released during the cellular processing of the protein. In addition to a "pre" header sequence, many proteins contain a distinct "pro" sequence, which describes a region in a protein that is a stable precursor of the mature protein. The proteins synthesized with pre and pro regions are called preproproteins. In view of the processing events that are known to occur with other members of the TGF-β family, as well as the sequences determined herein, the inventors believe that the form of the protein persephin, as synthesized within a cell, is a persephin "pre-pro" .. It is believed that the human pre-pro persephin contains a signal sequence of 23 amino acids at the N-terminus (human pre-signal sequence, SEQ ID NO: 219, Figure 24, amino acids 1 to 23). , encoded by SEQ ID NO: 208 and 209, Figure 24, nucleic acids 1 to 69). It is known that the full length of a header sequence need not be present for the sequence to act as a signal sequence and, therefore, within the definition of the "pre" region of persephin, its fragments are included, usually the N-terminal fragments, which retain the property of being able to act as a signal sequence, that is, facilitate co-translational insertion into the membranes, of one or more cellular organomes, such as the endoplasmic reticulum, the mitochondrion, the Golgi corpuscles, the plasma membrane, and the like. The persephin signal sequence is followed by a pro domain containing a RXXR proteolytic processing site immediately before the N-terminal amino acid sequence for the mature persephin. (Pro Human Sequence, SEQ ID NO: 220, Figure 24; amino acids 24 to 60, encoded by the nucleic acid sequence SEQ ID NO: 211, Figure 24, nucleic acids 70 to 180). The pre and pro regions of persephin, together, comprise a pre-pro sequence identified as the human pre-pro sequence (SEQ ID NO: 219, Figure 24, amino acids 1 to 60, encoded by SQ ID NO: 213 and 215; nucleos 1 to 285). The pre-region sequences and the pro-region sequences, as well as the pre-pro region sequences can be identified and obtained for non-human mammalian species and for non-mammalian species, by virtue of which the sequences are contained within of the pre-pro persefina, as defined here. Using the above marks, the human persephin cDNA has an open reading frame of 471 base pairs (bp), which encodes a protein of 156 amino acids long (Mr predicted: 16.6 kDa). The separation or detachment of the predicted signal peptide, 23 amino acids long, will lead to a pro-persephin molecule of 133 amino acids (Mr 14.2 kDa). The cleavage or proteolytic cleavage of pro-persephin in a RXXR consensus sequence should yield a mature protein of 96 amino acids, with a molecular weight of 10.3 kDa. The secreted, mature persephin molecule will probably form a disulfide-linked homodimer, by analogy with other members of the TGF-β family. The nucleotide sequences of the pre and / or pro regions of persephin, or similar regions, which are believed to be associated with persephin DNA, can be used to construct chimeric genes with the coding sequences for other growth factors or other proteins. (Booth and coauthors, Gene 156: 303-8, 1994, Ibáñez, Gene 146: 303-8, 1994, Storici and co-authors, FEBS Letters, 337: 303-7, 1994, Sha and co-authors, J. Cell Biol., 114: 827-839, 1991, which are incorporated herein by this reference). Said chimeric proteins may exhibit altered production or expression of the active protein species. A preferred persephin according to the present invention is prepared by recombinant DNA technology, although it is believed that persephin can be isolated in purified form from the cell conditioned medium, as was done for neurturin. By "pure form" or "purified form" or "substantially purified form" is meant that a persephin composition is substantially free of other proteins other than persephin. Preferably a substantially purified persephin composition comprises at least about 50 percent persephin on a molar basis, as compared to total proteins or other macromolecular species present. It is more preferable that a substantially purified persephin composition comprises at least about 80 to 90 mole percent of the total protein or other macromolecular species present, and it is still more preferable that it comprises at least about 95 mole percent, or more . The recombinant persephin can be prepared by expressing the DNA sequences encoding persephin, in a suitable transformed host cell. Using methods well known in the art, the DNA-coding persephin can be linked to an expression vector, transformed into a host cell and conditions established that are suitable for the expression of the persephin by the transformed cell. Any suitable expression vector can be employed to produce recombinant human persephin, such as, for example, the mammalian expression vector pcB6 (Brewer, Meth, Cell, Biol, 43: 233-245, 1994) or the expression vectors of E. Coli pET, specifically pET-30a (Studier and co-authors, Methods Enzymol., 185: 60-89, 1990, which is incorporated herein by this reference), both were used here. Other expression vectors suitable for expression in mammalian cells and bacteria are known in the art, as are expression vectors for use in yeast and insect cells. Baculovirus expression systems can also be used. The persephin can be expressed in the monomeric units or said monomeric form can be produced by preparing it under reducing conditions. In such cases, refolding and renaturation can be achieved using one of the agents listed above., which is known to promote the dissociation / association of proteins. For example, the monomeric form can be incubated with dithiothreitol, followed by incubation with the disodium salt of oxidized glutathione, followed by incubation with a regulator containing a refolding agent, such as urea. The persephin may exist as a dimer or other multimer and may be glycosylated or chemically modified in other ways. Mature human persephin does not contain N-linked glycosylation sites (see Figure 15B and SEQ ID NO: 221). Potential glycosylation sites, linked to O in mature human persephin, occur at positions 3, 10, 12, 14, 24, 36, 43, 67, 70 and 88 of SEQ ID NO: 221 (Figure 15B). As noted above, the human nucleic acid sequence suggests that the persephin is initially translated as a pre-pro polypeptide and that the proteolytic processing of the signal sequence and the "pro" portion of this molecule, resulting in the mature sequence, referred to herein as "mature persephin" exists in human and non-human species, in homologous manner. Accordingly, persephin includes any and all "mature persephin" sequences from human and non-human species, and any and all pre-pro persephin polypeptides, which can be translated from the persephin gene. By analogy with neurturin protein, it is possible that persephin isoforms may exist. For example, different possible cleavage sites (such as the RXXR sites) may be present in the pre-pro neurturin sequence, so that there may be more than one possible isoform of the pre-pro neurturin. Thus, the mature neurturin protein may have a variable number of amino acids that precede the first canonical cysteine. Such alternative division sites could be used differently between different organisms and between different tissues of the same organism. The N-terminal amino acids that precede the first seven cysteines conserved in the mature forms of members of the TGF-β family vary greatly in both length and sequence. Additionally, the insertion of a sequence of ten amino acids, two residues upstream of the first conserved cysteine, does not affect the known biological activities of a family member, dorsalin (Basler and co-authors, Cell 73: 687-702, 1993) . By analogy, it is also possible that persephin proteins that contain sequences of different lengths, which precede the first canonical cysteine, may exist or could be formed, and that they retain their biological activity. The inventors hereby believe that at least the sequence of a growth factor persephin-neurturin-GDNF exhibiting biological activity, will contain the sequence of the first to seventh canonical cysteines. This sequence of human persephin is from cysteine 66 to cysteine 154, as shown in Figure 24 (SQ ID NO: 223). The comparable sequence for murine persephin, as shown in Figure 12, is from cysteine 1 to cysteine 87 (SEQ ID NO: 79) and for rat persephin, as shown in Figure 14, from cysteine 1 to cysteine 87 (identified as SEQ ID NO: 82). Thus, within the scope of the persephin proteins of the present invention, are the amino acid sequences containing SEQ ID NO: 223, SEQ ID NO: 79 or SEQ ID NO: 82, and nucleic acid molecules containing sequences that encode these amino acid sequences. The present invention also comprises nucleic acid molecules comprising sequences encoding mouse, rat and human persephin (Figures 11, 14 and 23). Also included within the scope of this invention are sequences that are substantially the same as the nucleic acid sequences encoding persephin. Said sequences substantially equal, for example, can be substituted with codons more readily expressed in a given host cell, such as E. Coli, according to well-known and common procedures. Said modified nucleic acid sequences are included within the scope of this invention. The specific nucleic acid sequences can be modified by those skilled in the art and, thus, all of the nucleic acid sequences encoding the amino acid sequences of the pre-pro or pre-pro persephin, or the region of the persephin, can be modified in the same way. The present invention further includes the nucleic acid sequence having one or more substitutions, omissions or additions, wherein the nucleic acid sequence will hybridize with a persephin nucleic acid sequence, or a complement thereof, where appropriate. Specific hybridization is defined herein as the formation of hybrids between a polynucleotide (e.g., a persephin polynucleotide, which may include one or more substitutions, omissions and / or additions) and a specific reference polynucleotide, e.g. polynucleotides encoding mature persephin and having the sequences of SQ ID NO: 183, 184, 194, 195, 199, 200, 201 or 202), wherein the polynucleotide is preferably hybridized to the specific reference polynucleotide. For example, a polynucleotide encoding a mature persephin will hybridize specifically to a reference persephin polynucleotide (eg, SEQ ID NO: 183, 184, 194, 195, 199, 200, 201 or 202), and not to a polynucleotide. of reference neurturin (for example, SEQ ID NO: 9 or 10, or complementary sequences thereof). Hybridization is preferably carried out under very stringent conditions, which, as is well understood by those skilled in the art, are determined by numerous factors during hybridization and during the washing process, including temperature, ion concentration, duration and concentration of formamide. (see, for example, Sambrook and co-authors, 1989, supra). The present invention also includes nucleic acid sequences encoding polypeptides that have survival or growth activity and that are recognized by antibodies that bind to persephin. The present invention also comprises vectors comprising an expression regulatory element operably linked to any of the nucleic acid sequences included within the scope of the invention. This invention also includes host cells (of any variety) that have been transformed with said vectors. Methods are also provided herein to produce persephin. The preparation can be by isolating the conditioned medium from a variety of cell types, as long as the cell type produces persephin. A second, preferred method involves using recombinant methods isolating a nucleic acid sequence encoding persephin, cloning the sequence together with appropriate regulatory sequences, in suitable vectors, and in suitable cell types, and expressing the sequence to produce persephin. A family of mammalian genes that is composed of four neurotrophic factors has been identified, including nerval growth factor (NFC), brain-derived neurotrophic factor (BDGF), neurotrophin-3 (NT-3) and neurotrophin. 4/5 (NT-4/5). These factors share approximately 60 percent nucleic acid sequence homology (Tuszynski and Gage, Ann. Neurol., 35: S9-S12, 1994, which is incorporated herein by reference). The protein persephin and the neurturin protein do not exhibit significant homology with the NGF family of neurotrophic factors. It is either persefined or neurturin shares less than about 20% homology with the TGF-β superfamily of growth factors. Neverthelessboth persephin and neurturin show approximately 40% sequence identity with GDNF and approximately 50% sequence identity with one another. In particular, the positions of the seven cysteine residues present in persephin, neurturin and GDNF are almost exactly preserved. The inventors of the present believe that there may be other unidentified genes encoding proteins that have substantial homology in the amino acid sequence, with persephin, neurturin and GDNF, and that they function as selective growth factors for the same or different tissues and the same or different biological activities, and can act with the same or different receptors. A different spectrum of activity could result with respect to the affected tissues and / or the response elicited, from the preferential activation of different receptors by different family members, as is known to occur with members of the NGF family of neurotrophic factors (Tuszynski et al. Gage, 1994, supra). As a consequence of the members of a particular gene family showing substantial conservation of the amino acid sequence between the protein products of the family members, there is considerable conservation of the sequences at the DNA level. This forms the basis for a new approach to the identity of other members of the gene family, to which GDNF, neurturin and persephin belong. The method used for such identification is cross-hybridization using nucleic acid probes derived from a family member to form a hybrid duplex molecule, stable with the nucleic acid sequence, from different members of the gene family, or to amplify the Nucleic acid sequences from different family members. (See, for example, Kaisho and coauthors, FEBS Letters, 266: 187-191, 1990, which is incorporated herein by this reference). The sequence of the different family member may not be identical to the probe, but nevertheless will be sufficiently related to the sequence of the probe to hybridize with the probe. Alternatively, PRC using sensitizers of a family member can be used to identify additional family members. Previous approaches have not been successful so far in identifying other members of the gene family, because only one member of the family, GDNF, was known. With the identification of Neurturin in co-pending US Patent Application No. 08 / 519,777, however, new unique probes and new sensitizers were prepared which contained sequences from the conserved regions of this gene family. The same conserved regions were also found in the third member of the family: persephin. In particular, these conserved regions have been identified here and can be used as a basis to build new probes and sensitizers. The new probes and the new sensitizers made available from the work with neurturin and persephin, make possible this new powerful approach that can now identify, satisfactorily, other members of the gene family. Using this new approach, the genes related to GDNF, neurturin and persephin can be selected in sequence homology, preparing DNA or RNA probes, based on the regions conserved in the GDNF and neurturin molecules. Accordingly, one embodiment of the present invention comprises probes and sensitizers that are unique to, or derived from, a nucleotide sequence encoding said conserved regions, and a method for identifying other members of the gene family: neurturin-persephin- GDNF. Amino acid sequences of conserved region have been identified herein, including: Val-Xaa? Xaa2-Leu-Gly-Leu-Gly-Tyr, where Xaa1 is Ser, Thr or Ala; and Xaa2 is Glu or Asp (SEQ ID NO: 108); Glu-Xaa? -Xaa2-Xaa3-Phe-Arg-Tyr-Cys-Xaa4-Gly-Xaa5-Cys, wherein Xaai is Thr, Glu or Lys; Xaa2 is Val, Leu or lie; Xaa3 is Leu or He; Xaa4 is Ala or Ser and Xaa5 is Ala or Ser (SEQ ID NO: 113); and Cys-Cys-XaarPro-Xaa ^ Xaas-Xaa ^ Xaas-Asp-Xaa6-Xaa7-Xaa8-Phe-Leu-Asp-Xaag, where Xaai is Arg or Gln; Xaa2 is Thr or Val or lie; Xaa3 is Ala or Ser; Xaa4 is Tyr or Phe; Xaas is Glu, Asp or Ala; Xaa6 is Glu, Asp or no amino acid; Xaa7 is Val or Leu; Xaas is Ser or Thr; and Xaa9 is Asp or Val (SEQ ID NO: 114). Nucleotide sequences containing a coding sequence for the above-conserved sequences or fragments of the above conserved sequences can be used as probes. Examples of probe and sensitizer sequences encoding the amino acid sequences and SEQ ID NO: 125-129; sensitizers whose inverse complementary sequences encode amino acid sequences SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 130 and, in particular, the nucleotide sequences SEQ ID NO: 115-124. Additional sensitizers, based on GDNF and neurturin, include nucleic acid sequences encoding amino acid sequences SEQ ID NO: 33, SEQ ID NO. 36, SEQ ID NO. 40 and SEQ ID NO: 41; sensitizers whose inverse complementary sequences encode SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO: 39; and, in particular, the nucleic acid sequences SEQ ID NO: 42-48. Hybridization using the new probes of conserved regions of the nucleic acid sequences would be carried out under conditions of reduced stringency. The factors involved in determining the conditions of stringency are well known in the art (for example, see Sambrook and coauthors, Molecular Cloning, 2nd Edition, 1989, which is incorporated herein by this reference). Nucleic acid sources for selection would include libraries of genomic DNA from mammalian species or cDNA libraries constructed using RNA obtained from mammalian cells cloned in any suitable vector. Sensitizers for PCR would be used under reduced binding temperature PCR conditions, which would allow the amplification of the sequences of the family members of genes other than GDNF, neurturin and persephin. Nucleic acid sources for selection would include libraries of genomic DNA from mammalian species cloned in any suitable vector, cDNA transcribed from RNA obtained from mammalian cells, and genomic DNA from mammalian species. The DNA sequences identified on the basis of hybridization or PCR analysis would be sequenced and compared with GDNF, neurturin and persephin. The DNA sequences encoding the entire sequence of the novel factor would then be obtained in the same manner as described herein. Genomic DNA or libraries of genomic clones can also be used as templates because the intron / exon structures of GDNF and neurturin are conserved, and the coding sequences of the mature proteins are not interrupted by introns. Using this approach described above, sensitizers designed from conserved regions of neurturin and GDNF have been used to identify and obtain the sequence of the new family member, described here, persephin. Degenerate sensitizers designed from persephin, neurturin and GDNF can also be used to identify and obtain other members of the family. It is believed that all members of the GDNF-neurturin-persephin family will have a high degree of sequence identity with one or more of the three consensus regions for the three identified members of the family, in the portion of the sequence between the first and the seventh cysteines of the canonical framework (see figure 12). In particular, it is anticipated that a new family member will have at least 62.5% identity with the octapeptide of the consensus region, Val-Xaa -? - Xaa2-Leu-Gly-Leu-Gly-Tyr, where Xaai is Ser, Thr or Ala, and Xaa2 is Glu or Asp (SEQ ID NO: 108), or at least 62.5 percent sequence identity with the octapeptide of the consensus region Phe-Arg-Tyr- Cys-Xaa1-Gly-Xaa2-Cys, where Xaai and Xaa2 are alanine or serine (SEQ ID NO: 109), or at least 50 percent sequence identity with the octapeptide of the Asp-Xaa consensus region? -Xaa2-Xaa3-Phe-Leu-Asp-Xaa4, where Xaai is aspartic acid or glutamic acid or no amino acid; Xaa is valine or leucine, Xaa3 is serine or threonine; and Xaa4 is valine or aspartic acid (SEQ ID NO: 110). The inventors of the present believe that any new member of the family will have 28 amino acids in the sequence aligned between the first and seventh cysteine residues of the canonical framework, as set forth in Figure 15, with the residues numbered from the N-terminus of the family member; the sequence being aligned: (1) Cys, (3) Leu, (10) Val (13) Leu, (14 Gly, (15) Leu, (16) Gly, (17) Tyr, (21) Glu, (25) ) Phe, (26) Arg, (27) Tyr, (28) Cys, (30), Gly, (32) Cys, (44) Leu, (47) Leu, (58) Cys, (59) Cys, ( 61) Pro, (66) Asp, (69) Phe, (70) Leu, (71) Asp, (83) Ser, (84) Ala, (87) Cys and (89) Cys, however, it is possible that there may be up to three inequalities. based on the structural similarities of persephin to the sequences of neurturin and GDNF, one would expect that persephin promote the survival and growth of neuronal cells as well as non-neuronal cells. for example, it has It demonstrated that neurturin promotes the survival of cells superior cervical ganglion and neurons of the nodose sensory ganglia (see examples 1 to 3). Additionally, it has been shown that GDNF acts on dopaminergic, sympathetic, motor neurons and several neurons Sensory (Henderson and co-authors, supra, 1994; Miles yc OAutors, J. Cell Biol., 130: 137-148, 1995; Yan and co-authors,? / Aíure373: 341-344, 1995; Lin and co-authors, Science, 260: 1130-1132, 1993; Trupp and co-authors, J. Cell Biol 130: 137-148, 1995; Martin and co-authors, Brain Res., 683: 172-178, 1995; Bowenkamp and co-authors, J. Comp. Neurol., 355: 479-489, 1995, which are incorporated herein by this reference). Moreover, all other growth factors isolated to date have shown that act on many different cell types (for example see Scully and Otten, Cell Biol Int 19:.. 459-469, 1005; Hefti, Neurotrophic Factor Therapy, 25: 1418-1435, 1994, which are incorporated herein by this reference). Thus, it is likely that persephin shows activity on a variety of different neuronal cells, both peripheral and central, as well as on non-neuronal cells. With respect to peripheral neuronal cells, the profile of the cells for which persephin will show survival-promoting activity appears to be different from that of neurturin or GDNF. In contrast to the survival promoter activity, produced by neurturin and GDNF in sympathetic and sensory neurons, persephin did not show activity in these tissues at the concentrations tested. However, persephin showed survival promoting activity in mesocephalic cells, obtained from brains of rat embryos. Additionally, the activity of persephin can be determined on any type of target cell (or target), through routine experimentation, using common and current reference models. In addition, the inventors herein have identified brain and heart tissues as the tissues expressing persephin, further supporting the conclusion that persephin may act to promote survival and growth in a variety of neuronal cells and not neuronal As an example of the actions of neurotrophic factors on non-neuronal tissues, neurotrophic factor prototypical, NGF, also acts on mastoidales cells to increase their number when it is injected into newborn rats (Aloe, J Neuroimmunol, 18: 1. -12, 1988). Furthermore, mastoidales cells express trk receptor and respond to NGF such that NGF is a secretogogo for mastoid cell and a factor that promotes survival (Horigome and coauthors, J Biol Chem 260:.. 2695 to 2707, 1994, which is incorporated here as a reference). In addition, members of the TGF-β superfamily act on many different types of cells of function and embryological origin. The inventors of the present invention have identified the brain and the heart as the tissues in which persephin is expressed and it is further believed that persephin is expressed in many other neuronal and non-neuronal tissues. The family member related, neurturin, is expressed in many non-neuronal tissues, including blood, bone marrow, neonatal liver and mastoid cells. This suggests a role for neurturin in hematopoiesis, inflammation, allergy and cardiomyopathy. Similarly, persephin may also have a similar activity profile. It is believed that the neurotrophic factors of the FCN family act through high affinity receptors, specific for the factor (Tuszynski and Gage, 1994, supra). Only particular portions of the protein that acts at a receptor site are required to bind to the receptor. Said particular portions or discrete fragments can serve as an agonist when the substance activates a persephin receptor to elicit the promoter action on the survival and growth of the cell and persephin antagonists, when they bind to, but not activate, the receptor or promote Survival and growth. Said portions of fragments that are agonists and those that are antagonists are also within the scope of the present invention. Synthetic pan-growth factors can also be constructed by combining the active domains of persephin with the active domains of one or more non-persephin growth factors. (For example, see llag and coauthors, Proc. Nat'l Acad. Sci., 92: 607-611, 1995, which is incorporated herein by this reference). It would be expected that these pan-growth factors would have the combined activities or other advantageous properties of the persephin and the first or the other growth factors. As such, these pan-growth factors are believed to be potent and multispecific growth factors, which are useful in the treatment of a broad spectrum of degenerative diseases and degenerative conditions, which include conditions that can be treated by any or all the original factors from which the active domains were obtained. These pan-growth factors could also provide synergistic effects beyond the activities of the original factors (Barres and co-authors, supra). Pan-growth factors that are within the scope of the present invention may include chimeric or hybrid polypeptides, which are constructed from portions of fragments of at least two growth factors. The growth factors of the TGF-β superfamily are structurally related, having highly conserved sequence marks by which family members are identified. In particular the seven cysteine residues of canonical framework are almost invariable, in the members of the superfamily (Kingsley, Genes & amp;; Dev., 8: 133-146, 1994, which is incorporated herein by this reference). (See figure 17). Therefore, chimeric polypeptide molecules can be constructed from a sequence that is substantially identical to a portion of the persephin molecule, up to one or more crossing points; and one or more sequences, each of which is substantially identical to a portion of another member of the TGF-β superfamily, which extends on the other side of the corresponding crossing point or points. For example, a portion of the amino terminus of the polypeptide may be combined with a carboxy terminus portion of a neurturin polypeptide or, alternatively, a portion of the amino terminus of a neurturin polypeptide may be combined with a terminal carboxy terminus portion. of a persephin polypeptide. Both portions of the persephin or neurturin polypeptides are preferably about 5 to 95, more preferably about 10 to 90, still more preferable, about 20 to 80, and most preferably about 30 to 70 contiguous amino acids; and portions of another member that is not persephin or, as the case may be, another member of the TGF-β superfamily that is not neurturin, preferably will have about 5 to 95, more preferably, about 10 to 90, still more preferable , approximately 20 to 80 and, most preferably, approximately 30 to 70 contiguous amino acids. For example, a particular crossing point could be between the third and fourth cysteine residues of the canonical framework. One such exemplary construct would contain at the 5 'end a sequence consisting of a persephin sequence from residue 1 to the third cysteine residue 37 of the canonical framework, and up to a crossing point at some point between residue 37 and the residue 63, but without including the fourth cysteine residue 64 of the canonical framework; see mature persephin (SEQ ID NO: 80). The 3 'end of the hybrid construct would constitute a sequence derived from another member of the TGF-β superfamily, such as, for example, neurturin, which is another member of the TGF-β superfamily, which is intimately related to persephin. Using neurturin as another member of the TGF-β family, the hybrid construct beyond the natural crossing point would consist of a sequence starting at the desired crossing point in the neurturin sequence, between the third cysteine residue 37 of the canonical framework and the fourth cysteine residue 67 of the canonical framework, neurturin, and continuing through residue 100 at the 3 'end of neurturin (for alignment, see Figure 12). A second exemplary hybrid construction would be constituted by residue 1 to a crossing point between residues 37 and 67 of the neurturin, linked contiguously with the residues from the point of crossing between residues 37 and 64, to residue 96 of the persephin . The above constructions with persephin and neurturin are given as an example only, with the particular member of the TGF-β family being selected from the family members including, but not limited to, the transforming growth factor β1 (TGFβ1), the factor Transforming growth factor-2 (TGFß2), transforming growth factor-3 (TGFβ3), inhibin βA (INHYDE), inhibin βB (INHβB), nodal gene (NODAL), bone morphogenetic proteins 2 and 4 (MBP2) and BMP4), the Drosophila decapentaplegic (ddp) gene; 5-8 morphogenetic bone proteins (BMP5, BMP6, BMP7 and BMP8), the Drosophila 60A family of genes (60A), bone morphogenetic protein 3 (BMP3), the Vg1 gene, growth differentiation factors 1 and 3 (GDF1 and GDF3), dorsaline (drsln), inhibin a (INHa), the MIS gene (MIS), growth factor 9 (GDF-9), glial-derived neurotropic growth factor (GDNF), neurturin ( NTN) and persephin (see figure 16). Additionally, the crossing point can be any residue between the first and seventh cysteine molecules of the neurturin canonical framework, and the other particular member of the family. Additionally, additional crossing points may be used to incorporate any desired number of persephin portions or persephin fragments, with portions or fragments of any other or any other members of the family. In constructing a particular chimeric molecule, the portions of persephin and portions of the other non-persephin growth factor are amplified using PCR, mixed and used as a template for a PCR reaction using the positive sensitizer of one and the reverse sensitizer of the other of the two component portions of the chimeric molecule. Thus, for example, a positive and an inverse sensitizer is selected to amplify the persephin portion from the beginning to the crossing point selected from the third and fourth canonical cysteine residues, using a persephin plasmid as template. A positive sensitizer is then used with a 5 'portion that overlaps the persephin sequence, and a reverse sensitizer, to amplify the portion of the other non-persephin growth factor member, of the TGF-β superfamily, from the corresponding crossing point to the 3 'end, using a plasmid template containing the coding sequence for the TGF-β family member that is not persephin. The products of the two PCR reactions are gel purified and mixed together, and the PCR reaction is carried out.

Using an aliquot of this reaction as a template, an RCP reaction is carried out using the positive sensitizer of persephin and the reverse sensitizer for the non-persephin growth factor. The product is then cloned into an expression vector for the production of the chimeric molecule. It would be expected that the chimeric growth factors were effective in promoting the growth and development of cells and for use in preventing atrophy, degeneration or death of cells, in particular of neurons. The chimeric polypeptides may also act as receptor antagonists of one or both of the full length growth factors, from which the chimeric polypeptide was constructed, or as an antagonist of any other growth factor acting on the same receptor or the same receptors. The present invention also includes therapeutic or pharmaceutical compositions comprising persephin in an amount effective to treat patients with cellular degeneration or cellular dysfunction, and a method comprising administering a therapeutically effective amount of persephin. These compositions and these methods are useful for treating many degenerative diseases. When cell degeneration involves neuronal degeneration, diseases include, but are not limited to: peripheral neuropathy, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, ischemic attack, acute brain damage, acute spinal cord damage , tumors in the nervous system, multiple sclerosis, trauma or damage to peripheral nerves, exposure to neurotoxins, metabolic diseases, such as diabetes or kidney dysfunction or damage caused by infectious agents. In particular, the ability of persephin to promote survival in mesencephalic cells and the possibility of application of this growth factor in the treatment of neuronal degenerative diseases of the central nervous system, such as Parkinson's disease. When cellular degeneration involves degeneration of bone marrow cells, the diseases include, but are not limited to, insufficient red blood cell disorders, such as, for example, leukopenia including eosinopenia and / or basopenia; lymphopenia, monocytopenia, neutropenia, anemia, thrombocytopenia, as well as trunk cell insufficiency for any of the above. Cell degeneration can also involve myocardial muscle cells in diseases such as cardiomyopathy and congestive heart failure. Cells and anterior tissues can also be treated for depressed function. The compositions and methods of the present may also be useful for preventing degeneration and / or for promoting survival in other non-neuronal tissues as well. One skilled in the art can easily determine the use of a variety of assays known in the art to identify whether persephin would be useful to promote survival or to function in a particular type of cells.

In certain circumstances, it may be desirable to modulate or decrease the amount of persephin expressed. Thus, in another aspect of the present invention, oligonucleotides of the opposite direction to persephin can be made and a method can be used to decrease the level of expression of persephin, respectively, by a cell; which comprises administering one or more oligonucleotides of the opposite direction of persephin. By oligonucleotides of the opposite direction to persephin, reference is made to oligonucleotides having a nucleotide sequence that interacts by means of base pair formation with a specific complementary sequence of nucleic acid, involved in the expression of persephin, in such a way that reduce the expression of persephin. It is preferred that the specific nucleic acid sequence involved in the expression of persephin in a genomic DNA molecule or an mRNA molecule containing sequences of the persephin gene. This genomic DNA molecule can comprise flanking regions of the persephin gene, non-translated regions of the persephin mRNA, the "pre" or "pro" portions of the persephin gene or the coding sequence for the mature persephin protein. The term "complementary" to a nucleotide sequence, in the context of the oligonucleotides opposite to the persephin and the methods for them, means sufficiently complementary to said sequence, in order to allow hybridization to be sequence in a cell, i.e. under physiological conditions. Oligonucleotides in the opposite direction to persephin preferably comprise a sequence containing about 8 to 100 nucleotides and, more preferably, oligonucleotides in the opposite sense to persephin comprise about 15 to 30 nucleotides. Oligonucleotides in the opposite direction to persephin may also contain a variety of modifications that confer resistance to nucleolytic degradation, such as, for example, modified nucleotide linkages (Uhlmann and Peyman, Chemical Reviews 90: 543-548, 1990).; Schneider and Banner, Tetrahedron Lett., 31: 335, 1990, which are incorporated herein by this reference); bases and / or modified nucleic acid sugars and the like. The therapeutic or pharmaceutical compositions of the present invention can be administered by any suitable route known in the art, including, for example: intravenous, subcutaneous, intramuscular, transdermal, intrathecal or intracerebral. Administration can be rapid, such as by injection, or over a period of time, such as by slow infusion or administration of slow release formulation. For treating tissues in the central nervous system, administration can be by injection or infusion into cerebrospinal fluid (CSF). When it is intended to administer persephin to cells in the central nervous system, the administration may be with one or more agents capable of promoting the penetration of persephin through the blood-brain barrier. It is also possible to link or conjugate the persephin with agents that provide the desirable pharmaceutical or pharmacodynamic properties. For example, persephin may be coupled to any substance known in the art to promote penetration or transport through the blood-brain barrier, such as an antibody to the transferrin receptor, and may be administered by intravenous injection ( See, for example, Friden and co-authors, Science 259: 373-377, 1993, which is incorporated herein by this reference). Additionally, the persephin may be stably bound to a polymer, such as polyethylene glycol, to obtain desirable properties of solubility, stability, half-life and other pharmaceutically advantageous properties. (See, for example, Davis and co-authors, Enzyme Eng., 4: 169-73, 1978, Burnham, Am. J. Hosp. Pharm., 51: 210-218, 1994, which are incorporated herein by this reference). Usually, the compositions are used in the form of pharmaceutical preparations. Said preparations are made in a manner well known in the pharmaceutical art. A preferred preparation uses a physiological saline vehicle, but it is contemplated that other pharmaceutically acceptable carriers, such as physiological or other non-toxic salts, five percent aqueous glucose solution, sterile water or the like, may also be used. It may also be desirable that an appropriate regulator be present in the composition. If desired, said solutions can be lyophilized and stored in a sterile vial, ready to be reconstituted by the addition of sterile water for injection. The primary solvent can be aqueous or, alternatively, non-aqueous. The persephin can also be incorporated in a biologically compatible solid or semi-solid matrix that can be implanted in tissues that require treatment. The carrier may also contain other pharmaceutically acceptable excipients to modify or maintain the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation. Similarly, the carrier may still contain other pharmaceutically acceptable excipients, to modify or maintain release or absorption or penetration through the blood-brain barrier. Said excipients are those substances customary and usually used to formulate doses of parenteral administration in the form of unit doses or multiple doses, or for direct infusion in the cerebrospinal fluid, by continuous or periodic infusion. The administration of the dose can be repeated, depending on the pharmacokinetic parameters of the dose formulation and the route of administration used. It is also contemplated that certain formulations containing persephin are to be administered orally. Said formulations are preferably encapsulated and formulated with suitable carriers in solid dosage forms. Some examples of carriersSuitable excipients and diluents include: lactose, dextrose, sucrose, sorbitol, mannitol, starches, acacia gum, calcium phosphate, alginates, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, gelatin, syrup, methylcellulose, methyl- and propylhydroxybenzoates , talcum, magnesium, stearate, water, mineral oil and the like. The formulations may additionally include lubricating agents, wetting agents, emulsifiers and suspending agents; preservatives, sweetening agents or flavoring agents. The compositions can be formulated so as to provide rapid, sustained or delayed release of the active ingredients after administration to patients, employing procedures well known in the art. The formulations may also contain substances that decrease proteolytic degradation and promote absorption, such as, for example, surfactants. The specific dose is calculated according to the approximate weight of the body or the area of the patient's body surface, or the volume of the body space it will occupy. The dose will also be calculated depending on the particular route of administration selected. Further refinement of the calculations necessary to determine the appropriate dose for the treatment is carried out routinely by those of ordinary skill in the art. Such calculations can be made without undue experimentation, by one skilled in the art, in light of the activity of persephin. The activity of neurturin in the data of the target cells is described herein and in co-pending US Patent Application Serial No. 08 / 519,777, and the concentration of persephin necessary for activity at the cellular level is believed to be similar to neurturin. The activity of the persephin on the mesoencephalic cells is reported in the following example 17. The activity of the persephin on a particular type of target cell can be determined by routine experimentation. The exact doses are determined in conjunction with common and current dose-response studies. It will be understood that the amount of composition actually administered will be determined by the practitioner, in light of the relevant circumstances, which include the condition or conditions to be treated, the selection of the composition to be administered, the age , the weight and response of the individual patient, the severity of the patient's symptoms and the chosen route of administration. In one embodiment of this invention, persephin can be therapeutically administered by implanting into vector patients or cells capable of producing a biologically active form of persephin, or a persephin precursor, ie, a molecule that can be readily converted to a biologically active form of persephine, for the body. In one approach, cells secreting persephin in semipermeable membranes can be encapsulated to implant them in a patient. The cells can be cells that normally express persephin or a persephin precursor, or cells can be transformed to express persephin or a precursor thereof. It is preferred that the cell be of human origin and that the persephin be human persephin, when the patient is human. However, the formulations and methods herein can be used for veterinary as well as human applications, and the term "patient", when used herein, is intended to include human and veterinary patients. Ex vivo cells can be developed for use in transplants or in grafts in patients (Muench and coauthors, Leuk &Lymph, 16: 1-11, 1994, which is incorporated herein by this reference). In another embodiment of the present invention, persephin can be used to promote ex vivo expansion of cells for transplantation or grafting. Current methods have used bioreactor culture systems that contain factors such as erythropoietin, colony stimulating factors, stem cell factor and interleukin to expand the hematopoietic progenitor cells for erythrocytes, monocytes, neutrophils and lymphocytes (Verfaillie, Stem Cells 12: 466 -476, 1994, which is incorporated here by this reference). These stem cells can be isolated from the marrow of human donors, human peripheral blood or umbilical cord blood cells. Expanded red blood cells are used to treat patients who lack these cells as a result of specific disease conditions, or as a result of high-dose chemotherapy for the treatment of malignancy (George, Stem Cells 12 (Suppl 1): 249-255, 1994, which is incorporated herein by this reference). In the case of cell transplantation after chemotherapy, autologous transplants can be performed by removing bone marrow cells before chemotherapy, expanding the cells ex vivo, using methods that also work to purge the malignant cells, and transplanting the expanded cells back to the patient, after chemotherapy (for a summary, see Rummel and Van Zant, J.

Hematotherapy, 3: 213-218, 1994, which is incorporated herein by this reference). Since the persephin and the related growth factor, neurturin, can be expressed in the developing animal in particular tissues, when the proliferation and differentiation of progenitor cells occurs, it is believed that the persephin can function to regulate the proliferation of stem cells hematopoietic, and the differentiation of mature hematopoietic cells. Thus, the addition of persephin to culture systems used for the ex vivo expansion of cells could stimulate the rate at which certain populations of cells multiply or differentiate, and improve the effectiveness of these expansion systems by generating the cells necessary for the transplant. It is also believed that persephin can be used for the ex vivo expansion of precursor cells in the nervous system. Cell transplantation or grafting is currently being explored as a therapy for diseases in which certain populations of neurons are lost, due to degeneration, such as, for example, in Parkinson's disease (Bjorklund, Curr. Opin. Neurobiol, 2: 683-689, 1992, which is incorporated herein by reference, it is possible to obtain neuronal precursor cells from animal or human donors or from human fetal tissue, and then expand into the culture using persephin. in patients where they would work to replace some of the lost cells due to degeneration, since neurotrophins have been shown to be able to stimulate the survival and proliferation of neuronal precursor cells, such as, for example, NT-3, cell stimulation of sympathetic neuroblasts (Birren and co-authors, Develop., 119: 597-610, 1993, which is incorporated herein by this reference), the perse Fine could also work in a similar way during the development of the nervous system and could be useful in the ex vivo expansion of neuronal cells. In many circumstances it would be convenient to determine the levels of persephin in a patient. The identification of persephin along with the present report that persephin is expressed by certain tissues, gives the basis for the conclusion that the presence of persephin serves a normal physiological function, related to the growth and survival of the cells. In fact, it is known that other neurotrophic factors play a role in the function of neuronal and non-neuronal tissues. (For a summary, see Scully or Otten, Cell Biol. Int., 19: 459-469, 1994, Otten and Gadient, Int. J. Devl. Neurosciences, 13: 147-151, 1994, which are incorporated herein by this Reference: Endogenously produced persephin may also play a role in certain disease conditions, particularly when there is cellular degeneration, such as in neurodegenerative conditions or in neurodegenerative diseases.It is known that other neurotrophic factors change during disease conditions. Multiple sclerosis, FCN protein levels in the cerebrospinal fluid increase during the acute phases of the disease (Bracci-Laudiero and co-authors, Neuroscience Lett., 147: 9-12, 1992, which is incorporated herein by this reference) and in the systemic lupus erythematosus there is a correlation between inflammatory episodes and serum NGF levels (Bracci-Ludiero and co-authors, NeuroReport, 4: 563-565, 1993, which is incorporated here by this reference). Since persephin is expressed in certain tissues, it is likely that the level of persephin can be altered under a variety of conditions and that the quantification of persephin levels provides clinically useful information. Additionally, in the treatment of degenerative conditions, compositions containing persephin can be administered and it would be likely that it would be convenient to obtain certain levels of persephin in the serum to reach, at . cerebrospinal fluid or in any desired tissue compartment. Accordingly, it would be advantageous to be able to monitor the levels of persephin in a patient. As a consequence, the present invention also provides methods for detecting the presence of persephin in a sample of a patient. The term "detection" when used herein in the context of detecting the presence of persephin in a patient, is intended to include determination of the amount of persephin or the ability to express a quantity of persephin in a patient.; the distinction of persephin from other growth factors; the estimate of the prognosis in terms of probable outbreak of a degenerative disease and the recovery prospectus; monitoring of persephin levels over a period of time, as a measure of condition status; and monitoring of persephin levels to determine a preferred therapeutic regimen for the patient. To detect the presence of persephin in a patient, a sample of the patient is obtained. The sample can be a tissue biopsy sample or a sample of blood, plasma, serum, EGF or the like. Periphenone is expressed in kidney and brain tissues as shown in Example 18, and it is believed that persephin is also expressed in other tissues not analyzed. You can take samples to detect persephin from any tissue expressing persephin. When determining the peripheral levels of persephin, it is preferred that the sample be a blood, plasma or serum sample or, alternatively, a tissue biopsy sample. When the levels of persephin in the central nervous system are determined, a preferred sample is a sample obtained from cerebrospinal fluid. In some cases it is convenient to determine if the persephin gene is intact in the patient or in a tissue or cell line within the patient. By an intact persephin gene it is meant that there are no alterations in the gene, such as point mutations, omissions, insertions, chromosomal breakage, chromosomal rearrangements and the like, in which said alteration could alter the production of persephin or alter its activity biological, its stability or similar, to give rise to disease processes or susceptibility to conditions of cellular degeneration. Conversely, by a non-intact persephin gene it is meant that said alterations are present. Thus, in one embodiment of the present invention, a method is provided for detecting and characterizing any alterations in the persephin gene. The method comprises providing an oligonucleotide containing the cDNA of persephin, genomic DNA or a fragment thereof, or a derivative thereof. By an oligonucleotide derivative is meant that the derivatized oligonucleotide is substantially equal to the sequence from which it is derived, since the derived sequence has sufficient sequence complementarity with the sequence from which it is derived, to hybridize to the persephin gene. The derived nucleotide sequence is not necessarily physically derived from the nucleotide sequence, but can be generated in any way, including, for example, chemical synthesis or DNA replication or reverse transcription or transcription. Typically, the patient's genomic DNA is isolated from a patient's cell sample and digested with one or more restriction endonucleases, such as, for example, Taql and Alul. Using the Southern blot protocol, which is well known in the art, this analysis determines whether a patient or a particular tissue in a patient has an intact persephin gene or an abnormality in the persephin gene. Hybridization to the persephin gene would involve denaturing the Chromosomal DNA to obtain a single-strand DNA; contacting the single-stranded DNA with a gene probe, associated with the persephin gene sequence, and identifying the hybridized DNA probe to detect the chromosomal DNA containing at least a portion of the human persephin gene. The term "probe" as used herein refers to a structure consisting of a polynucleotide that forms a hybrid structure with a searched sequence, due to the complementarity of the probe sequence with a sequence in the searched region. Not necessarily the probes reflect the exact sequence of the searched sequence; but they must be sufficiently complementary to hybridize selectively with the filament being amplified. By "selective hybridization" or "specific hybridization" it is meant that a polynucleotide is preferentially hybridized to a desired polynucleotide. Oligomers suitable for use as probes may contain a minimum of approximately 8 to 12 contiguous nucleotides that are complementary to the searched sequence and, preferably, a minimum of about 15 nucleotides, although within the scope of this invention probes with up to about of 20 nucleotides and up to about 100 nucleotides or even more. The persephin gene probes of the present invention can be DNA or RNA oligonucleotides and can be made by any method known in the art such as, for example, by excision, transcription or chemical synthesis. The probes can be labeled with any detectable label known in the art, such as, for example, radioactive or fluorescent labels, or with enzymatic label. The labeling of the probe can be achieved by any method known in the art, such as by PCR, random sensitization and labeling, nick translation or the like. Whoever is an expert in the field will also recognize that other methods that do not use a labeled probe can be used to determine hybridization. Examples of methods that can be used to detect hybridization include: Southern staining, fluorescence, in situ hybridization, and single-strand conformation polymorphism, with PCR amplification. Hybridization is typically carried out at 25-45 ° C, more preferably at 32-40 ° C and, most preferably, at 37-38 ° C. The time necessary for hybridization is approximately 0.25 to 96 hours, more preferable, approximately 1 to 72 hours and, most preferably, approximately 4 to 24 hours. It is also possible to detect abnormalities in the persephin gene using the PCR method and sensitizers that flank or remain within the persephin gene. The PCR method is well known in the art. Briefly, this method is carried out using two oligonucleotide sensitizers, which are capable of hybridizing to the nucleic acid sequences flanking a sought sequence that remains within a persephin gene and amplifying the sought sequence. The terms "oligonucleotide sensitizer", as used herein, refer to a short strand of DNA or RNA, which typically varies in length from about 8 to about 30 bases. Sensors upstream and downstream preferably have a minimum length of about 15 nucleotides to about 20 nucleotides, and up to about 30 nucleotides or even more. The sensitizers can hybridize to the flanking regions for the reproduction of the nucleotide sequence. Polymerization is catalyzed by a DNA polymerase, in the presence of deoxynucleotide triphosphates or nucleotide analogs, to produce double-stranded DNA molecules. The double strands are then separated by any denaturing method, including physical, chemical or enzymatic. It is common for the physical denaturing method to be the one used, which involves heating the nucleic acid, typically at temperatures of about 80 ° C to 105 ° C for times ranging from about 1 to about 10 minutes. The procedure is repeated for the desired number of cycles. The sensitizers are selected to be substantially complementary to the strand of DNA that is being amplified. Therefore, the sensitizers do not necessarily reflect the exact sequence of the template; but they must be sufficiently complementary to hybridize selectively or hybridize specifically with the filament being amplified. By selective hybridization or by specific hybridization it is meant that a polynucleotide is preferably hybrid to a desired polynucleotide. After amplification by PCR, the DNA sequence comprising persephin or a pre-pro persephin or a fragment thereof is directly sequenced and analyzed by comparing it with the sequences described herein, to identify alterations that could change the activity or levels of expression, or similar. In another embodiment, a method is provided to detect persephin, which is based on tissue analysis expressing the persephin gene. It has been found that certain tissues, such as those identified later in Example 18, express the persephin gene. The method comprises hybridizing a polynucleotide probe to mRNA from a tissue sample that normally expresses the persephin gene or a cDNA produced from the mRNA of the sample. The sample is obtained from a patient suspected of having an abnormality in the persephin gene, or from a tissue of a particular patient or a particular cell type, which is suspected of having an abnormality in the persephin gene. The reference persephin polynucleotide probe may comprise SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 203-206 or derivatives thereof, or fragments thereof, provided that said derivatives or fragments hybridize specifically to the persephin mRNA, or from a cDNA produced from a persephin mRNA. To detect the presence of mRNA encoding the persephin protein, a sample is obtained from a patient. The sample can be from blood or from a tissue biopsy sample. The sample can be treated to extract the nucleic acids contained therein. The resulting nucleic acid from the sample is subjected to gel electrophoresis or other size separation techniques.

The mRNA of the sample is contacted with a nucleic acid that serves as a probe to form hybrid duplexes. The use of a probe marked as discussed above, allows the detection of the resulting duplex. When the cDNA encoding the persephin protein or a cDNA derivative is used as a probe, very stringent conditions can be used to prevent false positives, i.e., hybridization and apparent detection of persephin nucleotide sequences, when In fact, an intact persephin gene that works is not present. When using sequences derived from the persephin cDNA, less stringent conditions could be used; however, this would be a less preferred approach due to the possibility of obtaining false positives. The stringency of hybridization is determined by many factors during hybridization and during the washing procedure, which include: temperature, ion concentration, duration and concentration of formamide. These factors are delineated, for example, in Sambrook and co-authors (Sambrook and co-authors, 1989, supra). In order to increase the sensitivity of detection in a sample of mRNA encoding the persephin protein, the reverse transcription / polymerase chain reaction (RT / PCR) technique can be used to amplify the cDNA transcribed from the mRNA encoding the persephin protein. The RT / RCP method is well known in the art (see example 9 and figure 6, below).

The RT / RCP method can be carried out in the following manner. Total cellular RNA is isolated, for example, by the common guanidium isothiocyanate method, and the total RNA is reverse transcribed. The reverse transcription method involves the synthesis of DNA in an RNA template using a reverse transcriptase enzyme, and a 3 'end sensitizer. Typically the sensitizer contains an oligo (dT) sequence. The produced cDNA is then amplified using the PCR method and the specific sensitizers to persephin. (Belyavsky and coauthors, Nuci, Acid Res., 17: 2919-2932, 1989; Krug and Berger, Methods in Enzymology, Academic Press, NY, volume 152, pages 316-325, 1987, which are incorporated herein by this reference. ). The polymerase chain reaction method is carried out as described above, using two oligonucleotide sensitizers that are substantially complementary to the two flanking regions of the DNA segment to be amplified. After the amplification, the electrophoresis of the PCR product is carried out and detected by staining with ethidium bromide or by phospho-imaging. The present invention further provides methods for detecting the presence of the protein persephin in a sample obtained from a patient. Any method known in the art can be used to detect proteins. Such methods include, but are not limited to, immunodiffusion, immunoelectrophoresis, immunochemical methods, agglutinator-ligand assays, immunohistochemical techniques, agglutination and complement analyzes. (For examples, see Basic and Clinical Immunology, Sites and Terr, eds., Appleton &Lange, Norwalk, CT, E.U.A., pages 217-262, 1991, which is incorporated herein by reference). Preferred are binding-ligand immunoassay methods, which include reacting antibodies with one or more epitopes of the persephin protein or its derivatives, and competitively displacing the labeled persephin protein, or a derivative thereof. As used herein, a persephin protein derivative is intended to include a polypeptide in which certain amino acids have been omitted or replaced by other amino acids or changed to modified or unusual amino acids, where the persephin derivative is biologically equivalent to persephin and / or where the polypeptide derivative cross-reacts with antibodies formed against the persephin protein. By cross reaction it is meant that an antibody reacts with a different antigen than the one that induced its formation. Many other protein agglutination immunoassays, competitive and non-competitive, are well known in the art. The antibodies used in these assays may be unlabelled, for example, when used in agglutination tests, or may be labeled for use in a wide variety of assay methods. Labels that can be used include: radionuclides, enzymes, fluorescers, chemiluminescers, enzyme substrates and cofactors, enzyme inhibitors, particles, dyes and the like, for use in radioimmunoassay (RIA), enzyme immunoassay, for example, immunosorbent assay linked to enzyme (ELISA), fluorescent immunoassays and the like. Polyclonal or monoclonal antibodies can be formed for the persephin protein, or for an epitope thereof, for use in immunoassays, by any of numerous methods known in the art. By epitope reference is made to an antigenic determinant of a polypeptide. The term "epitope" may also include B-cell epitopes specific for persephin, or accessory cell epitopes T. An epitope could comprise three amino acids in a spatial conformation that is unique to the epitope. In general, an epitope consists of at least 5 of said amino acids. Methods for determining the spatial conformation of amino acids are known in the art and include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. One approach to prepare antibodies for a protein is the selection and preparation of an amino acid sequence of all or part of the protein; chemically synthesize the sequence and inject it into a suitable animal, usually a rabbit or a mouse (see example 10). Oligopeptides can be selected as candidates for the production of an antibody to the persephin protein, based on the oligopeptides remaining in the hydrophilic regions, which are likely to be exposed, as well, in the mature protein.

Antibodies to persephin may also be formed against oligopeptides that include one or more of the conserved regions, identified herein, such that the antibody can react with other members of the family. These antibodies can be used to identify and isolate the other members of the family. Methods for preparing the persephin protein or an epitope thereof include, but are not limited to: chemical synthesis, recombinant DNA techniques or isolation of biological samples. Chemical synthesis of a peptide can be effected, for example, by the classical Merrifeld method of solid phase peptide synthesis (Merrifeld, J. Am. Chem. Soc, 85: 2149, 1963, which is incorporated herein by this reference), or the FMOC strategy in a rapid, automatic multiple peptide synthesis system (DuPont Company, Wilmington, DE, USA) (Caprino and Han, J. Org. Chem., 37: 3404, 1972, which remains incorporated). here through this reference). Polyclonal antibodies can be prepared by immunizing rabbits or other animals, by injecting antigen, followed by subsequent boosters, at appropriate intervals. The animals are bled and the serum is analyzed against the purified persephin protein, usually by means of ELISA or by bioanalysis based on the ability to block the action of persephin. When bird species are used, for example, chickens, turkeys and the like, the antibody can be isolated from the egg yolk. Monoclonal antibodies can be prepared following the method of Milstein and Kohier, by fusing splenocytes from immunized mice, with tumor cells that reproduce continuously, such as myeloma or lymphoma cells. (Milstein and Kohier, Nature, 256: 495-497, 1974; Gulfre and Milstein, Methods in Enzymology: Immunochemical Techniques 73: 1-46, Langone and Banatis eds., Academic Press, 1981, which are incorporated herein by this reference) . The hybridoma cells thus formed are then cloned by means of limiting dilution methods and the supernatants are analyzed for antibody production, by means of ELISA, RIA or by bioanalysis. The unique ability of the antibodies to specifically recognize and bind to targeted proteins gives an approximation for treating excessive expression of the protein. Thus, another aspect of the present invention provides a method for preventing or treating diseases involving excessive expression of the protein persephin, by treating a patient with antibodies specific for the protein persephin. Specific antibodies, either polyclonal or monoclonal, for the protein persephin, can be produced by any suitable method known in the art, as discussed further below. For example, murine or human monoclonal antibodies can be produced by hybridoma technology or, alternatively, an immunologically active fragment thereof or an anti-idiotypic antibody or fragment thereof can be administered to an animal to cause production. of antibodies capable of recognizing and binding to the persephin protein. Said antibodies may be of any class of antibodies, including, but not limited to: IgG, IgA, IgM, IgD and IgE, or in the case of bird species, IgY and any subclass of antibodies. Preferred embodiments of the invention are described in the following examples. Other modalities within the scope of the present claims will be apparent to the person skilled in the art, when considering the description or practice of the invention described herein. It is intended that the specification, together with the examples, be considered as exemplary only, the scope and spirit of the invention being indicated by the claims that follow the examples.

EXAMPLE 1 This example illustrates the isolation and purification of neurturin from conditioned medium of CHO cells.

Preparation of the conditioned cell medium Cho was used a Chinese hamster ovary cell derivative DG44, DG44CHO-pHSP-NGFI-B (CHO) (Day and co-authors, J. Biol. Chem., 265: 15253-15260, 1990, which is incorporated here by this reference). The inventors of the present invention have also obtained neurturin in partially purified form from other derivatives of Chinese hamster ovarian cells DG44. The CHO cells were maintained in 20 ml of medium containing minimal essential medium (MEM) alpha (Gibco-BRL No. 12561, Gaithersburg, MD, USA), containing 10% fetal calf serum (Hyclone Laboratories, Logan, UT). , USA), 2 mM of 1 -glutamine, 100 U / ml of penicillin, 100 μg / ml of streptomycin and 25 nM of methotrexate, using 150 cm3 flasks (Corning Inc., Corning, NY, USA). For passage and expansion, the medium of a confluent flask was sucked; the cells were washed with 10 ml of phosphate buffered saline (PBS) containing, in g / l, 0.144 KH2P04, 0.795 Na2HP0 and 9.00 NaCl; and then the flask was incubated for 2-3 minutes with 2 ml of 0.25% trypsin in PBS. Then, it was beaten to detach from the surface of the flask, 8 ml of the medium was added and the cells were crushed several times with a pipette. The cells were divided 1: 5 or 1: 10, incubated at 37 ° C under a 5% C02 atmosphere in air, and developed to confluence for 3-4 days. The cell culture was then expanded into cylindrical 850 cc bottles (Becton Dickinson, Bedford, MA, E.U.A.). A confluent 150 cm3 flask was trypsinated and seeded in a cylindrical bottle containing 240 ml of the above modified MEM medium, without methotrexate. The pH was maintained either by forming a blanket for the medium with 5% C02 in air or by preparing the medium with 25 mM HEPES pH 7.4 (Sigma, St. Louis, MO, E.U.A.). The cylindrical bottles were rotated at 0.8-1.0 r.p.m. The cells reached confluence in 4 days. To collect the conditioned medium, serum free CHO cell medium (SF-CHO) was used. SF-CHO was prepared using 1: 1 of DME / F12 basic medium, which was prepared by mixing 1: 1 (volume / volume) of DMEM (Gibco-BRL, product No. 11965, Gibco-Brl, Gaithersburg, MD, USA) ), with Ham's F12 (Gibco-BRL, product No. 11765). The final SF-CHO medium contained 15 mM HEPES, pH 7.4 (Sigma, St. Louis, MO, USA), 0.5 mg / ml bovine serum albumin (BSA, Sigma, St. Louis, MO), 1X supplement of insulin-transferrin-selenite (bovine insulin, 5 μg / ml, human transferrin, 5 μg / ml, sodium selenite 5 ng / ml, Sigma, St. Louis, MO, USA), 2 mM of 1 -glutamine, 100 U / ml of penicillin and 100 μg / ml of SF-CHO medium to remove serum proteins. The cells were then incubated at 37 ° C for 16 to 24 hours in 80 ml of SF-CHO medium to remove serum proteins. The 80 ml of medium was removed and discarded. A volume of 120 ml of SF-CHO medium was added to the flask and the cells were incubated at 37 ° C. Every 48 hours thereafter, 120 ml was collected and replaced with the same volume of SF-CHO medium. The collected media was collected and centrifuged at 4 ° C in conical polypropylene tubes to eliminate cell detritus and the supernatant was stored at -70 ° C. The medium was collected five times for 10 days to produce a total of approximately 600 ml of conditioned medium per cylindrical bottle. The fractions collected from the columns in each purification stage were analyzed, in terms of biological activity, using neuronal survival analysis and in terms of protein content by analysis of Bradford dye agglutination (Anal. Biochem., 72: 248 and following, 1976, which is incorporated here by this reference). The total milligrams of protein in the starting volume, typically 50 liters, of conditioned medium was determined.

Superior cervical ganglion survival analysis The neurotrophic activity of CHO conditioned medium starting material and various purification steps was determined using the previously reported superior cervical ganglion survival analysis system (Martin and co-authors, J. Of Cell Biology, 106: 829-844; Deckwerth and Johnson, J. Cell Biol., 123: 1207-122, 1993, which is incorporated herein by this reference). Primary cultures of sympathetic neurons were prepared from the superior cervical ganglion (SCG) by dissecting rat embryo tissue on day 20-21 (E20-E-21). The SCG was placed in the middle of Leibovitz L15 with l-glutamine (Catalog No. 11415-023, Gibco-BRL, Gaithersburg, MD, USA), digested for 30 minutes with 1 mg / ml collagenase (Catalog No. 4188, Worthington Biochemical, Freehold, NJ, USA) in the middle of Leibovitz L15, at 37 ° C, followed by digestion for 30 minutes in lyophilized and irradiated trypsin (TRLVMF type, catalog No. 4454, Worthington Biochemical, Freehold, NJ) , which was resuspended in modified Hank's saline solution, modified (Catalog No. H-8389, Sigma Chemical Co., St. Louis, MO, USA). Digestion was stopped using AM50, which contained minimal essential medium, with Earle salts and without 1-glutamine (Catalog No. 11090-016, Gibco-BRL), 10% fetal calf serum (Catalog No. 1115, Hyclone Laboratories, Logan, UT, USA), 2 mM 1 -glutamine (Cat. No. G5763, Sigma Chemical Co., St. Louis, MO), 20 μM FuDr (F-0503, Sigma Chemical Co., St. Louis MO, USA); 20 μM uridine (Cat. No. 3003, Sigma Chemical Co., St. Louis, MO, E.U.A.), 100 U / ml penicillin, 100 μg / ml streptomycin and 50 ng / ml 2.5 S NGF. The cells were dissociated to a suspension of individual cells, using a Pasteur pipette silanized and flame-polished. After filtering the suspension through a nitex filter (size 3-20 / 14, Tetko Inc., Elmsford, NY, USA), the cells were placed in AM50 medium as before and pre-extended onto a Falcon or Primary culture dish. 100 mm (Becton Dickinson Labware, Lincoln Park, NJ) to reduce the nr of non-neuronal cells. After two hours, the medium containing the unfixed neuronal cells was separated from these dishes and ground again through a pipette of silanized Pasteur and polished to the flame. The suspension of individual cells was spread on tissue culture plates of 24 concavities (Costar, Wilmington, MA, USA), which had been previously coated with a double layer of collagen, a layer of collagen that had been ammoniated and a second layer. of collagen that had been air dried. They were allowed to set for 30 minutes to 2 hours. A specific nr of viable cells was spread in each concavity, usually about 1200 to 3000 total cells per concavity, or a specific percentage of the ganglion, usually 25% of the cells obtained by ganglion. When cell counts were to be carried out, they were placed in the 24-well plates mentioned above or, alternatively, in 2-cup chamber slides (Nunc, Naperville, IL, E.U.A.). The cultures were then incubated for five to six days at 37 ° C in AM50 medium in an atmosphere of 5% C02 / 95% air. The death of the cultured neurons was induced by changing the medium with medium without FCN and with anti-FCF of 0.05% (the final titer in the concavities is 1: 10). NFC deprivation results in the death of neurons for a period of 24 to 72 hours. Aliquots of the partially purified or purified factor or appropriate controls were added to the cultures at the time of FCN removal to determine the ability to prevent neuronal death. The evaluation of the capacity of the column fraction, the gel eluates or the purified factor, to prevent neuronal death, was carried out by visual inspection of the cultures under a phase contrast microscope. Viable neurons remained bright with intact neurites, whereas dead neurons shrunk, phase darkened and had irregular membranes and neurites fragmented (figure 3). When precise quantification of neuronal survival was needed, the cultures were fixed in 4% paraformaldehyde or in 10% formalin in PBS, and stained with crystal violet solution (Huntoon Formula Harieco E.M., Diagnostics Systems, Gibbstown, NJ, E.U.A.). When 24-well dishes were used, 1 μl of crystal violet solution was added to each concavity, containing 10% formalin, and the cells were counted using a phase contrast microscope. If the slides with chamber of 2 concavities were used, the cultures were fixed, stained with crystalline violet, the cultures were fixed, stained with crystalline violet, stained with water, dehydrated in increasing concentrations of ethanol to toluene, and mounted in a toluene-based assembly solution. The neurons were scored or scored as viable if they had a clear nucleolus and clear nuclei and if they were clearly stained with crystalline violet. Figure 3B shows the dead neurons at 72 hours. It is also shown: (A) the positive control cells maintained with the nerval growth factor and (C) the cells treated with anti-FCN and neurturin (approximately 3 ng / ml), which show the survival of the neurons. The activity was quantified by calculating a "survival unit". The total of survival units in a sample was defined as the minimum volume of an aliquot of the sample that produced the maximum survival, divided by the total volume of that sample. The specific activity was calculated as the survival units divided by the mg of the total protein. Survival units were determined in an analysis, using approximately 1200 viable neurons in a culture analysis of 0.5 ml and a culture period of 48 hours after the addition of the fraction. Survival was determined visually after 48 hours. The intrinsic activity shown in Figure 4 was determined in an analysis using approximately 2700 neurons and a culture period of 72 hours. Survival was determined by fixing the neurons and counting the number of neurons that survive. Due to the stability, which is determined by the half-life of activity, it would be expected that the measurement of intrinsic activity would be lower than that predicted by the determinations of specific activity. It would also be expected that the measurement of intrinsic activity was lower than that predicted by the specific activity, because survival was measured after 72 hours, instead of 48 hours. To guarantee the possibility of reproducing these activity unit analyzes, it was necessary to extend the primary neuronal cultures to reproducible cell densities, since the stability of the activity decreases significantly with increasing neuronal density. The scale of cell densities was approximately 1200 to 2700 cells per concavity. The presence of soluble heparin in the analysis medium had no effect on the short-term stability (less than three days) of the survival activity.

Purification of neurturin The assembled conditioned medium was filtered, through upper end bottle filters, of 0.2 μl pore (cellulose acetate membrane, Corning Inc., Corning, NY, E.U.A.). Typically, 50 liters of conditioned medium was used and processed in 25 liter loads. Each load of 25 liters was introduced at a rate of 20 ml / minute in a 5 x 5 cm column containing 100 ml of heparin-agarose (Sigma, St. Louis, MO), equilibrated with 25 mM of HEPES regulator, pH 7.4 , with 150 mM NaCl. The column was then washed with approximately 1000 ml of 25 mM HEPES buffer, pH 7.4, containing 0.5 M NaCl at 20 ml / minute, and then the activity was evaluated with 25 mM HEPES buffer, pH 7.4, containing 1.0 M of NaCl. After switching to an elution buffer of 1.0 M NaCl, the first 50 ml of regulator was discarded and a fraction of 300 ml was subsequently collected. The pooled material, eluted from the heparin-agarose column, was then diluted 1: 1 (volume / volume) with 25 mM HEPES regulator, pH 7.4, 0.05% TWEEN 20, at a NaCl concentration of 0.5 M and was introduced into a 1.5 cm x 9 cm column containing 16 ml of SP SEPHAROSE ® high performance ion exchange resin (Pharmacia, Piscataway, NJ, USA), equilibrated in 25 mM HEPES 7.4, containing 0.5 M NaCl and 0.02% TWEEN 20. The column was then washed with 160 ml of 25 mM HEPES regulator, pH 7.4, containing 0.5 M NaCl and 0.02% TWEEN 20, and the activity was eluted with 25 mM HEPES regulator, pH 7.4, 1.0 M of NaCl and 0.02% of TWEEN 20, at a flow rate of 2 ml / minute. A 50 ml fraction was collected after the first 7 ml of eluate from the column. The eluate from the SP column was fractionated SEPHAROSE using rapid protein liquid chromatography (FPLC) on a Chelating Superase HR 10/2 column, loaded with Cu ++ (Pharmacia, Piscataway, NJ, E.U.A.). The column had been prepared by washing with 10 ml of water, loading with 3 ml of 2.5 mg / ml of CUSO4.5H2O, washing with 10 ml of water and equilibrating with 10 ml of 25 mM of regulator HEPES, pH 7.4, containing 1.0 M of NaCl and 0.02% of TWEEN 20. The eluate was introduced into the column in 25 mM of regulator HEPES, pH 7.4, containing 1.0 M NaCl, at a rate of 1.0 ml / min. The bound proteins were eluted with a linear gradient of increasing concentration of glycine (0-300 mM) in 25 mM HEPES buffer, pH 7.4, containing 1.0 M NaCl, at a rate of 1.0 ml / minute. The gradient was produced by an FPLC system from Pharmacia, using an LCC-500 controller and P-500 pumps to establish a gradient of 0-300 mM glycine in 40 ml at 1.0 ml / minute, thus increasing the gradient by 7.5 mM. glycine per minute. Fractions of one milliliter were collected and analyzed for SCG survival promotion. Peak activity was observed in fractions 17-20, that is, 17 to 20 minutes or milliliters from the beginning of the gradient. Absorbance measurements at 280 nM using a monitor UV on line, indicated that most of the proteins were eluted before the survival activity in fractions 17-20. In that way significant purification was obtained in that step. A 25 kD band was copurified with the survival activity. The combined eluted fractions were diluted from the Cu ++ Sepharose column, to 0.45 M NaCl, using 25 mM HEPES regulator pH 7.4, which contained 0.02% TWEEN 20 and introduced into a Mono S HR cation exchange column. 5/5 (Pharmacia, Piscataway, NJ, USA), for purification by additional FPLC. The column was equilibrated with 25 mM HEPES buffer, pH 7.4, containing 0.45 M NaCl containing 0.02% TWEEN 20. The bound proteins were eluted with a linear gradient of increasing NaCl concentration (0.45-1.0 M). The gradient is produced as described above, from 0.45 M -1.0 M NaCl in 35 ml at 1.0 ml / minute, thereby increasing the concentration to 0.0157 M per thousand or per minute. Thirteen fractions of 1.0 ml were collected (fractions 1-13) followed by 44 fractions of 0.5 ml (fractions 14-53). The peak activity in the SCG analysis was in fractions 26-29. Each fraction was analyzed in the survival analysis with SCG, in a range of volumes from 0.1 to 1.0 μl per 0.5 ml of culture medium. One percent (5 μl) of each fraction was loaded on a 14% non-reducing SDS polyacrylamide gel and subjected to electrophoresis for 750 V-hour at 25 ° C. The proteins were visualized by staining with silver. The results are shown in Figure 2a. The markers shown in lane M in the gel represent 20 ng of bovine serum albumin, carbonic anhydrase, B-lactoglobulin and lysozyme, in the order of decreasing molecular weight. A 25 kD band appeared in fractions 25-30, a 28 kD protein elutes earlier in the gradient, and an 18 kD protein elutes later in the gradient. Figure 2b illustrates the survival activity in each of the fractions. It is noted that the survival activity corresponds to the presence and apparent intensity of the 25 kD protein in fractions 25-30. To demonstrate that the 25 kD band was responsible for the survival promoter activity, the 25 kD protein was eluted from the polyacrylamide gel, after electrophoresis, and analyzed for survival activity in the SCG analysis. After the electrophoresis of 150 μl of the SP SEPHAROSE ® fraction, 1.0 M NaCl, in a lane, of a 14% SDS-polyacrylamide gel, non-reducing, as before, the lane was cut in 12 cuts, and each cut was crushed and eluted by diffusion with balancing in regulator containing 25 mM HEPES, pH 7.4, 0.5 M NaCl, 0.02% Tween-20 for 18 hours at 25 ° C. BSA was added to the eluate at a final concentration of 200 μg / ml and the eluate was filtered through a 0.45 micron filter to remove the acrylamide gel fragments. The filtrate was then added to a SP SEPHAROSE ® column to concentrate and purify the sample. Before eluting the sample, the column was washed once in 400 μl of 25 mM HEPES regulator, pH 7.4, containing 0.5 M NaCl, 0.02% Tween-20 and 200 μg BSA per ml, and once in 400 μl. of 25 mM of HEPES regulator, pH 7.4, containing 0.02% Tween 20 and 200 μg BSA per ml. The column was then washed again in 400 μ of 25 mM HEPES buffer, pH 7.4, containing 0.5 M NaCl, 0.02% TWEEN 20 and 200 μg BSA per ml. The sample was eluted with 25 mM of HEPES buffer, pH 7.4, containing 1.0 M NaCl, 0.02% Tween 20 and 200 μg BSA per ml. Then the samples were analyzed for the survival activity. Only the cut that corresponded to the 25 kD band showed evidence of survival activity. It is believed that the 25 kD protein, purified from the CHO cell conditioned medium, is a homodimer. The performance of the above purification was typically 1 to 1.5 μg from 50 liters of CHO cell conditioned medium. It is estimated that the total recovery is from 10 to 30%, which results in a purification of approximately 390,000 times. Table 2 shows the progressive purification using the previous steps. a) the milligrams of protein was determined using the Bradford dye binding method (Anal. Biochem. 72: 248, 1976). b) Activity units or survival units, in total, in a sample, were defined as the minimum volume of an aliquot of the sample that produced the maximum survival, divided by the total volume of that sample. c) The activity for the conditioned medium was derived from the presumption that 100% of the activity was recovered in the heparin-agarose fraction, because the activity of the conditioned medium was too low to be analyzed directly. d) The specific activity was the units of activity divided by the total milligrams of protein.

EXAMPLE 2 This example illustrates the characterization of neurturin and several members of the TGF-β family of growth factors, in the analysis of SCG, and the lack of cross-reactivity of anti-GDNF antibodies with neurturin. SCG analysis of the purified protein indicated that the factor is maximally active at a concentration of approximately 3 ng / ml, or approximately 100 pM, and that the EC50 was approximately 1.5 ng / ml or approximately 50 pM on the scale expected for a diffusible peptide growth factor (Figure 4). Several members of the TGF-β family influence the expression of the neuropeptide gene in sympathetic neurons, while others promote the survival of different neuronal populations. Neurturin, which is a distant member of this protein family, is capable of promoting the virtually complete survival of sympathetic neurons for three days. Additionally, further culturing of SCG cells revealed that neurturin was able to continue to maintain these neurons for at least 10 days after FCN removal. Several other members of the TGF-β family were tested for their ability to promote survival in SCG assays, including TGF-β1, activin, BMP-2, BMP-4, BMP-6 and GDNF. Of these factors, only GDNF had survival promoting activity; however, the activity of GDNF was much less potent than neurturin in this activity, which shows an EC50 of 2-4 nM in the three-day survival analysis. The GDNF tested in this analysis was rhGDNF, produced in E. coli, obtained from Prepro Tech, Inc., Rocky Hill, NJ, E.U.A.). The duration of action of GDNF was also less than that of neurturin, while the ability of GDNF (50 ng / ml) to maintain survival over three days decreased substantially. These experiments suggest the possibility that GDNF is a weak agonist of activin and BMP-2 to promote survival, in contrast to its strong induction of gene expression related to the transmitter in these neurons (Fann and Paterson, Int. J. Dev. Neurosci., 13: 317-330, 1995; Fann and Patterson, J. Neurochem., 61: 1349-1355, 1993), suggesting that they signal through alternating recipients or alternate paths of signal transduction. To determine the cross-reactivity of the anti-GDNF antibodies with partially purified neurturin, SCG neurons that had been dissected and spread as described in Example 1, on day 6, were treated with 1 ng / ml, 3 ng / ml, 10 ng / ml or 30 ng / ml of GDNF (Prepro Tech. Inc., Rocky Hill, NJ, USA), in the presence of anti-FCN alone or in the presence of anti-FCN and anti-GDNF (goat IgG antibody to rhGDNF derived from E. Coli, R &D Systems, Minneapolis, MN, USA). A partially purified fraction in 1.0 M Sepharose SP, of neurturin in the assay, was used at approximate concentrations of 375 pg / ml, 750 pg / ml, 1.5 ng / ml and 3 ng / ml. This fraction was tested in the presence of anti-FCN alone and in the presence of anti-CFN and anti-GDNF. The anti-GDNF antibody blocked the GDNF survival promoting activity at a concentration of up to 30 ng / ml, but did not block the neurturin-promoting activity of survival.

EXAMPLE 3 This example illustrates the effect of neurturin on sensory neurons in a survival analysis of the ganglion nodosum. CHO cell conditioned media that had been partially purified on the SP Sepharose column was analyzed for its neurotrophic activity in sensory neurons, using nodose ganglia. The survival analysis is a modification of previously reported for upper cervical nodes. The primary dissociated cultures of the nodose ganglia were prepared by dissecting tissue from Sprague Dawley E18 rat pups. The nodose ganglia were placed in the middle of Leibovitz L15 with 2 mM of 1-glutamine (Catalog No. 11415-023, GIBCO-BRL, Gaithersburg, MD, E.U.A.). As tissues were dissected, they were digested for 30 minutes with 1 mg / ml collagenase (Cat. No. 4188, Worthington Biochemical, Freehold, NJ, USA), in Leibovitz medium L15 at 37 ° C, and then by digestion for 30 minutes in trypsin (lyophilized and irradiated, TRLVMF type, catalog No. 4454, Worthington Biochemical, Freehold, NJ, USA), and resuspended at a final concentration of 0.25% in Hank's balanced salt solution, modified (Catalog No. H8389, Sigma Chemical Co., St Louis, MO, USA). Digestion was stopped using AMO-BDNF100, a medium containing minimal essential medium with Earle salts and without 1-glutamine (No. 11090-016, GIBCO-BRL), 10% fetal calf serum (Cat No. 1115, Hyclone Laboratories, Logan, UT, USA), 2 mM 1 -glutamine (Cat. No. 5763, Sigma Chemical Co., St. Louis, MO, USA), 20 mM FuDr (F-0503, Sigma Chemical Co.), 20 μM uridine (Cat. No. 3003, Sigma Chemical Co., St. Louis, MO, USA), 100 U / ml penicillin, 100 μg / ml streptomycin and 100 ng factor Brain-derived neurotrope (BDNF, Amgen, Thousand Oaks, CA, USA). The cells were dissociated in a suspension of individual cells, using a silanized Pasteur pipette and flame-polished, in the AMO-BDNF100 medium, and pre-extended onto a Falcon or Primary 100 mm culture dish (Becton Dickinson Labware, Lincoln Park, NJ, USA) to eliminate non-neuronal cells. After two hours the medium containing the unfixed neuronal cells was removed from these dishes and ground again by means of a pipette of silanized Pasteur and polished to the flame. The suspension of individual cells was spread on tissue culture plates of 24 concavities (Costar, Wilmington, MA, USA), which had been previously coated with a double layer of collagen, a layer that had been ammoniated and a second layer that had been been air dried. The ganglia of ten rat E18 embryos were then dissociated in 2.5 ml of medium and 100 μl of this suspension was added to each concavity. The cells were allowed to attach for 30 minutes in an incubator at 37 ° C with 5% CO 2/95% air. The concavities were fed with AMO-BDNF100 medium overnight. The next day the cells were washed three times for 20 minutes each time, with AMO medium that did not contain BDNF. The concavities were fed with 0.5 ml of this medium alone or this medium containing 50 ng / ml of FCN, 100 ng / ml of BDNF (Amgen, Thousand Oaks, CA, USA), 100 ng / ml of GDNF (Prepro Tech, Inc., Rocky Hill, NJ, USA), or 3 ng / ml neurturin. The cells were incubated at 37 ° C in an incubator with 5% C02 / 95% air, for three days; it was fixed with 10% formalin, stained with crystalline violet (1 μl / ml 10% formalin) and counted. Survival was determined as previously noted. Figure 10 shows the death of neurons at 72 hours. The survival of neurons of the nodosa neurons cultured in BDNF had previously been reported (Thaler and co-authors, Develop Biol, 161: 338-344, 1994, which is incorporated herein by this reference). This was used as the norm for survival for these neurons, and was given the value of 100% survival. The nodose ganglia that did not have trophic support (AMO) showed from 20% to 30% of survival, like the neurons that were cultured in the presence of 50 ng / ml of FCN. Neurons cultured in the presence of 3 ng / ml neurturin and in the absence of BDNF showed a survival similar to neurons cultured in the presence of BDNF (100 ng / ml). GDNF, at a concentration of 100 ng / ml, promoted greater survival of nodal neurons than BDNF (100 ng / ml). Recently, similar findings were reported with GDNF for chicken sensory neurons (Ebendal, T and co-authors, J. Neurosci, Res., 40: 276-284, 1995, which is incorporated herein by this reference).

EXAMPLE 4 This example illustrates the determination of amino acid partial sequences of neurturin, isolated from the CHO cell conditioned medium. To obtain the N-terminal amino acid sequence of a purified preparation of approximately 1 μg of neurturin, Mono S 26-39 fractions containing the activity peak were concentrated to 25 μl by centrifugal ultrafiltration in a microcon-3 concentrator (Amicon Inc., Beverley, MA, USA) and loaded onto an SDS-polyacrylamide gel 14%, not reducing. After electrophoretic separation, the proteins were electro-patched to a PVDF membrane (Bio-Rad, Hercules, CA) and stained with 0.1% Coomassie blue. The 25 kD band was excised and inserted into the reaction cartridge of an automatic sequencer (Model 476, Applied Biosystems (Foster City, CA, E.U.A.)). The recovery in phenylthiohydantoin-amino acid (PTH-aa) in the first 2-3 cycles of automatic sequencing by Edman degradation indicated a sequencing yield of 4 pmol, which was approximately 10% of the estimated amount of protein loaded in the gel of SDS. Two N-terminal sequencing operations were carried out, from two 50-liter purification preparations. In the first operation, 1 μg of protein was concentrated in three pooled fractions of 1.5 ml of total volume, to 25 μl and electrowinged at 100V for two hours at 25 ° C, using a 10 mM electrophoretic regulator of CAPS regulator, pH 11.0 (Sigma, St. Louis, MO, USA), which contained 5% methanol. The amino acid sequence of 13 Edman degradation cycles was obtained and the yield of the sequencing was 4 pmol, as before. In the second operation, 1.5 μg of protein was concentrated in four pooled fractions and 2.0 ml of total volume, at 25 μl and electrowinged at 36V for 12 hours at 4 ° C, using an electrotransport regulator of 25 mM Tris, 192 mM of glycine, 0.04% SDS and 17% MeOH. The sequencing yield was 15 pmol and the sequence, after 16 cycles, was SGARPXGLRELEVSVS (SEQ ID NO: 3). The sequence obtained after 16 cycles corresponded to the shortest sequence obtained in the first operation. Definitive assignments could not be made on three of the amino acid residues in the sequence (residues 1, 6 and 11 N-terminals). A search of protein databases did not detect any significantly homologous sequence, suggesting that the purified factor was a new protein. These initial data of the N-terminal amino acid sequence did not allow isolation of the cDNA clones using degenerate oligonucleotides as PCR sensitizers or PCR probes, to select libraries. To facilitate these approximations, additional protein was purified in order to obtain the internal amino acid sequence from proteolytic fragments. To obtain the internal amino acid sequence of neurturin, another 50 liters of CHO cell-conditioned medium was purified, using only the first three chromatographic steps noted above, except that the gradient used to elute the Cu ++ Supercharger column was as follows: 0-60 mM glycine (4 ml), 60 mM glycine (10 ml), 60-300 mM glycine (32 ml). Fractions No. 20-23, which contained neurturin, were concentrated to 25 μl by ultrafiltration (Amicon microcon 3, Amicon, Beverley, MA, E.U.A.), and loaded onto a non-reducing SDS-polyacrylamide gel. After electrophoresis, the gel was stained with Coomassie blue, and the 25 kD neurturin band was excised. The neurturin was digested in the gel cut with endoproteinase Lys-C, and the eluted proteolytic fragments were purified by reverse phase HPLC. Only one peak was observed by HPLC separation of the eluted peptides, which produced amino acid sequence information for 23 cycles at the signal level of 1 pmol using the automatic sequencer (internal fragment P2, SEQ ID NO: 5). The amino acid analysis performed on 10% of the previous sample, before subjecting it to digestion, had indicated that 150 pmol of protein was present in the gel cut, which consisted of 7.5% lysine and 19.5% arginine. The only low-level peak of digestion with Lys-C suggested that digestion and elution of the peptides were inefficient. The same gel slice was again digested with trypsin and the eluted peptides were separated by HPLC. Two peaks were observed in HPLC, which result in the determination of two additional amino acid sequences of 10 residues (4-5 pmol signal level, internal fragment P1, SEQ ID NO: 4) and internal fragment P3, SEQ ID NO. : 6) that were distinct from the N-terminal and previous internal amino acid sequences. In situ digestion, elution and purification of peptides and peptide sequencing were performed by the Biotechnology Resource Laboratory of W. M. Keck Foundation, Yale University, in accordance with the normal protocols for that service.

EXAMPLE 5 The following example illustrates the isolation and sequence analysis of mouse and human neurturin cDNA clones. Degenerate oligonucleotides corresponding to various stretches of the confident amino acid sequence data were synthesized and used as sensitizers in the polymerase chain reaction (PCR) to amplify the cDNA sequences from reverse transcribed mRNA. A positive sensitizer (M1676: 5'-CCNACNGCNTAYGARGA, SEQ ID NO: 50) was used, which corresponds to the P2 peptide sequence Xaa -Xaa2-Val-Glu-Ala-Lys-Pro-Cys-Cys-Gly-Pro -Thr-Ala-Tyr-Glu-Asp-Xaa3-Val-Ser-Phe-Leu-Ser-Val, where Xaai and Xaa2 are unknown; Xaa3 was Gln or Glu (SEQ ID NO: 5), in combination with a reverse sensitizer (M1677; 5'-ARYTCYTGNARNGTRTGRTA (SEQ ID NO: 52), which corresponds to the Pe peptide sequence (Tyr-His-Thr-Leu -Gln-Glu-Leu-Ser-Ala-Arg) (SEQ ID NO: 6), to amplify a product of 69 nucleotides from cDNA templates derived from rat brain E21 and adult mouse.RCP parameters were: 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, for 35 cycles, the product was subcloned into the Bluescript KS plasmid and sequenced, all nucleotide sequencing was carried out using fluorescent dye terminator, according to the manufacturer's instructions, in an Applied Biosystems automatic sequencer, model No. 373 (Applied Biosystems, Foster City, CA, USA) Plasmid DNA for sequencing was prepared using the Wizard Miniprep kit (Promega Corp ., Madison, Wl, USA), according to the manufacturer's instructions. The sequence of the amplified product correctly predicted the internal amino acid sequence data for the PCR sensitizers. The sensitizers corresponding to the amplified sequence were used in combination with the degenerate sensitizers in the rapid amplification of the cDNA end technique (RACE) (Frohman, MA, Methods in Enzymology, 218: 340-356, 1993), using the Marathon RACE team (CLONTECH, Palo Alto, CA, USA) following the manufacturer's instructions, except that the first cDNA synthesis of a filament at 50 ° C was carried out, using the Superscript II reverse transcriptase (Gibco-BRL). Briefly, a strand adapter oligonucleotide was ligated to the ends of a double-stranded cDNA from rat brain mRNA 1 day after birth. Using sensitizers for neurturin PCR, positive, basketed (M1676; 5'-CCNACNGCNTAYGARGA, SEQ ID NO: 50 and 1678; 5'-GACGAGGGTCCTTCCTGGACGTACACA, SEQ ID NO: 53), in combination with sensitizers for the ligated adapter, supplied in the equipment or kit (AP1, AP2), the 3 'end of the neurturin cDNA was amplified by means of two successive PCR reactions (first: M1676 and AP1, using 94 ° C for 30 seconds; 55 ° C for 30 seconds; 72 ° C for 2 minutes, for 35 cycles, second: M1678 and AP2, using 94 ° C for 30 seconds and 68 ° C for 2 minutes, for 35 cycles). A 5 'portion of the rat neurturin cDNA was obtained by two successive PCR reactions, using the linked cDNA, as a template. The first reaction used sensitizers M1677 (SEQ ID NO: 52) and AP1; using 95 ° C for 30 seconds; 55 ° C for 30 seconds, and 72 ° C for 2 minutes, for 35 cycles. The second reaction used M1679 5'- TAGCGGCTGTGTACGTCCAGGAAGGACACCTCGT (SEQ ID NO: 54) and AP2 at 94 ° C for 30 seconds and 68 ° C for 2 minutes, for 35 cycles. These reactions resulted in a truncated form of the 5 'end of the neutrurin cDNA, apparently as a result of the premature termination of the cDNA during reverse transcription. The 5 'and 3' RACE products were subcloned into the Bluescript KS plasmid and sequenced. The sequence of these RACE 3 'and 5' products resulted in the partial rat neurturin cDNA sequence of 220 nt. Sensitizers were used (No. 4679321 5'-CAGCGACGACGCGTGCGCAAAGAGCG, SEQ ID NO: 55 and M1679 (SEQ ID NO: 54), which correspond to the rat, partial cDNA sequence (parameters for PCR: 94 ° C for 30 seconds and 68 ° C for 1 minute, for 35 cycles) to amplify a PCR product of 101 nucleotides, from the mouse genomic DNA, which was homologous to the rat neurturin cDNA sequence. These sensitizers were then used to obtain murine neurturin genomic clones, amplifying gene fragments in a mouse 129 / Sv bank, in a bacteriophage vector P1 (bank selection service of Genome Systems, Inc., St. Louis, MO, USA). A 1.6 kb Ncol fragment of this P1 clone, which contained the neurturin gene, was identified by hybridization with the sensitizer (No. 465782: 5'-TAYGARGACGAGGTGTCCTTCCTGGACGTACACAGCCGCTAYCAYAC, SEQ ID NO: 56). This Ncol fragment was sequenced and found to contain a stretch of the coding sequence corresponding to the N-terminal and internal amino acid sequences, obtained from the sequencing of the active protein, isolated from the conditioned CHO cell media. Beginning in the N-terminal amino acid sequence of the purified protein, this nucleotide sequence encodes a protein of 100 amino acids, with a predicted molecular mass of 11.5 kD. A search of the protein and nucleic acid databases identified neurturin as a novel protein that was approximately 40% identical to the glial-derived neurotrophic factor (GDNF). GDNF was purified and cloned as a factor that promotes the survival of dopaminergic neurons in the midbrain, and is a distantly related member of the TGF-β superfamily, which now includes more than 25 different genes that possess a wide variety of activities proliferative and differentiating. While GDNF is less than 20% identical to any other member of the TGF-β family, it contains the seven cysteine residues that are conserved throughout the family, and is believed to be the basis of a cysteine node structure, conserved , observed in the determination of the crystal structure of TGF-β2. Neurturin also contains these seven cysteine residues, but like GDNF it has less than 20% homology with any other member of the TGF-β family. Thus, neurturin and GDNF appear to represent a subfamily of growth factors that have diverged significantly from the rest of the TGF-β superfamily. To determine the sequence of the full-length mouse neurturin cDNA, the 5 'and 3' RACE PCR was carried out, as before for rats, using baske sensitizers, predicted from the mouse genomic sequence and the cDNA. of neonatal mouse brain. The first reaction for the used 3 'end sensitizers: M1777, 5'-GCGGCCATCCGCATCTACGACCGGG (SEQ ID NO: 57) and AP1 at 94 ° C for 30 seconds; 65 ° C for 15 seconds and 68 ° C for 2 minutes, for 35 cycles. The second reaction used sensitizer No. 467921 (SEQ ID NO: 55) and AP2 at 94 ° C for 30 seconds, 65 ° C for 15 seconds and 68 ° C for 2 minutes, for 20 cycles. The 5 'end was obtained using the first reaction sensitizer M1759, 5'-CRTAGGCCGTCGGGCGRCCARCACGGGT (SEQ ID NO: 58) and AP1 at 94 ° C for 30 seconds, 65 ° C for 15 seconds and 68 ° C for 2 minutes, during 35 cycles. The second reaction used the sensitizer M1785 5-GCGCCGAAGGCCCAGGTCGTAGATGCG (SEQ IS NO: 59) and AP2, at 94 ° C for 30 seconds, 65 ° C for 15 seconds and 68 ° C for 2 minutes, for 20 cycles. Both sets of PCR reactions included 5% DMSO. The RACE 5 'and 3' mouse products were subcloned into the Bluescript KS plasmid and sequenced. Using the sequence of RACE products a mouse neurturin cDNA sequence of 1.0 kb can be assembled. This cDNA sequence contains an open reading frame of 585 nucleotides that encodes a protein with a molecular mass of 24 kD. This full-length mouse cDNA sequence is shown in Figure 8 (SEQ ID NO: 12). Consistent with the processing events that are known to occur for members of the TGF-225 family, the 24 kD neurturin protein contains an amino-terminal signal sequence of 19 amino acids, followed by a pro-domain containing a site of RXXR proteolytic processing, immediately before the N-terminal amino acid sequence, obtained when the purified protein is sequenced from the conditioned CHO cell medium. Using these labels, the mature 11.5 kD neurturin molecule, which has 11.5 kD, is predicted and, by analogy, forms a 23 kD disulfide-linked homodimer, consistent with the 25 kD mass of the purified protein from the medium CHO cell conditioning, as estimated by the SDS-PAGE analysis. For isolation of human genomic clones, the sensitizers were used (No. 467524: 'CGCTACTGCGCAGGCGCGTGCGARGCGGC, SEQ ID NO: 60 and No. 10005, 5'-CGCCGACAGCTCTTGCAGCGTRTGGTA, SEQ ID NO. 61), predicted from the mouse neurturin sequence, to amplify (PCR parameters: initial denaturation at 95 ° C for 1 minute and 30 seconds, followed by 94 ° C for 30 seconds, 60 ° C for 15 seconds and 68 ° C for 60 seconds, for 35 cycles); a fragment of 192 nucleotides of human genomic DNA. The sequence of the PCR product showed that it was the human homologue of mouse neurturin. Sensitizers were then used to select a human genomic library, constructed in vector P1 (bank selection service, Genome Systems, Inc.), and two clones containing the human neurturin genomic site were obtained.

The same strategy was used to determine the human sequence discussed above for the mouse sequence. an oligo (No. 30152, GACCTGGGCCTGGGCTGGGCTACGCGTCCGACGAG, SEQ ID NO: 62) was used as probe in a Southern blot analysis to identify restriction fragments of the P1 Clones which contained the human neurturin coding sequence. These restriction fragments 8Eag I, Pvu II, Hind III, Kpn I) were subcloned into the plasmid Bluescript KS and sequenced. The results of the subcloning and sequencing of the human genomic fragments were as follows: The Eag I fragment was found to be approximately 6 kb in size, with the 3 'Eag I site located 60 bp downstream of the stop codon. The Pvu II fragment was approximately 3.5 kb in size, with the 3 'Pvu site located 250 bp downstream of the stop codon. The Hind III fragment was approximately 4.8 kb in size, with the 3 'Hind Ni site located 3 kb downstream of the stop codon. The Kpn I fragment was approximately 4.2 kb in size, with the 3 'Kpn I site located 3.1 kb downstream of the stop codon. The second coding exon was sequenced using these subcloned fragments. Additionally, the 250 bp sequence flanking the 3 'side of the second exon was obtained. The 1000 bp sequence flanking the 5 'side of the coding exon was also obtained. ': 30331 sensitizer and reverse (5'-GCCAGTGGTGCCGTCGAGGCGGG-3 (71, SEQ ID NO, SEQ ID NO: 72) of these flanking sequences, the 5'-30341 positsivo sensitizer CTGGCGTCCCAMCAAGGGTCTTCG-3)' is designated, so that The entire coding sequence of the second exon could be amplified by PCR. The first coding exon was not mapped relative it to the restriction sites above but was contained in the Eag I fragment The sequence of this exon was obtained from the subcloned Eag I fragment using the mouse sensitizer 466215 (5'- GGCCCAGGATGAGGCGCTGGAAAGG- 3 ', SEQ ID NO: 73), which contains the ATG start codon. Additionally and obtained the sequence of the first coding exon with reverse sensitizer 22215 (5'-CCACTCCACTGCCTGAWATTCWACCCC-3 ', SEQ ID NO 74), designed from the sequence obtained with the sensitizer 466215. The positive sensitizer 20205 (5'-CCATGTGATTATCGACCATTCGGC -3 \ SEQ ID NO: 75) was designed from the sequence obtained with the sensitizer 20215. The sensitizers 20205 and 20215 flank the coding sequence of the first coding exon and can be used to amplify said coding sequence using PCR. The human cDNA and the inferred amino acid sequence are shown in Figure 7 and the mouse cDNA and the inferred amino acid sequence are shown in Figure 8.

EXAMPLE 6 This example illustrates the preparation of expression vectors containing neurturin cDNA. For expression of recombinant neurturin in mammalian cells, the neurturin vector Pcmv-ntn-3-1 was constructed. The open reading frame of 585 nucleotides of the neurturin cDNA was amplified by PCR using a sensitizer containing the first 27 nucleotides of the coding sequence of neurturin: (5'-GCGACGCGTACCATGAGGCGCTGGAAGGCAGCGGCCCTG, SEQ ID NO: 63) and a sensitizer contains at least 5 codons and the high codon (5'-GACGGATCCGCATCACACGCACGCGCACTC (SEQ ID NO: 64), using 1-day-old mouse brain mRNA, reverse transcribed, as a template, using (PCR parameters: 94 ° C for 30 seconds, 60 ° C for 15 seconds and 68 ° C for 2 minutes for 35 cycles; and including 5% DMSO in the reaction). The PCR product was subcloned into the Eco RV site of BSKS and sequenced to verify that it did not contain mutations. The neurturin coding sequence of this vector was then excised, using Mlu I (5 'end) and BamH1 (3' end) and inserted downstream of the CMV IE promoter / enhancer into the mammalian pCB6 expression vector (Brewer, CB , Methods in Cell Biology, 43: 233-245, 1994), to produce the vector pCMV-NTN-3-1-, using these sites. For expression of recombinant protein in E. coli, the mature coding region of mouse neurturin was amplified by PCR, using a sensitizer containing the first seven codons of the mature coding sequence: (5'-GACCATATGCCGGGGGCTCGGCCTTGTGG) (SEQ ID NO: 65 ) and a sensitizer containing the last five codons and the high 5'-GACGGATCCGCATCACACGCACGCGCACTC codon (SEQ ID NO: 66), using a fragment containing the murine neurturin gene as a template, using (PCR parameters: 94 ° C for 30 seconds, 60 ° C for 15 seconds and 68 ° C for 90 seconds, for 25 cycles, with 5% DMSO added to the reaction). The amplified product was subcloned into the Eco RV site of BSKS, the nucleotide sequence was verified and this fragment was then transformed into the expression vector pET-30a (Novagen, Madison, Wl, USA), using an Nde 1 site (extreme 5). ') and an Eco R1 site (3' end). The pET-neurturin vector (pET-NTN) encodes a starter methionine in front of the first amino acid of the mature mouse neurturin protein, predicted by the N-terminal amino acid sequence of neurturin, purified from CHO cell conditioned medium .

EXAMPLE 7 This example illustrates the transient transfection of cells NIH35T3 with the neurturin expression vector pCMV-NTN-3-1, and that the product of the genomic sequence of example 5 is biologically active. To demonstrate that the cloned neurturin cDNA was sufficient to direct the synthesis of biologically active neurturin, the plasmid pCMV-NTN-3-1 was transiently introduced into NIH3T3 cells, using the lipofectamine method for transfection. NIH3T3 cells were spread at a density of 400,000 cells per concavity (34.6 mm diameter) in six concavities plates (Corning, Corning, NY, U.S.A.), 24 hours before transfection. Liposome and DNA complexes were prepared and added to the cells according to the manufacturer's protocol, using 1.5 μg of plasmid CMV-neurturin DNA (isolated and purified using a Quiagen column (Chatsworth, CA, EU A), from tip 500, according to the manufacturer's protocol) and 10 μl of lipofectamine reagent (Gibco BRL, Gaithersburg, MD) in a 1: 1 medium of DME / F12 containing 5 μg / ml of sodium selenite (Sigma, St Louis MO, USA). Five hours after the addition of the DNA-liposome complexes in 1 ml of medium per concavity, 1 ml of DME medium containing 20% calf serum was added to each concavity at each concavity. Twenty-four hours after the addition of the DNA-liposome complexes, the 2 ml of the above medium was replaced by 1 ml of DME medium containing 10% calf serum, 2 mM glutamine, 100 U / ml penicillin, 100 ml. μ / ml streptomycin and 25 μg / ml heparin. The cells were incubated for another 24 hours before harvesting the conditioned medium, centrifuged to remove cellular debris and frozen. As a control NIH3T3 cells transfected as above using 1.5 ug of plasmid CMV neoexpresión (containing no cDNA insert) in place of 1.5 g of CMV-neurturin plasmid. the conditioned medium of NIH3T3 cells with the control plasmid or with the plasmid CMV-neurturin of analyzed by direct culture medium SCG upon removal of NGF addition. Addition of 0.25 ml conditioned medium CMV-neurturin-of transfected cells promoted 70% survival of sympathetic neurons and more than 90 percent survival could be obtained with 0.45 ml of this conditioned medium. No significant survival promoter activity was detected in the conditioned medium or in the transfected, control NIH3T3 cells.

EXAMPLE 8 This example illustrates the preparation of Chinese hamster ovary cells, transformed with neurturin cDNA. Stabilized cotransfected cells were DG44, a Chinese hamster ovary cell derivative, which is deficient in dihydrofolate reductase (DHFR) (Urlaub et al., Cell 3: 405-412, 1983, which is incorporated herein by reference). , with the expression plasmid (Pcmv-ntn-3-1) and an dhfr (hld) EXPRESSION PLASMID (mCaRTHUR and Stanners, J. Biol. Chem., 266: 6000-6005, 1991, which is incorporated herein by this reference). On day 1, DG44 cells were extended to 1 x 10 6 cells per 10 cm plate, in Han's F12 medium, with 10% fetal calf serum (FCS). This density must not be exceeded or cells will grow excessively before selection media is added on the day 5. On day 2 cells transfected with a ratio 9: 1 pCMV-NTN expression plasmid using the method DNFR calcium phosphate (10 ug DNA / 10 cm plate) (Chen and Okayama, Mol Cell Biol, 7: 2745, 2752, 1987), which is incorporated herein by this reference. On day 3 the transfected cells were washed with Ham's F12 medium and Ham's F12 medium was fed with 10% FCS. On day 5 the cells were washed with MEM-alpha medium and selection medium was fed, which is MEM-alpha with 10% FCS and 400 ug / ml of G418. The cells were maintained in the selection medium, feeding every 4 days.

Colonies began to appear approximately 14 days after transfection. The colonies growing in the selection medium were then transferred to a plate of 24 concavities and triptinized the next day to disperse the cells. The cells were developed until confluence in 24 concavity plates or in plates with six concavities, in order to select the cells for expression of the recombinant protein. The expression of neurturin was ex- posed in 10 clonal lines and two lines of high expression were detected using the SCG survival analysis. These clonal lines were expanded and expression in these selected cell lines was amplified by selection in 50 nM methotrexate (MTX). For selection in MTX, cells up to 50% confluence were developed in a 150 cm2 flask in selection medium. The medium was changed to MEM-alpha containing 50 nM MTX concentration (it was not necessary to use G418 during the amplification with MTX). After placing in 50 nM of MTX, most of the cells died and colonies of resistant cells reappeared in 1-2 weeks. At that time the cells were triptinized to disperse the colonies and split when the cells reached confluence. Eventually the cells reached the same rate of growth as before. The selected cells were selected for the expression of recombinant protein. An increase of 2 to 3 times in expression was observed, after selection in 50 nM of MTX. The frozen materials were maintained for the cell lines obtained from the original selection and selection with 50 nM of MTX. It could continue to be selected by increasing MTX until the desired levels of expression are obtained. Using the above method, cells identified as DG44CH05-3 (G418) (pCMV-NTN-3-1) and DG44CHO5-3 (50nMMTX) (pCMV-NTN-3-1) were isolated. The cells of strain DG44CHO5-3 (50nMMTX) (pCMV-NTN-3-1) expressed levels of approximately 100 μg of biologically active protein per liter of conditioned medium, determined by direct analysis of conditioned medium in SCG analysis, according to with the methods of example 1.

EXAMPLE 9 This example illustrates the expression of neurturin in various tissues. An investigation of the expression of neurturin and GDNF in rat embryonic tissues (E10, day 10 after conception), neonatal tissues (P1, day 1 after birth) and adult tissues (more than 3 months), using semiquantitative RT / PCR (Estus and coauthors, J. Cell Biol., 127: 17171-1727, 1994, which is incorporated herein by this reference). RNA samples were obtained from various tissues and the PCR products were detected either by autoradiography, after incorporating a-32P-dCTP in the PCR and by electrophoresis in a polyacrylamide gel (Figure 6), or by means of of staining with ethidium bromide, of the DNA, after electrophoresis on agarose gels (tables 3 and 4). The neurturin fragment of 101 base pairs was obtained, using the positive sensitizer CAGCGACGACGCGTGCGCAAAGAGCG (SEQ ID NO: 67) and the reverse sensitivity TAGCGGCTGTGTACGTCCAGGAAGGACACCTCGT (SEQ ID NO: 68) and the 194 bp gDNF fragment was obtained, using the positive sensitizer AAAAATCGGGGGTGYGTCTTA (SEQ ID NO: 69), and the reverse sensitizer CATGCCTGGCCTACYTTGTCA (SEQ ID NO: 70). Neither neurturin nor GDNF mRNA was detected at the earliest embryonic age (embryonic day 10, E10) investigated.

In neonates (postnatal day 1, P1) both transcripts were expressed in many tissues, although neurturin tended to show a greater proportion in most tissues, than GDNF (see table 3).

TABLE 3 As shown in Table 3, the differences in the neurturin and GDNF distributions in tissues are remarkable. In particular, GDNF was not detected in the liver or in the thymus, where the expression of neurturin was detected; and neurturin was not detected in the sciatic nerve, where it was detected GDNF. Neurturin and GDNF mRNA were detected in many tissues of the adult animal; but the tissue-specific expression pattern for these two genes was very different (Table 4, Figure 6).

TABLE 4 As shown in Table 4, neurturin was found to be expressed in the brain and spinal cord, as well as in the blood and bone marrow, where GDNF was not detected. However, the level of neurturin expression in the brain and blood was lower than that detected in the neonatal tissue. Neurturin was also largely expressed in newly isolated peritoneal rat mastoid cells, whereas GDNF showed little or no expression.

EXAMPLE 10 This example illustrates the preparation of antisera for neurturin, immunizing rabbits with a neurturin peptide. The peptide sequence corresponding to amino acids 73-87 of mature murine neurturin protein was synthesized and ligated to keyhole limpet hemocyanin (KLH), as described further back (Harlow and Lane, Antibodies: a laboratory manual, 1988, Cold Spring Harbor Laboratory, New York, NY, USA, pages 72-81, which is incorporated herein by this reference). The peptide coupled to KLH was sent to Caltag, Inc., and each of two rabbits was immunized. Immunization was by subcutaneous injection in 7-10 sites. The first injection was with 150 μg of peptide coupled to KLH, which was resuspended in 0.5 ml of saline and emulsified with 0.5 ml of complete Freund's adjuvant. Booster injections were started 4 weeks after the initial injection, and were performed once every seven days, as before, for a total of five injections, except that 100 μg of peptide coupled to KLH and incomplete Freund's adjuvant were used. . Serum samples were collected one week after the fifth boost. A pooled volume of twenty milliliters of serum was purified, which had been collected from both rabbits one week after the fifth injection. For purification an affinity column was prepared with the peptide, coupling the above method to Sepharose 4B, activated with cyanogen bromide, according to the manufacturer's protocol (Pharmacia Biotech). The serum was diluted ten times in 10 mM Tris buffer, pH 7.5, and mixed by gentle rocking for 16 hours at 4 ° C with 0.5 ml of the peptide-agarose matrix, which contained 5 mg of the coupled peptide. The matrix was placed on a column, washed with 5 ml of 10 mM Tris, pH 7.5, 150 mM NaCl, washed with 5 ml of 10 mM Tris buffer, pH 7.5, containing 0.4 M NaCl, and was eluted with 5.5 ml of 100 mM glycine buffer, pH 2.5. One-tenth volume of 1.0M Tris buffer, pH 8.0, was added. to the eluate, immediately after elution, to neutralize the pH. The glycine eluate was dialysed overnight, against 10 mM Tris, pH 7.5, 150 mM NaCl. Affinity-purified antibodies were used in a Western blot to demonstrate specific recognition of the recombinant neurturin protein. 10 ml of conditioned medium, harvested from cells DG44CHO5-3 (G418) (pCMV-NTN-3-1), was purified on SP Sepharose, as described in example 1, and the proteins were electrophoresed in a gel SDS-PAGE in a tricine regulatory system (Schagger and von Jagow, Analytical Biochemistry, 166: 368-379, 1987). The proteins were electro-engineered to a nitrocellulose membrane in 25 mM Tris, 192 mM glycine, 0.05% SDS, 17% methanol, at 4 ° C for 16 hours. The membrane was incubated with anti-neurturin peptide antibodies, purified by affinity, and then with sheep anti-rabbit IgG, coupled to horseradish peroxidase (Harlow and Lane, supra, pages 498-510). The bound antibodies were detected with enhanced chemiluminescence (ECL equipment, Amersham, Buckinghamshire, England). The anti-neurturin antibodies recognized a single protein band of approximately 11.5 kD, in the conditioned medium of the cells DG44CHO5-3 (G418) (pCMV-NTN-3-1). Using these anti-neurturin antibodies, neurturin protein could be detected in 10 ml of conditioned medium of DG44CHO5-3- (G418) cells (pCMV-NTN-3-1), but could not be detected in 10 ml of conditioned medium with DG44 cells that had not been transformed with the neurturin expression vector.

EXAMPLE 11 The following example illustrates the identification of additional members of the GDNF / neurturin / persephin gene subfamily. The TGF-β superfamily currently contains more than 25 different gene members (for a summary, see Kingsley, Genes and Development, 8: 133-146, 1994, which is incorporated herein by this reference). Individual members of the family exhibit varying degrees of homology to each other, and several subgroups within the superfamily can be defined by means of phylogenetic analysis, using the Clustal V program (Higgins et al., Comput. Appl. Biosci., 8: 189 -191, 1992, which is incorporated herein by this reference), and by means of binding analysis of the phylogenetic trees (Felsenstein, Evolution 39: 783-791, 1985, which is incorporated herein by this reference). Neurturin or persephin are approximately 40% identical with GDNF, but less than 20% identical with any other member of the TGF-β superfamily. Several sequence regions can be identified in neurturin (Figure 5) that are highly conserved within the subfamily of GDNF / neurturin / persephin, but not within the TGF-β superfamily. These conserved regions are capable of characterizing a subfamily containing previously unisolated genes, which can now be isolated using the regions of conserved sequence, identified by the discovery and sequencing of the neurturin and persephin genes. The regions of high sequence conservation between neurturin, persephin and GDNF allow the design of degenerate oligonucleotides that can be used either as probes or as sensitizers. The amino acid sequences of conserved region have been identified herein including Val-Xaa -? - Xaa2.Leu-Gly-Leu-Gly-Tyr, where Xaa-i is Ser, Thr or Ala and Xaa2 is Glu or Asp (SEQ ID NO. : 108); Glu-XaarSaa ^ Xaas-Phe-Arg-Tyr-Cys-Xaa4-Gly-Xaa5-Cys, where Xaai is Thr, Glu or Lys; Xaa2 is Val, Leu or lie, Xaa3 is Leu or lie, Xaa4 is Ala or Ser and Xaa5 is Ala or Ser (SEQ ID NO: 113); And Cys-Cys-Xaa? -Pro-Xaa2-Xaa3-Xaa4-Xaa5-Asp-Xaa6-Xaa -Xaa8-Phe-Leu-Asp-Xaag, where Xaai is Arg or Gln, Xaa2 is Thr or Val or He, Xaa3 is Ala or Ser, Xaa4 is Tyr or Phe, Saa5 is Glu, Asp or Ala, Xaa6 is Glu, Asp or no amino acid, Xaa7 is Val or Leu, Xaa8 is Ser or Thr and Xaag is Asp or Val (SEQ ID NO: 114). The nucleotide sequences containing a coding sequence for the above conserved sequences, or fragments of the above conserved sequences, can be used as probes. The following are exemplary probe and sensitizer sequences that can be designed from these regions: Positive Sensitizers: Sensitizer A (M31 19): 5'- GTNDGNGANYTGGGNYTGGGNTA (SEQ ID NO: 115) 23 nt, which encodes the amino acid sequence Val-XaarXaa2-Leu-Gly-Leu-GlyTyr, where Xaai is Thr, Ser or Ala and Xaa2 is Glu or Asp (SEQ ID NO: 125); Sensitizer B (M3123): 5'-GANBTNWCNTTYYTNGANG (SEQ ID NO: 1 16), 19 nt, which encodes the amino acid sequence Xaa? -Xaa2-Xaa3-Phe-Leu-Xaa4-Xaa, where Xaai is Asp or Glu, Xaa2 is Val or Leu, Xaa3 is Thr or Ser, Xaa4 is Asp or Glu and Xaa5 is Asp or Val (SEQ ID NO: 126); Sensitizer C (M3126): 5'GANBTNWCNTTYYTNGANGW (SEQ ID NO: 1 17), 20 nt, which encodes the Xaar Xaa2-Xaa3-Phe-Leu-Xaa4-Xaa5 amino acid sequence, where Xaai is Asp or Glu, Xaa2 is Val or Leu, Xaa3 is Thr or Ser, Xaa is Asp or Glu and Xaa5 is Asp or Val (SEQ ID NO: 126); Sensitizer D (M3121): 5TTYMGNTAYTGYDSNGGNDSNTG (SEQ ID NO: 1 18), 23 nt, which encodes the amino acid sequence Phe-Arg-Tyr-Cys-XaarGIy-Xaa2-Cys, where Xaai is Ser or Ala and Xaa2 is Ser or Ala (SEQ ID NO: 127); Sensitizer E (M3122): 5'-GTNDGNGANYTGGGNYTNGG (SEQ ID NO: 1 19), 20 nt, which encodes the amino acid sequence Val-Xaa-r Xaa2-Leu-Gly-Leu-Gly, where Xaa! is Thr, Ser or Ala and Xaa2 is Asp or Glu (SEQ ID NO: 128); and Sensitizer F (M3176): 5'-GTNDGNGANYTGGGNYTGGGNTT (SEQ ID NO: 120), 23 nt, which encodes the Val-Xaar amino acid sequence Xaa2-Leu-Gly-Leu-Gly-Phe, where Xaai is Thr, Ser or Ala and Xaa2 is Glu or Asp (SEQ ID NO: 129). Inverse Sensitizers: Sensitizer G (M3125): 5'-WCNTCNARRAANGWNAVNTC (SEQ ID NO: 121), 20 nt, whose inverse complementary sequence encodes the amino acid sequence Xaa -? - Xaa2-Xaa3Phe-Leu-Xaa4-Xaa5, where Xaai is Asp or Glu, Xaa2 is Val or Leu, Xaa3 is Thr or Ser, Xaa4 is Asp or Glu and Xaa5 is Asp or Val (SEQ ID NO: 126); Sensitizer H (M3124): 5'-WCNTCNARRAANGWNAVNT (SEQ ID NO: 122 (19 nt, whose inverse complementary sequence encodes the amino acid sequence Xaa? -Xaa2-Xaa3-Phe-Leu_Xaa4-Xaa5, .where Xaai is Asp or Glu, Xaa2 is Val or Leu, Xaa3 is Thr or Ser, Xaa4 is Asp or Glu and Xaa5 is Asp or Val (SEQ ID NO: 126); Sensitizer I (M3120): 5'-CANSHNCCNSHRCARTANCKRAA (SEQ ID NO: 123), 23 nt, whose inverse complementary sequence encodes the sequence of amino acids Phe-Arg-Tyr-Cys-XaarGly-Xaa2-Cys, where Xaai is Ser or Ala and Xaa2 is Ser or Ala (SEQ ID NO: 127); and Sensitizer J (M3118): 5'- CANSHNCCNSHRCARTANCKRAANA (SEQ ID NO : 124), 25 nt, whose inverse complementary sequence encodes the amino acid sequence XaarPhe-Arg-Tyr-Cys-Xaa2-Gly-Xaa3-Cys, where Xaai is He or Leu, Xaa2 is Ser or Ala and Xaa3 is Ser or Ala (SEQ ID NO: 130) In addition to the foregoing, the following sensitizers are based on the regions conserved in GDNF and neurturin (SEQ ID NO: 33-35): Sensitizer 1, GTNWSNGANYTNGGNYTNGGNTA (SEQ ID NO: 42), which encodes the amino acid sequence Va-Xaa -? - Xaa2-Leu-Gly-Leu-Gly-Tyr, where Xaa! is Ser or Thr and Xaa2 is Glu or Asp (SEQ ID NO: 33); Sensitizer 2: TTYMGNTAYTGYDSNGGNDSNTGYGAN KCNGC (SEQ ID NO: 43) which encodes the amino acid sequence Phe, Arg, Tyr, Cys, Xaa Gly-Xaa2-Cys-Xaa3-Ala, where Xaa! is Ala or Ser, Xaa2 is Ala or Ser, Xaa3 is Glu or Asp and Xaa4 is Ser or Ala (SEQ ID NO: 36); Reverse Sensitizer 3: GCNGMNTCRCANSHNCCNSHR TANCKRAA (SEQ ID NO: 44), whose inverse complementary sequence encodes the amino acid sequence Phe-Arg-Tyr-Cys-XaarGly-Xaa2-Cys-Xaa3-Xaa-Ala, where Xaai is Ala or Ser, Xaa2 is Ala or Ser, Xaa3 is Glu or Asp and Xaa4 is Ser or Ala (SEQ ID NO: 37); Reverse Sensitizer 4: TCRTCNTCRWANGCNRYNGGNCK CARCA (SEQ ID NO: 45) whose inverse complementary sequence encodes the amino acid sequence Cys-Cys-Arg-Pro-Xaa? -Ala-Xaa2-Xaa3-Asp-Xaa, where Xaai is He or Thr or Val; Xaa2 is Tyr or Phe, Xaa3 is Glu or Asp and Xaa4 is Glu or Asp (SEQ ID NO: 38); Reverse Sensitizer 5: TCNARRAANSWNAVNTCRTCNT CRWANGC (SEQ ID NO: 46), whose inverse complementary sequence encodes the amino acid sequence Ala-Xaa -? - Xaa2-Asp-Xaa3-Xaa4-Ser-Phe-Leu-Asp, where Xaai is Tyr or Phe, Xaa2 is Glu or Asp, Xaa3 is Glu or Asp and Xaa4 is Val or Leu (SEQ ID NO: 39); Sensitizer 6: GARRMNBTNHTNTTYMGNTAYTG (SEQ ID NO: 47), which encodes the amino acid sequence Glu-Xaa -? - Xaa2-Xaa3-Phe-Arg-Tyr-Cys, where Xaai is Glu or Thr, Xaa2 is Leu or Val and Xaa3 is He or Leu (SEQ ID NO: 40); Sensitizer 7: GARRMNBTNHTNTTYMGNTAYTGYDSNGGND SNTGHGA (SEQ ID NO: 48), which encodes the amino acid sequence Glu-Xaa? -Xaa2-Xaa3-Phe-Arg-Tyr-Cys-Xaa4-Gly-Xaa5-Cys-Xaa6, where Xaai is Glu or Thr, Xaa2 is Leu or Val, Xaa3 is He or Leu, Xaa is Ser or Ala, Xaa5 is Ser or Ala and Xaa6 is Glu or Asp (SEQ ID NO: 41); The above sequences can be used as probes to select libraries of genomic clones or as sensitizers to amplify gene fragments, from genomic DNA or from libraries of genomic clones, or from the reverse transcribed cDNA, using RNA templates of a variety of tissues. Genomic DNA or libraries of genomic clones can be used as templates, because neurturin, persephin and GDNF encoding sequences for mature proteins are not interrupted by templates.

A degenerate oligonucleotide can be synthesized as a mixture of oligonucleotides containing all possible nucleotide sequences that encode the conserved amino acid sequence. To reduce the number of different oligonucleotides in a degenerate mixture, a base of universal iosin or base can be incorporated (Loakes and co-authors, Nucleic Acids Res., 22, 4039-43, 1994), in the synthesis, in positions in which all four nucleotides are possible. Inosine or universal base forms base pairs with each of the four normal DNA bases, which are less stabilizing than base pairs AT and GC, but which are also less destabilizing than the equalities between normal bases, (ie , AGH, AC, TG, TC). To isolate the family members, a prior 32 P sensitizer can be labeled at the end, using T4 polynucleotide kinase and hybridized to human genomic clone banks according to common and current procedures. A preferred method for isolating the genes of family members would be to use different combinations of the degenerate sensitizers as sensitizers in the polymerase chain reaction, using genomic DNA as a template. The various combinations of sensitizers may include sequential PCR reactions, using sensitized primers, or the use of a posistive sensitizer, which is paired with an oligo-dT sensitizer. In addition, one of the degenerate sensitizers can be used with a vector sensitizer; a single sensitizer can be used in an inverse PCR analysis or CPR can be performed with a degenerate sensitizer and a random sensitizer. As an example of the use of the above set of sensitizers, sensitizer 2 (SEQ ID NO: 43) can be used with sensitizer 4 (SEQ ID NO: 45) in PCR with 1 ug of human genomic DNA and cyclic parameters of 94 °. C for 30 seconds, 50 ° C for 30 seconds and 72 ° C for 60 seconds. The above PCR conditions are exemplary only, and one skilled in the art will readily appreciate that a scale of suitable conditions and sensitizer combinations could be used, or could be optimized, as with different temperatures and varying concentrations of salt in the medium regulator, and the like. It is preferred that DMSO be added to the PCR reaction, at a final concentration of 5%, since it was found that this was necessary for the amplification of this region of the neurturin gene. The PCR reaction, when operating on an agarose gel, must contain products in the size range of 100 to 150 base pairs, since a separation of one amino acid in the neurturin sequence and a separation of five amino acids is introduced in the sequence of persephin, when any of the sequences is aligned with GDNF and, in such a way, the genes of the family member could also contain a slightly variable separation between the conserved sequences of sensitizers 2 and 4. The PCR products on a scale of 100 to 150 base pairs, they must contain multiple amplified gene products, including GDNF, neurturin and persephin, as well as family members not previously isolated. To identify the sequences of these products, they can be gel purified and ligated to the plasmid Bluescript (Stratagene) and then transformed into the host strain of E. Co // XL1-blue (Stratagene). It is possible to collect the bacterial colonies containing individual subclones, for isolation and application on nitrocellulose filters, in two duplicates. Each of the duplicate filters can be screened with an oligonucleotide probe for any of the unique sequences of GDNF or neurturin or persephin in the amplified region. Sequences that do not inhibit GDNF or neurturin or persephin can be sequenced, and if found to encode previously isolated family members, the sequence can be used to isolate full-length cDNA clones, and genomic clones, as it was done for neurturin (example 5). A similar method was used to isolate the new gene members (GDF-3 and GDF-9) of the TGF-β superfamily, based on the homology between the previously identified genes (McPherron J. Biol. Chem., 268: 3444 -3449, 1993, which is incorporated herein by this reference). The inventors hereby believe that the most preferred way of isolating the genes from family members may be to apply the above PCR method as a selection method to isolate genomic clones of the individual member of the family, from a library. This is because there is only one exon for the coding region of both mature neurturin and GDNF. For example, if the above PCR reaction with sensitizers 2 and 4 generates products of the appropriate size using human genomic DNA as a template, the same reaction can be carried out using as a template sets of genomic clones in vector P1 according to well-established methods. known in the art, for example, that used to isolate human genomic clones from neurturin (example 5). The sets containing the neurturin gene in this bank had previously been identified and the sets containing persephin and GDNF can be easily identified by selecting with sensitizers specific for GDNF and PSP. In this way, sets that do not have neurturin, that do not have persephin, that do not have GDNF, that generate a product of the correct size, using the degenerate sensitizers, will be easily recognized as family members not previously isolated. The PCR products generated from these pools can be sequenced directly using the automatic sequencer and the genomic clones can be isolated by further subdivision and selection of the assembled clones as a normal service offered by Genome Systems, Inc.

EXAMPLE 12 The following example illustrates the isolation and identification of persephin, using the methods and sensitizers that were described in Example 11. The degenerate CPR strategy, devised by the inventors herein, has now been successfully used to identify a third factor, persephin, which is approximately 35 to 50% identical to both GDNF and neurturin. The experimental approach was described above and is given in more detail in what follows. Sensitizers corresponding to the amino acid sequence Val-Xaa1-Xaa2-Leu-Gly-Leu-Gly-Tyr were used, where Xaa1 is Ser or Ther and Xaa2 is Glu or Asp (SEQ ID NO: 33) [M1996; 5'GTNWSNGANYTNGGNYTNGGNTA (SEQ ID INO: 42)] and Phe-Arg-Tyr-Cys-Xaa1-Gly-Xaa2-Cys-Xaa3-Xaa4-Ala, where Xaa1 is Ala or Ser, Xaa2 is Ala or Ser, Xaa3 is Glu or Asp and Xaa4 is Ser or Ala (SEQ ID NO: 37) [M1999; 5'-GCNGMNTCRCANSHNCCNSHRCARTANCKRAA (SEQ ID NO: 44)], to amplify a 77 nt fragment of the rat genomic DNA, using the Klentaq enzyme and regulator, under the following conditions: 94 ° C for 30 seconds, 44 ° C for 30 minutes seconds, 72 ° C for 30 seconds, for 40 cycles. The resulting product was subcloned into the Bluescript KS plasmid and sequenced. Sequencing of the entire nucleotide was carried out using the fluorescent dye terminator technology, following the manufacturer's instructions, in an Applied Biosystems automatic sequencer, model 373 (Applid Biosystems, Foster City, CA, E.U.A.). Plasmid DNA was prepared for sequencing using the Miniprep Wizard equipment (Promega Corp., Madison, Wl, E.U.A.), according to the manufacturer's instructions. The sequence of one of the amplified products predicted internal amino acid sequence data with respect to the PCR sensitizers that were different from those of GDNF or neurturin, but that had more than 20% identity with GDNF and neurturin; while the sequences of others corresponding to GDNF or neurturin were obtained, as expected. It was believed that the novel sequence identified a new member of this family, who was named persephin. The sequence of this internal fragment with respect to the sensitizers was 5'-TGCCTCAGAGGAGAAGATTAATC (SEQ ID NO: 90). This encodes the last nucleotide of the Tyr codon, and then encodes the amino acids: Ala-Ser-Glu-Glu-Lys-lle-lle (SEQ ID NO: 91). This sequence was then aligned with the rat sequences of GDNF and neurturin. This analysis confirmed that persephin was unique. IGLGYETKEELIFRYC GDNF (rat) (SEQ ID NO: 92) LGLGYTSDETVLFRYC NTN (rat) (SEQ ID NO: 93) LGLGYASEEKIIFRYC PSP (rat) (SEQ ID NO: 94). To obtain an additional persesphin sequence, sensitizers containing portions of the unique 22 nt amplified fragment were used in the rapid amplification of the cDNA end technique (RACE) (Forhman, MA, Methods in Enzmology, 218: 340-356, 1993), using the Marathon RACE equipment (CLONTECH, Palo Alto, CA, USA), according to the manufacturer's instructions, except that the first one was carried out. Single-cDNA synthesis at 50 ° C using reverse transcriptase Superscript II (Gibco-BRL). Briefly, a two-strand adapter oligonucleotide was ligated to the ends of the double-stranded cDNA, synthesized from 1-day old rat brain mRNA. Using positive sensitizers staked with persephin for PCR, (10135; 5'-AGTCGGGGTTGGGGTATGCCTCA, SEQ ID NO: 95 and M2026; 5'-TATGCCTCAGAGGAGAAGATTATCTT, SEQ ID NO: 96), binding with sensitizers for the ligated adapter, supplied in the kit ( AP1, AP2), the 3 'exremo of the persephin cDNA was amplified by two successive PCR reactions: (first, 10135 and AP1, using 94 ° C for 30 seconds, 60 ° C for 15 seconds and 68 ° C for 2 minutes , for 35 cycles, second: M2026 and AP2, using 94 ° C for 30 seconds, 60 ° C for 15 seconds and 68 ° C for 2 minutes, for 21 cycles). A fragment of about 350 nt was obtained from this PCR reaction and that fragment was sequenced directly using the M2026 sensitizer. The sequence of this 3'-RACE product resulted in a partial sequence of rat persephin cDNA, approximately 350 nt (SEQ ID NO: 97). The predicted amino acid sequence of this cDNA was compared with that of GDNF and neurturin, and it was found to have approximately 40% homology with each of these proteins. It is important that the characteristic separation of the cysteine residues in members of the TGF-β superfamily was present. Additionally, in addition to the region of similarity, encoded by the degenerate sensitizers used to isolate persephin, another region of high homology, shared between GDNF and neurturin, but absent in other members of the TGF-β superfamily, was also present in persephin: GDNF ACCRPVAFDDDLSFLDD (aa 60-76) (SEQ ID NO: 98) NTN: PCCRPTAYEDEVSFKDV (aa 61-77) (SEQ ID NO: 99) PSP PCCQPTSYAD-VTFLDD (aa 57-72) SEQ ID NO: 100) (numbering of amino acids uses the first Cys residue as amino acid No. 1). With confirmation that persephin was actually a new member of the GDNF / neurturin subfamily, murine genomic clones were isolated from persephin, to obtain additional sequence information. Sensitizers (positive, M2026: 5'-TATGCCTCAGAGGAGAAGATTATCTT SEQ ID NO: 96 and inferso, M3028: 5'-TCATCAAGGAAGGTCACATCAGCATA SEQ ID NO: 101) were used corresponding to the rat cDNA sequence, in a PCR reaction (parameters of RCP: 94 ° C for 30 seconds, 55 ° C for 15 seconds, and 72 ° C for 30 seconds, for 35 cycles) to amplify a 155 nt fragment of mouse genomic DNA, which was homologous to the ANDc sequence of rat persephin. These sensitizers were used in order to obtain murine persephin genomic clones, from a mouse 129 / Sv bank in a bacteriophage vector P1 (bank selection service of Genome Systems, Inc., St. Louis, MO, USA). ). Restriction fragments were identified (Neo I of 3.4 kb and Ram H1 of 3.3 kb) from this clone P1 containing the persephin gene, by hybridization with a 210 nt fragment, obtained by PCR, using mouse genomic DNA, with sensitizers (positsivo, M2026; SEQ ID NO: 96 and inverse, M3159, 5'- CCACCACAGCCACAAGCTGCGGSTGAGAGCTG, SEQ ID NO. 102) and CPR parameters: 94 ° C for 30 seconds; 55 ° C for 15 seconds and 72 ° C for 30 seconds, for 35 cycles. The sequences Neo I and Bam H1 were sequenced and found to encode a stretch of amino acids corresponding to the present in the rat persephin RACE product, as well as being homologous to the mature regions of both neurturin and GDNF (Figure 11) . When the amino acid sequences of murine GDNF, neurturin and persephin are aligned using the first cysteine as the starting point (which is done due to alterations in the division sites between the family members, variability is created in the current segments). above the first cysteine), persephin (91 amino acids) is a little smaller than neurturin (95 amino acids or GDNF (94 amino acids)) The general identity within this region is approximately 50% with neurturin and approximately 40% with GDNF (Figure 12) Another nucleotide sequencing of the murine persephin Neo I fragment revealed the nucleotide sequence of the entire murine persephin gene (SEQ ID NO: 131, Figure 17A) .An open reading frame extends from the sequence that encodes an initiating methionine, up to a stop codon at positions 244-246, however, at some point in that sequence there is an apparent anomaly, so that the sequence cia that encodes the RXXR cleavage site (the nucleotides in positions 257-268) and the sequence corresponding to the mature persephin protein (positions 269-556), are not colinear with this open reading frame. Rather, a second reading frame encodes the division site and the persephin matures. Additional sequencing has also been performed in rat persephin. Rat genomic fragments were amplified by PCR using Klentaq and rat genomic DNA as a template. Positive sensitizer No. 40266 (5'-AATCCCCAGGACAGGCAGGCAAT, SEQ ID NO: 137), corresponding to a region upstream of the mouse persephin gene, and a reverse sensitizer M3156 (5'-CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC, SEQ ID NO: 138) , which corresponds to a region within the mature rat persephin sequence, were used with the following parameters (95 ° C for 15 seconds, 55 ° C for 15 seconds, 68 ° C for 45 seconds x 30 cycles). The amplified product was treated with kinase, with T4 polynucleotide kinase, the ends were made blunt with E. coli DNA polymerase I (Klenow fragment) and cloned into the BSKS plasmid. Nucleotide sequencing was carried out to establish the sequence of the whole rat persephin gene (SEQ ID NO: 134, Figure 18A). It was found that an open reading frame extended from the sequence encoding an initiating methionine to a stop codon, at positions 244-246, as seen in the murine persephin. As also seen with murine persephin, it was found that an anomaly occurred between the sequence encoding the initiating methionine and the one coding for the dividing site for mature rat persephin, such that there are two cogent reader frames. Regardless of that abnormality, mammalian cells were found to express persephin from the murine or rat full length genomic sequence, as illustrated below (see example 14). To determine the genesis of this abnormality, mammalian expression vectors were prepared for both murine and rat persephin. To construct the murine plasmid, a clone P1 containing the murine persephin gene was used as a template in a PCR analysis. Sensitizers were designed such that the resulting fragment contained the persephin gene extending from the starter methionine to the stop codon. The PCR reaction used a positive sensitizer M3174 [5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and the reverse sensitizer M3156 [5'-CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC]. To construct the anal rat plasmid, rat genomic DNA was used as a template in a PCR analysis. The PCR reaction used a positsive sensitizer M3174 [5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA] and the reverse sensitizer M3156 [5'-CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC]. The amplified products were cloned into BSKS and sequenced to verify that the correct clone had been obtained. Rat and murine persephin fragments were excised using Sma I and Hind III and cloned into Asp718 (blunt) and Hind lll sites of mammalian expression vector pCB6. Monkey cells were transfected with rat or murine persephin expression vectors, or with the non-recombinant vector (pCB6) itself. The cells were subjected to lysis for the following 48 hours, the samples were loaded on a 15% SDS-polyacrylamide gel, and the proteins were separated by electrophoresis. The proteins were then transferred to nitrocellulose by electrospinning. This nitrocellulose membrane was incubated with anti-persephin antibodies (which were formed for mature persephin, produced in bacteria from a pET plasmid) to detect the presence of persephin in the lysates. Lysates from cells transfected with rat or murine persephin expression vectors, but not lysate from cells transfected with pCB6, contain high amounts of persephin. The size of the persephin detected was 10 to 15 kD, consistent with the predicted size for the processed form (ie, the mature form of persephin). Conditioned media, harvested from these cells, also contained mature persephin. These results demonstrate that both murine and rat persephin genes are capable of directing the synthesis of an appropriately processed persephin molecule. To determine the mechanism by which this occurred, RNA was isolated from cells transfected with the rat or murine persephin expression vector. RT / PCR analysis was carried out, using sensitizers corresponding to the initiating Met and the high codon. Two fragments were detected: one that corresponds to the predicted size of the persephin gene and the other a bit smaller, which suggests that an RNA boost has occurred. This was confirmed with many other sensitizing pairs. The large and small persephin fragments were cloned and sequenced. As expected, the largest fragment corresponded to the persephin gene. The small fragment corresponded to a reinforced version of persephin. A small intron of 88 nt was reinforced within the pro domain (located 154 nt downstream of the start codon). After this reinforcement event, the "frame shift" was no longer present (ie, the initiating Met and the mature region are within the frame or frame) in both rat and mouse persephin (see Figures 17B and 18B).

EXAMPLE 13 This example illustrates the preparation of a bacterial expression vector for murine persephin and its introduction into an E. coli for expression of recombinant mature persephin. The persephin polynucleotide encoding the mature murine persephin protein, which starts five amino acids upstream of the first Cys residue of the framework (SEQ ID NO: 80), was cloned into the expression vector of pET, pET-30a, at the sites Nde I and Bglll. This persephin polynucleotide was generated by PCR, using the murine persephin genome P1 clone as template. An M3157 sensitizer (5'GGACTATCATATGGCCCACCACCACCACCACCACCACCAGGACGACG ACGACCAGGCCTTGGCTGGTTCATGCCGA (SEQ ID NO: 139), which encodes an Nde I site, eight histidine residues and an enterokinase site, and a reverse sensitizer M3156 (5'-CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC, SEQ ID NO: 138 ), which corresponds to the sequence encoding the last six amino acid residues of the mature persephin sequence, the high codon, and a Bgl II site.The reaction conditions of RCP were 95 ° C for 15 seconds, 55 ° C for 15 seconds, 68 ° C for 60 seconds x 25 cycles This PCR product was subcloned into the EcoRV site of the BSKS plasmid and sequenced to verify that it did not contain mutations, then the persephin sequence was excised from this vector, using Nde I and Bgl II, and was cloned into the Nde I (5 ') and Bgl II (3') sites of the bacterial expression vector pET30a (Novagen, Madison, Wl, USA) .This expression vector, therefore, would produce the mature form of the protein persephin that possesses an amino-terminal label consisting of 8 histidine residues directly followed by an enterokinase site. The plasmid was introduced into strain BL21 of E. coli (DE3). To produce persephin, the bacterium that hosts this plasmid was developed for 16 hours; was harvested and lysed using 6M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, at pH 8.0, and the recombinant persephin protein was purified from these lysates, on a Ni-NTA resin (Qiagen) . The protein was eluted using 3 column volumes of regulator E containing 8 M urea, 0.1 M NaH2P04, 0.01 M Tris, at pH 4.5. Then the persephin was renatured by dialysis in renaturation buffer, which consisted of 0.1 M NaH2P0, 0.01 M Tris, at pH 8.3, 0.15 M NaCl, 3 mM cysteine, 0.02% Tween 20, 10% glycerol and It contains decreasing concentrations of urea, starting with 4 M, for 16 hours, followed by 2 M for 16 hours, 1 M for 72 hours and 0.5 M for 16 hours. The concentration of persephin was then determined using a Dot Metric analysis (Geno Technology, St. Louis, MO, E.U.A.), and stored at 4 ° C. This recombinant persephin produced bacterially was used as an immunogen in mice to produce antibodies for mature persephin. All immunogen injections and blood extraction were performed at Cal Tag Inc. (Healdsburg, CA, E.U.A.). It was shown that the anti-persephin antiserum specifically recognized persephin, but not neurturin or GDNF, using protein stain analysis. This specific antiserum for persephin was then used to detect persephin in lysates prepared from transfected COS cells.

EXAMPLE 14 This example illustrates the preparation of mammalian expression vectors, which contain the murine or rat persephin genes, and their incorporation into mammalian cell lines, for the production of mature persephin. To construct the murine plasmid, a clone P1 containing the murine persephin gene was used as a template in a PCR analysis. Sensitizers were designed such that the resulting polynucleotide contained the persephin gene extending from the initiator methionine codon to the high 3 'codon with respect to the mature persephin coding sequence (SEQ ID NO: 131). The PCR reaction used a positive sensitizer M3175 (5'- TGCTGTCACCATGGCTGCAGGAAGACTTCGGA, SEQ ID NO: 138). To construct the anal rat plasmid, rat genomic DNA was used as a template in a PCR analysis. The PCR reaction used a positive sensitizer M3175 (5'-TGCTGTCACCATGGCTGCAGGAAGACTTCGGA, SEQ ID NO: 140) and the reverse sensitizer M3156 (5'- CGGTACCCAGATCTTCAGCCACCACAGCCACAAGC, SEQ ID NO: 138). Both reactions were carried out using Klentaq and the following parameters: 95 ° C for 15 seconds, 55 ° C for 15 seconds, 68 ° C for 45 seconds, x 25 cycles. The amplified products were treated with kinase, with T4 polynucleotide kinase; the ends were made blunt with E. coli DNA polymerase I (Klenow fragment), and cloned into the BSKS plasmid. Nucleotide sequencing was carried out to verify that the correct clone was obtained. The rat and murine persephin polynucleotides were excised using Sma I and Hind III, and each was cloned into an Asp718 (blunt) and Hind III sites of the mammalian expression vector pCB6.

COS monkey cells were transfected with the rat or murine persephin expression vectors (16 μg per 5 x 10 5 cells) or the non-recombinant vector itself (pCB6), using the calcium phosphate precipitation method (Chen and Okayama , Mol. Cell Biol., 7: 2745-2752, 1987, which is incorporated herein by this reference). Forty-eight hours later the cells were subjected to lysis in IP regulator containing 50 mM Tris at pH 7.5, 300 mM NaCl, 1% Triton X-100, 1% deoxycholate, 10 mM EDTA, 0.1% SDS, 5 μg / ml leupeptin, 7 μg / ml pepstatin and 250 μM PMSF. Samples were loaded on a 15% SDS-polyacrylamide gel and proteins were separated by electrophoresis. The proteins were then transferred to nitrocellulose by electrospinning. This nitrocellulose membrane was incubated with anti-persephin antibodies to detect the presence of persephin in the lysates. As shown in Figure 19, lysates of cells transfected with the murine persephin expression vectors, but not the lysate of the cells transfected with pCB6, contain high amounts of persephin. The size of the persephin detected was approximately 14 kD, which is consistent with the predicted size for the processed persephin form, ie mature. This demonstrates that both murine and rat persephin genes are capable of directing the synthesis of a properly processed persephin molecule.

EXAMPLE 15 The following example illustrates the isolation and identification of human persephin. In order to identify the human homologue of persephin or additional members of the GDNF family, degenerate sensitizers for PCR were designed, based on the neurturin and human GDNF sequences, and used to amplify human genomic DNA. The following sensitizers were used (SEQ ID NO: 225-228): Dhneurutirinl (DN1): GTSASYGASYTGGGYCTGGGCTAY REF: B-46Z Dhneuruturin2 (DN2) TTYMGSTACTGCRSMGGCKCYTGC REF: B-46X Dhneurturin3r (DN3) RWAGGCSRTSGGKCKGCARCAKGS REF: B-46V Dhneurturin4r (DN4) MKCRTCYARRAASGACASSTC REF: B-46W Human genomic DNA (Clontech 6550-1, 0.1 μg / μl) was amplified with the four possible sensitizer combinations (DN1-Dn3r, DN1-DN4r, DN2-DN3r, DN2-DNr4). The reaction mixtures contained 5 μl of Klentaq 10x buffer, 0.5 μl of dNTP (20 mM); 1 μl of human genomic DNA, 0.6 μl of Klentaq (Clontech) and 1.5 μl of each sensitizer (0.1 OD / μl), in a total volume of 50 μl. The DNA was amplified by annotation PCR on AMP9600 from Perkin Elmer Gene, under the following conditions: initial denaturation: at 98 ° C for two minutes, then 5 cycles (98 ° C, 30 seconds, 72 ° C, 1.5 minutes), cycles (98 ° C, 30 seconds, 70 ° C, 1.5 minutes) and 25 cycles (98 ° C, 30 minutes, 68 ° C, 1.5 minutes), followed by at least one extension step at 68 ° C for 5 minutes . The PCR products of approximately 130 to 200 base pairs (bp) were identified after electrophoresis on agarose gel, purified and cloned into the pCR 2.1 vector, using the Vitrogen TA cloning kit (Cat. No. K2000). -01). Clones containing an insert of 130-200 bp (after digestion with EcoR1) were sequenced, and one of them (clone A3) obtained with the pair of sensitizers DN1-DN3r had a homologous sequence to the mouse persephin and corresponded to the human persephin. The partial sequence of human persephin genomic DNA in clone A3 is shown below (SEQ ID NO: 229): CGGCTTGTGACCGAGCTGGGCCTGGCTACGCCTCACAGGAGAAGGTCATCTTCCGC TACTGCGCCGGCAGCTGCCCCCGTGGTGCCCGCACCCAGGATGGCCTGGCGCTGGCC CGGCTGCAGGGCCAGGGCCGAGCCCACGGCGGGCCCTGCTGCCGCCCCATGGCC In order to identify a source from which a full-length cDNA clone of human persephin was isolated, cDNA libraries were selected by PCR, using exact match sensitizers, designed based on the sequence and genomic DNA described. above. Two sets of sensitizers specific for human persephin were prepared (SEQ ID NO: 230-233): hPSP-571 GAGGAGAAGGTCATCTTCCG REF: B-95K hPSP-3'.1 GCCGTGGGCTCGGCCCTGGC REF: B-95L hPSP-5'.3 AGAGGAGAAGGTCATCTTCCGCTA REF: C-62Y hPSP-3'.4 CTCGGCCCTGGCCCTGCAGC REF: C-62X and used to amplify single-stranded DNA from pRK5 cDNA libraries (1 μd3 200 ng / μl ) or the Stratagene Quickscreen panel (3 μl from each bank) using the same conditions described above. PCR products of the expected size (108 bp for hPSP-571 with hPSP-3'.1 and 101 bp for hPSP-573 with hPSP-3'.4) were detected in fetal lung, fetal liver, fetal kidney, small intestine , retina, cerebellum; and in the lifoblast hT + 13. To isolate cDNA clones encoding human persephin, pRK5 libraries were enriched from human tissues, for persephin cDNA clones, by extension of the single-strand DNA, from plasmid banks developed in a host dut '. ung ', using any of the following sensitizers (SEQ ID NO: 233-234): hPSP-372 TGCAGCCGGGCCAGCGCCAG REF: D- 68T} hPSP-3'.4 CTCGGCCCTGGCCCTGCAGC REF: C-62X in a reaction containing 10 μl of RCP regulator 10 x (Perkin Elmer), 1 μl of dNTP (20 mM), 1 μl of Amplitaq (Perkin Elmer) added after a hot start The reaction was denatured for one minute at 95 ° C, fixed for one minute at 50, 60 or 68 ° C, then extended for 20 minutes at 72 ° C. The DNA was extracted with phenol / chloroform, precipitated in ethanol, then transformed by electroporation into the host bacterium dH10B. Approximately 40,000 colonies of each transformation were obtained on nylon membranes, and were discriminated with a DNA probe derived from the sequence of clone A3 (described above). The fragment was labeled by the random oligonucleotide method using [32 P] -dCTP. The filters were hybridized overnight at 42 ° C in 50% formamide, 5xSCC, 10x Denhardt, 0.05M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, 50 μg / ml salmon sperm DNA treated sonically The filters were then rinsed in 2xSSC and washed in O.lxSSC, 0.1% SDS, and then exposed overnight to Kodak X-ray films. Pure positsive clones were obtained after secondary selection and the isolated clones were then sequenced. The human persephin clones were isolated from fetal lung, fetal kidney and fetal liver banks. All isolated persephin clones belong to two categories: non-reinforced (10 clones) or chimeric (6 clones). The non-reinforced clones were around 900 bp in length and contain a region encoding a fragment corresponding to human persephin. However, there is no start methionine or signal peptide present in that reading frame (table +2). An upstream potential upstream codon (ATG) is present in another reading frame (+1) and is followed by a hydrophobic sequence corresponding to a potential signal peptide. This suggests that said cDNAs are incompletely reinforced and that an intron remains between the exons encoding the signal peptide and the persephin protein. The consensual donor and recipient sequences of the consensual reinforcement can be identified in positions 340 and 425, respectively. The reinforcement of an intron located between these positions would lead to a cDNA in which the persephin coding sequence is "in frame" with the starting methionine. It is interesting that the aberrant chimeric clones were identified as a result of the binding of a cDNA encoding the predicted exon 2 of persephin, exactly at the booster receptor site, present at position 425. The corresponding transcript was probably generated by aberrant reinforcement, but confirms the presence of a booster receptor site at position 425. As an alternative approach to isolate the human persephin cDNA clone, 3 million clones were selected from a human cerebellum cDNA library in lambda ZAP (No. Stratagene catalog 935201), with a DNA probe corresponding to clone A3 labeled by the random oligonucleotide method, using [32P] -dCTP. The bank was selected under high stringency hybridization conditions. The filters were pre-hybridized for two hours, then hybridized overnight at 42 ° C in 50% formamide, 5xSSC, 10x Denhardt, 0.05M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, 50 μg / ml sonicated salmon sperm DNA. The filters were then rinsed in 2xSSC and washed once in O.lxSSC, 0.1% SDS at 60 ° C. The filters were exposed overnight to Kodak X-ray films. Four positive clones (Cere 1.1, 1.2, 6.1, 6.2) were harvested and plaque purified. The plasmid contained within the arms of phage lambda ZAP was rescued as described according to the manufacturer's instructions, using the auxiliary phage Ex Assist. The sequencing of the four clones indicated that these clones were "blood-line" and contained two silent mutacioins, when compared with human persephin clones isolated from the pRK5 bank, described above. These silent mutations occur at positions 30 (T-»C) and 360 (T-C) of the sequence shown in Figure 24). Direct sequencing of the human persephin gene revealed that these silent mutations are actually allelic variations in the gene. In order to determine if the correct protein could be expressed from the non-spliced cDNA identified above, constructs were generated in which the sequence encoding a flag tag (Flag) inserted just before the stop codon present at position 685 ( frame + 1) or position 746 (frame + 2), starting from an ATG codon present at position 46 or 193. The four possible constructions were generated by PCR, using the following sensitizers (SEQ ID NO: 235-238) : hPSP1 ° Met.F 5'-CGC GGA TCC ATG CCT GGA TTC GAG GGT GCA G 3 'REF: B-127R hPSP2 ° Met.F 5'-CGC GGA TCC ATG GCC GTA GGG AAG TTC CTG C 3' REF B -127S hPSP.FLAG.R 5'-CTC CCA AGC TTT TAC TTG TCA TCG TCG TCC TTG TAG TCG CCA CCA CAG CCG CAG GCC GCC 3 'REF: A-120C HPSP.sig.FLAG.R 5'-CTC CCA AGC TTT TAC TTG TCA TCG TCG TCC TTG TAG TCT CGA CGA CGA AGG CCA CGT CGG TG 3 'REF: A-120B In the four PCR reactions the clone Cere 1.2 was used as template and amplified with Pfu-polymerase, in a 96 cycler with gradient, Robocycler Stratagene. The CPR conditions were: 95 ° C for 2 minutes, 30 cycles of (95 ° C for 30 seconds, 1 minute at 52, 56, 60 or 63 ° C, 72 ° C for 2 minutes), followed by a last extension of 5 minutes at 72 ° C. The positive sensitizers have a Bam Hl site and the reverse sensitizers have a Hind III restriction site. The PCR products digested with Bam Hl and Hind lii were subcloned at those sites in pRK5. The DNA of each of the constructions was transfected into 293 cells, using the CaP0 method. Medium containing serum was conditioned for 24 hours, and then harvested. The cells were also harvested and divided into two: 1/4 of each plate for RT-PCR and the remaining% of each plate for immunoprecipitation. The analysis of the expressed proteins was carried out by immunoprecipitation. The cell pellet was lysed in 1 ml of lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP40, Aprotinin, Leupeptin, PMSF, 1 mM Naf and 1 mM sodium vanadiate) for 20 minutes at 4 ° C. The extract was centrifuged for 10 minutes at 10,000 r.p.m. and then the supernatant was transferred to a new tube and pre-rinsed with 20 μl of Protein A Sepharose, for one hour. From here, one ml of the conditioned medium was processed in parallel. Protein A sepharose was centrifuged and 1 μl of anti-Flag antibody (3.6 μg) was added to each tube. After incubating overnight at 4 ° C, 30 μl of Protein G Sepharose was added and the tubes were incubated at 4 ° C for one hour. The G protein granules were then centrifuged for one minute, washed three times with lysis buffer, resuspended in 20 μl of Laemli buffer, in the presence of beta-mercaptoethanol. The samples were denatured for 5 minutes at 100 ° C, then loaded on a 16% polyacrylamide gel. The proteins were then transferred to nitrocellulose and analyzed by Western blot, using the same anti-Flag antibody overnight, at 1 μg / ml in blocking buffer (PBS + 0.5% Tween + 5% dry fat-free milk + 3% goat serum). After this an anti-mouse HRP.ECL was used for detection and the membrane was exposed for 90 seconds to X-ray film. A specific band of 16 kDa was detected in the cell pellet of cells transfected with the construction starting at ATG 193 of the frame +1 and with the flag inserted in the +2 frame and a specific band of approximately 10 kDa could be detected in the supernatant. No flag-labeled protein could be detected in any other transfection or in fictitious transfected cells. The correctly reinforced mRNA was identified by means of RT-PCR, in the following manner. The total RNA was extracted from the transfected cells (1/4 of each pellet) using RNAzol B (Tel-Text Inc.) and treated for 40 minutes at 37 ° C with Dnasa. The RNA was then purified on an RNAasy column (Promega) and collected in a final volume of 50 μl. The first-strand cDNA was synthesized in 4 μl of RNA using the RT superscript (GIBCO-BRL) for one hour at 37 ° C, then for 5 minutes at 95 ° C, to inactivate. 2 μl of each RT reaction was then used as a template to amplify by PCR in the presence of the following two sensitizers (SEQ ID NO: 236 and 239): hPSP2 ° Met.F 5'-CGCGGATCCATGGCCGTAGGGAAGTTCCTGC 3 'REF: B-127S hPSP. high.R TCAGCCACCACAGCCGCAGGCAGCC REF: D-103N or a gradient 96 cycler, from Stratagene Robocyler. The CPR conditions were: 98 ° C for 1.5 minutes, 28 cycles of (98 ° C for 30 seconds, fixation 1 minute between 60 ° C and 76 ° C, 72 ° C for 1.5 minutes), followed by a final extension of 5 minutes at 72 ° C. Analysis of the PCR product on agarose gel indicates that PCR using the plasmid pRK5.hPSP-FLAG.2 as template gave the expected product of around 570 bp, whereas the RT-PCR product, using RNA from cells transfected with this construct as a template, was less than 500 bp. The PCR product from this last reaction was subcloned into the pCR 2.1 vector, using the Invitrogen TA cloning kit (Catalog No. K2000-01) and sequenced. Sequence analysis revealed that the predicted 84 bp intron had been reinforced outside the transcript. In summary, the human persephin cDNA has an open reading frame of 471 bp which encodes a protein of 156 amino acids long (predicted Mr 16.6 kDA). The division of the predicted signal peptide, 23 amino acids long, will lead to a molecule of pro-persephin of 133 amino acids (Mr 14.2 kDa); the proteolytic cleavage of pro-persephin in a RXXR consensus sequence should yield a mature protein of 96 amino acids, with a molecular weight of 10.3 kDa. This predicted size corresponds to the size of the flagged, immunoprecipitated protein of the conditioned medium of 293 transfected cells. Additionally, the amino-terminal sequencing of the flag-marked persephin, purified from the conditioned medium of 293 transfected cells, confirmed that the first residue of the mature form is Ala 61. The alignment between human persephin and human neurturin indicates 38% similarity between the two molecules (50% for the mature region) and the human persephin have 30% similarity with human GDNF (40% in the mature region).

EXAMPLE 16 This example illustrates the preparation of chimeric or hybrid polypeptide molecules containing portions derived from persephin (PSP) and portions derived from neurturin (NTN). As closely related members of the TGF-ß family, it is predicted that each of persephin and neurturin will have a very similar general structure, but while neurturin promotes the survival of sympathetic neurons, persephin, intimately related, does not. Two chimeras were produced essentially replacing portions of persephin with neurturin, with the crossing point located between two adjacent residues, the third and the fourth, highly conserved cysteines. The first chimera, designated PSP / NTN (SEQ ID NO: 141, FIG. 20), contains the first 63 residues of murine mature persephin, combined with residues 68 to 100 of murine mature neurturin (using preferred codons of E. coli). ). To construct this molecule, two PCR reactions were carried out: 1) using the positive sensitizer M2012 (5'-TAATACGACTCACTATAGGGGAA, SEQ ID NO: 142) and the reverse sensitizer M2188 (5'-TCGTCTTCGTAAGCAGTCGG ACGGCAGCAGGGTCGGCCATGGGCTCGAC, SEQ ID NO: 143) and the murine pET30a-murine plasmid, as template (see Example 13); and 2) using the positive sensitizer M2190 (5'-TGCTGCCGTCCGACTGCTTACGAAGACGA SEQ ID NO 144) and the reverse sensitizer M2186 (5'-GTTATGCTAGTTATTGCTCAGCGGT, SEQ ID NO: 145) and neurturin plasmid pET30a-murine (preferred codons of E. coli ) as a template (see example 6). Both CPR reactions were carried out using the following parameters: 94 ° C for 30 seconds; 55 ° C for 30 seconds, 72 ° C for 30 seconds x 25 cycles. The products of these two PCR reactions were gel purified, mixed together and a PCR reaction was carried out under the following conditions: 94 ° C for 30 seconds, 60 ° C for 20 minutes, 68 ° C for 5 minutes. After 8 cycles an aliquot of this reaction was used as a template in a third PCR reaction, using the positive sensitizer M2012 and the reverse sensitizer M2186, under the following conditions: 94 ° C for 30 seconds; 55 ° C for 30 seconds, 72 ° C for 30 seconds x 25 cycles. The resulting product was treated with T4 polynucleotide kinase, the ends were accrossed with E. coli DNA polymerase I (Klenow fragment) and cloned into the BSKS plasmid. The nucleotide was sequenced to verify that the correct clone was obtained. The PSP / NTN fragment was excised using Nde I and Bam H1 and cloned into the corresponding sites of the bacterial expression vector pET30a. The second chimera, called NTN / PSO (SEQ ID NO: 156, figure 20), encodes the inverse molecule. It contains the first 67 residues of murine mature neurturin (using the preferred codons of E. coli) combined with residues 64 to 96 of mature murine persephin. To construct this molecule, two PCR reactions were carried out: 1) using the positive sensitizer M2012 and the reverse sensitizer M2183 (5'-CACATCAGCATAGCTGGTGGGAGCACGGGTGAGCACGAGCACG TT SEQ ID NO: 147) and the nudeurin plasmid pET30a-murine (preferred codons of E). .coli) as a template; and 2) using the positive sensitizer M2185 (5'-TGCTGCCAGCCCACCAGCTATGCTG SEQ ID NO: 148) and the reverse sensitizer M2186 (5'-GTTATGCTAGTTATTGCTCAGCGGT SEQ ID NO: 145) and the murine pET30a-murine plasmid as template. Both CPR reactions were performed using the following parameters: 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 30 seconds, for 25 cycles. The products of these two PCR reactions were used to construct the final plasmid NTN / PSP pET30a, as detailed above for PSP / NTN, except that Bgl II was used instead of Bam H1. These chimeric proteins were produced in E. coli and purified by Ni-NTA chromatography, as described above (example 13). The purified proteins were analyzed for their ability to promote survival in the analysis of sympathetic SCG neurons. The NTN / PSP protein did not promote survival, whereas the PSP / NTN protein promoted the survival of sympathetic neurons in a similar way to that observed for neurturin itself. These results indicate that the neurturin residues that remain under the two adjacent highly conserved cysteine residues are critical for activity by promoting survival in the sympathetic neurons of SCG. In contrast, the corresponding residues of persephin are not sufficient to promote survival in sympathetic neurons.

EXAMPLE 17 This example illustrates the neuronal survival promoting activity of persephin in mesencephalic cells. The profile of the persephin-promoting survival activity is different from that of neurturin and GDNF. In contrast to the survival-promoting activity produced by neurturin and GDNF in sympathetic and sensory neurons, persephin does not show survival-promoting activity in these tissues. The neuronal survival promoting activity of persephin in mesencephalic cells was further evaluated. Controlled time pregnant Sprague-Dawley rats were purchased from Harlan Sprague-Dawley. The mesocephalon was taken from the rats, which measured 1.2 to 1.4 cm long and with a time dated as day 14 embryo. He removed his skull and placed the entire mesocephalus in cold L15. The mesencephalic tissue was resuspended in a serum-free medium consisting of DME / Hams F12 (No. 11330-032, Life Technologies), 1 mg / ml BSA, Fraction V (A-6793, Sigma Chemical Co.) , 5 μM insulin (I-5500, Sigma), 10 nM progesterone (PO130, Sigma), 100 μM putrescine (p7505, Sigma), 30 nM selenium (SO7150, Pflatz &Bauer), 10 ng / ml of rat transferrin (012-000-050, Jacson Chrompure), 100 U / ml of penicillin and 100 U / ml of streptomycin. The assembled mesencephalic tissues were ground, approximately 80 times, using a bent-tipped pipette, and the cells were spread on a plate of 24 concavities (CoStar) at a density of 15,000 cells in a 10 μl drop. Plates were coated with 125 ng / ml poly-d-lysine (p-7280, Sigma) and 25 ng / ml laminin (No. 40232, Collaborative Biomedical Products). These dissociated cells were allowed to bind for two hours at 37 ° C in 5% CO 2 and then fed with another 500 μl of the above serum-free medium, with or without approximately 100 ng / ml of recombinant persephin. These cells were photographed after three days of culture. Inspection of the cells over the course of three days in the culture showed a gradual decrease in the number of cells. In the absence of any growth factor, almost all cells died (Figure 21 A). In the presence of persephin, a great increase in the survival of mesencephalic neuronal cells was evident (figures 21 B). This study was repeated to obtain comparative effects in mesencephalic cells, for persephin and the related growth factors neurturin and GDNF. Mesencephalic tissue was removed from E14 pair pps, it was collected and dissociated in dispase for 30 minutes. The cells were then ground and spread on supplemented N2 medium and plaque formed at a density of 20,000 cells per concavity on a slide with 8-chamber concavity. The cells of a given concavity were left untreated or were treated with a growth factor at 50 ng / ml for four days. The cells were washed once with PBS, fixed with 4% paraformaldehyde for 30 minutes and stained with the tyrosine hydroxylase antibody (TOH) (Chemicon, ABC-Vectastain) and counted. Staining with TOH served as a marker for dopaminergic cells since TOH is a synthetic enzyme for dopamine. Figure 22 shows the mean cell counts for the treated and treated cells. The persephin (PSP), the neurturin (NTN) and the GDNF promoted the survival of mesencephalic neuronal cells to a comparable degree.

EXAMPLE 18 This example illustrates the expression of persephin in various tissues. An investigation of the expression of persephin in adult mouse tissues was carried out using semi-quantitative RT / PCR (see example 9). Poly A RNA was isolated from the brain, cerebellum, kidney, lung, heart, ovaries, sciatic nerve, dorsal root ganglion, blood and spleen. It was then reverse transcribed to produce cDNA (see Kotzbauer and co-authors, Nature, 385: 467-470, 1996, which is incorporated herein by this reference). The PCR sensitizers used were the following: positive sensitizer: 5'-CCTCGGAGGAGAAGGTCATCTTC (SEQ ID NO: 149) and reverse sensitizer: 5'-TCATCAAGGAAGGTCACATCAGCATA (SEQ ID NO: 101). CPR was performed for 26 cycles with a fixation temperature of 60 ° C. To control the presence of genomic DNA, RNA samples were used that were not reverse transcribed for PCR (for example, the tissue control shown in figure 23 is marked "kidney without RT"). It was found that all samples were without contamination with genomic DNA. As shown in figure 23, a correctly sized band (160 bp) was seen in the kidney sample. At higher cycle numbers you can also see a band of persephin in the brain. Thus, the distribution of persephin expression in various mouse tissues differs from neurturin in rats (Example 8).

Deposit of the strain The following stock is in deposit, according to the terms of the Budapest Treaty, with American Type Culture Collection, 12301 Parkiawn Drive, Rockville, MD, E.U.A. The access number indicated was assigned after satisfactorily testing the viability, and having paid the required fees. Access to said crops will be available during the processing time of the patent application, to the person designated by the Commissioner with the right to do so, pursuant to 37 CFR 1.14 and 35 USC 122. Any restriction on the availability of said crops to the public will be eliminated. irrevocably upon granting the patent, based on the request. In addition, designated deposits will be maintained for a period of thirty (30) years from the date of deposit, or for five (5) years after the last request for deposit, or during the term of the US patent, make it longer In the event that a culture becomes non-viable, or is not destroyed intentionally, or if the plasmid-containing strains lose their plasmid, they will be replaced by a viable culture. The deposited materials mentioned herein are intended solely for convenience and are not necessary to practice the present invention, in view of the description herein and, further, these materials are incorporated herein by this reference.

In view of the above, it will be evident that the various advantages of the invention are obtained and that other advantageous results are achieved. Since several changes could be made to the above methods and compositions, without departing from the scope of the invention, it is intended that all material contained in the preceding description and shown in the accompanying drawings be construed as illustrative and not in any sense limitative.

LIST OF SEQUENCES (1) .- GENERAL INFORMATION: (i). APPLICANT: Johnson, Eugene M .; Milbrandt, Jeffrey D. Kotzbauer, Paul T. Lampe, Patricia A. Klein, Robert Desauvage, Fred. (ii). TITLE OF THE INVENTION: Persefin and related growth factor, (ii). NUMBER OF SEQUENCES: 242. (iv). ADDRESS FOR CORRESPONDENCE: (A). RECIPIENT: Howell & Haferkamp, L.C. (B): STREET: 7733 Forsyth Boulevard, Suite 1400 (C): CITY: St. Louis (D): STATE: MO (E): COUNTRY: E.U.A. (F): ZIP: 63105 (v). FORM TO BE READ IN COMPUTER: (A): TYPE OF MEDIUM: flexible disk (B): COMPUTER: PC compatible with IBM (C): OPERATING SYSTEM: PC-DOS / MS-DOS (D): PROGRAM: Patenln, emission 1.0, version 1.30 (vi). CURRENT APPLICATION DATA: (A): APPLICATION NUMBER: (B): SUBMISSION DATE: (C): CLASSIFICATION: (viii) INFORMATION ABOUT POWDER / AGENT: (A): NAME: Holland, Donald R. (B): REGISTRATION NO .: 35,197 (C): REFERENCE / CASE No: 971486 (¡x): TELECOMMUNICATIONS INFORMATION: (A): TELEPHONE: 314-727- 5188 (B): TELEFAX: 314-727-6092 (2) INFORMATION FOR SEQ ID NO: 1: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1 Wing Arg Leu Gly Wing Arg Pro Cys Gly Leu Arg Glu Leu Glu Val Arg 1 5 10 15 Val Ser Glu Leu Gly Leu Gly Tyr Wing Ser Asp Glu Thr Val Leu Phe 20 25 30 Arg Tyr Cys Wing Gly Wing Cys Glu Wing Wing Wing Arg Val Tyr Asp Leu 35 40 45 Gly Leu Arg Arg Leu Arg Gln Arg Arg Arg Leu Arg Arg Glu Arg Val 50 55 60 Arg Wing Gln Pro Cys Cys Arg Pro Thr Wing Tyr Glu Asp Glu Val Ser 65 70 75 80 Phe Leu Asp Ala His Ser Arg Tyr His Thr Val His Glu Leu Ser Wing 85 90 95 Arg Glu Cys Ala Cys Val 100 (2) .- INFORMATION FOR SEQ ID NO: 2: (i): CHARACTERISTICS OF THE SEQUENCE: (A ): LENGTH: 100 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 Pro Gly Wing Arg Pro Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser 1 5 10 15 Glu Leu Gly Leu Gly Tyr Thr Ser Asp Glu Thr Val Leu Phe Arg Tyr 20 25 30 Cys Ala Gly Ala Cys Glu Ala Ala lie Arg lie Tyr Asp Leu Gly Leu 35 40 45 Arg Arg Leu Arg Gln Arg Arg Arg Arg Arg Glu Arg Ala Arg Wing 50 55 60 His Pro Cys Cys Arg Pro Thr Wing Tyr Glu Asp Glu Val Ser Phe Leu 65 70 75 80 Asp Val His Ser Arg Tyr His Thr Leu Gln Glu Leu Ser Wing Arg Glu 85 90 95 Cys Ala Cys Val 100 (2) .- INFORMATION FOR SEQ ID NO: 3: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 6 (D): OTHER INFORMATION: / note "ANY AMINO ACID" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 Ser Gly Ala Arg Pro Xaa Gly Leu Arg Glu Leu Glu Val Ser Val Ser 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 4: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 10 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 1 (D): OTHER INFORMATION: / note = "ANY AMINOACIDO "(xi): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 6 (D): OTHER INFORMATION: / note =" SERINA OR CISTEINA "(xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4 Xaa Cys Ala Gly Ala Xaa Glu Ala Ala Val 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 5: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 1 (D): OTHER INFORMATION: / note = "ANY AMINO ACID "(xi): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note =" ANY AMINOACIDO "(xi): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 17 (D): OTHER INFORMATION: / note =" GLUTAMINE OR GLUTAMIC ACID "(xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5 Xaa Xaa Val Glu Ala Lys Pro Cys Cys Gly Pro Thr Ala Tyr Glu Asp 1 5 10 15 Xaa Valñ Ser Phe Leu Ser 20 (2) .- INFORMATION FOR SEQ ID NO: 6: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 10 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6 Tyr His Thr Leu Gln Glu Leu Ser Ala Ag 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 7: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 197 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7 Met Gln Arg Trp Lys Wing Wing Wing Leu Wing Being Val Leu Cys Ser Being 1 5 10 15 Val Leu Ser lie Trp Met Cys Arg Glu Gly Leu Leu Leu Ser His Arg 20 25 30 Leu Gly Pro Wing Leu Val Pro Leu His Arg Leu Pro Arg Thr Leu Asp 35 40 45 Wing Arg lie Wing Arg Leu Wing Gln Tyr Arg Wing Leu Leu Gln Gly Wing 50 55 60 Pro Asp Wing Met Glu Leu Arg Glu Leu Thr Pro Trp Wing Gly Arg Pro 65 70 75 80 Pro Gly Pro Arg Arg Arg Wing Gly Pro Arg Arg Wing Arg Wing Arg Wing 85 90 95 Arg Leu Gly Wing Arg Pro Cys Gly Leu Arg Glu Leu Glu Val Arg Val 100 105 110 Ser Glu Leu Gly Leu Gly Tyr Wing Ser Asp Glu Thr Val Leu Phe Arg 115 120 125 Tyr Cys Ala Gly Ala Cys Glu Ala Ala Ala Arg Val Tyr Asp Leu Gly 130 135 140 Leu Arg Arg Leu Arg Gln Arg Arg Arg Leu Arg Arg Glu Arg Val Arg 145 150 155 160 Ala Gln Pro Cys Cys Arg Pro Thr Ala Tyr Glu Asp Glu Val Ser Phe 165 170 175 Leu Asp Ala His Ser Arg Tyr His Thr Val His Glu Leu Ser Ala Arg 180 185 190 Glu Cys Ala Cys Val 195 (2) .- INFORMATION FOR SEQ ID NO: 8: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 195 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 8 Met Arg Arg Trp Lys Ala Ala Ala Ala Val Ser Leu lie Cys Ser Ser 1 5 10 15 Leu Leu Ser Val Trp Met Cys Gln Glu Glu Leu Leu Glu His Arg 20 25 30 Leu Gly Pro Wing Leu Wing Pro Leu Arg Arg Pro Pro Arg Thr Leu Asp 35 40 45 Wing Arg lie Wing Arg Leu Wing Gln Tyr Arg Wing Leu Leu Gln Gly Wing 50 55 60 Pro Asp Wing Val Glu Leu Arg Glu Leu Ser Pro Trp Wing Wing Arg lie 65 70 75 80 Pro Gly Pro Arg Arg Arg Wing Gly Pro Arg Arg Wing Arg Wing Arg Pro 85 90 95 Gly Wing Arg Pro Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser Glu 100 105 lio Leu Gly Leu Gly Tyr Thr Ser Asp Glu Thr Val Leu Phe Arg Tyr Cys 115 120 125 Wing Gly Wing Cys Glu Wing Wing Arg lie Tyr Asp Leu Gly Leu Arg 130 135 140 Arg Leu Arg Gln Arg Arg Arg Arg Val Arg Arg Arg Ala Arg Ala His 145 150 155 160 Pro Cys Cys Arg Pro Thr Wing Tyr Glu Asp Glu Val Ser Phe Leu Asp 165 170 175 Val His Ser Arg Tyr His Thr Leu Gln Glu Leu Ser Wing Arg Glu Cys 180 185 190 Wing Cys Val 195 (2) .- INFORMATION FOR SEQ ID NO: 9: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 306 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9 GCGCGGTTGG GGGCGCGGCC TTGCGGGCTG CGCGAGCTGG AGGTGCGCGT GAGCGAGCTG 60 GGCCTGGGCT ACGCGTCCGA CGAGACGGTG CTGTTCCGCT ACTGCGCAGG CGCCTGCGAG 120 GCTGCCGCGC GCGTCTACGA CCTCGGGCTG CGACGACTGC GCCAGCGGCG GCGCCTGCGG 180 CGGGAGCGGG TGCGCGCGCA GCCCTGCTGC CGCCCGACGG CCTACGAGGA CGAGGTGTCC 240 TTCCTGGACG CGCACAGCCG CTACCACACG GTGCACGAGC TGTCGGCGCG CGAGTGCGCC 300 TOCGTG 306 (2) .- INFORMATION FOR SEQ ID NO: 10: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 300 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10 CCGGGGGCTCGGCCTTGTGG GCTGCGCGAG CTCGAGGTGC GCGTGAGCGA GCTGGGCCTG 60 GGCTACACGT CGGATGAGAC CGTGCTGTTC CGCTACTGCG CAGGCGCGTG CGAGGCGGCC 120 ATCCGCATCT ACGACCTGGG CCTTCGGCGC CTGCGCCAGC GGAGGCGCGT GCGCAGAGAG 180 CGGGCGCGGG CGCACCCGTG TTGTCGCCCG ACGGCCTATG AGGACGAGGT GTCCTTCCTG 240 GACGTGCACA GCCGCTACCA CACGCTGCAA GAGCTGTCGG CGCGGGAGTG CGCGTGCGTG 300 (2) .- INFORMATION FOR SEQ ID NO: 11: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 591 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11 ATGCAGCGCT GGAAGGCGGC GGCCTTGGCC TCAGTGCTCT GCAGCTCCGT GCTGTCCATC 60 TGGATGTGTC GAGAGGGCCT GCTTCTCAGC CACCGCCTCG GACCTGCGCT GGTCCCCCTG 120 CACCGCCTGC CTCGAACCCT GGACGCCCGG ATTGCCCGCC TGGCCCAGTA CCGTGCACTC 180 CTGCAGGGGG CCCCGGATGC GATGGAGCTG CGCGAGCTGA CGCCCTGGGC TGGGCGGCCC 240 CCAGGTCCGC GCCGTCGGGC GGGGCCCCGG CGGCGGCGCG CGCGTGCGCG GTTGGGGGCG 300 CGGCCTTGCG GGCTGCGCGA GCTGGAGGTG CGCGTGAGCG AGCTGGGCCT GGGCTACGCG 360 TCCGACGAGA CGGTGCTGTT CCGCTACTGC GCAGGCGCCT GCGAGGCTGC CGCGCGCGTC 420 TACGACCTCG GGCTGCGACG ACTGCGCCAG CGGCGGCGCC TGCGGCGGGA GCGGGTGCGC 480 GCGCAGCCCT GCTGCCGCCC GACGGCCTAC GAGGACGAGG TGTCCTTCCT GGACGCGCAC 540 AGCCGCTACC ACACGGTGCA CGAGCTGTCG GCGCGCGAGT GCGCCTGCGT G 591 (2) .- INFORMATION FOR SEQ ID NO: 12: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 585 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12 ATGAGGCGCT GGAAGGCAGC GGCCCTGGTG TCGCTCATCT GCAGCTCCCT GCTATCTGTC 60 TGGATGTGCC AGGAGGGTCT GCTCTTGGGC CACCGCCTGG GACCCGCGCT TGCCCCGCTA 120 CGACGCCCTC CACGCACCCT GGACGCCCGC ATCGCCCGCC TGGCCCAGTA TCGCGCTCTG 180 CTCCAGGGCG CCCCCGACGC GGTGGAGCTT CGAGAACTTT CTCCCTGGGC TGCCCGCATC 240 CCGGGACCGC GCCGTCGAGC GGGTCCCCGG CGTCGGCGGG CGCGGCCGGG GGCTCGGCCT 300 TGTGGGCTGC GCGAGCTCGA GGTGCGCGTG AGCGAGCTGG GCCTGGGCTA CACGTCGGAT 360 GAGACCGTGC TGTTCCGCTA CTGCGCAGGC GCGTGCGAGG CGGCCATCCG CATCTACGAC 420 CTGGGCCTTC GGCGCCTGCG CCAGCGGAGG CGCGTGCGCA GAGAGCGGGC GCGGGCGCAC 480 CCGTGTTGTC GCCCGACGGC CTATGAGGAC GAGGTGTCCT TCCTGGACGT GCACAGCCGC 540 TACCACACGC TGCAAGAGCT GTCGGCGCGG GAGTGCGCGT GCGTG 585 (2) .- INFORMATION FOR SEQ ID NO: 13: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 348 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13 GGAGGGAGAG CGCGCGGTGG TTTCGTCCGT GTGCCCCGCG CCCGGCGCTC CTCGCGTGGC 60 CCCGCGTCCT GAGCGCGCTC CAGCCTCCCA CGCGCGCCAC CCCGGGGTTC ACTGAGCCCG 120 GCGAGCCCGG GGAAGACAGA GAAAGAGAGG CCAGGGGGGG AACCCCATGG CCCGGCCCGT 180 GTCCCGCACC CTGTGCGGTG GCCTCCTCCG GCACGGGGTC CCCGGGTCGC CTCCGGTCCC 240 CGCGATCCGG ATGGCGCACG CAGTGGCTGG GGCCGGGCCG GGCTCGGGTG GTCGGAGGAG 300 TCACCACTGA CCGGGTCATC TGGAGCCCGT GGCAGGCCGA GGCCCAGG 348 (2) .- INFORMATION FOR SEQ ID NO: 14: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 87 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: only one (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14 TGCTACCTCA CGCCCCCCGA CCTGCGAAAG GGCCCTCCCT GCCGACCCTC GCTGAGAACT 60 GACTTCACAT AAAGTGTGGG AACTCCC 87 (2) .- INFORMATION FOR SEQ ID NO: 15: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 19 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15 Met GIn Arg Trp Lys Ala Ala Ala Leu Ala Ser Val Leu Cys Ser Ser 1 5 10 15 Val Leu Ser (2) .- INFORMATION FOR SEQ ID NO: 16: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 19 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 16 Met Arg Arg Trp Lys Ala Ala Ala Leu Val Ser Leu lie Cys Ser Ser Leu Leu Ser 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 17: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 57 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 17 ATGCAGCGCT GGAAGGCGGC GGCCTTGGCC TCAGTGCTCT GCAGCTCCGT GCTGTCC 57 (2) .- INFORMATION FOR SEQ ID NO: 18: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 57 base pairs (B): TYPE: nucleic acid (C): No. DE FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 18 ATGAGGCGCT GGAAGGCAGC GGCCCTGGTG TCGCTCATCT GCAGCTCCCT GCTATCT 57 (2) .- INFORMATION FOR SEQ ID NO: 19: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 76 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 19 lie Trp Met Cys Arg Glu Gly Leu Leu Leu Ser His Arg Leu Gly Pro 1 5 10 15 Wing Leu Val Pro Leu His Arg Leu Pro Arg Thr Leu Asp Wing Arg lie 20 25 30 Wing Arg Leu Wing Gln Tyr Arg Wing Leu Leu Gln Gly Ala Pro Asp Wing 35 40 45 Met Glu Leu Arg Glu Leu Thr Pro Trp Wing Gly Arg Pro Pro Gly Pro 50 55 60 Arg Arg Arg Wing Gly Pro Arg Arg Arg Arg Wing Arg 65 70 75 (2) .- INFORMATION FOR SEQ ID NO: 20: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 222 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 20 ATCTGGATGT GTCGAGAGGG CCTGCTTCTC AGCCACCGCC TCGGACCTGC GCTGGTCCCC 60 CTGCACCGCC TGCCTCGAAC CCTGGACGCC CGGATTGCCC GCCTGGCCCA GTACCGTGCA 120 CTCCTGCAGG GGGCCCCGGA TGCGATGGAG CTGCGCGAGC TGACGCCCTG GGCTGGGCGG 180 CCCCCAGGTC CGCGCCGTCG GGCGGGGCCC CGGCGGCGGC GCGCGCGT 228 (2) .- INFORMATION FOR SEQ ID NO: 21: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 228 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 21 GTCTGGATGT GCCAGGAGGG TCTGCTCTTG GGCCACCGCC TGGGACCCGC GCTTGCCCCG 60 CTACGACGCC CTCCACGCAC CCTGGACGCC CGCATCGCCC GCCTGGCCCA GTATCGCGCT 120 CTGCTCCAGG GCGCCCCCGA CGCGGTGGAG CTTCGAGAAC TTTCTCCCTG GGCTGCCCGC 180 ATCCCGGGAC CGCGCCGTCG AGCGGGTCCC CGGCGTCGGC GGGCGCGG 228 (2) - INFORMATION FOR SEQ ID NO: 22: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 76 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY : linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 22 Val Trp Met Cys Gln Glu Gly Leu Leu Gly His Arg Leu Gly Pro 1 5 10 15 Ala Leu Ala Pro Leu Arg Arg Pro Pro Arg Thr Leu Asp Ala Arg lie 20 25 30 Wing Arg Leu Wing Gln Tyr Arg Wing Leu Leu Gln Gly Wing Pro Asp Wing 35 40 45. Val Glu Leu Arg Glu Leu Ser Pro Trp Wing Wing Arg lie Pro Gly Pro 50 55 60 Arg Arg Arg Wing Gly Pro Arg Arg Arg Arg Ala Arg 65 70 75 (2) .- INFORMATION FOR SEQ ID NO: 23: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 95 amino acids (B): TYPE: amino acid (C): No. FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 23 Met Gln Arg Trp Lys Wing Wing Wing Leu Wing Being Val Leu Cys Ser Being 1 5 10 15 Val Leu Ser lie Trp Met Cy SsEAQrg2G3lu Gly Leu Leu Leu Ser His Arg 20 25 30 Leu Gly Pro Wing Leu Val Pro Leu His Arg Leu Pro Arg Thr Leu Asp 35 40 45 Wing Arg lie Wing Arg Leu Wing Gln Tyr Arg Wing Leu Leu Gln Gly Wing 50 55 60 Pro Asp Wing Met Glu Leu Arg Glu Leu Thr Pro Trp Wing Gly Arg Pro 65 70 75 80 Pro Gly Pro Arg Arg Arg Wing Gly Pro Arg Arg Arg Arg Wing Arg 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 24: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 95 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 24 Met Arg Arg Trp Lys Wing Wing Wing Leu Val Being Leu lie Cys Ser Being 1 5 10 15 Leu Leu Being Val Trp Met Cys Gln Glu Glu Leu Leu Glu His Arg 20 25 30 Leu Gly Pro Wing Leu Wing Pro Leu Arg Arg Pro Pro Arg Thr Leu Asp 35 40 45 Wing Arg lie Wing Arg Leu Wing Gln Tyr Arg Wing Leu Leu Gln Gly Wing 50 55 60 Pro Asp Wing Val Glu Leu Arg Glu Leu Ser Pro Trp Wing Wing Arg lie 65 70 75 80 Pro Gly Pro Arg Arg Arg Ala Gly Arg Arg Arg Arg Ala Arg 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 25: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 285 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 25 ATGCAGCGCT GGAAGGCGGC GGCCTTGGCC TCAGTGCTCT GCAGCTCCGT GCTGTCCATC 60 TGGATGTGTC GAGAGGGCCT GCTTCTCAGC CACCGCCTCG GACCTGCGCT GGTCCCCCTG 120 CACCGCCTGC CTCGAACCCT GGACGCCCGG ATTGCCCGCC TGGCCCAGTA CCGTGCACTC 180 CTGCAGGGGG CCCCGGATGC GATGGAGCTG CGCGAGCTGA CGCCCTGGGC TGGGCGGCCC 240 CCAGGTCCGC GCCGTCGGGC GGGGCCCCGG CGGCGGCGCG CGCGT 285 (2) .- INFORMATION FOR SEQ ID NO: 26: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 225 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 26 ATGAGGCGCT GGAAGGCAGC GGCCCTGGTG TCGCTCATCT GCAGCTCCCT GCTATCTGTC 60 TGGATGTGCC AGGAGGGTCT GCTCTTGGGC CACCGCCTGG GACCCGCGCT TGCCCCGCTA 120 CGACGCCCTC CACGCACCCT GGACGCCCGC ATCGCCCGCC TGGCCCAGTA TCGCGCTCTG 180 CTCCAGGGCG CCCCCGACGC GGTGGAGCTT CGAGAACTTT CTCCCTGGGC TGCCCGCATC 240 CCGGGACCGC GCCGTCGAGC GGGTCCCCGG CGTCGGCGGG CGCGG 285 (2) .- INFORMATION FOR SEQ ID NO: 27: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 169 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 27 ATGCAGCGCT GGAAGGCGGC GGCCTTGGCC TCAGTGCTCT GCAGCTCCGT GCTGTCCATC 60 TGGATGTGTC GAGAGGGCCT GCTTCTCAGC CACCGCCTCG GACCTGCGCT GGTCCCCCTG 120 CACCGCCTGC CTCGAACCCT GGACGCCCGG ATTGCCCGCC TGGCCCAGT 169 (2) INFORMATION FOR SEQ ID .- NO: 28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 425 pairs of bases (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 28 ACCGTGCACT CCTGCAGGGG GCCCCGGATG CGATGGAGCT GCGCGAGCTG ACGCCCTGGG 60 CTGGGCGGCC CCCAGGTCCG CGCCGTCGGG CGGGGCCCCG GCGGCGGCGC GCGCGTGCGC 120 GGTTGGGGGC GCGGCCTTGC GGGCTGCGCG AGCTGGAGGT GCGCGTGAGC GAGCTGGGCC 180 TGGGCTACGC GTCCGACGAG ACGGTGCTGT TCCGCTACTG CGCAGGCGCC TGCGAGGCTG 240 CCGCGCGCGT CTACGACCTC GGGCTGCGAC GACTGCGCCA GCGGCGGCGC CTGCGGCGGG 300 AGCGGGTGCG CGCGCAGCCC TGCTGCCGCC CGACGGCCTA CGAGGACGAG GTGTCCTTCC 360 TGGACGCGCA CAGCCGCTAC CACACGGTGC ACGAGCTGTC GGCGCGCGAG TGCGCCTGCG 420 TGTGA 425 (2) .- INFORMATION FOR SEQ ID NO: 29: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 169 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 29 ATGAGGCGCT GGAAGGCAGC GGCCCTGGTG TCGCTCATCT GCAGCTCCCT GCTATCTGTC 60 TGGATGTGCC AGGAGGGTCT GCTCTTGGGC CACCGCCTGG GACCCGCGCT TGCCCCGCTA 120 CGACGCCCTC CACGCACCCT GGACGCCCGC ATCGCCCGCC TGGCCCAGT 169 (2) .- INFORMATION FOR SEQ ID NO: 30: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 419 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 30 ATCGCGCTCT GCTCCAGGGC GCCCCCGACG CGGTGGAGCT TCGAGAACTT TCTCCCTGGG 60 CTGCCCGCAT CCCGGGACCG CGCCGTCGAG CGGGTCCCCG GCGTCGGCGG GCGCGGCCGG 120 GGGCTCGGCC TTGTGGGCTG CGCGAGCTCG AGGTGCGCGT GAGCGAGCTG GGCCTGGGCT 180 ACACGTCGGA TGAGACCGTG CTGTTCCGCT ACTGCGCAGG CGCGTGCGAG GCGGCCATCC 240 GCATCTACGA CCTGGGCCTT CGGCGCCTGC GCCAGCGGAG GCGCGTGCGC AGAGAGCGGG 300 CGCGGGCGCA CCCGTGTTGT CGCCCGACGG CCTATGAGGA CGAGGTGTCC TTCCTGGACG 360 TGCACAGCCG CTACCACACG CTGCAAGAGC TGTCGGCGCG GGAGTGCGCG TGCGTGTGA 419 (2) .- INFORMATION FOR SEQ ID NO: 31: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 94 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 31 Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser Glu Leu Gly Leu Gly 1 5 10 15 Tyr Ala Ser Asp Glu Thr Val Leu Phe Arg Tyr Cys Wing Gly Wing Cys 20 25. 30 Glu Wing Wing Wing Arg Val Tyr Asp Leu Gly Leu Arg Arg Leu Arg Gln 35 40 45 Arg Arg Arg Leu Arg Arg Glu Arg Val Arg Wing Gln Pro Cys Cys Arg 50 55 60 Pro Thr Wing Tyr Glu Asp Glu Val Ser Phe Leu Asp Ala His Ser Arg 65 70 75 80 Tyr His Thr Val His Glu Leu Ser Wing Arg Glu Cys Ala Cys 85 90 (2) .- INFORMATION FOR SEQ ID NO: 32: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 94 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 32 Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser Glu Leu Gly Leu Gly 1 5 10 15 Tyr Thr Ser Asp Glu Thr Val Leu Phe Arg Tyr Cys Wing Gly Wing Cys 20 25 30 Glu Ala Ala lie Arg lie Tyr Asp Leu Gly Leu Arg Arg Leu Arg Gln 35 40 45 Arg Arg Arg Arg Arg Arg Arg Ala Arg Ala His Pro Cys Cys Arg 50 55 60 Pro Thr Ala Tyr Glu Asp Glu Val Ser Phe Leu Asp Val His Ser Arg 65 70 75 80 Tyr His Thr Leu Gln Glu Leu Ser Wing Arg Glu Cys Ala Cys 85 90 (2) .- INFORMATION FOR SEQ ID NO: 33: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 2 (D): Other information: / note = "SERINA OR TREONINA" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 33 Val Xaa Xaa Leu Gly Leu Gly Tyr fifteen (2) .- INFORMATION FOR SEQ ID NO: 34: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 15 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 2 (D): Other information: / note = "TREONINE OR GLUTAMIC ACID" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "VALINA OR LEUCINE" (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 4 (D): Other information: / note = "LEUCINE OR ISOLEUCINE" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 9 (D): OTHER INFORMATION: / note = "ALANINA OR SERINA "(ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 11 (D): Other information: / note =" ALANINA OR SERINA "(ix): ASPECT: (A) : NAME / KEY: Modified site (B): LOCATION: 13 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (ix): ASPECT: (A): NAME / KEY: modified site (B) : Location: 14 (D): Other information: / note = "ALANINA OR SERINA" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 34 Gñi Xaa XaaXaa Phe Arg Tyr C ys Xaa Gly Xaa Cys Xaa Xaa Ala 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 35: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 15 amino acids (B): TYPE: amino acid ( C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 5 (D): Other information: / note = "TREONINE OR VALINE OR ISOLEU-CINA" (ix): ASPECT: (A ): NAME / KEY: Modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note = "TIROSINA OR PHENYLALANIN "(ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 8 (D): Other information: / note =" GLUTAMIC ACID OR ASPARTIC ACID "(ix): ASPECT: (A ): NAME / KEY: Modified site (B): LOCATION: 10 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPECTIVE ACID" (ix): ASPECT: (A): NAME / KEY: modified site (B) ): Location: 1 1 (D): Other information: / note = "VALINE OR LEUCINE" (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 35 Cys Cys Arg Pro Xaa Ala Xaa Xaa Asp Xaa Xaa Ser Phe Leu Asp 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 36: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 1 1 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D) : TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 5 (D): Other information: / note = "ALANINA OR SERINA" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note = "ALANINE OR SERINE" (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 9 ( D): Other information: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 10 (D): OTHER INFORMATION: / note = " SERINE OR ALANINE "(xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 36 Phe Arg Tyr Cys Xaa Gly Xaa Cys Xaa Xaa Wing 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 37: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 11 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 5 (D): Other information: / note = "ALANINA OR SERINA" "(ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note = "ALANINA OR SERINA" (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 9 (D): Other information: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 10 (D): OTHER INFORMATION: / note = "SERINE OR ALANINE" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 37 Phe Arg Tyr Cys Xaa Gly Xaa Cys Xaa Xaa Ala 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 38: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 10 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 5 (D): Other information: / note = "ISOLEUCINE OR TREONINE OR VALÍ NA "(ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note =" TIROSINA OR PHENYLALANIN "(ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 8 (D): Other information: / note =" GLUTAMIC OR ACID ACID AS PARTÍ CO "(ix): APPEARANCE: (A): NAME / KEY: Modified site (B): LOCATION: 10 (D): OTHER INFORMATION: / note =" GLUTAMIC ACID OR ASPARTIC ACID "(xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 38 Cys Cys Arg Pro Xaa Ala Xaa Xaa Asp Xaa 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 39: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 10 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 2 (D): Other information: / note = "TYROSINE OR PHENYLALANIN" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 5 (D): Other information: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 6 (D): OTHER INFORMATION: / note = "VALINE OR LEUCINE" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 39 Ala Xaa Xaa Asp Xaa Xaa Ser Phe Leu Asp 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 40: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 2 (D): Other information: / note = "GLUTAMIC ACID OR TREONINE "(ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note =" LEUCINE OR VALINE "(ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 4 (D): Other information: / note = "ISOLEUCINE OR LEUCINE" (xi): SEQUENCE DESCRIPTION: SEQ ID NO: 40 Glu Xaa Xaa Xaa Phe Arg Tyr Cys fifteen (2) .- INFORMATION FOR SEQ ID NO: 41: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 13 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 2 (D): Other information: / note = "GLUTAMIC ACID OR TREONINE" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "LEUCINE OR VALINE" (ix): ASPECT: (A): NAME / KEY: modified site (B): Location: 4 (D): Other information: / note = "ISOLEUCINE OR LEUCINE" (ix): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 9 (D): OTHER INFORMATION: / note = "SERINA OR ALANINA " (X): ASPECT: (A): NAME / KEY: Modified site (B): LOCATION: 11 (D): OTHER INFORMATION: / note = "SERINA OR ALANINA" (ix): ASPECT: (A) NAME / KEY: Modified site (B) LOCATION: 13 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTICIAL ACID" (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 41 Glu Xaa Xaa Xahe Phe Arg Tyr Cys Xaa Gly Xaa Cys Xaa 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 42: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 42 GTNWSNGANY TNGGNYTNGG NTA 23 (2) .- INFORMATION FOR SEQ ID NO: 43: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 32 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 43 TTYMGNTAYT GYDSNGGNDS NTGYGANKCN GC 32 (2) .- INFORMATION FOR SEQ ID NO: 44: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 32 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 44 GCNGMNTCRC ANSHNCCNSH RCARTANCKR AA 32 (2) .- INFORMATION FOR SEQ ID NO: 45: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 29 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 45 TCRTCNTCRW ANGCNRYNGG NCKRCARCA 29 (2) .- INFORMATION FOR SEQ ID NO: 46: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 29 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 46 TCNARRAANS WNAVNTCRTC NTCRWANGC 29 (2) .- INFORMATION FOR SEQ ID NO: 47: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 47 GARRMNBTNH TNTTYMGNTA YTG 23 (2) .- INFORMATION FOR SEQ ID NO: 48: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 38 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 48 GARRMNBTNH TNTTYMGNTA YTGYDSNGGN DSNTGHGA 38 (2) .- INFORMATION FOR SEQ ID NO: 49: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 49 Ser Gly Ala Arg Pro Xaa Gly Leu Arg Glu Leu Glu Val Ser Val Ser 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 50: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 17 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 50 CCNACNGCNT AYGARGA 17 (2) .- INFORMATION FOR SEQ ID NO: 51: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 51 Ala Arg Ala Pro Pro Cys Cys Arg Pro Thr Ala Tyr Glu Asp Glu Val 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 52: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 52 ARYTCYTGNA RNGTRTGRTA 20 (2) .- INFORMATION FOR SEQ ID NO: 53: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 28 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 53 GACGAGGTGT CCTTCCTGGA CGTACACA 28 (2) .- INFORMATION FOR SEQ ID NO: 54: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 34 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 54 TAGCGGCTGT GTACGTCCAG GAAGGACACC TCGT 34 (2) .- INFORMATION FOR SEQ ID NO: 55: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 26 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 55 CAGCGACGAC GCGTGCGCAA AGAGCG 26 (2) .- INFORMATION FOR SEQ ID NO: 56: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 47 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 56 TAYGARGACG AGGTGTCCTT CCTGGACGTA CACAGCCGCT AYCAYAC 47 (2) .- INFORMATION FOR SEQ ID NO: 57: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 26 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 57 GCGGCCATCC GCATCTACGA CCTGGG 26 (2) .- INFORMATION FOR SEQ ID NO: 58: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 27 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 58 CRTAGGCCGT CGGGCGRCAR CACGGGT 27 (2) .- INFORMATION FOR SEQ ID NO: 59: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 27 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 59 GCGCCGAAGG CCCAGGTCGT AGATGCG 27 (2) .- INFORMATION FOR SEQ ID NO: 60: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 29 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 60 CGCTACTGCG CAGGCGCGTG CGARGCGGC 29 (2) .- INFORMATION FOR SEQ ID NO: 61: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 27 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 61 CGCCGACAGC TCTTGCAGCG TRTGGTA 27 (2) .- INFORMATION FOR SEQ ID NO: 62: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 30 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 62 GAGCTGGGCC TGGGCTACGC GTCCGACGAG 30 (2) .- INFORMATION FOR SEQ ID NO: 63: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 39 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 63 GCGACGCGTA CCATGAGGCG CTGGAAGGCA GCGGCCCTG 39 (2) .- INFORMATION FOR SEQ ID NO: 64: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 30 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 64 GACGGATCCG CATCACACGC ACGCGCACTC 30 (2) .- INFORMATION FOR SEQ ID NO: 65: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 29 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 65 GACCATATGC CGGGGGCTCG GCCTTGTGG 29 (2) .- INFORMATION FOR SEQ ID NO: 66: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 30 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 66 GACGGATCCG CATCACACGC ACGCGCACTC 30 (2) .- INFORMATION FOR SEQ ID NO: 67: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 26 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 67 CAGCGACGAC GCGTGCGCAA AGAGCG 26 (2) .- INFORMATION FOR SEQ ID NO: 68: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 34 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 68 TAGCGGCTGT GTACGTCCAG GAAGGACACC TCGT 34 (2) .- INFORMATION FOR SEQ ID NO: 69: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 pairs of bases (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 69 AAAAATCGGG GGTGYGTCTT A 21 (2) .- INFORMATION FOR SEQ ID NO: 70: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 70 CATGCCTGGC CTACYTTGTC A 21 (2) .- INFORMATION FOR SEQ ID NO: 71: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 71 CTGGCGTCCC AMCAAGGGTC TTCG 24 (2) .- INFORMATION FOR SEQ ID NO: 72: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 72 GCCAGTGGTG CCGTCGAGGC GGG 23 (2) .- INFORMATION FOR SEQ ID NO: 73: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 73 GGCCCAGGAT GAGGCGCTGG AAGG 24 (2) .- INFORMATION FOR SEQ ID NO: 74: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 27 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 74 CCACTCCACT GCCTGAWATT CWACCCC 27 (2) .- INFORMATION FOR SEQ ID NO: 75: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 75 CCATGTGATT ATCGACCATT CGGC 24 (2) .- INFORMATION FOR SEQ ID NO: 76: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 134 amino acids (B) ): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 76 Ser Pro Asp Lys Gln Met Wing Val Leu Pro Arg Glu Arg Asn Arg 1 5 10 15 Gln Wing Wing Wing Wing Asn Pro Glu Asn Being Arg Gly Lys Gly Arg Arg 20 25 30 Gly Gln Arg Gly Lys Asn Arg Gly Cys Val Leu Thr Ala lie His Leu 35 40 45 Asn Val Thr Asp Leu Gly Leu Gly Tyr Glu Thr Lys Glu Glu Leu lie 50 55 60 Phe Arg Tyr Cys Ser Gly Ser Cys Asp Ala Ala Glu Thr Thr Tyr Asp 65 70 75 80 Lys lie Leu Lys Asn Leu Ser Arg Asn Arg Arg Leu Val Ser Asp Lys 85 90 95 Val Gly Gln Wing Cys Cys Arg Pro lie Wing Phe Asp Asp Asp Leu Ser l'OO 105 110 Phe Leu Asp Asp Asn Leu Val Tyr His lie Leu Arg Lys His Ser Wing 115 120 125 Lys Arg Cys Gly Cys He 130 (2) .- INFORMATION FOR SEQ ID NO: 77: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 134 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 77 Ser Pro Asp Lys Gln Wing Wing Wing Leu Pro Arg Arg Glu Arg Asn Arg 1 5 10 15 Gln Wing Wing Wing Wing Pro Pro Glu Asn Ser Arg Gly Lys Gly Arg Arg 20 25 30 Gly Gln Arg Gly Lys Asn Arg Gly Cys Val Leu Thr Ala He His Leu 35 40 45 Asn Val Thr Asp Leu Gly Leu Gly Tyr Glu Thr Lys Glu Glu Leu He 50 55 60 Phe Arg Tyr Cys Ser Gly Ser Cys Glu Ser Ala Glu Thr Met Tyr Asp 65 70 75 80 Lys He Leu Lys Asn Leu Being Arg Being Arg Arg Leu Thr Being Asp Lys 85 90 95 Val Gly Gln Wing Cys Cys Arg Pro Val Wing Phe Asp Asp Asp Leu Ser 100 105 110 Phe Leu Asp Asp Asn Leu Val Tyr His He Leu Arg Lys His Ser Wing 115 120 125 Lys Arg Cys Gly Cys He 130 (2) .- INFORMATION FOR SEQ ID NO: 78: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 134 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 78 Ser Pro Asp Lys Gln Ala Ala Ala Ala Pro Arg Arg Arlu Glu Arg Asn Arg 1 5 10 15 Gln Ala Ala Wing Wing Pro Pro Glu Asn Ser Arg Gly Lys Gly Arg Arg 20 25 30 Gly Gln Arg Gly Lys Asn Arg Gly Cys Val Leu Thr Wing He His Leu 35 40 45 Asn Val Thr Asp Leu Gly Leu Gly Tyr Glu Thr Lys Glu Glu Leu He 50 55 60 Phe Arg Tyr Cys Ser Gly Ser Cys Glu Ala Wing Glu Thr Met Tyr Asp 65 70 75 80 Lys He Leu Lys Asn Leu Ser Arg Arg Arg Leu Thr Ser Asp Lys 85 90 95 Val Gly Gln Ala Cys Cys Arg Pro Val Ala Phe Asp Asp Asp Leu Ser 100 105 110 Phe Leu Asp Asp Ser Leu Val Tyr His He Leu Arg Lys His Ser Ala 115 120 125 Lys Arg Cys Gly Cys He 130 (2) .- INFORMATION FOR SEQ ID NO: 79: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 89 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 79 Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly 1 5 10 15 Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing Gly Ser Cys 20 25 30 Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val Leu Ala Arg Leu Arg 35 40 45 Gly Arg Gly Arg Ala His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr 50 55 60 Wing Asp Val Thr Phe Leu Asp Asp Gln His His Trp Gln Gln Leu Pro 65 70 75 80 Gln Leu Ser Ala Ala Ala Cys Gly Cys 85 (2) .- INFORMATION FOR SEQ ID NO: 80: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 96 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 80 Ala Leu Ala Gly Ser Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing 1 5 10 15 Glu Leu Gly Leu Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr 20 25 30 Cys Wing Gly Ser Cys Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val 35 40 45 Leu Wing Arg Leu Arg Gly Arg Gly Arg Wing His Gly Arg Pro Cys Cys 50 55 60 Gln Pro Thr Ser Tyr Wing Asp Val Thr Phe Leu Asp Asp Gln His His 65 70 75 80 Trp Gln Gln Leu Pro Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 81: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 134 amino acids ( B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 81 Val Arg He Pro Gly Gly Leu Pro Thr Pro Gln Phe Leu Leu Ser Lys 1 5 10 15 Pro Ser Leu Cys Leu Thr He Leu Leu Tyr Leu Ala Leu Gly Asn Asn 20 25 30 His Val Arg Leu Pro Arg Ala Leu Ala Gly Ser Cys Arg Leu Trp Ser 35 40 45 Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly Tyr Wing Ser Glu Glu 50 55 60 Lys Val He Phe Arg Tyr Cys Wing Gly Ser Cys Pro Gln Glu Wing Arg 65 70 75 80 Thr Gln His Ser Leu Val Leu Wing Arg Leu Arg Gly Arg Gly Arg Wing 85 90 95 His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr Wing Asp Val Thr Phe 100 105 110 Leu Asp Asp Gln His His Trp Gln Gln Leu Pro Gln Leu Ser Ala Ala 115 120 125 Ala Cys Gly Cys Gly Gly 130 (2) .- INFORMATION FOR SEQ ID NO: 82: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 89 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 82 Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly 1 5 10 15 Tyr Wing Ser Glu Glu Lys He He Phe Arg Tyr Cys Wing Gly Ser Cys 20 25 30 Pro Gln Glu Val Arg Thr Gln His Ser Leu Val Leu Wing Arg Leu Arg 35 40 45 Gly Gln Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr 50 55 60 Wing Asp Val Thr Phe Leu Asp Asp His His His Trp Gln Gln Leu Pro 65 70 75 80 Gln Leu Ser Ala Ala Ala Cys Gly Cys 85 (2) .- INFORMATION FOR SEQ ID NO: 83: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 91 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 83 Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly 1 5 10 15 Tyr Wing Ser Glu Glu Lys He He Phe Arg Tyr Cys Wing Gly Ser Cys 20 25 30 Pro Gln Glu Val Arg Thr Gln His Ser Leu Val Leu Wing Arg Leu Arg 35 40 45 Gly Gln Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr 50 55 60 Wing Asp Val Thr Phe Leu Asp Asp His His His Trp Gln Gln Leu Pro 65 70 75 80 Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 85 90 (2) .- INFORMATION FOR SEQ ID NO: 84: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 267 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 84 TGCCGACTGT GGAGCCTGAC CCTACCAGTG GCTGAGCTGG GCCTGGGCTA TGCCTCGGAG 60 GAGAAGGTCA TCTTCCGATA CTGTGCTGGC AGCTGTCCCC AAGAGGCCCG TACCCAGCAC 120 AGTCTGGTAC TGGCCCGGCT TCGAGGGCGG GGTCGAGCCC ATGGCCGACC CTGCTGCCAG 180 CCCACCAGCT ATGCTGATGT GACCTTCCTT GATGATCAGC ACCATTGGCA GCAGCTGCCT 240 CAGCTCTCAG CTGCAGCTTG TGGCTGT 267 (2) .- INFORMATION FOR SEQ ID NO: 85: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 267 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 85 TGCCGGCTGT GGAGCCTGAC CCTACCAGTG GCTGAGCTTG GCCTGGGCTA TGCCTCAGAG 60 GAGAAGATTA TCTTCCGATA CTGTGCTGGC AGCTGTCCCC AAGAGGTCCG TACCCAGCAC 120 AGTCTGGTGC TGGCCCGTCT TCGAGGGCAG GGTCGAGCTC ATGGCAGACC TTGCTGCCAG 180 CCCACCAGCT ATGCTGATGT GACCTTCCTT GATGACCACC ACCATTGGCA GCAGCTGCCT 240 CAGCTCTCAG CCGCAGCTTG TGGCTGT 267 (2) .- INFORMATION FOR SEQ ID NO: 86: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 273 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 86 TGCCGGCTGT GGAGCCTGAC CCTACCAGTG GCTGAGCTTG GCCTGGGCTA TGCCTCAGAG 60 GAGAAGATTA TCTTCCGATA CTGTGCTGGC AGCTGTCCCC AAGAGGTCCG TACCCAGCAC 120 AGTCTGGTGC TGGCCCGTCT TCGAGGGCAG GGTCGAGCTC ATGGCAGACC TTGCTGCCAG 180 CCCACCAGCT ATGCTGATGT GACCTTCCTT GATGACCACC ACCATTGGCA GCAGCTGCCT 240 CAGCTCTCAG CCGCAGCTTG TGGCTGTGGT GGC 273 (2) INFORMATION FOR .- SEQ ID NO: 87: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 94 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 87 Cys Val Leu Thr Ala He His Leu Asn Val Thr Asp Leu Gly Leu Gly 1 5 10 15 Tyr Glu Thr Lys Glu Glu Leu He Phe Arg Tyr Cys Ser Gly Ser Cys 20 25 30 Glu Be Ala Glu Thr Met Tyr Asp Lys He Leu Lys Asn Leu Ser Arg 40 45 Ser Arg Arg Leu Thr Ser Asp Lys Val Gly Gln Wing Cys Cys Arg Pro 50 55 60 Val Wing Phe Asp Asp Asp Leu Ser Phe Leu Asp Asp Asn Leu Val Tyr 65 70 75 80 His He Leu Arg Lys His Ser Wing Lys Arg Cys Gly Cys He 85 90 (2) .- INFORMATION FOR SEQ ID NO: 88: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 95 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 88 Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser Glu Leu Gly Leu Gly 1 5 10 15 Tyr Thr Ser Asp Glu Thr Val Leu Phe Arg Tyr Cys Wing Gly Wing Cys 20 25 30 Glu Wing Wing He Arg He Tyr Asp Leu Gly Leu Arg Arg Leu Arg Gln 35 40 45 Arg Arg Arg Arg Val Arg Arlu Glu Arg Ala Arg Ala Pro Cys Cys Arg 50 55 60 Pro Thr Ala Tyr Glu Asp Glu Val Ser Phe Leu Asp Val His Ser Arg 65 70 75 80 Tyr His Thr Leu Gln Glu Leu Ser Wing Arg Glu Cys Wing Cys Val 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 89: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 91 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 89 Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly 1 5 10 15 Tyr Ala Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing Gly Ser Cys 20 25 30 Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val Leu Wing Arg Leu Arg 35 40 45 Gly Arg Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr 50 55 60 Wing Asp Val Thr Phe Leu Asp Asp Gln His His Trp Gln Gln Leu Pro 65 70 75 80 Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 85 90 (2) .- INFORMATION FOR SEQ ID NO: 90: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 22 base pairs (B): TYPE : nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 90 TGCCTCAGAG GAGAAGATTA TC 22 (2) .- INFORMATION FOR SEQ ID NO: 91: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 7 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 91 Wing Ser Glu Glu Lys lie lie 1 5 (2) .- INFORMATION FOR SEQ ID NO: 92: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 92 Leu Gly Leu Gly Tyr Glu Thr Lys Glu Glu Leu lie Phe Arg Tyr Cys 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 93: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 93 Leu Gly Leu Gly Tyr Thr Ser Asp Glu Thr Val Leu Phe Arg Tyr Cys 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 94: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 94 Leu Gly Leu Gly Tyr Ala Ser Glu Glu Lys lie lie Phe Arg Tyr Cys 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 95: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 95 AGTCGGGGTT GGGGTATGCC TCA 23 (2) .- INFORMATION FOR SEQ ID NO: 96: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 26 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 96 TATGCCTCAG AGGAGAAGAT TATCTT 26 (2) .- INFORMATION FOR SEQ ID NO: 97: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 336 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 97 CCTCAGAGGA GAAGATTATC TTCCGATACT GTGCTGGCAG CTGTCCCCAA GAGGTCCGTA 60 CCCAGCACAG TCTGGTGCTG GCCCGTCTTC GAGGGCAGGG TCGAGCTCAT GGCAGACCTT 120 GCTGCCAGCC CACCAGCTAT GCTGATGTGA CCTTCCTTGA TGACCACCAC CATTGGCAGC 180 AGCTGCCTCA GCTCTCAGCC GCAGCTTGTG GCTGTGGTGG CTGAAGGCGG CCAGCCTGGT 240 CTCTCAGAAT CACAAGCAAG AGGCAGCCTT TGAAAGGCTC AGGTGACGTT ATTAGAAACT 300 TGCATAGGAG AAGATTAAGA AGAGAAAGGG GACCTG 336 (2) .- INFORMATION FOR SEQ ID NO: 98: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 17 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 98 Wing Cys Cys Arg Pro Val Wing Phe Asp Asp Asp Leu Ser Phe Leu Asp Asp 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 99: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 17 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 99 Pro Cys Cys Arg Pro Thr Ala Tyr Glu Asp Glu Val Ser Phe Lys Asp Val 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 100: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 100 Pro Cys Cys Gln Pro Thr Ser Tyr Ala Asp Val Thr Phe Leu Asp Asp 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 101: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 26 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 101 TCATCAAGGA AGGTCACATC AGCATA 26 (2) .- INFORMATION FOR SEQ ID NO: 102: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 32 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 102 CCACCACAGC CACAAGCTGC GGSTGAGAGC TG 32 (2) .- INFORMATION FOR SEQ ID NO: 103: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 5 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 103 Ala Leu Ala Gly Ser 1 5 (2) .- INFORMATION FOR SEQ ID NO: 104: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 43 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 104 Val Arg lie Pro Gly Gly Leu Pro Thr Pro Gln Phe Leu Leu Ser Lys 1 5 10 15 Pro Ser Leu Cys Leu Thr He Leu Leu Tyr Leu Ala Leu Gly Asn Asn 20 25 30 His Val Arg Leu Pro Arg Ala Leu Ala Gly Ser 35 40 (2) .- INFORMATION FOR SEQ ID NO: 105: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 544 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 105 GAGGGACCTG GACGCCCCAT CAGGGTAAGA ATTCCTGGGG GCCTCCCGAC TCCCCAATTC 60 CTTCTCTCAA AGCCCTCACT TTGCCTTACA ATCCTACTCT ACCTTGCACT AGGTAACAAC 120 CATGTCCGTC TTCCAAGAGC CTTGGCTGGT TCATGCCGAC TGTGGAGCCT GACCCTACCA 180 GTGGCTGAGC TGGGCCTGGG CTATGCCTCG GAGGAGAAGG TCATCTTCCG ATACTGTGCT 240 GGCAGCTGTC CCCAAGAGGC CCGTACCCAG CACAGTCTGG TACTGGCCCG GCTTCGAGGG 300 CGGGGTCGAG CCCATGGCCG ACCCTGCTGC CAGCCCACCA GCTATGCTGA TGTGACCTTC 360 CTTGATGATC AGCACCATTG GCAGCAGCTG CCTCAGCTCT CAGCTGCAGC TTGTGGCTGT 420 GGTGGCTGAA GGAGGCCAGT CTGGTGTCTC AGAATCACAA GCATGAGACA GGCTGGGCTT 480 TGAAAGGCTC AGGTGACATT ACTAGAAATT TGCATAGGTA AAGATAAGAA GGGAAAGGAC 540 CAGG 544 (2) .- INFORMATION FOR SEQ ID NO: 106: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 336 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS : one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 106 CCTCAGAGGA GAAGATTATC TTCCGATACT GTGCTGGCAG CTGTCCCCAA GAGGTCCGTA 60 CCCAGCACAG TCTGGTGCTG GCCCGTCTTC GAGGGCAGGG TCGAGCTCAT GGCAGACCTT 120 GCTGCCAGCC CACCAGCTAT GCTGATGTGA CCTTCCTTGA TGACCACCAC CATTGGCAGC 180 AGCTGCCTCA GCTCTCAGCC GCAGCTTGTG GCTGTGGTGG CTGAAGGCGG CCAGCCTGGT 240 CTCTCAGAAT CACAAGCAAG AGGCAGCCTT TGAAAGGCTC AGGTGACGTT ATTAGAAACT 300 TGCATAGGAG AAGATTAAGA AGAGAAAGGG GACCTG 336 (2) .- INFORMATION FOR SEQ ID NO: 107: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 391 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 107 TGCCGGCTGT GGAGCCTGAC CCTACCAGTG GCTGAGCTTG GCCTGGGCTA TGCCTCAGAG 60 GAGAAGATTA TCTTCCGATA CTGTGCTGGC AGCTGTCCCC AAGAGGTCCG TACCCAGCAC 120 AGTCTGGTGC TGGCCCGTCT TCGAGGGCAG GGTCGAGCTC ATGGCAGACC TTGCTGCCAG 180 CCCACCAGCT ATGCTGATGT GACCTTCCTT GATGACCACC ACCATTGGCA GCAGCTGCCT 240 CAGCTCTCAG CCGCAGCTTG TGGCTGTGGT GGCTGAAGGC GGCCAGCCTG GTCTCTCAGA 300 ATCACAAGCA AGAGGCAGCC TTTGAAAGGC TCAGGTGACG TTATTAGAAA CTTGCATAGG 360 AGAAGATTAA GAAGAGAAAG GGGACCTGAT T 391 (2) .- INFORMATION FOR SEQ ID NO: 108: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein. (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note = "SERINA, TREONINA OR ALAN I NA" (ix): ASPECT: (A ): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 108 Val Xaa Xaa Leu Gly Leu Gly Tyr 1 5 (2) .- INFORMATION FOR SEQ ID NO: 109: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 5 (D): OTHER INFORMATION: / note = "ALANINA OR SERINA "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note =" ALANINA OR SERINA " (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 109 Phe Arg Tyr Cys Xaa Gly Xaa Cys 1 5 (2) .- INFORMATION FOR SEQ ID NO: 110: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note = "ASPÁRATIC ACID, GLUTAMIC ACID OR NO AMINO ACID "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note =" VALINA OR LEUCINE "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 4 (D): OTHER INFORMATION: / note = "SERINA OR TREONINE" (ix): ASPECT: (A): NAME / KEY: modified site (B) ): LOCATION: 8 (D): OTHER INFORMATION: / note = "VALINA OR ASPARTICO ACID" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 110 Asp Xaa Xaa Phe Leu Asp Xaa 1 5 (2) .- INFORMATION FOR SEQ ID NO: 111: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 124 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: protein. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 111: Glu Gly Pro Gly Arg Pro He Arg Val Arg He Pro Gly Gly Leu Pro 1 5 10 15 Thr Pro Gln Phe Leu Leu Ser Lys Pro Ser Leu Cys Leu Thr He Leu 20 25 30 Leu Tyr Leu Ala Leu Gly Asn Asn His Val Arg Leu Pro Arg Ala Leu 35 40 45 Wing Gly Ser Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu 50 55 60 Gly Leu Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing 65 70 75 80 Gly Ser Cys Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val Leu Wing 85 90 95 Arg Leu Arg Gly Arg Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro 100 105 110 Thr Ser Tyr Wing Asp Val Thr Phe Leu Asp Asp Gln His His Trp Gln 115 120 125 Gln Leu Pro Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 130 135 140 (2) .- INFORMATION FOR SEQ ID NO: 112: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 5 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 112: Ala Leu Pro Gly Leu 1 5 (2) .- INFORMATION FOR SEQ ID NO: 113: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 12 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note = "TREONINE, ACID GLUTAMICO OR USINA "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note =" VALINA, LEUCINA OR ISOLEUCINE "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 4 (D): OTHER INFORMATION: / note =" LEUCINE OR ISOLEUCINE " (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 9 (D): OTHER INFORMATION: / note = "ALANINA OR SERINA" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 11 (D): OTHER INFORMATION: / note = "ALANINE OR SERINE" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 113: Glu Xaa Xaa Xaa Phe Arg Tyr Cys Xaa Gly Xaa Cys 1 5 10 (2) .- INFORMATION FOR SEQ ID NO: 114: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 16 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "ARGININE OR GLUTAMINE " (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 5 (D): OTHER INFORMATION: / note = "TREONINE, VALINE, OR ISOLEUCINE" (ix): ASPECT: (A) : NAME / KEY: modified site (B): LOCATION: 6 (D): OTHER INFORMATION: / note = "ALANINE OR SERINE" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION : 7 (D): OTHER INFORMATION: / note = "TYROSINE OR PHENYLALANIN "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 8 (D): OTHER INFORMATION: / note =" GLUTAMIC ACID, ACIDO AS PARTÍ CO OR ALAN I NA (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 10 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID, ASPARTIC ACID OR NO AMINO ACID "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 1 1 (D): OTHER INFORMATION: / note =" VALÍ NA, O LEUCINA "(ix) : ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 12 (D): OTHER INFORMATION: / note = "SERINA OR TREONINA" (ix): ASPECT: (A): NAME / KEY: site modified (B): LOCATION: 16 (D): OTHER INFORMATION: / note = "ASPARTIC ACID OR VALI NA "(xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1 14: Cys Cys Xaa Pro Xaa Xaa Xaa Xaa Asp Xaa Xaa Xaa Phe Leu Asp Xaa 1 5 10 15 (2) .- INFORMATION FOR SEQ ID NO: 115: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 115 GTNDGNGANY TGGGNYTGGG NTA 23 (2) .- INFORMATION FOR SEQ ID NO: 116: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 19 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 116 GANBTNWCNT TYYTNGANG 19 (2) .- INFORMATION FOR SEQ ID NO: 117: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 117 GANBTNWCNT TYYTNGANGW 20 (2) .- INFORMATION FOR SEQ ID NO: 118: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 118 TTYMGNTAYT GYDSNGGNDS NTG 23 (2) .- INFORMATION FOR SEQ ID NO: 119: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 119 GTNDGNGANY TGGGNYTNGG 20 (2) .- INFORMATION FOR SEQ ID NO: 120: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 120 GTNDGNGANY TGGGNYTGGG NTT 23 (2) .- INFORMATION FOR SEQ ID NO: 121: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 121 WCNTCNARRA ANGWNAVNTC 20 (2) .- INFORMATION FOR SEQ ID NO: 122: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 19 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 122 WCNTCNARRA ANGWNAVNT 19 (2) .- INFORMATION FOR SEQ ID NO: 123: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 123 CANSHNCCNS HRCARTANCK RAA 23 (2) .- INFORMATION FOR SEQ ID NO: 124: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 25 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): SEQUENCE DESCRIPTION: SEQ ID NO: 124 CANSHNCCNS HRCARTANCK RAANA 25 (2) .- INFORMATION FOR SEQ ID NO: 125: (i): SEQUENCE CHARACTERISTICS: (A): LENGTH: 8 amino acids (B) ): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B) : LOCATION: 2 (D): OTHER INFORMATION: / note = "TREONINE, SERINE OR ALAN I NA" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 125: Val Xaa Xaa Leu Gly Leu Gly Tyr 1 5 (2) .- INFORMATION FOR SEQ ID NO: 126: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 7 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 1 (D): OTHER INFORMATION: / note = "ASPARTIC ACID OR GLUTAMIC ACID "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note =" VALINA OR LEUCINE "(ix): ASPECT: (A) : NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "TREONINE OR SERINE" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION : 6 (D): OTHER INFORMATION: / note = "ASPARTIC ACID OR GLUTAMIC ACID" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note = "ASPARTICO ACIDO OR VALÍ NA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 126: Xaa Xaa Xaa Phe Leu Xaa Xaa 1 5 (2) .- INFORMATION FOR SEQ ID NO: 127: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 5 (D): OTHER INFORMATION: / note = "SERINA OR ALANINA " (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 7 (D): OTHER INFORMATION: / note = "SERINA OR ALANINA" (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO : 127: Phe Arg Tyr Cys Xaa Gly Xaa Cys 1 5 (2) .- INFORMATION FOR SEQ ID NO: 128: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 7 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note = "TREONINE, SERINE OR ALAN I NA "(ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note =" ASPARTIC ACID OR GLUTAMIC ACID "(xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 128: Val Xaa Xaa Leu Gly Leu Gly 1 5 (2) .- INFORMATION FOR SEQ ID NO: 129: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 8 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 2 (D): OTHER INFORMATION: / note = "TREONINE, SERINE OR ALAN I NA" (ix): ASPECT: ( A): NAME / KEY: modified site (B): LOCATION: 3 (D): OTHER INFORMATION: / note = "GLUTAMIC ACID OR ASPARTIC ACID" (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 129: Val, Xaa Xaa Leu Gly Leu Gly Phe 1 5 (2) .- INFORMATION FOR SEQ ID NO: 130: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 9 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: protein, (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 1 (D): OTHER INFORMATION: / note = "ISOLEUCINE OR LEUCINE" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 6 (D): OTHER INFORMATION: / note = "SERINA OR ALANINA" (ix): ASPECT: (A): NAME / KEY: modified site (B): LOCATION: 8 (D): OTHER INFORMATION: / note = "SERINE OR ALANINE" (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO : 130: Xaa Phe Arg Tyr Cys Xaa Gly Xaa Cys 1 5 (2) .- INFORMATION FOR SEQ ID NO: 131: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 559 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: DNA (genomic). (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 131: ATGGCTGCAG GAAGACTTCG GATCCTGTGT CTGCTGCTCC TGTCCTTGCA CCCGAGCCTC 60 GGCTGGGTCC TTGATCTTCA AGAGGCTTCT GTGGCAGATA AGCTCTCATT TGGGAAGATG 120 GCAGAGACTA GAGGGACCTG GACGCCCCAT CAGGGTAAGA ATTCCTGGGG GCCTCCCGAC 180 TCCCCAATTC CTTCTCTCAA AGCCCTCACT TTGCCTTACA ATCCTACTCT ACCTTGCACT 240 AGGTAACAAC CATGTCCGTC TTCCAAGAGC CTTGGCTGGT TCATGCCGAC TGTGGAGCCT 300 GACCCTACCA GTGGCTGAGC TGGGCCTGGG CTATGCCTCG GAGGAGAAGG TCATCTTCCG 360 ATACTGTGCT GGCAGCTGTC CCCAAGAGGC CCGTACCCAG CACAGTCTGG TACTGGCCCG 420 GCTTCGAGGG CGGGGTCGAG CCCATGGCCG ACCCTGCTGC CAGCCCACCA GCTATGCTGA 480 TGTGACCTTC CTTGATGATC AGCACCATTG GCAGCAGCTG CCTCAGCTCT CAGCTGCAGC 540 TTGTGGCTGT GGTGGCTGA 559 (2) .- INFORMATION FOR SEQ ID NO: 132: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 81 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 132: Met Ala Ala Gly Arg Leu Arg He Leu Cys Leu Leu Leu Leu Ser Leu 1 5 10 15 His Pro Ser Leu Gly Trp Val Leu Asp Leu Gln Glu Wing Ser Val Wing 20 25 30 Asp Lys Leu Ser Phe Gly Lys Met Wing Glu Thr Arg Gly Thr Trp Thr 35 40 45 Pro His Gln Gly Lys Asn Ser Trp Gly Pro Pro Asp Ser Pro Pro 50 55 60 Ser Leu Lys Ala Leu Thr Leu Pro Tyr Asn Pro Thr Leu Pro Cys Thr 65 70 75 80 Arg (2) .- INFORMATION FOR SEQ ID NO: 133: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 185 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 133: Trp Leu Gln Glu Asp Phe Gly Ser Cys Val Cys Cys Ser Cys Pro Cys 1 5 10 15 Thr Arg Wing Ser Wing Gly Ser Leu He Phe Lys Arg Leu Leu Trp Gln 20 25 30 He Ser Ser His Leu Gly Arg Trp Gln Arg Leu Glu Gly Pro Gly Arg 35 40 45 Pro He Arg Val Arg He Pro Gly Gly Leu Pro Thr Pro Gln Phe Leu 50 55 60 Leu Ser Lys Pro Ser Leu Cys Leu Thr He Leu Leu Tyr Leu Ala Leu 65 70 75 80 Gly Asn Asn His Val Arg Leu Pro Arg Ala Leu Ala Gly Ser Cys Arg 85 90 95 Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly Tyr Wing 100 105 110 Ser Glu Glu Lys Val He Phe Arg Tyr Cys Ala Gly Ser Cys Pro Gln 115 120 125 Glu Ala Arg Thr Gln His Ser Leu Val Leu Ala Arg Leu Arg Gly Arg 130 135 140 Gly Arg Ala His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr Ala Asp 145 150 155 160 Val Thr Phe Leu Asp Asp Gln His His Trp Gln Gln Leu Pro Gln Leu 165 170 175 Be Ala Ala Ala Cys Gly Cys Gly Gly 180 185 (2) .- INFORMATION FOR SEQ ID NO: 134: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 559 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: DNA (genomic). (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 134: ATGGCTGCAG GAAGACTTCG GATCTTGTTT CTGCTGCTCC TGTCCTTGCA CCTGGGCCTT 60 GGCTGGGTCC TTGATCTTCA AGAGGCTCCT GCGGCAGATG AGCTCTCATC TGGGAAAATG 120 GCAGAGACTG GAAGGACCTG GAAGCCCCAT CAGGGTAAGA ATTCTTGGGG GCCTCCTAAC 180 TCTACAGTTC TTCCTCTCAA AGCCCTCACT TTGCCTCACA ATCCTATTCT ACCTTGCACT 240 AGGTAACAAC AATGTCCGCC TTCCAAGAGC CTTACCTGGT TTGTGCCGGC TGTGGAGCCT 300 GACCCTACCA GTGGCTGAGC TTGGCCTGGG CTATGCCTCA GAGGAGAAGA TTATCTTCCG 360 ATACTGTGCT GGCAGCTGTC CCCAAGAGGT CCGTACCCAG CACAGTCTGG TGCTGGCCCG 420 TCTTCGAGGG CAGGGTCGAG CTCATGGCAG ACCTTGCTGC CAGCCCACCA GCTATGCTGA 480 TGTGACCTTC CTTGATGACC ACCACCATTG GCAGCAGCTG CCTCAGCTCT CAGCCGCAGC 540 TTGTGGCTGT GGTGGCTGA 559 (2). INFORMATION FOR SEQ ID NO: 135: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 81 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 135: Met Ala Ala Gly Arg Leu Arg He Leu Phe Leu Leu Leu Leu Ser Leu 1 5 10 15 His Leu Gly Leu Gly Trp Val Leu Asp Leu Gln Glu Wing Pro Wing Wing 20 25 30 Asp Glu Leu Be Ser Gly Lys Met Wing Glu Thr Gly Arg Thr Trp Lys 35 40 45 Pro His Gln Gly Lys Asn Ser Trp Gly Pro Pro Asn Ser Thr Val Leu 50 55 60 Pro Leu Lys Ala Leu Thr Leu Pro His Asn Pro He Leu Pro Cys Thr 65 70 75 80 Arg (2) .- INFORMATION FOR SEQ ID NO: 136: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 185 (B): TYPE: amino acid ( C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 136: Trp Leu Gln Glu Asp Phe Gly Ser Cys Phe Cys Cys Ser Cys Pro Cys 1 5 10 15 Thr Trp Wing Leu Wing Gly Ser Leu He Phe Lys Arg Leu Leu Arg Gln 20 25 30 Met Ser Ser His Leu Gly Lys Trp Gln Arg Leu Glu Gly Pro Gly Ser 35 40 45 Pro He Arg Val Arg He Leu Gly Gly Leu Leu Thr Leu Gln Phe Phe 50 55 60 Leu Ser Lys Pro Ser Leu Cys Leu Thr He Leu Phe Tyr Leu Ala Leu 65 70 75 80 Gly Asn Asn Asn Val Arg Leu Pro Arg Ala Leu Pro Gly Leu Cys Arg 85 90 95 Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu Gly Tyr Wing 100 105 110 Ser Glu Glu Lys He He Phe Arg Tyr Cys Ala Gly Ser Cys Pro Gln 115 120 125 Glu Val Arg Thr Gln His Ser Leu Val Leu Wing Arg Leu Arg Gly Gln 130 135 140 Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro Thr Ser Tyr Wing Asp 145 150 155 160 Val Thr Phe Leu Asp Asp His His His Trp Gln Gln Leu Pro Gln Leu 165 170 175 Wing Wing Wing Cys Gly Cys Gly Gly 180 185 (2) .- INFORMATION FOR SEQ ID NO: 137: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 137: AATCCCCAGG ACAGGCAGGG AAT 23 (2) .- INFORMATION FOR SEQ ID NO: 138: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 35 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 138: CGGTACCCAG ATCTTCAGCC ACCACAGCCA CAAGC 35 (2) .- INFORMATION FOR SEQ ID NO: 139: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 76 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 139: GGACTATCATATGGCCCACC ACCACCACCA CCACCACCAC GACGACGACG ACAAGGCCTT GGCTGGTTCATGCCGA 76 (2) .- INFORMATION FOR SEQ ID NO: 140: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 35 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 140: CGGTACCCAG ATCTTCAGCC ACCACAGCCA CAAGC 35 (2) .- INFORMATION FOR SEQ ID NO: 141: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 96 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 141: Ala Leu Ala Gly Ser Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing 1 5 10 15 Glu Leu Gly Leu Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr 20 25 30 Cys Wing Gly Ser Cys Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val 35 40 45 Leu Wing Arg Leu Arg Gly Arg Gly Arg Wing His Gly Arg Pro Cys Cys 50 55 60 Arg Pro Thr Wing Tyr Glu Asp Glu Val Ser Phe Leu Asp Val His Ser 65 70 75 80 Arg Tyr His Thr Leu Gln Glu Leu Ser Wing Arg Glu Cys Wing Cys Val 85 90 95 1 (2) .- INFORMATION FOR SEQ ID NO: 142: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 142: TAATACGACT CACTATAGGG GAA 23 (2) .- INFORMATION FOR SEQ ID NO: 143: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 49 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 143: TCGTCTTCGT AAGCAGTCGG ACGGCAGCAG GGTCGGCCAT GGGCTCGAC 49 (2) .- INFORMATION FOR SEQ ID NO: 144: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 29 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 144: TGCTGCCGTC CGACTGCTTA CGAAGACGA 29 (2) .- INFORMATION FOR SEQ ID NO: 145: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 25 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 145: GTTATGCTAG TTATTGCTCA GCGGT 25 (2) .- INFORMATION FOR SEQ ID NO: 146: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 100 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 146: Pro Gly Wing Arg Pro Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser 1 5 10 15 Glu Leu Gly Leu Gly Tyr Thr Ser Asp Glu Thr Val Leu Phe Arg Tyr 20 25 30 Cys Wing Gly Wing Cys Glu Wing Wing He Arg He Tyr Asp Leu Gly Leu 35 40 45 Arg Arg Leu Arg Arg Arg Arg Arg Val Arg Arlu Glu Arg Ala Arg Wing 50 55 60 His Pro Cys Cys Gln Pro Thr Ser Tyr Wing Asp Val Thr Phe Leu Asp 65 70 75 80 Asp Gln His His Trp Gln Gln Leu Pro Gln Leu Ser Wing Ala Wing Cys 85 90 95 Gly Cys Gly Gly 100 (2) .- INFORMATION FOR SEQ ID NO: 147: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 50 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 147: CACATCAGCA TAGCTGGTGG GCTGGCAGCA CGGGTGAGCA CCAGCACGTT 50 (2) .- INFORMATION FOR SEQ ID NO: 148: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 25 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 148: TGCTCGCAGC CCACCAGCTA TGCTG 25 (2) .- INFORMATION FOR SEQ ID NO: 149: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: another nucleic acid. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 149: CCTCGGAGGA GAAGGTCATC TTC 23 (2). INFORMATION FOR SEQ ID NO: 150: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 98 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (I): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 150: Cys Cys Val Arg Gln Leu Tyr He Asp Phe Arg Lys Asp Leu Gly Trp 1 5 10 15 Lys Trp He His Glu Pro Lys Gly Tyr His Wing Asn Phe Cys Leu Gly 20 25 30 Pro Cys Pro Tyr He Trp Ser Leu Asp Thr Gln Tyr Ser Lys Val Leu 35 40 45 Wing Leu Tyr Asn Gln His Asn Pro Gly Wing Wing Wing Pro Pro Cys Cys 50 55 60 Val Pro Gln Wing Leu Glu Pro Leu Pro He Val Tyr Tyr Val Gly Arg 65 70 75 80 Lys Pro Lys Val Glu Gln Leu Ser Asn Met He Val Arg Ser Cys Lys 85 90 95 Cys Ser (2) .- INFORMATION FOR SEQ ID NO: 151: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 98 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 151: Cys Cys Leu Arg Pro Leu Tyr He Asp Phe Lys Arg Asp Leu Gly Trp 1 5 10 15 Lys Trp He His Glu Pro Lys Gly Tyr Asn Wing Asn Phe Cys Wing Gly 20 25 30 Wing Cys Pro Tyr Leu Trp Ser Being Asp Thr Gln His Ser Arg Val Leu 35 40 45 Ser Leu Tyr Asn Thr He Asn Pro Glu Wing Being Wing Being Pro Cys Cys 50 55 60 Val Ser Gln Asp Leu Glu Pro Leu Thr He Leu Tyr Tyr He Gly Lys 65 70 75 80 Thr Pro Lys He Glu Gln Leu Ser Asn Met He Val Lys Ser Cys Lys 85 90 95 Cys Ser (2) .- INFORMATION FOR SEQ ID NO: 152: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 98 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 152: Cys Cys Val Arg Pro Leu Tyr He Asp Phe Arg Gln Asp Leu Gly Trp 1 5 10 15 Lys Trp Val His Glu Pro Lys Gly Tyr Tyr Wing Asn Phe Cys Ser Gly 20 25 30 Pro Cys Pro Tyr Leu Arg Ser Wing Asp Thr Thr His Ser Thr Val Leu 35 40 45 Gly Leu Tyr Asn Thr Leu Asn Pro Glu Wing Being Wing Being Pro Cys Cys 50 55 60 Val Pro Gln Asp Leu Glu Pro Leu Thr He Leu Tyr Tyr Val Gly Arg 65 70 75 80 Thr Pro Lys Val Glu Gln Leu Ser Asn Met Val Val Lys Ser Cys Lys 85 90 95 Cys Ser (2) .- INFORMATION FOR SEQ ID NO: 153: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 106 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 153: Cys Cys Lys Lys Gln Phe Phe Val Ser Phe Lys Asp He Gly Trp Asn 1 5 10 15 Asp Trp He He Wing Pro Wing Ser Gly Tyr His Wing Asn Tyr Cys Glu Gly 20 25 30 Glu Cys Pro Ser His He Wing Wing Gly Thr Ser Gly Ser Ser Leu Ser Phe 35 40 45 His Ser Thr Val He Asn His Tyr Arg Met Arg Gly His Ser Pro Phe 50 55 60 Wing Asn Leu Lys Ser Cys Cys Val Pro Thr Lys Leu Arg Pro Met Ser 65 70 75 80 Met Leu Tyr Tyr Asp Asp Gly Gln Asn He He Lys Lys Asp He Gln 85 90 95 Asn Met He Val Glu Glu Cys Gly Cys Ser 100 105 (2) .- INFORMATION FOR SEQ ID NO: 154: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 105 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 154: Cys Cys Arg Gln Gln Phe Phe He Asp Phe Arg Leu He Gly Trp Asn 1 5 10 15 Asp Trp He He Wing Pro Thr Gly Tyr Tyr Gly Asn Tyr Cys Glu Gly 20 25 30 Ser Cys Pro Wing Tyr Leu Wing Gly Val Pro Gly Be Ala Be Ser Phe 35 40 45 His Thr Ala Val Val Asn Gln Tyr Arg Met Arg Gly Leu Asn Pro Gly 50 55 60 Thr Val Asn Ser Cys Cys He Pro Thr Lys Leu Ser Thr Met Ser Met 65 70 75 80 Leu Tyr Phe Asp Asp Glu Tyr Asn He Val Lys Arg Asp Val Pro Asn 85 90 95 Met He Vallu Glu Glu Cys Gly Cys Ala 100 105 (2) .- INFORMATION FOR SEQ ID NO: 155: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 101 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 155: Cys Arg Arg Val Lys Phe Gln Val Asp Phe Asn Leu He Gly Trp Gly 1 5 10 15 Ser Trp He He Tyr Pro Lys Gln Tyr Asn Ala Tyr Arg Cys Glu Gly 20 25 30 Glu Cys Pro Asn Pro Val Gly Glu Glu Phe His Pro Thr Asn His Wing 35 40 45 Tyr He Gln Ser Leu Leu Lys Arg Tyr Gln Pro His Arg Val Pro Ser 50 55 60 Thr Cys Cys Ala Pro Val Lys Thr Lys Pro Leu Ser Met Leu Tyr Val 65 70 75 80 Asp Asn Gly Arg Val Leu Leu Glu His His Lys Asp Met He Val Glu 85 90 95 Glu Cys Gly Cys Leu 100 (2) .- INFORMATION FOR SEQ ID NO: 156: (i): CHARACTERISTICS OF THE SEQUENCE: (A) : LENGTH: 101 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 156: Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn 1 5 10 15 Asp Trp He Val Wing Pro Pro Gly Tyr His Wing Phe Tyr Cys His Gly 20 25 30 Glu Cys Pro Phe Pro Leu Wing Asp His Leu Asn Ser Thr Asn His Wing 35 40 45 He Val Gln Thr Leu Val Asn Ser Val Asn Ser Lys He Pro Lys Wing 50 55 60 Cys Cys Val Pro Thr Glu Leu Ser Wing He Ser Met Leu Tyr Leu Asp 65 70 75 80 Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gln Asp Met Val Val Glu 85 90 95 Gly Cys Gly Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 157: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 101 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 157: Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn 1 5 10 15 Asp Trp He Val Wing Pro Pro Gly Tyr Gln Wing Phe Tyr Cys His Gly 20 25 30 Asp Cys Pro Phe Pro Leu Wing Asp His Leu Asn Ser Thr Asn His Wing 35 40 45 He Val Gln Thr Leu Val Asn Ser Val Asn Ser Ser He Pro Lys Wing 50 55 60 Cys Cys Val Pro Thr Glu Leu Ser Wing He Ser Met Leu Tyr Leu Asp 65 70 75 80 Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gln Glu Met Val Val Glu 85 90 95 Gly Cys Gly Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 158: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 158: Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asp 1 5 10 15 Asp Trp He Val Wing Pro Leu Gly Tyr Asp Wing Tyr Tyr Cys His Gly 20 25 30 Lys Cys Pro Phe Pro Leu Wing Asp Hxs Phe Asn Ser Thr Asn His Wing 35 40 45 Val Val Gln Thr Leu Val Asn Asn Met Asn Pro Gly Lys Val Pro Lys 50 55 60 Wing Cys Cys Val Pro Thr Gln Leu Asp Ser Val Wing Met Leu Tyr Leu 65 70 75 80 Asn Asp Gln Be Thr Val Val Leu Lys Asn Tyr Gln Glu Met Thr Val 85 90 95 Val Gly Cys Gly Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 159: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 159: Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp Gln 1 5 10 15 Asp Trp He He Wing Pro Glu Gly Tyr Ala Wing Phe Tyr Cys Asp Gly 20 25 '30 Glu Cys Ser Phe Pro Leu Asn Ala His Met Asn Ala Thr Asn His Ala 40 45 He Val Gln Thr Leu Val His Leu Met Phe Pro Asp His Val Pro Lys 50 55 60 Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr Phe 65 70 75 80 Asp Asp Ser As Asn Val He Leu Lys Lys Tyr Arg Asn Met Val Val 85 90 95 Arg Ser Cys Gly Cys His 100 (2) .- INFORMATION FOR SEQ ID NO: 160: (i): CHARACTERISTICS OF THE SEQUENCE: (A ): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 160: Cys Arg Lys His Glu Leu Tyr Val Ser Phe Gln Asp Leu Gly Trp Gln 1 5 10 15 Asp Trp He He Wing Pro Lys Gly Tyr Wing Wing Asn Tyr Cys Asp Gly 20 25 30 Glu Cys Ser Phe Pro Leu Asn Wing His Met Asn Ala Thr Asn His Ala 35 40 45 He Val Gln Thr Leu Val His Leu Met Asn Pro Glu Tyr Val Pro Lys 50 55 60 Pro Cys Cys Ala Pro Thr Lys Leu Asn Ala He Ser Val Leu Tyr Phe 65 70 75 80 Asp Asp Asn Ser Asn Val He Leu Lys Lys Tyr Arg Asn Met Val Val 85 90 95 Arg Ala Cys Gly Cys His 100 (2) .- INFORMATION FOR SEQ ID NO: 161: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 161: Cys Lys Lys His Glu Leu Tyr Val Ser Phe Arg Asp Leu Gly Trp Gln 1 5 10 15 Asp Trp He He Wing Pro Glu Gly Tyr Wing Wing Tyr Tyr Cys Glu Gly 20 25 30 Glu Cys Wing Phe Pro Leu Asn Ser Tyr Met Asn Wing Thr Asn His Wing 35 40 45 He Val Gln Thr Leu Val His Phe He Asn Pro Glu Thr Val Pro Lys 50 55 60 Pro Cys Cys Wing Pro Thr Gln Leu Asn Wing He Ser Val Leu Tyr Phe 65 70 75 80 Asp Asp Ser As Asn Val He Leu Lys Lys Tyr Arg Asn Met Val Val SEQ1691 ° Arg Ala Cys Gly Cys His 100 (2) .- INFORMATION FOR SEQ ID NO: 162: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 162: Cys Arg Arg His Glu Leu Tyr Val Ser Phe Gln Asp Leu Gly Trp Leu 1 5 10 15 Asp Trp Val He Wing Pro Gln Gly Tyr Ser Wing Tyr Tyr Cys Glu Gly 20 25 30 Glu Cys Ser Phe Pro Leu Asp Ser Cys Met Asn Ala Thr Asn His Ala 35 40 45 He Leu Gln Ser Leu Val His Leu Met Lys Pro Asn Ala Val Pro Lys 50 55 60 Ala Cys Cys Ala Pro Thr Lys Leu Ser Ala Thr Ser Val Leu Tyr Tyr 65 70 75 80 Asp Ser As Asn Asn Val He Leu Arg Lys His Arg Asn Met Val Val 85 90 95 Lys Ala Cys Gly Cys His 100 (2). INFORMATION FOR SEQ ID NO: 163: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 163: Cys Gln Met Gln Thr Leu Tyr He Asp Phe Lys Asp Leu Gly Trp His 1 5 10 15 Asp Trp He He Wing Pro Glu Gly Tyr Gly Wing Phe Tyr Cys Ser Gly 20 25 30 Glu Cys Asn Phe Pro Leu Asn Wing His Met Asn Wing Thr Asn His Wing 35 40 45 He Val Gln Thr Leu Val His Leu Leu Glu Pro Lys Lys Val Pro Lys 50 55 60 Pro Cys Cys Wing Pro Thr Arg Leu Gly Ala Leu Pro Val Leu Tyr His 65 70 75 80 Leu Asn Asp Glu Asn Val Asn Leu Lys Lys Tyr Arg Asn Met He Val 85 90 95 Lys Ser Cys Gly Cys His 100 (2) .- INFORMATION FOR SEQ ID NO: 164: (i): CHARACTERISTICS OF THE SEQUENCE: (A ): LENGTH: 103 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 164: Cys Ala Arg Arg Tyr Leu Lys Val Asp Phe Wing Asp He Gly Trp Ser 1 5 10 15 Glu Trp He He Ser Pro Lys Ser Phe Asp Ala Tyr Tyr Cys Ser Gly 20 25 30 Wing Cys Gln Phe Pro Met Pro Lys Ser Leu Lys Pro Ser Asn His Wing 35 40 45 Thr He Gln Ser He Val Arg Wing Val Gly Val Val Pro Gly He Pro 50 55 60 Glu Pro Cys Cys Val Pro Glu Lys Met Being Ser Leu Ser He Leu Phe 65 70 75 80 Phe Asp Glu Asn Lys Asn Val Val Leu Lys Val Tyr Pro Asn Met Thr 85 90 95 Val Glu Ser Cys Ala Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 165: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 165: Cys Lys Lys Arg His Leu Tyr Val Glu Phe Lys Asp Val Gly Trp Gln 1 5 10 15 Asn Trp Val He Ala Pro Gln Gly Tyr Met Ala Asn Tyr Cys Tyr Gly 20 25 30 Glu Cys Pro Tyr Pro Leu Thr Glu He Leu Asn Gly Ser Asn His Wing 35 40 45 He Leu Gln Thr Leu Val His Ser He Glu Pro Glu Asp He Pro Leu 50 55 60 Pro Cys Cys Val Pro Thr Lys Met Ser Pro He Ser Met Leu Phe Tyr 65 70 75 80 Asp Asn Asn Asp Asn Val Val Leu Arg His Tyr Glu Asn Met Wing Val 85 90 95 Asp Glu Cys Gly Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 166: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 106 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 166: Cys Arg Ala Arg Arg Leu Tyr Val Ser Phe Arg Glu Val Gly Trp His 1 5 10 15 Arg Trp Val He Wing Pro Arg Gly Phe Leu Wing Asn Tyr Cys Gln Gly 20 25 30 Gln Cys Ala Leu Pro Val Ala Leu Ser Gly Ser Gly Gly Pro Pro Wing 35 40 45 Leu Asn His Wing Val Leu Arg Wing Leu Met His Wing Wing Wing Pro Gly 50 55 60 Wing Wing Asp Leu Pro Cys Cys Val Pro Wing Arg Leu Ser Pro He Be 65 70 75 80 Val Leu Phe Phe Asp Asn Ser Asp Asn Val Val Leu Arg Gln Tyr Glu 85 90 95 Asp Met Val Val Asp Glu Cys Gly Cys Arg 100 105 (2) .- INFORMATION FOR SEQ ID NO: 167: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 101 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 167: Cys His Arg His Gln Leu Phe He Asn Phe Gln Asp Leu Gly Trp His 1 5 10 15 Lys Trp Val He Wing Pro Lys Gly Phe Met Wing Asn Tyr Cys His Gly 20 25 30 Glu Cys Pro Phe Ser Met Thr Thr Tyr Leu Asn Being Ser Asn Tyr Ala 40 45 Phe Met Gln Ala Leu Met His Met Wing Asp Pro Lys Val Pro Lys Wing 50 55 60 Val Cys Val Pro Thr Lys Leu Ser Pro He Met Met Leu Tyr Gln Asp 65 70 75 80 Be Asp Lys Asn Val He Leu Arg His Tyr Glu Asp Met Val Val Asp 85 90 95 Glu Cys Gly Cys Gly 100 (2) .- INFORMATION FOR SEQ ID NO: 168: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 103 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 168: Cys Arg Arg Thr Ser Leu His Val Asn Phe Lys Glu He Gly Trp Asp 1 5 10 15 Ser Trp He He Wing Pro Lys Asp Tyr Glu Wing Phe Glu Cys Lys Gly 20 25 30 Gly Cys Phe Phe Pro Leu Thr Asp Asn Val Thr Pro Thr Lys His Wing ._ 35 40 45 He Val Gln Thr Leu Val His Leu Gln Asn Pro Lys Lys Wing Ser Lys 50 55 60 Wing Cys Cys Val Pro Thr Lys Leu Asp Wing He Ser He Leu Tyr Lys 65 70 75 80 Asp Asp Wing Gly Val Pro Thr Leu He Tyr Asn Tyr Glu Gly Met Lys 85 90 95 Val Wing Glu Cys Gly Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 169: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 105 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: only one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 169: Cys His Arg Val Ala Leu Asn He Ser Phe Gln Glu Leu Gly Trp Glu 1 5 10 15 Arg Trp He Val Tyr Pro Pro Ser Phe He Phe His Tyr Cys His Gly 20 25 30 Gly Cys Gly Leu His He Pro Pro Asn Leu Ser Leu Pro Val Pro Gly 40 45 Wing Pro Pro Thr Pro Wing Gln Pro Tyr Ser Leu Leu Pro Gly Wing Gln 50 55 60 Pro Cys Cys Wing Wing Leu Pro Gly Thr Met Arg Pro Leu His Val Arg 65 70 75 80 Thr Thr Ser Asp Gly Gly Tyr Ser Phe Lys Tyr Glu Thr Val Pro Asn 85 90 95 Leu Leu Thr Gln His Cys Ala Cys He 100 105 (2) .- INFORMATION FOR SEQ ID NO: 170: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 99 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 170: Cys Ala Leu Arg Glu Leu Ser Val Asp Leu Arg Ala Glu Arg Ser Val 1 5 10 15 Leu He Pro Glu Thr Tyr Gln Wing Asn Asn Cys Gln Gly Wing Cys Gly 20 25 30 Trp Pro Gln Ser Asp Arg Asn Pro Arg Tyr Gly Asn His Val Val Leu 35 40 45 Leu Leu Lys Met Gln Wing Arg Gly Wing Thr Leu Wing Arg Pro Pro Cys 50 55 60 Cys Val Pro Thr Wing Tyr Thr Gly Lys Leu Leu He Ser Leu Ser Glu 65 70 75 80 Glu Arg He Ser Wing His His Val Pro Asn Met Val Wing Thr Glu Cys 85 90 95 Gly Cys Arg (2) .- INFORMATION FOR SEQ ID NO: 171: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 102 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 171: Cys Glu Leu His Asp Phe Ser Leu Ser Phe Ser Gln Leu Lys Trp Asp 1 5 10 15 Asn Trp He Val Wing Pro His Ser Tyr Asn Pro Ser Tyr Cys Lys Gly 20 25 30 Asp Cys Pro Ser Wing Val Ser His Arg Tyr Gly Ser Pro Val His Thr 35 40 45 Met Val Gln Asn Met He Tyr Glu Lys Leu Asp Pro Ser Val Pro Ser 50 55 60 Pro Ser Cys Val Pro Gly Lys Tyr Ser Pro Leu Ser Val Leu Thr He 65 70 75 80 Glu Pro Asp Gly Ser He Wing Tyr Lys Glu Tyr Glu Asp Met Met Wing 85 90 95 Thr Ser Cys Thr Cys Arg 100 (2) .- INFORMATION FOR SEQ ID NO: 172: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 94 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 172: Cys Val Leu Thr Ala He His Leu Asn Val Thr Asp Leu Gly Leu Gly 1 5 10 15 Tyr Glu Thr Lys Glu Glu Leu He Phe Arg Tyr Cys Ser Gly Ser Cys 20 25 30 Asp Ala Ala Glu Thr Thr Tyr Asp Lys He Leu Lys Asn Leu Ser Arg 35 40 45 Asn Arg Arg Leu Val Ser Asp Lys Val Gly Gln Wing Cys Cys Arg Pro 50 55 60 He Wing Phe Asp Asp Asp Leu Ser Phe Leu Asp Asp Asn Leu Val Tyr 65 70 75 80 His He Leu Arg Lys His Ser Ala Lys Arg Cys Gly Cys He 85 90 (2) .- INFORMATION FOR SEQ ID NO: 173: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 95 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 173: Cys Gly Leu Arg Glu Leu Glu Val Arg Val Ser Glu Leu Gly Leu Gly 1 5 10 15 Tyr Ala Ser Asp Glu Thr Val Leu Phe Arg Tyr Cys Ala Gly Ala Cys 20 25 30 Glu Wing Wing Wing Arg Val Tyr Asp Leu Gly Leu Arg Arg Leu Arg Gln 35 40 45 Arg Arg Arg Leu Arg Arg Glu Arg Val Arg Ala Gln Pro Cys Cys Arg 50 55 60 Pro Thr Ala Tyr Glu Asp Glu Val Ser Phe Leu Asp Ala His Ser Arg 65 70 75 80 Tyr His Thr Val His Glu Leu Ser Wing Arg Glu Cys Wing Cys Val 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 174: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid 5 (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: DNA (genomic). (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 174: GCCTTGGCTG GTTCATGCCG ACTGTGGAGC CTGACCCTAC CAGTGGCTGA GCTGGGCCTG 60 • JO GGCTATGCCT CGGAGGAGAA GGTCATCTTC CGATACTGTG CTGGCAGCTG TCCCCAAGAG 120 GCCCGTACCC AGCACAGTCT GGTACTGGCC CGGCTTCGAG GGCGGGGTCG AGCCCATGGC 180 CGACCCTGCT GCCAGCCCAC CAGCTATGCT GATGTGACCT TCCTTGATGA TCAGCACCAT 240 TGGCAGCAGC TGCCTCAGCT CTCAGCTGCA GCTTGTGGCT GTGGTGGCTG A 291 (2) .- INFORMATION FOR SEQ ID NO: 175: 15 (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 405 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D): TOPOLOGY: linear 20 (ii): TYPE OF MOLECULE: DNA (genomic). (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 175: GTAAGAATTC CTGGGGGCCT CCCGACTCCC CAATTCCTTC TCTCAAAGCC CTCACTTTGC 60 CTTACAATCC TACTCTACCT TGCACTAGGT AACAACCATG TCCGTCTTCC AAGAGCCTTG 120 GCTGGTTCAT GCCGACTGTG GAGCCTGACC CTACCAGTGG CTGAGCTGGG CCTGGGCTAT 180 GCCTCGGAGG AGAAGGTCAT CTTCCGATAC TGTGCTGGCA GCTGTCCCCA AGAGGCCCGT 240 ACCCAGCACA GTCTGGTACT GGCCCGGCTT CGAGGGCGGG GTCGAGCCCA TGGCCGACCC 300 TGCTGCCAGC CCACCAGCTA TGCTGATGTG ACCTTCCTTG ATGATCAGCA CCATTGGCAG 360 CAGCTGCCTC AGCTCTCAGC TGCAGCTTGT GGCTGTGGTG GCTGA 405 (2) .- INFORMATION FOR SEQ ID NO: 176: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: DNA (genomic). (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 176: GCCTTACCTG GTTTGTGCCG GCTGTGGAGC CTGACCCTAC CAGTGGCTGA GCTTGGCCTG 60 GGCTATGCCT CAGAGGAGAA GATTATCTTC CGATACTGTG CTGGCAGCTG TCCCCAAGAG 120 GTCCGTACCC AGCACAGTCT GGTGCTGGCC CGTCTTCGAG GGCAGGGTCG AGCTCATGGC 180 AGACCTTGCT GCCAGCCCAC CAGCTATGCT GATGTGACCT TCCTTGATGA CCACCACCAT 240 TGGCAGCAGC TGCCTCAGCT CTCAGCCGCA GCTTGTGGCT GTGGTGGCTG A 291 (2) .- INFORMATION FOR SEQ ID NO: 177: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 723 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 176: ATGGCTGCAG GAAGACTTCG GATCCTGTGT CTGCTGCTCC TGTCCTTGCA CCCGAGCCTC 60 GGCTGGGTCC TTGATCTTCA AGAGGCTTCT GTGGCAGATA AGCTCTCATT TGGGAAGATG 120 GCAGAGACTA GAGGGACCTG GACGCCCCAT CAGGGTAAGA ATTCCTGGGG GCCTCCCGAC 180 TCCCCAATTC CTTCTCTCAA AGCCCTCACT TTGCCTTACA ATCCTACTCT ACCTTGCACT 240 AGGTAACAAC CATGTCCGTC TTCCAAGAGC CTTGGCTGGT TCATGCCGAC TGTGGAGCCT 300 GACCCTACCA GTGGCTGAGC TGGGCCTGGG CTATGCCTCG GAGGAGAAGG TCATCTTCCG 360 ATACTGTGCT GGCAGCTGTC CCCAAGAGGC CCGTACCCAG CACAGTCTGG TACTGGCCCG 420 GCTTCGAGGG CGGGGTCGAG CCCATGGCCG ACCCTGCTGC CAGCCCACCA GCTATGCTGA 480 TGTGACCTTC CTTGATGATC AGCACCATTG GCAGCAGCTG CCTCAGCTCT CAGCTGCAGC 540 TTGTGGCTGT GGTGGCTGAA GGAGGCCAGT CTGGTGTCTC AGAATCACAA GCATGAGACA 600 GGCTGGGCTT TGAAAGGCTC AGGTGACATT ACTAGAAATT TGCATAGGTA AAGATAAGAA 660 GGGAAAGGAC CAGGGGTTTT TTGTTTCTTT CTTTGCTTGC TTGTTAGTTT TTTTTTTTT 720 TTT 723 (2) .- INFORMATION FOR SEQ ID NO: 177: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 723 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 177: ATGGCTGCAG GAAGACTTCG GATCCTGTGT CTGCTGCTCC TGTCCTTGCA CCCGAGCCTC 60 GGCTGGGTCC TTGATCTTCA AGAGGCTTCT GTGGCAGATA AGCTCTCATT TGGGAAGATG 120 GCAGAGACTA GAGGGACCTG GACGCCCCAT CAGGGTAAGA ATTCCTGGGG GCCTCCCGAC 180 TCCCCAATTC CTTCTCTCAA AGCCCTCACT TTGCCTTACA ATCCTACTCT ACCTTGCACT 240 AGGTAACAAC CATGTCCGTC TTCCAAGAGC CTTGGCTGGT TCATGCCGAC TGTGGAGCCT 300 GACCCTACCA GTGGCTGAGC TGGGCCTGGG CTATGCCTCG GAGGAGAAGG TCATCTTCCG 360 ATACTGTGCT GGCAGCTGTC CCCAAGAGGC CCGTACCCAG CACAGTCTGG TACTGGCCCG 420 GCTTCGAGGG CGGGGTCGAG CCCATGGCCG ACCCTGCTGC CAGCCCACCA GCTATGCTGA 480 TGTGACCTTC CTTGATGATC AGCACCATTG GCAGCAGCTG CCTCAGCTCT CAGCTGCAGC 540 TTGTGGCTGT GGTGGCTGAA GGAGGCCAGT CTGGTGTCTC AGAATCACAA GCATGAGACA 600 GGCTGGGCTT TGAAAGGCTC AGGTGACATT ACTAGAAATT TGCATAGGTA AAGATAAGAA 660 GGGAAAGGAC CAGGGGTTTT TTGTTTCTTT CTTTGCTTGC TTGTTAGTTT 720 TTT 723 (2) .- INFORMATION FOR SEQ ID NO: 178: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 723 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 178: TACCGACGTC CTTCTGAAGC CTAGGACACA GACGACGAGG ACAGGAACGT GGGCTCGGAG 60 CCGACCCAGG AACTAGAAGT TCTCCGAAGA CACCGTCTAT TCGAGAGTAA ACCCTTCTAC 120 CGTCTCTGAT CTCCCTGGAC CTGCGGGGTA GTCCCATTCT TAAGGACCCC CGGAGGGCTG 180 AGGGGTTAAG GAAGAGAGTT TCGGGAGTGA AACGGAATGT TAGGATGAGA TGGAACGTGA 240 TACATTGTTG GTACAGGCAG AAGGTTCTCG GAACCGACCA AGTACGGCTG ACACCTCGGA 300 CTGGGATGGT CACCGACTCG ACCCGGACCC GATACGGAGC CTCCTCTTCC AGTAGAAGGC 360 TATGACACGA CCGTCGACAG GGGTTCTCCG GGCATGGGTC GTGTCAGACC ATGACCGGGC 420 CGAAGCTCCC GCCCCAGCTC GGGTACCGGC TGGGACGACG GTCGGGTGGT CGATACGACT 480 ACACTGGAAG GAACTACTAG TCGTGGTAAC CGTCGTCGAC GGAGTCGAGA GTCGACGTCG 540 AACACCGACA CCACCGACTT CCTCCGGTCA GACCACAGAG TCTTAGTGTT CGTACTCTGT 600 CCGACCCGAA ACTTTCCGAG TCCACTGTAA TGATCTTTAA ACGTATCCAT TTCTATTCTT 660 CCCTTTCCTG GTCCCCAAAA AACAAAGAAA GAAACGAACG AACAATCAAA AAAAAAAAAA 720 AAA 723 (2) .- INFORMATION FOR SEQ ID NO: 179: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 179: ATGGCTGCAG GAAGACTTCG GATCCTGTGT CTGCTÍÍCTCC TGTCCTTGCA CCCGAGCCTC 60 GGCTGGGTCC TTGATCTTCA AGAGGCTTCT GTGGCAGATA AGCTCTCATT TGGGAAGATG 120 GCAGAGACTA GAGGGACCTG GACGCCCCAT CAGGGTAACA ACCATGTCCG TCTTCCAAGA 180 GCCTTGGCTG GTTCATGCCG ACTGTGGAGC CTGACCCTAC CAGTGGCTGA GCTGGGCCTG 240 GGCTATGCCT CGGAGGAGAA GGTCATCTTC CGATACTGTG CTGGCAGCTG TCCCCAAGAG 300 GCCCGTACCC AGCACAGTCT GGTACTGGCC CGGCTTCGAG GGCGGGGTCG AGCCCATGGC 360 CGACCCTGCT GCCAGCCCAC CAGCTATGCT GATGTGACCT TCCTTGATGA TCAGCACCAT 420 TGGCAGCAGC TGCCTCAGCT CTCAGCTGCA GCTTGTGGCT GTGGTGGCTG A 471 (2) .- INFORMATION FOR SEQ ID NO: 180: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 180: TACCGACGTC CTTCTGAAGC CTAGGACACA GACGACGAGG ACAGGAACGT GGGCTCGGAG 60 CCGACCCAGG AACTAGAAGT TCTCCGAAGA CACCGTCTAT TCGAGAGTAA ACCCTTCTAC 120 CGTCTCTGAT CTCCCTGGAC CTGCGGGGTA GTCCCATTGT TGGTACAGGC AGAAGGTTCT 180 CGGAACCGAC CAAGTACGGC TGACACCTCG GACTGGGATG GTCACCGACT CGACCCGGAC 240 CCGATACGGA GCCTCCTCTT CCAGTAGAAG GCTATGACAC GACCGTCGAC AGGGGTTCTC 300 CGGGCATGGG TCGTGTCAGA CCATGACCGG GCCGAAGCTC CCGCCCCAGC TCGGGTACCG 360 GCTGGGACGA CGGTCGGGTG GTCGATACGA CTACACTGGA AGGAACTACT AGTCGTGGTA 420 ACCGTCGTCG ACGGAGTCGA GAGTCGACGT CGAACACCGA CACCACCGAC T 471 (2) .- INFORMATION FOR SEQ ID NO: 181: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid 5 (C) ): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 181: ATGGCTGCAG GAAGACTTCG GATCCTGTGT CTGCTGCTCC TGTCCTTGCA CCCGAGCCTC 60 - | Q GGCTGGGTCC TTGATCTTCA AGAGGCTTCT GTGGCAGATA AGCTCTCATT TGGGAAGATG 120 GCAGAGACTA GAGGGACCTG GACGCCCCAT CAGGGTAACA ACCATGTCCG TCTTCCAAGA 180 (2) .- INFORMATION FOR SEQ ID NO: 182: (i): CHARACTERISTICS OF THE SEQUENCE: 15 (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. 20 (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 182: TACCGACGTC CTTCTGAAGC CTAGGACACA GACGACGAGG ACAGGAACGT GGGCTCGGAG 60 CCGACCCAGG AACTAGAAGT TCTCCGAAGA CACCGTCTAT TCGAGAGTAA ACCCTTCTAC 120 CGTCTCTGAT CTCCCTGGAC CTGCGGGGTA GTCCCATTGT TGGTACAGGC AGAAGGTTCT 180 (2) INFORMATION FOR SEQ ID .- NO: 183: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 291 base pairs (B): TYPE: nucleic acid 5 (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 183: GCCTTGGCTG GTTCATGCCG ACTGTGGAGC CTGACCCTAC CAGTGGCTGA GCTGGGCCTG 60 - | Q GGCTATGCCT CGGAGGAGAA GGTCATCTTC CGATACTGTG CTGGCAGCTG TCCCCAAGAG 120 GCCCGTACCC AGCACAGTCT GGTACTGGCC CGGCTTCGAG GGCGGGGTCG AGCCCATGGC 180 CGACCCTGCT GCCAGCCCAC CAGCTATGCT GATGTGACCT TCCTTGATGA TCAGCACCAT 240 TGGCAGCAGC TGCCTCAGCT CTCAGCTGCA GCTTGTGGCT GTGGTGGCTG A 291 (2) .- INFORMATION FOR SEQ ID NO: 184: 15 (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D): TOPOLOGY: linear 20 (ii): TYPE OF MOLECULE: cDNA. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 184: CGGAACCGAC CAAGTACGGC TGACACCTCG GACTGGGATG GTCACCGACT CGACCCGGAC 60 CCGATACGGA GCCTCCTCTT CCAGTAGAAG GCTATGACAC GACCGTCGAC AGGGGTTCTC 120 CGGGCATGGG TCGTGTCAGA CCATGACCGG GCCGAAGCTC CCGCCCCAGC TCGGGTACCG 180 GCTGGGACGA CGGTCGGGTG GTCGATACGA CTACACTGGA AGGAACTACT AGTCGTGGTA 240 ACCGTCGTCG ACGGAGTCGA GAGTCGACGT CGAACACCGA CACCACCGAC T 291 (2) .- INFORMATION FOR SEQ ID NO: 185: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 156 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 185: Met Ala Ala Gly Arg Leu Arg He Leu Cys Leu Leu Leu Leu Ser Leu 1 5 10 15 His Pro Ser Leu Gly Trp Val Leu Asp Leu Gln Glu Ala Ser Val Wing 20 25 30 Asp Lys Leu Ser Phe Gly Lys Met Wing Glu Thr Arg Gly Thr Trp Thr 35 40 45 Pro His Gln Gly Asn Asn His Val Arg Leu Pro Arg Ala Leu Wing Gly 50 55 60 Ser Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Ala Glu Leu Gly Leu 65 70 75 80 Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing Gly Ser 85 90 95 Cys Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val Leu Wing Arg Leu 100 105 110 Arg Gly Arg Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro Thr Ser 115 120 125 Tyr Ala Asp Val Thr Phe Leu Asp Asp Gln His His Trp Gln Gln Leu 130 135 140 Pro Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 145 150 155 (2) .- INFORMATION FOR SEQ ID NO: 186: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 60 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide. (xi): SEQUENCE DESCRIPTION: SEQ ID NO: 186: Met Ala Ala Gly Arg Leu Arg He Leu Cys Leu Leu Leu Leu Ser Leu 1 5 10 15 His Pro Ser Leu Gly Trp Val Leu Asp Leu Gln Glu Ala Ser Val Wing 20 25 30 Asp Lys Leu Ser Phe Gly Lys Met Wing Glu Thr Arg Gly Thr Trp Thr 35 40 45 Pro His Gln Gly Asn Asn His Val Arg Leu Pro Arg 50 55 60 (2) .- INFORMATION FOR SEQ ID NO: 187: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 96 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide. (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 187: Ala Leu Ala Gly Ser Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing 1 5 10 15 Glu Leu Gly Leu Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr 20 25 30 Cys Wing Gly Ser Cys Pro Gln Glu Wing Arg Thr Gln His Ser Leu Val 35 40 45 Leu Wing Arg Leu Arg Gly Arg Gly Arg Wing His Gly Arg Pro Cys Cys 50 55 60 Gln Pro Thr Ser Tyr Wing Asp Val Thr Phe Leu Asp Asp Gln His His 65 70 75 80 Trp Gln Gln Leu Pro Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 188: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 559 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): SEQUENCE DESCRIPTION: SEQ ID NO: 188: ATGGCTGCAG GAAGACTTCG GATCTTGTTT CTGCTGCTCC TGTCCTTGCA CCTGGGCCTT 60 GGCTGGGTCC TTGATCTTCA AGAGGCTCCT GCGGCAGATG AGCTCTCATC TGGGAAAATG 120 GCAGAGACTG GAAGGACCTG GAAGCCCCAT CAGGGTAAGA ATTCTTGGGG GCCTCCTAAC 180 TCTACAGTTC TTCCTCTCAA AGCCCTCACT TTGCCTCACA ATCCTATTCT ACCTTGCACT 240 AGGTAACAAC AATGTCCGCC TTCCAAGAGC CTTACCTGGT TTGTGCCGGC TGTGGAGCCT 300 GACCCTACCA GTGGCTGAGC TTGGCCTGGG CTATGCCTCA GAGGAGAAGA TTATCTTCCG 360 ATACTGTGCT GGCAGCTGTC CCCAAGAGGT CCGTACCCAG CACAGTCTGG TGCTGGCCCG 420 TCTTCGAGGG CAGGGTCGAG CTCATGGCAG ACCTTGCTGC CAGCCCACCA GCTATGCTGA 480 TGTGACCTTC CTTGATGACC ACCACCATTG GCAGCAGCTG CCTCAGCTCT CAGCCGCAGC 540 TTGTGGCTGT GGTGGCTGA 559 ( 2) .- INFORMATION FOR SEQ ID NO: 189: (i): CHARACTERISTIC AS OF SEQUENCE: (A): LENGTH: 559 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 189: TACCGACGTC CTTCTGAAGC CTAGAACAAA GACGACGAGG ACAGGAACGT GGACCCGGAA 60 CCGACCCAGG AACTAGAAGT TCTCCGAGGA CGCCGTCTAC TCGAGAGTAG ACCCTTTTAC 120 CGTCTCTGAC CTTCCTGGAC CTTCGGGGTA GTCCCATTCT TAAGAACCCC CGGAGGATTG 180 AGATGTCAAG AAGGAGAGTT TCGGGAGTGA AACGGAGTGT TAGGATAAGA TGGAACGTGA 240 TCCATTGTTG TTACAGGCGG AAGGTTCTCG GAATGGACCA AACACGGCCG ACACCTCGGA 300 CTGGGATGGT CACCGACTCG AACCGGACCC GATACGGAGT CTCCTCTTCT AATAGAAGGC 360 TATGACACGA CCGTCGACAG GGGTTCTCCA GGCATGGGTC GTGTCAGACC ACGACCGGGC 420 AGAAGCTCCC GTCCCAGCTC GAGTACCGTC TGGAACGACG GTCGGGTGGT CGATACGACT 480 ACACTGGAAG GAACTACTGG TGGTGGTAAC CGTCGTCGAC GGAGTCGAGA GTCGGCGTCG 540 AACACCGACA CCACCGACT 559 (2) .- INFORMATION FOR SEQ ID NO: 190: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 190: ATGGCTGCAG GAAGACTTCG GATCTTGTTT CTGCTGCTCC TGTCCTTGCA CCTGGGCCTT 60 GGCTGGGTCC TTGATCTTCA AGAGGCTCCT GCGGCAGATG AGCTCTCATC TGGGAAAATG 120 GCAGAGACTG GAAGGACCTG GAAGCCCCAT CAGGGTAACA ACAATGTCCG CCTTCCAAGA 180 GCCTTACCTG GTTTGTGCCG GCTGTGGAGC CTGACCCTAC CAGTGGCTGA GCTTGGCCTG 240 GGCTATGCCT CAGAGGAGAA GATTATCTTC CGATACTGTG CTGGCAGCTG TCCCCAAGAG 300 GTCCGTACCC AGCACAGTCT GGTGCTGGCC CGTCTTCGAG GGCAGGGTCG AGCTCATGGC 360 AGACCTTGCT GCCAGCCCAC CAGCTATGCT GATGTGACCT TCCTTGATGA CCACCACCAT 420 TGGCAGCAGC TGCCTCAGCT CTCAGCCGCA GCTTGTGGCT GTGGTGGCTG A 471 (2) .- INFORMATION FOR SEQ ID NO: 191: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 191: TACCGACGTC CTTCTGAAGC CTAGAACAAA GACGACGAGG ACAGGAACGT GGACCCGGAA 60 CCGACCCAGG AACTAGAAGT TCTCCGAGGA CGCCGTCTAC TCGAGAGTAG ACCCTTTTAC 120 CGTCTCTGAC CTTCCTGGAC CTTCGGGGTA GTCCCATTGT TGTTACAGGC GGAAGGTTCT 180 CGGAATGGAC CAAACACGGC CGACACCTCG GACTGGGATG GTCACCGACT CGAACCGGAC 240 CCGATACGGA GTCTCCTCTT CTAATAGAAG GCTATGACAC GACCGTCGAC AGGGGTTCTC 300 CAGGCATGGG TCGTGTCAGA CCACGACCGG GCAGAAGCTC CCGTCCCAGC TCGAGTACCG 360 TCTGGAACGA CGGTCGGGTG GTCGATACGA CTACACTGGA AGGAACTACT GGTGGTGGTA 420 ACCGTCGTCG ACGGAGTCGA GAGTCGGCGT CGAACACCGA CACCACCGAC T 471 (2) INFORMATION FOR SEQ ID .- NO: 192 : (i): SEQUENCE CHARACTERISTICS: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENT OS: only one (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 192: ATGGCTGCAG GAAGACTTCG GATCTTGTTT CTGCTGCTCC TGTCCTTGCA CCTGGGCCTT 60 GGCTGGGTCC TTGATCTTCA AGAGGCTCCT GCGGCAGATG AGCTCTCATC TGGGAAAATG 120 GCAGAGACTG GAAGGACCTG GAAGCCCCAT CAGGGTAACA ACAATGTCCG CCTTCCAAGA 180 (2) .- INFORMATION FOR SEQ ID NO: 193: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 193: TACCGACGTC CTTCTGAAGC CTAGAACAAA GACGACGAGG ACAGGAACGT GGACCCGGAA 60 CCGACCCAGG AACTAGAAGT TCTCCGAGGA CGCCGTCTAC TCGAGAGTAG ACCCTTTTAC 120 CGTCTCTGAC CTTCCTGGAC CTTCGGGGTA GTCCCATTGT TGTTACAGGC GGAAGGTTCT 180 (2) INFORMATION FOR SEQ ID .- NO: 194: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO : 194: GCCTTACCTG GTTTGTGCCG GCTGTGGAGC CTGACCCTAC CAGTGGCTGA GCTTGGCCTG 60 GGCTATGCCT CAGAGGAGAA GATTATCTTC CGATACTGTG CTGGCAGCTG TCCCCAAGAG 120 GTCCGTACCC AGCACAGTCT GGTGCTGGCC CGTCTTCGAG GGCAGGGTCG AGCTCATGGC 180 AGACCTTGCT GCCAGCCCAC CAGCTATGCT GATGTGACCT TCCTTGATGA rtGr CCACCACCAT 240 & T GCT AOGT prArtr rtr firrarA prttptcic¡rt aa pr p r r???!; to (2) .- INFORMATION FOR SEQ ID NO: 195: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 195: CGGAATGGAC CAAACACGGC CGACACCTCG GACTGGGATG GTCACCGACT CGAACCGGAC 60 CCGATACGGA GTCTCCTCTT CTAATAGAAG GCTATGACAC GACCGTCGAC AGGGGTTCTC 120 CAGGCATGGG TCGTGTCAGA CCACGACCGG GCAGAAGCTC CCGTCCCAGC TCGAGTACCG 180 TCTGGAACGA CGGTCGGGTG GTCGATACGA CTACACTGGA AGGAACTACT GGTGGTGGTA 240 ACCGTCGTCG ACGGAGTCGA GAGTCGGCGT CGAACACCGA CACCACCGAC T 291 (2) .- INFORMATION FOR SEQ ID NO: 196: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 156 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 196: Met Ala Ala Gly Arg Leu Arg He Leu Phe Leu Leu Leu Leu Ser Leu 1 5 10 15 His Leu Gly Leu Gly Trp Val Leu Asp Leu Gln Glu Ala Pro Wing Ala 20 25 30 Asp Glu Leu Ser Ser Gly Lys Met Ala Glu Thr Gly Arg Thr Trp Lys 35 40 45 Pro His Gln Gly Asn Asn Asn Val Arg Leu Pro Arg Ala Leu Pro Gly 50 55 60 Leu Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing Glu Leu Gly Leu 65 70 75 80 Gly Tyr Wing Ser Glu Glu Lys He He Phe Arg Tyr Cys Wing Gly Ser 85 90 95 Cys Pro Gln Glu Val Arg Thr Gln His Ser Leu Val Leu Wing Arg Leu 100 105 110 Arg Gly Gln Gly Arg Wing His Gly Arg Pro Cys Cys Gln Pro Thr Ser 115 120 125 Tyr Ala Asp Val Thr Phe Leu Asp Asp His His His Trp Gln Gln Leu 130 135 140 Pro Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 145 150 155 (2) .- INFORMATION FOR SEQ ID NO : 197: (i): CHARACTERISTICS OF L A SEQUENCE: (A): LENGTH: 60 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 197: Met Ala Ala Gly Arg Leu Arg He Leu Phe Leu Leu Leu Leu Ser Leu 1 5 10 15 His Leu Gly Leu Gly Trp Val Leu Asp Leu Gln Glu Ala Pro Wing Wing 20 25 30 Asp Glu Leu Ser Gly Lys Met Wing Glu Thr Gly Arg Thr Trp Lys 35 40 45 Pro His Gln Gly Asn Asn Asn Val Arg Leu Pro Arg 50 55 60 (2) .- INFORMATION FOR SEQ ID NO: 198: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 96 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 198: Wing -Leu Pro Gly Leu Cys Arg Leu Trp Ser Leu Thr Leu Pro Val Wing 1 5 10 15 Glu Leu Gly Leu Gly Tyr Wing Ser Glu Glu Lys He He Phe Arg Tyr 20 25 30 Cys Wing Gly Ser Cys Pro Gln Glu Val Arg Thr Gln His Ser Leu Val 35 40 45 Leu Wing Arg Leu Arg Gly Gln Gly Arg Wing His Gly Arg Pro Cys Cys 50 55 60 Gln Pro Thr Ser Tyr Wing Asp Val Thr Phe Leu Asp Asp His His His 65 70 75 80 Trp Gln Gln Leu Pro Gln Leu Be Ala Ala Ala Cys Gly Cys Gly Gly 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 199: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 199: GCCCTGTCTG GTCCATGCCA GCTGTGGAGC CTGACCCTGT CCGTGGCAGA GCTAGGCCTG 60 GGCTACGCCT CAGAGGAGAA GGTCATCTTC CGCTACTGCG CCGGCAGCTG CCCCCGTGGT 120 GCCCGCACCC AGCATGGCCT GGCGCTGGCC CGGCTGCAGG GCCAGGGCCG AGCCCACGGT 180 GGGCCCTGCT GCCGGCCCAC TCGCTACACC GACGTGGCCT TCCTCGATGA CCGCCACCGC 240 TGGCAGCGGC TGCCCCAGCT CTCGGCGGCT GCCTGCGGCT GTGGTGGCTG A 291 (2) .- INFORMATION FOR SEQ ID NO: 200: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 200: CGGGACAGAC CAGGTACGGT CGACACCTCG GACTGGGACA GGCACCGTCT CGATCCGGAC 60 CCGATGCGGA GTCTCCTCTT CCAGTAGAAG GCGATGACGC GGCCGTCGAC GGGGGCACCA 120 CGGGCGTGGG TCGTACCGGA CCGCGACCGG GCCGACGTCC CGGTCCCGGC TCGGGTGCCA 180 CCCGGGACGA CGGCCGGGTG AGCGATGTGG CTGCACCGGA AGGAGCTACT GGCGGTGGCG 240 ACCGTCGCCG ACGGGGTCGA GAGCCGCCGA CGGACGCCGA CACCACCGAC T 291 (2) .- INFORMATION FOR SEQ ID NO: 201: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 201: GCCCTGTCTG GTCCATGCCA GCTGTGGAGC CTGACCCTGT CCGTGGCAGA GCTAGGCCTG 60 GGCTACGCCT CAGAGGAGAA GGTCATCTTC CGCTACTGCG CCGGCAGCTG CCCCCGTGGT 120 GCCCGCACCC AGCATGGCCT GGCGCTGGCC CGGCTGCAGG GCCAGGGCCG AGCCCACGGC 180 GGGCCCTGCT GCCGGCCCAC TCGCTACACC GACGTGGCCT TCCTCGATGA CCGCCACCGC 240 TGGCAGCGGC TGCCCCAGCT CTCGGCGGCT GCCTGCGGCT GTGGTGGCTG A 291 (2) .- INFORMATION FOR SEQ ID NO: 202: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 291 base pairs ( B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 202: CGGGACAGAC CAGGTACGGT CGACACCTCG GACTGGGACA GGCACCGTCT CGATCCGGAC 60 CCGATGCGGA GTCTCCTCTT CCAGTAGAAG GCGATGACGC GGCCGTCGAC GGGGGCACCA 120 CGGGCGTGGG TCGTACCGGA CCGCGACCGG GCCGACGTCC CGGTCCCGGC TCGGGTGCCG 180 CCCGGGACGA CGGCCGGGTG AGCGATGTGG CTGCACCGGA AGGAGCTACT GGCGGTGGCG 240 ACCGTCGCCG ACGGGGTCGA GAGCCGCCGA CGGACGCCGA CACCACCGAC T 291 (2) .- INFORMATION FOR SEQ ID NO: 203: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 203: ATGGCCGTAG GGAAGTTCCT GCTGGGCTCT CTGCTGCTCC TGTCCCTGCA GCTGGGACAG 60 GGCTGGGGCC CCGATGCCCG TGGGGTTCCC GTGGCCGATG GAGAGTTCTC GTCTGAACAG 120 GTGGCAAAGG CTGGAGGGAC CTGGCTGGGC ACCCACCGCC CCCTTGCCCG CCTGCGCCGA 180 GCCCTGTCTG GTCCATGCCA GCTGTGGAGC CTGACCCTGT CCGTGGCAGA GCTAGGCCTG 240 GGCTACGCCT CAGAGGAGAA GGTCATCTTC CGCTACTGCG CCGGCAGCTG CCCCCGTGGT 300 GCCCGCACCC AGCATGGCCT GGCGCTGGCC CGGCTGCAGG GCCAGGGCCG AGCCCACGGT 360 GGGCCCTGCT GCCGGCCCAC TCGCTACACC GACGTGGCCT TCCTCGATGA CCGCCACCGC 420 TGGCAGCGGC TGCCCCAGCT CTCGGCGGCT GCCTGCGGCT GTGGTGGCTG A 471 (2) .- INFORMATION FOR SEQ ID NO: 204: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 204: TACCGGCATC CCTTCAAGGA CGACCCGAGA GACGACGAGG ACAGGGACGT CGACCCTGTC 60 CCGACCCCGG GGCTACGGGC ACCCCAAGGG CACCGGCTAC CTCTCAAGAG CAGACTTGTC 120 CACCGTTTCC GACCTCCCTG GACCGACCCG TGGGTGGCGG GGGAACGGGC GGACGCGGCT 180 CGGGACAGAC CAGGTACGGT CGACACCTCG GACTGGGACA GGCACCGTCT CGATCCGGAC 240 CCGATGCGGA GTCTCCTCTT CCAGTAGAAG GCGATGACGC GGCCGTCGAC GGGGGCACCA 300 CGGGCGTGGG TCGTACCGGA CCGCGACCGG GCCGACGTCC CGGTCCCGGC TCGGGTGCCA 360 CCCGGGACGA CGGCCGGGTG AGCGATGTGG CTGCACCGGA AGGAGCTACT GGCGGTGGCG 420 ACCGTCGCCG ACGGGGTCGA GAGCCGCCGA CGGACGCCGA CACCACCGAC T 471 (2) .- INFORMATION FOR SEQ ID NO: 205: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C) : No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 205: ATGGCCGTAG GGAAGTTCCT GCTGGGCTCC CTGCTGCTCC TGTCCCTGCA GCTGGGACAG 60 GGCTGGGGCC CCGATGCCCG TGGGGTTCCC GTGGCCGATG GAGAGTTCTC GTCTGAACAG 120 GTGGCAAAGG CTGGAGGGAC CTGGCTGGGC ACCCACCGCC CCCTTGCCCG CCTGCGCCGA 180 GCCCTGTCTG GTCCATGCCA GCTGTGGAGC CTGACCCTGT CCGTGGCAGA GCTAGGCCTG 240 GGCTACGCCT CAGAGGAGAA GGTCATCTTC CGCTACTGCG CCGGCAGCTG CCCCCGTGGT 300 GCCCGCACCC AGCATGGCCT GGCGCTGGCC CGGCTGCAGG GCCAGGGCCG AGCCCACGGC 360 GGGCCCTGCT GCCGGCCCAC TCGCTACACC GACGTGGCCT TCCTCGATGA CCGCCACCGC 420 TGGCAGCGGC TGCCCCAGCT CTCGGCGGCT GCCTGCGGCT GTGGTGGCTG A 471 (2) .- INFORMATION FOR SEQ ID NO: 206: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 471 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 206: TACCGGCATC CCTTCAAGGA CGACCCGAGG GACGACGAGG ACAGGGACGT CGACCCTGTC 60 CCGACCCCGG GGCTACGGGC ACCCCAAGGG CACCGGCTAC CTCTCAAGAG CAGACTTGTC 120 CACCGTTTCC GACCTCCCTG GACCGACCCG TGGGTGGCGG GGGAACGGGC GGACGCGGCT 180 CGGGACAGAC CAGGTACGGT CGACACCTCG GACTGGGACA GGCACCGTCT CGATCCGGAC 240 CCGATGCGGA GTCTCCTCTT CCAGTAGAAG GCGATGACGC GGCCGTCGAC GGGGGCACCA 300 CGGGCGTGGG TCGTACCGGA CCGCGACCGG GCCGACGTCC CGGTCCCGGC TCGGGTGCCG 360 CCCGGGACGA CGGCCGGGTG AGCGATGTGG CTGCACCGGA AGGAGCTACT GGCGGTGGCG 420 ACCGTCGCCG ACGGGGTCGA GAGCCGCCGA CGGACGCCGA CACCACCGAC T 471 (2) .- INFORMATION FOR SEQ ID NO: 207: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 69 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 207 ATGGCCGTAG GGAAGTTCCT GCTGGGCTCT CTGCTGCTCC TGTCCCTGCA GCTGGGACAG GGCTGGGGC 69 (2) .- INFORMATION FOR SEQ ID NO: 208: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 69 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 208: TACCGGCATC CCTTCAAGGA CGACCCGAGA GACGACGAGG ACAGGGACGT CGACCCTGTC 60 CCGACCCCG 69 (2) .- INFORMATION FOR SEQ ID NO: 209: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 69 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 209: ATGGCCGTAG GGAAGTTCCT GCTGGGCTCC CTGCTG CTCC TGTCCCTGCA GCTGGGACAG 60 GGCTGGGGC 69 (2) .- INFORMATION FOR SEQ ID NO: 210: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 69 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 210: TACCGGCATC CCTTCAAGGA CGACCCGAGG GACGACGAGG ACAGGGACGT CGACCCTGTC 60 CCGACCCCG 69 (2) .- INFORMATION FOR SEQ ID NO: 211: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 111 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 211: CCCGATGCCC GTGGGGTTCC CGTGGCCGAT GGAGAGTTCT CGTCTGAACA GGTGGCAAAG 60 GCTGGAGGGA CCTGGCTGGG CACCCACCGC CCCCTTGCCC GCCTGCGCCG A 111 (2) .- INFORMATION FOR SEQ ID NO: 212: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 111 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 212: GGGCTACGGG CACCCCAAGG GCACCGGCTA CCTCTCAAGA GCAGACTTGT CCACCGTTTC 60 CGACCTCCCT GGACCGACCC GTGGGTGGCG GGGGAACGGG CGGACGCGGC T 111 (2) .- INFORMATION FOR SEQ ID NO: 213: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 213: ATGGCCGTAG GGAAGTTCCT GCTGGGCTCT CTGCTGCTCC TGTCCCTGCA GCTGGGACAG 60 GGCTGGGGCC CCGATGCCCG TGGGGTTCCC GTGGCCGATG GAGAGTTCTC GTCTGAACAG 120 GTGGCAAAGG CTGGAGGGAC CTGGCTGGGC ACCCACCGCC CCCTTGCCCG CCTGCGCCGA 180 (2) .- INFORMATION FOR SEQ ID NO: 214: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 214: TACCGGCATC CCTTCAAGGA CGACCCGAGA GACGACGAGG ACAGGGACGT CGACCCTGTC 60 CCGACCCCGG GGCTACGGGC ACCCCAAGGG CACCGGCTAC CTCTCAAGAG CAGACTTGTC 120 CACCGTTTCC GACCTCCCTG GACCGACCCG TGGGTGGCGG GGGAACGGGC GGACGCGGCT 180 (2) .- INFORMATION FOR SEQ ID NO: 215: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 215: ATGGCCGTAG GGAAGTTCCT GCTGGGCTCC CTGCTGCTCC TGTCCCTGCA GCTGGGACAG 60 GGCTGGGGCC CCGATGCCCG TGGGGTTCCC GTGGCCGATG GAGAGTTCTC GTCTGAACAG 120 GTGGCAAAGG CTGGAGGGAC CTGGCTGGGC ACCCACCGCC CCCTTGCCCG CCTGCGCCGA 180 (2) .- INFORMATION FOR SEQ ID NO: 216: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 180 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 216: TACCGGCATC CCTTCAAGGA CGACCCGAGG GACGACGAGG ACAGGGACGT CGACCCTGTC 60 CCGACCCCGG GGCTACGGGC ACCCCAAGGG CACCGGCTAC CTCTCAAGAG CAGACTTGTC 120 CACCGTTTCC GACCTCCCTG GACCGACCCG TGGGTGGCGG GGGAACGGGC GGACGCGGCT 180 (2) .- INFORMATION FOR SEQ ID NO: 217: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 156 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 217: Met Wing Val Gly Lys Phe Leu Leu Gly Ser Leu Leu Leu Leu Ser Leu 1 5 10 15 Gln Leu Gly Gln Gly Trp Gly Pro Asp Wing Arg Gly Val Pro Val Wing 20 25 30 Asp Gly Glu Phe Ser Glu Gln Val Wing Lys Wing Gly Gly Thr Trp 35 40 45 Leu Gly Thr His Arg Pro Leu Wing Arg Leu Arg Arg Wing Leu Ser Gly 50 55 60 Pro Cys Gln Leu Trp Ser Leu Thr Leu Ser Val Wing Glu Leu Gly Leu 65 70 75 80 Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing Gly Ser 85 90 95 Cys Pro Arg Gly Wing Arg Thr Gln His Gly Leu Wing Leu Wing Arg Leu 100 105 110 Gln Gly Gln Gly Arg Wing His Gly Gly Pro Cys Cys Arg Pro Thr Arg 115 120 125 Tyr Thr Asp Val Wing Phe Leu Asp Asp Arg His Arg Trp Gln Arg Leu 130 135 140 Pro Gln Leu Ser Ala Ala Ala C ys Gly Cys Gly Gly 145 150 155 (2) .- INFORMATION FOR SEQ ID NO: 218: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 60 amino acids (B): TYPE: amino acid (C): No FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 218: Met Wing Val Gly Lys Phe Leu Leu Gly Ser Leu Leu Leu Leu Ser Leu 1 5 10 15 Gln Leu Gly Gln Gly Trp Gly Pro Asp Wing Arg Gly Val Pro Val Wing 20 25 30 Asp Gly Glu Phe Ser Glu Gln Val Wing Lys Wing Gly Gly Thr Trp 35 40 45 Leu Gly Thr His Arg Pro Leu Wing Arg Leu Arg Arg 50 55 60 (2) .- INFORMATION FOR SEQ ID NO: 219: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 23 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 219: Met Wing Val Gly Lys Phe Leu Leu Gly Ser Leu Leu Leu Leu Ser Leu 1 5 10 15 Gln Leu Gly Gln Gly Trp Gly 20 (2). INFORMATION FOR SEQ ID NO: 220: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 37 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 220: Pro Asp Wing Arg Gly Val Pro Val Wing Asp Gly Glu Phe Ser Ser Glu 1 5 10 15 Gln Val Wing Lys Wing Gly Gly Thr Trp Leu Gly Thr His Arg Pro Leu 20 25 30 Wing Arg Leu Arg Arg 35 (2) .- INFORMATION FOR SEQ ID NO: 221: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 96 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 221: Wing Leu Ser Gly Pro Cys Gln Leu Trp Ser Leu Thr Leu Ser Val Wing 1 5 10 15 Glu Leu Gly Leu Gly Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr 20 25 30 Cys Wing Gly Ser Cys Pro Arg Gly Wing Arg Thr Gln His Gly Leu Wing 35 40 45 Leu Wing Arg Leu Gln Gly Gln Gly Arg Wing His Gly Gly Pro Cys Cys 50 55 60 Arg Pro Thr Arg Tyr Thr Asp Val Wing Phe Leu Asp Asp Arg His Arg 65 70 75 80 Trp Gln Arg Leu Pro Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 85 90 95 (2) .- INFORMATION FOR SEQ ID NO: 222: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 91 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (i): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 222: Cys Gln Leu Trp Ser Leu Thr Leu Ser Val Ala Glu Leu Gly Leu Gly 1 5 10 15 Tyr Ala Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing Gly Ser Cys 20 25 30 Pro Arg Gly Wing Arg Thr Gln His Gly Leu Wing Leu Wing Arg Leu Gln 35 40 45 Gly Gln Gly Arg Wing His Gly Gly Pro Cys Cys Arg Pro Thr Arg Tyr 50 55 60 Thr Asp Val Wing Phe Leu Asp Asp Arg His Arg Trp Gln Arg Leu Pro 65 70 75 80 Gln Leu Ser Ala Ala Ala Cys Gly Cys Gly Gly 85 90 (2) .- INFORMATION FOR SEQ ID NO: 223: 0): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 89 amino acids (B): TYPE: amino acid ( C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 223: Cys Gln Leu Trp Ser Leu Thr Leu Ser Val Wing Glu Leu Gly Leu Gly 1 5 10 15 Tyr Wing Ser Glu Glu Lys Val He Phe Arg Tyr Cys Wing Gly Ser Cys 20 25 30 Pro Arg Gly Wing Arg Thr Gln His Gly Leu Wing Leu Ala Arg Leu Gln 40 45 Gly Gln Gly Arg Wing His Gly Gly Pro Cys Cys Arg Pro Thr Arg Tyr 50 55 60 Thr Asp Val Wing Phe Leu Asp Asp Arg His Arg Trp Gln Arg Leu Pro 65 70 75 80 Gln Leu Ser Ala Ala Ala Cys Gly Cys 85 (2) .- INFORMATION FOR SEQ ID NO: 224: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 5 amino acids (B): TYPE: amino acid (C): No. OF FILAMENTS: one (D) ): TOPOLOGY: linear (ii): TYPE OF MOLECULE: peptide (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 224 Ala Leu Ser Gly Pro 1 5 (2) .- INFORMATION FOR SEQ ID NO: 225: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 225: GTSASYGASY TGGGYCTGGG CTAY 24 (2) .- INFORMATION FOR SEQ ID NO: 226: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 226: TTYMGSTACT GCRSMGGCKC YTGC 24 (2) .- INFORMATION FOR SEQ ID NO: 227: ( i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 227: RWAGGCSRTS GGKCKGCARC AKGS 24 (2) .- INFORMATION FOR SEQ ID NO: 228: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 21 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 228: MKCRTCYARR AASGACASST C 21 (2) .- INFORMATION FOR SEQ ID NO: 229: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 168 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 229: CGGCTTGTGA CCGAGCTGGG CCTGGGCTAC GCCTCAGAGG AGAAGGTCAT CTTCCGCTAC 60 TGCGCCGGCA GCTGCCCCCG TGGTGCCCGC ACCCAGCATG GCCTGGCGCT GGCCCGGCTG 120 CAGGGCCAGG GCCGAGCCCA CGGCGGGCCC TGCTGCCGCC CCATGGCC 168 (2) .- INFORMATION FOR SEQ ID NO: 230: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 230: GAGGAGAAGG TCATCTTCCG 20 (2) .- INFORMATION FOR SEQ ID NO: 231: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 231: CCCGTGGGCT CGGCCCTGGC 20 (2) .- INFORMATION FOR SEQ ID NO: 232: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 24 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 232: AGAGGAGAAG GTCATCTTCC GCTA 24 (2) .- INFORMATION FOR SEQ ID NO: 233: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 233: CTCGGCCCTG GCCCTGCAGC 20 (2) .- INFORMATION FOR SEQ ID NO: 234: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 20 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 234: TGCAGCCGGG CCAGCGCCAG 20 (2) .- INFORMATION FOR SEQ ID NO: 235: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 31 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 235: CGCGGATCCA TGCCTGGATT CGAGGGTGCA G 31 (2) .- INFORMATION FOR SEQ ID NO: 236: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 31 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 236: CGCGGATCCA TGGCCGTAGG GAAGTTCCTG C 31 (2) .- INFORMATION FOR SEQ ID NO: 237: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 60 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 237: CTCCCAAGCT TTTACTTGTC ATCGTCGTCC TTGTAGTCGC CACCACAGCC GCAGGCAGCC 60 (2) .- INFORMATION FOR SEQ ID NO: 238: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 59 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (i): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 238: CTCCCAAGCT TTTACTTGTC ATCGTCGTCC TTGTAGTCTC GAGGAAGGCC ACGTCGGTG 59 (2) .- INFORMATION FOR SEQ ID NO: 239: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 25 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 239: TCAGCCACCA CAGCCGCAGG CAGCC 25 (2) .- INFORMATION FOR SEQ ID NO: 240: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 70 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only, (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 240: CATAAAATAG GTGTGGAGTC GCAAAAAGTT TAAAGAAGAG AAAGGAACCA GAAAAAAAAA 60 TAGAAAGCGC 70 (2) .- INFORMATION FOR SEQ ID NO: 241: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 69 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 241: CATAAAATAG GTGTGGAGTC GCGAAAAGTT TAAAGAGAGT AAGGAACCAG AAAAAAAAAT 60 AGAAAGCGC 69 (2) .- INFORMATION FOR SEQ ID NO: 242: (i): CHARACTERISTICS OF THE SEQUENCE: (A): LENGTH: 68 base pairs (B): TYPE: nucleic acid (C): No. OF FILAMENTS: one only (D): TOPOLOGY: linear (ii): TYPE OF MOLECULE: cDNA (xi): DESCRIPTION OF SEQUENCE: SEQ ID NO: 242: CATAAAATAG GTGTGGAGTC GCGAAGTTTA AAGAGAGTAA GGAACCAGAA AAAAAAAATA 60 GAAAGCGC 68

Claims (27)

NOVELTY OF INVENTION CLAIMS

1. - An isolated and purified growth factor, characterized in that it comprises persephin or a fragment eof, or a variant eof conservatively substituted.

2. isolated and purified growth factor according to claim 1, fur characterized in that it comprises a polypeptide sequence having at least about 75% sequence identity with SEQ ID NO: 79, SEQ ID NO: 82 o SEQ ID NO: 223, or its conservatively substituted variants.

3. growth factor isolated and purified according to claim 2, fur characterized in that it comprises a polypeptide sequence as indicated in SEQ ID NO: 187, SEQ ID NO: 198, SEQ ID NO: 221, or its variants conservatively replaced.

4. isolated and purified growth factor according to claim 3, fur characterized by promoting survival in mesencephalic cells.

5. An isolated and purified polypeptide, characterized in that it comprises: (a) a pre-pro-persephin as indicated in SEQ ID NO: 217, SEQ ID NO: 185 or SEQ ID NO: 196; (b) a prepro region of persephin, as indicated in SEQ ID NO: 218, SEQ ID NO: 186 or SEQ ID NO: 197; (c) a pre-persephin region, as indicated in SEQ ID NO: 219; (d) a pro-persephin region, as indicated in SEQ ID NO: 220; or (e) its conservatively substituted variants.

6. isolated and purified growth factor according to claim 1, fur characterized in that it comprises a polypeptide containing an amino acid sequence having at least about 65% sequence identity with SEQ ID NO: 79 or SEQ ID NO: 82 or SEQ ID NO: 223; where growth factor comes from a species that is not a mammal.

7 '.- A method to obtain a growth factor, member of neurturin-persephin-GDNF family, characterized in that it comprises: (a) isolating (1) from a genomic bank or from human cDNA, a clone that hybridizes with a polynucleotide comprising a sequence of persephin, neurturin or GDNF, or fragments eof; or (2) of a genomic or human cDNA template, a clone using a polymerase chain reaction method, which degenerates sensitizers of a conserved region of any two of persephin, neurturin or GDNF, or fragments of said conserved regions; and (b) sequencing said clone.

8. An isolated and purified precursor factor, which is a member of neurturin-persephin-GDNF family, characterized in that it comprises a polypeptide having between about 30% and about 75% sequence identity with persephin; between about 30% and about 75% sequence identity with neurturin and between about 30% and about 75% sequence identity with GDNF; wherein said factor is constituted by an amino acid sequence of a conserved region, having at least 62.5 percent sequence identity with SEQ ID NO: 108 or at least 62.5 percent sequence identity with SEQ ID NO: 109 or at least 50% sequence identity with SEQ ID NO: 110.

9. A pan-growth factor, characterized in that it comprises a fragment of persephin polypeptide, according to claim 1, and a fragment of at least a growth factor of TGF-β superfamily, different from persefine.

10. An isolated and purified nucleic acid molecule, or a nucleic acid molecule complementary eto, characterized in that it comprises a nucleotide sequence encoding a growth factor of claim 1, or a fragment of that nucleotide sequence, which consists of at least 15 contiguous nucleotides.

11. isolated and purified nucleic acid molecule, or nucleic acid molecule complementary eto, according to claim 10, fur characterized in that it comprises a nucleotide sequence that encodes a persephin polypeptide, which promotes cell survival mesencephalic; wherein nucleic acid molecule or complement eof hybridizes specifically to SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 200 , SEQ ID NO: 201 or SEQ ID NO: 202.

12. - The isolated and purified nucleic acid molecule, or the nucleic acid molecule complementary thereto, according to claim 11, further characterized in that it comprises SEQ ID NO: 183, SEQ ID NO: 194, SEQ ID NO: 199 OR SEQ ID NO: 201.

13.- A rector characterized in that it comprises expression regulatory elements, operably linked to a nucleic acid molecule of claim 10.

14. A host cell, characterized in that it is transformed with the vector of claim 13.

15. An isolated and purified nucleic acid molecule, characterized in that it comprises: 8a) a pre-pro nucleotide sequence of persephin, as indicated in SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 203, SEQ ID NO: 204, SEQ ID NO: 205 or SEQ ID NO: 206; or a polynucleotide that hybridizes specifically to SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 203, SEQ ID NO: 204, SEQ ID NO: 205 OR SEQ ID NO: 206; (b) a pre-pro region of a persephin polynucleotide, as indicated in SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO: 213, SEQ ID NO: 214, SEQ ID NO: 215 or SEQ ID NO: 216; (c) a pre region of a persephin polynucleotide, as indicated in SEQ ID NO: 207, SEQ ID NO: 208, SEQ ID NO: 209 or SEQ ID NO: 210; (d) a pro region of a persephin polynucleotide as indicated in SEQ ID NO: 211 or SEQ ID NO: 212; or (e) a fragment thereof, comprising at least 15 contiguous nucleotides.

16. A recombinant method characterized in that it comprises: (a) subcloning a polynucleotide encoding the growth factor of claim 1, into an expression vector comprising regulatory elements operably linked to the polynucleotide; (b) transforming a host cell with the expression vector; (c) developing the host cell in a host cell culture; and (d) harvesting the growth factor and / or the polynucleotide from the host cell culture.

17. Isolated and purified antibodies, characterized in that they are capable of reacting with a growth factor as defined in claim 1, or an epitope thereof.

18. A method for detecting the presence of a growth factor in a sample of a patient, characterized in that it comprises reacting antibodies according to claim 17, with a growth factor present in the sample; and detect a binding of the antibodies with the growth factor.

19. A device for detecting the presence of a growth factor in a sample of a patient, characterized in that it comprises antibodies of claim 17, which are capable of reacting in a detectable manner with said growth factor, packaged in a container.

20. The use of a quantity of the growth factor of claim 1 or of a polynucleotide that encodes the growth factor of claim 1, for the manufacture of a medicament for preventing or treating cellular degeneration or insufficiency in an individual .

21. The use according to claim 20, further characterized by cellular degeneration or failure are: (a) neuronal degeneration resulting from peripheral neuropathy, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, infarction ischemic, acute brain damage, acute spinal cord damage, tumors in the nervous system, multiple sclerosis or infection; (b) degeneration or insufficiency of the hematopoietic cells, as a result of eosinopenia, basopenia, lymphopenia, monocytopenia, neutropenia, anemias, thrombocytopenia or stem cell insufficiencies for them; or (c) degeneration or failure of the heart muscle, as a result of cardiomyopathy or congestive heart failure.

22. The use of the growth factor of claim 1, for the manufacture of a medicament for preventing or treating cellular degeneration or insufficiency in an individual.

23.- A method to detect the presence of a growth factor in a sample of a patient, characterized in that it comprises detecting and / or quantifying the presence in the sample of mRNA encoding a growth factor of claim 1.

24.- A method for detecting alterations in the persephin gene, characterized in that it comprises detecting the presence of a gene. of persephin not intact in a cell, where the presence of the non-intact gene indicates the presence of alterations of the gene.

25. - A method for promoting the growth and / or differentiation of a cell in a culture medium, characterized in that it comprises adding to the culture medium the growth factor of claim 1.

26.- A polynucleotide of the opposite direction of persephin isolated and purified, characterized in that it comprises a sequence complementary to a nucleic acid sequence of claim 10, and that it is capable of hybridizing to a naturally occurring DNA or mRNA polynucleotide sequence, which encodes persephin, to prevent transcription and / or the translation of a coded persephin polypeptide.

27. The use of an effective inhibitory amount of the opposite-sense polynucleotide according to claim 26, for the manufacture of a medicament for treating a disease condition mediated by the expression of persephin by a population of cells.