WO1998046743A1 - Novel ldl-receptor - Google Patents
Novel ldl-receptor Download PDFInfo
- Publication number
- WO1998046743A1 WO1998046743A1 PCT/GB1998/001102 GB9801102W WO9846743A1 WO 1998046743 A1 WO1998046743 A1 WO 1998046743A1 GB 9801102 W GB9801102 W GB 9801102W WO 9846743 A1 WO9846743 A1 WO 9846743A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- polypeptide
- sequence
- lrp5
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- the present invention relates to nucleic acids, polypeptides, oligonucleotide probes and primers, methods of diagnosis or prognosis, and other methods relating to and based on the identification of a gene, which is characterised as a member of the LDL-receptor family and for which there are indications that some alleles are associated with susceptibility to insulin-dependent diabetes mellitus (“IDDM”), also known as type 1 diabetes.
- IDDM insulin-dependent diabetes mellitus
- the present invention is based on cloning and characterisation of a gene which the present inventors have termed "LDL-receptor related protein-5 ⁇ LRP5) " (previously “LRP-3 ”) , based on characteristics of the encoded polypeptide which are revealed herein for the first time and which identify it as a member of the LDL receptor family. Furthermore, experimental evidence is included herein which provides indication that LRP5 is the IDDM susceptibility gene IDDM4 .
- Type 1 diabetes which affects up to 0.4% of European- derived population, is caused by autoimmune destruction of the insulin producing j ⁇ -cells of the pancreas, with a peak age of onset of 12 years.
- the /S-cell destruction is irreversible, and despite insulin replacement by injection patients suffer early mortality, kidney failure and blindness (Bach, 1994; Tisch and McDevitt, 1996) .
- the major aim, therefore, of genetic research is to identify the genes predisposing to type 1 diabetes and to use this information to understand disease mechanisms and to predict and prevent the total destruction of 3-cells and the disease.
- Type 1 diabetes does not follow a simple Mendelian pattern, and the concordance of susceptibility genotype and the occurrence of disease is much less than 100%, as evidenced by the 30-70% concordance of identical twins (Matsuda and Kuzuya, 1994; Kyvik et al, 1995) . Diabetes is caused by a number of genes or polygenes acting 5 together in concert, which makes it particularly difficult to identify and isolate individual genes.
- the main IDDM locus is encoded by the major histo- compatibility complex (MHC) on chromosome 6p21 ( IDDM1) .
- MHC major histo- compatibility complex
- IDDM1 chromosome 6p21
- association mapping relies on historical recombination events during the history of the population from which the families came from.
- Association mapping has been used in over a dozen examples of rare single gene traits, and particularly in genetically isolated populations such as Finland to fine map disease mutations. Nevertheless, association mapping is fundamentally different from straightforward linkage mapping because even though the degree of association between two markers or a marker and a disease mutation is proportional to the physical distance along the chromosome this relationship can be unpredictable because it is dependent on the allele frequencies of the markers, the history of the population and the age and number of mutations at the disease locus.
- Figure 1 illustrates approximate localisation of IDDM4 on chromosome llql3.
- MLS of 2.3 at FGF3 and D11S1883 ( ⁇ s 1.19) were obtained (Davies et al (1994) Nature 371: 130-136) .
- Figure 2 shows a physical map of the region D11S987 - Galanin on chromosome llql3. The interval was cloned in pacs, bacs and cosmids, and restriction mapped using a range of restriction enzymes to determine the physical distance between each marker.
- x-axis physical distance in kb;
- y-axis TDT ⁇ 2 statistic (tdf) .
- Figure 4 shows a three-point rolling linkage disequilibrium curve at IDDM4 , with 1289 families, from four different populations (UK, USA, Sardinia and Norway) .
- the TDT data was obtained at three consecutive markers, and expressed as an average of the three.
- x-axis physical distance in kb;
- y-axis TDT ⁇ 2 statistic.
- Figure 5 shows DNA sequence of the LRP5 isoform 1 cDNA.
- Figure 5 (b) shows the DNA sequence of the longest open reading frame present in the LRP5 cDNA.
- the EGF- binding motifs are shaded light gray
- LDL-receptor ligand motifs are shaded a darker gray.
- the spacer regions are indicated by the underlined four amino acids with high similarity to the YWTD motif.
- a putative transmembrane spanning domain is underlined with a heavy line. Areas shaded in the cytoplasmic domain (1409 to end) may be involved in endocytosis .
- Figure 5(f) shows the comparison of the nucleotide sequence of the first 432 nucleotides of the 5' end of the human isoforml cDNA sequence ( Figure 5(a)) on the upper line with the first 493 nucleotides of the 5' end of the mouse Lrp5 cDNA sequence ( Figure 16(a)) on the lower line.
- the comparison was performed using the GCG algorithm GAP (Genetics Computer Group, Madison, WI) .
- Figure 5(g) shows the comparison of the first 550 amino acids of human LRP5 isoform 1 with the first 533 amino acids of mouse Lrp5 using the GCG algorithm GAP (Genetics Computer Group, Madison, WI) .
- Figure 6(a) shows the amino acid sequence of LRP5 motifs.
- a comparison was made using the program crossmatch (obtained from Dr. Phil Green, University of Washington) between the motifs present in LRP1 and the LRP5 amino acid sequence. The best match for each LRP5 motif is shown.
- the top line is the LRP5 isoform 1 amino acid sequence
- the middle line is amino acids that are identical in the two motifs
- the lower line is the amino acid sequence of the best match LRP1 motif.
- conserved cysteine (C) residues that are the hallmark of both the EGF- precursor and LDL-receptor ligand binding motifs.
- Figure 6 (b) illustrates the motif organization of the LDL-receptor and LRP5.
- the LDL-receptor ligand binding motif are represented by the light gray boxes
- the EGFlike motifs are represented by the dark gray boxes.
- the YWTD spacer motifs are indicated by the vertical lines.
- the putative transmembrane domains are represented by the black box.
- Figure 7 shows LRP5 gene structure .
- the DNA sequence of contiguous pieces of genomic DNA is represented by the heavy lines and are according to the indicated scale.
- D11S1337, and D11S970 are indicated.
- the exons are indicated by the small black boxes with their numerical or alphabetical name below, the size of the exons is not to scale.
- Figure 8 illustrates different LRP5 gene isoforms. Alternatively spliced 5' ends of the LRP5 gene are indicated with the isoform number for each alternatively spliced form.
- the light gray arrow indicates the start of translation which occurs in exon 6 in isoform 1, may occur upstream of exon 1 in isoform 3 and occurs in exon B in isoforms 2, 4, 5. and 6.
- the core 22 exons (A to V) are represented by the box.
- Figure 9 is a SNP map of Contig 57. Polymorphisms were identified by the comparison of the DNA sequence of BAC 14-1- 15 with cosmids EO 864 and BO 7185. Corresponding Table 6 indicates a PCR amplicon that includes the site of the polymorphism, the nature of the single nucleotide polymorphis (SNP) , its location and the restriction site that is altered, if any. The line represents the contiguous genomic DNA with the relative location of the polymorphisms and the amplicons used to detect them. The large thin triangles represent the site of putative exons. The marker H0570POLYA is indicated.
- Figure 10 is a SNP map of Contig 58. Polymorphisms were identified by the comparison of the DNA sequence of BAC 14-1- 15 with cosmid BO 7185. Corresponding Table 6 indicates a PCR amplicon that includes the site of the polymorphism, the nature of the single nucleotide polymorphism (SNP) , its location and the restriction site that is altered, if any. 5 The line represents the contiguous genomic DNA with the relative location of the polymorphisms and the amplicons used to detect them. The large thin triangle at the very end of the line represents exon A of LRP5.
- Figure 11 (a) shows the DNA sequence of the isoform 2 lOcDNA.
- Figure 11 (b) shows the longest open reading frame of isoform 2 (also isoform 4,5,6).
- Figure 11(c) shows the amino acid sequence of isoform 2 (also isoform 4,5,6), encoded by the open reading frame of 15 Figure 12 (b) .
- Figure 12 (a) shows the DNA sequence of isoform 3 cDNA.
- Figure 12 (b) shows sequence obtained by GRAIL and a putative extension of isoform 3.
- Figure 12 (c) shows a putative open reading frame for 0 isoform 3.
- Figure 12 (d) shows the amino acid sequence of isoform 3.
- Figure 12 (e) shows the GRAIL predicted promoter sequence for isoform 3.
- Figure 13 shows the DNA sequence of the isoform 4 cDNA, 5 which contains an open reading frame encoding isoform 2 ( Figure 11 (b) ) .
- Figure 14 shows the DNA sequence of the present in cDNA isoform 5 , which contains an open reading frame encoding isoform 2 ( Figure 11 (b) ) .
- Figure 15 shows the DNA sequence of isoform 6, which contains an open reading frame encoding isoform 2 ( Figure 11 (b)) .
- Figure 15 (b) shows the GRAIL predicted promoter sequence associated with isoform.6.
- Figure 16 (a) shows the DNA sequence of a portion of the mouse Lrp5 cDNA.
- Figure 16(b) shows the DNA sequence of the 5' extension of the mouse clone.
- Figure 16(c) shows the DNA sequence of a portion of the open reading frame of mouse Lrp5.
- Figure 16 (d) show the amino acid sequence of the open reading frame encoding a portion of mouse Lrp5.
- Figure 17 (a) shows DNA sequence of exons A to V.
- Figure 17 (b) shows the amino acid sequence encoded by an open reading frame contained in Figure 17 (a) .
- Figure 18 (a) shows the nucleotide sequence of the full length mouse Lrp5 cDNA.
- Figure 18 (b) shows the nucleotide sequence for the longest open reading frame present in the mouse Lrp5 cDNA.
- Figure 18 (c) shows the amino acid sequence translation (in single letter code) of the open reading frame in Figure 18 (b) .
- Figure 18 (d) shows an alignment of the amino acid sequence of the human LRP5 protein and the mouse Lrp5 protein program using the GCG algorithm GAP (Genetics Computer Group, Madison, WI) .
- Figure 18 (e) shows an alignment of the amino acid sequence of the mature human LRP5 protein with the mature mouse LRP5 program using the GCG algorithm GAP (Genetics Computer Group, Madison, WI) .
- Figure 19 shows a schematic representation of haplotypes across the IDDM4 region. Three distinct haplotypes are shown. Haplotype A is protective against IDDM whereas haplotypes B and C are susceptible/non-protective for IDDM.
- FIG 20 shows a schematic representation of single nucleotide polymorphism (SNP) haplotypes across the IDDM4 region.
- Haplotype A is protective whereas haplotypes B, C, D, and E are susceptible/non-protective.
- a minimal region of 25 kb which is Identical By Descent (IBD) for the four susceptible haplotypes is indicated.
- the SNP designations, e.g. 57-3, are as described in Table 6 and Figures 9 and 10.
- the gene identified contains 22 exons, termed A-V, which encode most of the mature LRP5 protein.
- the 22 exons account for 4961 nucleotides of the LRP5 gene transcript ( Figure 5(a)) and are located in an approximately 110 kb of genomic DNA.
- the genomic DNA containing these exons begins downstream of the genetic marker L3001CA and includes the genetic markers D11S1337, 14lca5, and D11S970 ( Figure 7) .
- Several different 5' ends of the LRP5 transcript have been identified. Of particular interest is isoform 1 with a 5' end encoding a signal peptide sequence for protein export (secretory leader peptide) across the plasma membrane.
- exon 6 lies near the genetic marker HO 57 OPOLYA . This exon is 35 kb upstream of exon A and thus extends the genomic DNA comprising the LRP5 gene to at least 160kb.
- isoform 3 consists of exon 1 spliced directly to exon A.
- the reading frame is open at the 5' end and thus there is the potential for additional coding information present in exons upstream of exon 1.
- centromeric extension of exon 1 to include all of the open reading frame associated with this region yields the open reading frame for isoform 3.
- the second transcript that contains exon 1 also contains exon 5, which is located near the genetic marker H0570POLYA.
- the open reading frame for this isoform, isoform 2 begins in exon B and thus encodes a truncated LRP5 protein which lacks any predicted secretory leader peptide in the first 100 amino acids .
- Northern blot analysis indicates that the major mRNA transcript for the LRP5 gene is approximately 5 to 5.5 kb and is most highly expressed in liver, pancreas, prostate, and placenta. Expression is also detected in skeletal muscle, kidney, spleen, thymus, ovary, lung, small intestine, and colon. Minor bands both larger and smaller than 5 kb are detected and may represent alternative splicing events or related family members.
- LRP5 is a Member of the LDL-receptor Family
- the gene identified in the IDDM4 locus, lrp5 is a member of the LDL-receptor family.
- This family of proteins has several distinguishing characteristics, a large extracellular domain containing cysteine rich motifs which are involved in ligand binding, a single transmembrane spanning domain, and an "NPXY" internalization motif (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637).
- the functional role of the members of this family is the clearance of their ligands by the mechanism of receptor mediated endocytosis . This is illustrated by the most highly characterized member of the family, the LDL-receptor which is responsible for the clearance of LDL cholesterol from plasma (Goldstein, et. al . (1985) Ann. Rev. Cell Biol. 1: 1-39).
- LRP5 is most closely related to the LDL-receptor related protein (LRP) which is also know as the alpha2-macroglobulin receptor.
- LRP LDL-receptor related protein
- ORF open reading frame
- Comparison of the LRP5 protein to human LRPl using the algorithm GAP (Genetics Computer Group, Madison, WI) reveals an overall amino acid similarity of 55% and 34% identity to the region of the human LRPl protein from amino acids 1236 to 2934.
- the DNA of this ORF is 45% identical to LRPl encoding DNA as indicated by GAP.
- a slightly lower but significant level of similarity is seen with the megalin receptor also termed LRP2 and gp330 (Saito, et . al . .
- LRP5 The N-terminal portion of LRP5 likely has the potential for a signal sequence cleavage site. Signal sequences are
- mouse ortholog ⁇ Lrp5 25 to be the mouse ortholog ⁇ Lrp5 of the human LRP5.
- the cloned portion of the mouse cDNA contains an open reading frame ( Figure 16(c)) encoding 533 amino acids.
- the initiating codon has consensus nucleotides for efficient translation at both the -3 (purine) and +4 (G nucleotide) positions (Kozak, M.
- a 500 amino acid of the portion of the mouse Lrp5 (Figure 5 (g) and Figure 16 (d) ) is 96% identical to human LRP5 , further supporting the proposal that this is the mouse ortholog of LRP5.
- isoform 1 which encodes a signal peptide for protein export likely represents the most biologically relevant form of LRP5.
- both the human LRP5 and mouse Lrp5 open reading frames encodes a peptide with the potential to act as a eukaryotic signal sequence for protein export (von Heijne, 1994, Ann. Rev. Biophys. Biomol. Struc. 23:167-192).
- the highest score for the signal sequence as determined by using the SigCleave program in the GCG analysis package generates a mature peptide beginning at residue 25 of human LRP5 and residue 29 of mouse Lrp5 ( Figure 5 (d and g) ) .
- Additional sites that may be utilized produce mature peptides in the human LRP5 beginning at amino acid residues 22, 23, 23, 26, 27, 28, 30 or 32.
- Additional cleavage sites in the mouse Lrp5 result in mature peptides beginning at amino acid residue 31, 32, 33, or 38 ( Figure 5 (g) ) .
- the mature human LRP5 protein is show in Figure 5(e) .
- the other alternative isoforms of LRP5 lack a signal sequence near the N-terminus of the encoded protein.
- the functional relevance of these additional isoforms is not known, however there are several exported proteins which lack a signal sequence and are transported by a signal peptide independent mechanism (Higgins, CF. (1992) Ann. Rev. Cell Biol . 8: 67-113) .
- Higgins, CF. (1992) Ann. Rev. Cell Biol . 8: 67-113 There is possible that the putative extracellular domain of these isoforms is translocated across the plasma membrane .
- the extracellular domain of members of the LDL receptor family contains multiple motifs containing six cysteine residues within an approximately 40 amino acid region. (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637). Several classes of these cysteine rich motifs have been defined based on the spacing of the cysteine residues and the nature of other conserved amino acids within the motif.
- the LDL-receptor ligand binding (class A) motif is distinguished by a cluster of acidic residues in the C-terminal portion of the motif which includes a highly conserved SDE sequence. The importance of this acidic region in ligand binding has been demonstrated by mutagenesis studies (Russell et. al . (1989) J. Biol. Chem.
- the EGF-like (class B) motif lacks the cluster of acidic residues present in the LDL-receptor ligand binding motif.
- the spacing of the cysteine residues differs in the EGF-like motifs relative to the LDL-receptor ligand binding motif.
- the LRP5 protein contains 4 EGF-precursor (B.2) motifs, which have the property of an NGGCS motif between the first and second cysteine residue ( Figure 6 (a) ) .
- LRPl is a large protein of 4544 amino acids and contains 31 LDL-receptor ligand binding motifs (class A) and 22 EGF-like motifs (class B) (Herz et. al . , (1988) EMBO 7: 4119-4127) .
- the megalin receptor, LRP2 is a protein of 4660 amino acids and consists of 36 LDL- receptor ligand binding motifs and 17 EGF-like motifs (Saito et. al . (1994) PNAS 91: 9725-9729).
- the LDL receptor is a relatively small protein of 879 amino acids which contains 7 LDL-ligand binding motifs and 3 EGF-like motifs.
- the predicted size of the mature LRP5 protein 1591 amino acids, is intermediate between LRPl and the LDL receptor.
- the LRP5 protein contains four EGF-like motifs and three LDL-ligand binding motifs. It has been postulated that the multiple motif units, particularly evident in LRPl and LRP2 , account for the ability of these proteins to bind multiple lipoprotein and protein ligands (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637) .
- LDL-receptor ligand binding and EGF-like motifs are similar in both the LDL receptor, LRPl, and LRP2.
- LRP5 multiple LDL-ligand binding motifs are grouped together and followed by at least one EGF-like motif (Herz et. al . , (1988) EMBO 7: 4119-4127, 1988) .
- an EGF-like motif precedes the group of three LDL-ligand binding motifs ( Figure 6 (b) ) .
- An additional property unique to LRP5 is that the LDL-ligand binding motifs in LRP5 are followed by the putative transmembrane domain.
- the different arrangement of the motifs may define LRP5 as a member of a new subfamily 5 within the LDL-receptor related protein family.
- LRP5 has a signal peptide for protein export at the N- terminus of the protein. Signal peptide cleavage yields a mature LRP5 protein which begins with an EGF precursor spacer
- the EGF precursor spacer domain is composed of five approximately 50 amino acid repeats that each contain the characteristic sequence motif Tyr-Trp- Thr-Asp (YWTD) . There are three additional spacer domains
- EGF repeats contain six conserved cysteine residues and are of the B.2 class which has an Asn-Gly-Gly-Cys (NGGC) motif
- the LDLR repeats have the conserved cysteine residues, as well as, the motif Ser-Asp-Glu (SDE) as a characteristic feature ( Figure 6(a)). There are thirteen amino acids separating the LDLR repeats from the putative transmembrane spanning domain of 23 amino acids from 1386-
- the putative extracellular domain of LRP5 has six potential sites for N-linked glycosylation at amino acid residues 93, 138, 446, 499, 705, and 878 ( Figure 5(d)).
- the intracellular domain of LRP5 is comprised of 207 35 amino acids which is longer than most members of the family but similar in size to LRP2 (Saito et. al . (1994) PNAS 91:9725-9729) . It does not exhibit similarity to the LDL- receptor family, nor is it similar to any other known proteins.
- the cytoplasmic domain of LRP5 is comprised of 16% proline and 15% serine residues ( Figure 5 (d) ) . Most members of the LDL-receptor family contain a conserved NPXY motif in the cytoplasmic domain which has been implicated in endocytosis by coated pits (Chen et. al . (1990) J. Biol. Chem. 265: 3116-3123).
- the cytoplasmic domain of LRP5 does not contain an NPXY motif, there are several aromatic residues in the LRP5 cytoplasmic domain that lie in putative turn regions ( Figure 5(d)) and thus may be involved in facilitating endocytosis.
- tyrosine 1473 which occurs in the sequence VPLY motif has the proline and tyrosine in the correct position, relative to the consensus motif.
- the NPXY motif has been implicated in endocytosis in several proteins it is not an absolute requirement as there are proteins that lack the NPXY motif, e.g. the transferrin receptor, that undergo endocytosis by coated pits (Chen, et. al . (1990) J. Biol. Chem. 265: 3116-3123). In any event, we anticipate that the primary function of this protein will be receptor mediated endocytosis of its ligand.
- LRP5 may function to bind one or more ligands. Moreover, in a fashion analogous to other members of the family, once bound the LRP5 receptor ligand complex would endocytose resulting in clearance of the ligand from the extracellular milieu.
- the nature of the LRP5 ligand may be a lipid, a protein, a protein complex, or a lipoprotein and may possess a variety of functions. Although the physiological function of the most closely related member of 5 the LDL-receptor family, LRPl, is uncertain, it does possess a number of biochemical activities. LRPl binds to alpha-2 macroglobulin.
- Alpha-2 macroglobulin is a plasma complex that contains a "bait" ligand for a variety of proteinases e.g. trypsin, chymotrypsin, pancreatic elastase and plasma lOkallikrein (Jensen (1989) J. Biol. Chem. 20:11539-11542).
- a "bait" ligand for a variety of proteinases e.g. trypsin, chymotrypsin, pancreatic elastase and plasma lOkallikrein (Jensen (1989) J. Biol. Chem. 20:11539-11542).
- Antigen presentation is a critical component in the development of IDDM as is evidenced by the pivotal role of MHC haplotypes in conferring disease susceptibility (Tisch and McDivitt (1996) Cell 85: 291-297) .
- LRP5 5 may play a role in antigen presentation in which case polymorphisms within this gene could affect the development of autoimmunity in the type 1 diabetic patient.
- the alpha-2 macroglobulin complex also binds cytokines and growth factors such as interleukin-1 beta, interleukin 2, 0 interleukin 6, transforming growth factor-beta, and fibroblast growth factor (Moestrup and Gliemann (1991) J. Biol. Chem. 266: 14011-14017).
- cytokines and growth factors such as interleukin-1 beta, interleukin 2, 0 interleukin 6, transforming growth factor-beta, and fibroblast growth factor (Moestrup and Gliemann (1991) J. Biol. Chem. 266: 14011-14017).
- the alpha-2 macroglobulin receptor has the potential to play a role in the clearance of cytokines and growth factors.
- the role of cytokines in mediating immune 5 and inflammatory responses is well established.
- the interleukin-2 gene is a strong candidate gene for the Idd3 locus in the non-obese diabetic mouse, an animal model for type
- LRP5 binds alpha-2 macroglobulin or related complexes then it may play a role in the immune response by mediating cytokine clearance.
- the LRP5 which is expressed in pancreas, the target tissue of IDDM may play a role in clearing cytokines from the inflammatory infiltrate (insulitis) that is ongoing in the disease.
- a polymorphism in LRP5 that reduces the ability of LRP5 to clear cytokines may increase an individuals susceptibility to developing IDDM.
- an individual with a polymorphism that increases the ability of LRP5 to clear cytokines may be protected from developing IDDM.
- certain cytokines counteract other cytokines and thus removal of certain beneficial cytokines by LRP5 may confer disease susceptibility and thus a polymorphism that reduces LRP5 activity may confer protection from developing the disease.
- LRP5 lipolysis-stimulated receptor
- LRP2 Another member of the LRP family is LRP2 , also known as megalin and gp330, this protein has been implicated in Heymann's nephritis, an autoimmune disease of the kidney in rats (Saito et. al . (1994) PNAS 91: 9725-9729).
- Heymann's nephritis is a model of glomerularnephritis and is characterized by the development of autoantibodies to the alpha-2 macroglobulin receptor associated protein, also known as the Heymann nephritis antigen.
- the Heymann nephritis antigen binds to LRP2 (Strickland et. al . (1991) J. Biol. Chem.
- LRP2 may play a role in this disease by clearance of this pathogenic protein.
- the function of LRP5 may be to bind and clear proteins in the pancreas to which the IDDM patient has generated autoantibodies.
- LRP5 itself may be an autoantigen in the IDDM patient.
- LRPl has been identified as the receptor for certain bacterial toxins (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637) and the human rhinovirus (Hofer et. al . (1994) Proc. Natl. Acad. Sci. 91: 1839-42). It is possible that a viral infection alters an individuals susceptibility to IDDM (Epstein (1994) N. Eng. J. Med. 331: 1428-1436) . If certain viruses utilize LRP5 as a mode of entry into the cell then polymorphisms in LRP5 may alter the individuals susceptibility to type 1 diabetes.
- LRP5 may participate in the pathogenesis of other diseases.
- LRPl binds lipoproteins such as apoE and C-apolipoproteins.
- the clearance of lipoproteins such as apoE and apoB by the LDL receptor is its primary role, mutations in the LDL receptor lead to hypercholesterolemia (Chen et. al . (1990) J. Biol. Chem. 265: 3116-3123). Therefore mutations in LRP5 that decrease the ability of the protein to scavenge lipoproteins may cause an elevation in cholesterol.
- LRP5 Long fatty acid phosphatidylcholine
- pancreatic pathology is characterised by the deposition of amyloid. Amyloid deposition may decrease pancreatic -cell function.
- LRP5 could function in the metabolism of islet amyloid and influence susceptibility to type 2 diabetes as well as type 1 diabetes.
- ApoE in Alzheimer's disease indicates that proteins such as LRPl and possibly LRP5 have the potential to contribute to the pathogenesis of this disease.
- the exons of the LRP5 gene are being scanned for polymorphisms .
- polymorphisms that change an amino acid in LRP5 that have been identified in IDDM patients (Table 5) .
- C to T transition which changes an Ala codon to Val, in one of the three conserved LDL receptor ligand binding motifs.
- a C to T transition was identified in the codon for Asn 709 (with no effect on the encoded amino acid) , and three polymorphisms were identified in intronic sequences flanking the exons .
- An additional set of polymorphisms has been identified by comparing experimentally derived cDNA sequences with the genomic DNA sequence (Table 5) .
- SNPs single nucleotide polymorphisms
- a region of identity-by-descent associated with type 1 diabetes has been identified in the 5' portion of the LRP5 gene.
- the minimal region consists of 25 kb which contains the putative regulatory regions of LRP5 and the first exon. This strengthens the genetic evidence for LRP5 being a diabetes risk gene. Therefore therapies that affect LRP5 may be useful in the prevention and treatment of type 1 diabetes .
- LRP5 Overexpression of LRP5 in mice provides evidence for LRP5 affecting lipoprotein metabolism. Statistically significant evidence for modulation of triglycerides by LRP5 has been obtained. Thus therapies that affect LRP5 may be useful in the treatment of cardiovascular disease and conditions where serum triglycerides are elevated.
- LRP5 low-density lipoprotein
- LRP5 Overexpression of LRP5 in mice provided statistically significant evidence for a reduction in serum alkaline phosphatase. A reduction in serum alkaline phosphatase is consistent with LRP5 playing a role in modulation of the immune response. This provides evidence for LRP5 participating in the pathogenesis of type 1 diabetes. Therefore therapies that affect LRP5 may be useful in the treatment of autoimmune diseases.
- LRP5 Cellular localization of LRP5 indicates that it is expressed in a particular subtype, the phagocytic macrophages, of mature tissue macrophages. Evidence from the literature indicates that this class of macrophages is involved in autoimmune disease, supporting a role for LRP5 in autoimmune disease and type 1 diabetes . Therefore therapies that affect LRP5 may be useful in the treatment of autoimmune diseases. Full length cDNAs for both human and mouse LRP5 have been obtained. Antibodies directed against LRP5 have been developed. These reagents provide tools to further analyze the biological function of LRP5.
- nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which includes the amino acid sequence shown in Figure 5 (c) , Figure 5 (d) or Figure 5 (e) .
- the amino acid sequence of Figure 5(c) includes that of Figure 5(e) and a signal sequence.
- the coding sequence may be that shown included in Figure 5(a) or Figure 5(b) or it may be a mutant, variant, derivative or allele of the sequence shown.
- the sequence may differ from that shown by a change which is one or more of addition, insertion, deletion and substitution of one or more nucleotides of the sequence shown. Changes to a nucleotide sequence may result in an amino acid change at the protein level, or not, as determined by the genetic code.
- nucleic acid according to the present invention may include a sequence different from the sequence shown in Figure 5 (a) or Figure 5 (b) yet encode a polypeptide with the same amino acid sequence.
- the amino acid sequence shown in Figure 5(c) consists of 1615 residues.
- the encoded polypeptide may comprise an amino acid sequence which differs by one or more amino acid residues from the amino acid sequence shown in Figure 5 (c)
- Nucleic acid encoding a polypeptide which is an amino acid 5 sequence mutant, variant, derivative or allele of the sequence shown in Figure 5(c) is further provided by the present invention. Such polypeptides are discussed below. Nucleic acid encoding such a polypeptide may show at the nucleotide sequence and/or encoded amino acid level greater than about
- the present invention extends to nucleic acid that hybridizes with any one or more of the specific sequences disclosed herein under stringent conditions.
- Suitable 5 conditions include, e.g. for detection of sequences that are about 80-90% identical such as detection of mouse LRP5 with a human.probe or vice versa, hybridization overnight at 42°C in 0.25M Na 2 HP0 4 , pH 7.2 , 6.5% SDS, 10% dextran sulfate and a final wash at 55°C in 0. IX SSC, 0.1% SDS.
- suitable conditions include hybridization overnight at 65 °C in 0.25M Na 2 HP0 4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60°C in 0. IX SSC, 0.1% SDS.
- the coding sequence may be included within a nucleic acid molecule which has the sequence shown in Figure 5(a) (isoform 1) or Figure 5(b) and encode the full polypeptide of isoform 1 ( Figure 5(c)). Mutants, variants, derivatives and alleles of these sequences are included within the scope of the present invention in terms analogous to those set out in the preceding paragraph and in the following disclosure.
- nucleic acid molecule encoding a polypeptide which includes the amino acid sequence shown in Figure 17(b) This sequence forms a substantial part of the amino acid sequence shown in Figure 5(e) .
- Nucleic acid encoding a polypeptide which includes the amino acid sequence shown in Figure 17 (b) may include the coding sequence shown in Figure 17(b), or an allele, variant, mutant or derivative in similar terms to those discussed above and below for other aspects and embodiments of the present invention.
- the gene of Figure 5 is known as isoform 1.
- the gene of Figure 5 is known as isoform 1.
- Included within the present invention is a nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which includes the amino acid sequence of a polypeptide shown in Figure 11(c) (isoform 2).
- the coding sequence may be as shown in Figure 11 (b) (which may be included within a molecule which has the sequence shown in Figure.11(a) (isoform 2) or the sequence shown in Figure 12(a) (isoform 3)), Figure 13 (isoform 4), Figure 14 (isoform 5) and Figure 15 (isoform 6) .
- Mutants, derivatives, variants and alleles of these sequences are also provided by the present invention, as disclosed.
- nucleic acid molecules according to the present invention include the nucleotide sequence of any of Figure 5(a), Figure 12(b), Figure 12(e), Figure 15(b), Figure 16(a) and Figure 16 (b) and nucleic acid encoding the amino acid sequences encoded by Figure 5(a), Figure 11(b), Figure 12(c) or Figure 16(c), along with mutants, alleles, variants and derivatives of these sequences. Further included are nucleic acid molecules encoding the amino acid sequence of Figure 518 (c) , particularly including the coding sequence shown in Figure 18 (b) .
- Particular alleles according to the present invention have sequences have a variation indicated in Table 5 or Table 6.
- One or more of these may be associated with susceptibility 0 to IDDM or other disease.
- Alterations in a sequence according to the present invention which are associated with IDDM or other disease may be preferred in accordance with embodiments of the present invention. Implications for screening, e.g. for diagnostic or prognostic purposes, are discussed below. 5
- nucleic acid according to the present invention is provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the human genome, except possibly one or more regulatory sequence (s) for expression.
- Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA.
- the coding sequence shown herein is a DNA sequence. Where nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as encompassing reference to the RNA equivalent, with U substituted for T.
- Nucleic acid may be provided as part of a replicable vector, and also provided by the present invention are a vector including nucleic acid as set out above, particularly any expression vector from which the encoded polypeptide can be expressed under appropriate conditions, and a host cell containing any such vector or nucleic acid.
- An expression vector in this context is a nucleic acid molecule including nucleic acid encoding a polypeptide of interest and appropriate regulatory sequences for expression of the polypeptide, in an in vi tro expression system, e.g. reticulocyte lysate, or in vivo, e.g. in eukaryotic cells such as COS or CHO cells or in prokaryotic cells such as E. coli . This is discussed further below.
- the nucleic acid sequence provided in accordance with the present invention is useful for identifying nucleic acid of interest (and which may be according to the present invention) in a test sample.
- the present invention provides a method of obtaining nucleic acid of interest, the method including hybridisation of a probe having the sequence shown in any of Figures 5(a), 11(a), 11(b), 12(a), 12(b), 12(c), 12(e), 13, 14, 15, 15(b) 16(a), 16(b), and 16(c), or a complementary sequence, to target nucleic acid.
- Hybridisation is generally followed by identification of successful hybridisation and isolation of nucleic acid which has hybridised to the probe, which may involve one or more steps of PCR.
- Nucleic acid according to the present invention is obtainable using one or more oligonucleotide probes or primers designed to hybridise with one or more fragments of the nucleic acid sequence shown in any of the figures, particularly fragments of relatively rare sequence, based on codon usage or statistical analysis.
- a primer designed to hybridise with a fragment of the nucleic acid sequence shown in any of the figures may be used in conjunction with one or more oligonucleotides designed to hybridise to a sequence in a cloning vector within which target nucleic acid has been cloned, or in so-called "RACE" (rapid amplification of cDNA ends) in which cDNA' s in a library are ligated to an oligonucleotide linker and PCR is performed using a primer which hybridises with a sequence shown and a primer which hybridises to the oligonucleotide linker.
- RACE rapid amplification of cDNA ends
- oligonucleotide probes or primers as well as the full-length sequence (and mutants, alleles, variants and derivatives) are also useful in screening a test sample containing nucleic acid for the presence of alleles, mutants and variants, with diagnostic and/or prognostic implications as discussed in more detail below.
- Nucleic acid isolated and/or purified from one or more cells may be probed under conditions for selective hybridisation and/or subjected to a specific nucleic acid amplification reaction such as the polymerase chain reaction (PCR) (reviewed for instance in "PCR protocols; A Guide to Methods and Applications” , Eds. Innis et al , 1990, Academic Press, New York, Mullis et al, Cold Spring Harbor Symp. Quant.
- PCR polymerase chain reaction
- PCR comprises steps of denaturation of template nucleic acid (if double-stranded) , annealing of primer to target, and polymerisation.
- the nucleic acid probed or used as template in the amplification reaction may be genomic DNA, cDNA or RNA.
- Other specific nucleic acid amplification techniques include strand displacement activation, the QB replicase system, the repair chain reaction, the ligase chain reaction and ligation activated transcription.
- PCR is used herein in contexts where other nucleic acid amplification techniques may be applied by those skilled in the art. Unless the context requires otherwise, reference to PCR should be taken to cover use of any suitable nucleic amplification reaction available in the art .
- cloning it may be necessary for one or more gene fragments to be ligated to generate a full-length coding sequence. Also, where a full-length encoding nucleic acid molecule has not been obtained, a smaller molecule representing part of the full molecule, may be used to obtain full-length clones. Inserts may be prepared from partial cDNA clones and used to screen cDNA libraries. The full-length clones isolated may be subcloned into expression vectors and activity assayed by transfection into suitable host cells, e.g. with a reporter plasmid.
- a method may include hybridisation of one or more (e.g. two) probes or primers to target nucleic acid. Where the nucleic acid is double-stranded DNA, hybridisation will generally be preceded by denaturation to produce single- stranded DNA.
- the hybridisation may be as part of a PCR procedure, or as part of a probing procedure not involving PCR.
- An example procedure would be a combination of PCR and low stringency hybridisation.
- a screening procedure chosen from the many available to those skilled in the art, is used to identify successful hybridisation events and isolated hybridised nucleic acid. Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art.
- probes may be radioactively, fluorescently or enzymatically labelled.
- Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR, RN'ase cleavage and allele specific oligonucleotide probing.
- Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes . Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined.
- DNA for probing may be prepared from RNA preparations from cells.
- Preliminary experiments may be performed by hybridising under low stringency conditions various probes to Southern blots of DNA digested with restriction enzymes. Suitable conditions would be achieved when a large number of hybridising fragments were obtained while the background hybridisation was low. Using these conditions nucleic acid libraries, e.g. cDNA libraries representative of expressed sequences, may be searched. Those skilled in the art are well able to employ suitable conditions of the desired stringency for selective hybridisation, taking into account factors such as oligonucleotide length and base composition, temperature and so on.
- oligonucleotide probes or primers may be designed, taking into account the degeneracy of the genetic code, and, where appropriate, codon usage of the organism from the candidate nucleic acid is derived.
- An oligonucleotide for use in nucleic acid amplification may have about 10 or fewer codons (e.g. 6, 7 or 8) , i.e. be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24).
- Generally specific primers are upwards of 14 nucleotides in length, but need not be than 18- 20.
- primers for use processes such as PCR.
- Various techniques for synthesizing oligonucleotide primers are well known in the art, including phosphotriester and phosphodiester synthesis methods .
- Preferred amino acid sequences suitable for use in the design of probes or PCR primers may include sequences conserved (completely, substantially or partly) encoding the motifs present in LRP5 ( Figure 5(d).
- a further aspect of the present invention provides an oligonucleotide or polynucleotide fragment of the nucleotide sequence shown in any of the figures herein providing nucleic acid according to the present invention, or a complementary sequence, in particular for use in a method of obtaining and/or screening nucleic acid.
- Some preferred oligonucleotides have a sequence shown in Table 2, Table 4, Table 7, Table 8 or Table 9, or a sequence which differs from any of the sequences shown by addition, substitution, insertion or deletion of one or more nucleotides, but preferably without abolition of ability to hybridise selectively with nucleic acid in accordance with the present invention, that is wherein the degree of similarity of the oligonucleotide or polynucleotide with one of the sequences given is sufficiently high.
- oligonucleotides according to the present invention that are fragments of any of the sequences shown, or any allele associated with IDDM or other disease susceptibility, are at least about 10 nucleotides in length, more preferably at least about 15 nucleotides in length, more preferably at least about 20 nucleotides in length. Such fragments themselves individually represent aspects of the present invention. Fragments and other oligonucleotides may be used as primers or probes as discussed but may also be generated (e.g. by PCR) in methods concerned with determining the presence in a test sample of a sequence indicative of IDDM or other disease susceptibility.
- nucleic acid in diagnostic and/or prognostic contexts, for instance in determining susceptibility to IDDM or other disease, and other methods concerned with determining the presence of sequences indicative of IDDM or other disease susceptibility are discussed below.
- oligonucleotides are anti-sense oligonucleotide sequences based on the nucleic acid sequences described herein.
- Antisense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of polypeptide encoded by a given DNA sequence (e.g. either native polypeptide or a mutant form thereof) , so that its expression is reduce or prevented altogether.
- Anti-sense techniques may be used to target a coding sequence, a control sequence of a gene, e.g. in the 5' flanking sequence, whereby the antisense oligonucleotides can interfere with control sequences.
- Antisense oligonucleotides may be DNA or RNA and may be of around 14-23 nucleotides, particularly around 15-18 nucleotides, in length. The construction of antisense sequences and their use is described in Peyman and Ulman, Chemical Reviews, 90:543- 584, (1990), and Crooke, Ann. Rev. Pharmacol. Toxicol., 32:329-376, (1992) .
- Nucleic acid according to the present invention may be used in methods of gene therapy, for instance in treatment of individuals with the aim of preventing or curing (wholly or partially) IDDM or other disease. This may ease one or more symptoms of the disease. This is discussed below.
- Nucleic acid according to the present invention such as a full-length coding sequence or oligonucleotide probe or primer, may be provided as part of a kit, e.g. in a suitable container such as a vial in which the contents are protected from the external environment .
- the kit may include instructions for use of the nucleic acid, e.g. in PCR and/or a method for determining the presence of nucleic acid of interest in a test sample.
- a kit wherein the nucleic acid is intended for use in PCR may include one or more other reagents required for the reaction, such as polymerase, nucleosides, buffer solution etc.
- the nucleic acid may be labelled.
- a kit for use in determining the presence or absence of nucleic acid of interest may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal cavity or a syringe for removing a blood sample (such components generally being sterile) .
- the present invention provides a nucleic acid molecule including a LRP5 gene promoter.
- the present invention provides a nucleic acid molecule including a promoter, the promoter including the sequence of nucleotides shown in Figure 12 (e) or Figure 15 (b) .
- the promoter may comprise one or more fragments of the sequence shown in Figure 12 (e) or Figure 15 (b) , sufficient to promote gene expression.
- the promoter may comprise or consist essentially of a sequence of nucleotides 5' to the LRP5 gene in the human chromosome, or an equivalent sequence in another species, such as the mouse.
- any of the sequences disclosed in the figures herein may be used to construct a probe for use in identification and isolation of a promoter from a genomic library containing a genomic LRP5 gene. Techniques and conditions for such probing are well known in the art and are discussed elsewhere herein.
- restriction enzyme or nucleases may be used to digest a nucleic acid molecule, followed by an appropriate assay (for example using a reporter gene such as luciferase) to determine the sequence required.
- a preferred embodiment of the present invention provides a nucleic acid isolate with the minimal nucleotide sequence shown in Figure 12(e) or Figure 15(b) required for promoter activity.
- the promoter may comprise one or more sequence motifs or elements conferring developmental and/or tissue- specific regulatory control of expression.
- Other regulatory sequences may be included, for instance as identified by mutation or digest assay in an appropriate expression system or by sequence comparison with available information, e.g. using a computer to search on-line databases.
- promoter is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA) .
- operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
- DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
- the present invention extends to a promoter which has a nucleotide sequence which is allele, mutant, variant or derivative, by way of nucleotide addition, insertion, substitution or deletion of a promoter sequence as provided herein.
- Preferred levels of sequence homology with a provided sequence may be analogous to those set out above for encoding nucleic acid and polypeptides according to the present invention.
- Systematic or random mutagenesis of nucleic acid to make an alteration to the nucleotide sequence may be performed using any technique known to those skilled in the art .
- One or more alterations to a promoter sequence according to the present invention may increase or decrease promoter activity, or increase or decrease the magnitude of the effect of a substance able to modulate the promoter activity.
- Promoter activity is used to refer to ability to initiate transcription.
- the level of promoter activity is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter.
- the amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridise with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction.
- Use of a reporter gene facilitates determination of promoter activity by reference to protein production.
- nucleic acid construct comprising a LRP5 promoter region or a fragment, mutant, allele, derivative or variant thereof able to promoter transcription, operably linked to a heterologous gene, e.g. a coding sequence.
- a "heterologous” or “exogenous” gene is generally not a modified form of LRP5.
- the gene may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression.
- a gene whose encoded product may be assayed following expression is termed a "reporter gene", i.e. a gene which "reports" on promoter activity.
- the reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product.
- a detectable signal preferably a visually detectable signal, such as a coloured product.
- Many examples are known, including / S-galactosidase and luciferase.
- ⁇ - galactosidase activity may be assayed by production of blue colour on substrate, the assay being by eye or by use of a spectro-photometer to measure absorbance. Fluorescence, for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer .
- Radioactive assays may be used, for instance using chloramphenicol acetyltransferase, which may also be used in non-radioactive assays.
- the presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof.
- the binding molecule may be labelled directly or indirectly using any standard technique .
- Nucleic acid constructs comprising a promoter (as disclosed herein) and a heterologous gene (reporter) may be employed in screening for a substance able to modulate activity of the promoter.
- a substance able to up- regulate expression of the promoter may be sought.
- a method of screening for ability of a substance to modulate activity of a promoter may comprise contacting an expression system, such as a host cell, containing a nucleic acid construct as herein disclosed with a test or candidate substance and determining expression of the heterologous gene. The level of expression in the presence of the test substance may be compared with the level of expression in the absence of the test substance.
- a difference in expression in the presence of the test substance indicates ability of the substance to modulate gene expression.
- An increase in expression of the heterologous gene compared with expression of another gene not linked to a promoter as disclosed herein indicates specificity of the substance for modulation of the promoter.
- a promoter construct may be introduced into a cell line using any technique previously described to produce a stable cell line containing the reporter construct integrated into the genome.
- the cells may be grown and incubated with test compounds for varying times.
- the cells may be grown in 96 well plates to facilitate the analysis of large numbers of compounds .
- the cells may then be washed and the reporter gene expression analysed. For some reporters, such as luciferase the cells will be lysed then analysed.
- the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals .
- a composition such as a medicament, pharmaceutical composition or drug.
- the present invention extends in various aspects not only to a substance identified using a nucleic acid molecule as a modulator of promoter activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising P rd
- a polypeptide which is an amino acid sequence variant, allele, derivative or mutant of the amino acid sequence shown in a figure herein may comprise an amino acid sequence which shares greater than about 35% sequence identity with the sequence shown, greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90% or greater than about 95%.
- the sequence may share greater than about 60% similarity, greater than about 70% similarity, greater than about 80% similarity or greater than about 90% similarity with the amino acid sequence shown in the relevant figure.
- Amino acid similarity is generally defined with reference to the algorithm GAP (Genetics Computer Group, Madison, WI) as noted above, or the TBLASTN program, of Altschul et al . (1990) J. Mol. Biol.
- Similarity allows for "conservative variation", i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine.
- Particular amino acid sequence variants may differ from that shown in a figure herein by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5-10, 10-20 20-30, 30-50, 50-100, 100-150, or more than 150 amino acids.
- Sequence comparison may be made over the full-length of the relevant sequence shown herein, or may more preferably be over a contiguous sequence of about or greater than about 20, 25, 30, 33, 40, 50, 67, 133, 167, 200, 233, 267, 300, 333, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, or more amino acids or nucleotide triplets, compared with the relevant amino acid sequence or nucleotide sequence as the case may be .
- the present invention also includes active portions, fragments, derivatives and functional mimetics of the polypeptides of the invention.
- An "active portion" of a polypeptide means a peptide which is less than said full length polypeptide, but which retains a biological activity, such as a biological activity selected from binding to ligand, involvement in endocytosis.
- an active portion of the LRP5 polypeptide may, in one embodiment, include the transmembrane domain and the portion of the cytoplasmic tail involved in endocytosis.
- Such an active fragment may be included as part of a fusion protein, e.g. including a binding portion for a different ligand.
- combinations of LDL and EGF motifs may be included in a molecule to confer on the molecule different binding specificities .
- a "fragment" of a polypeptide generally means a stretch of amino acid residues of at least about five contiguous amino acids, often at least about seven contiguous amino acids, typically at least about nine contiguous amino acids, more preferably at least about 13 contiguous amino acids, and, more preferably, at least about 20 to 30 or more contiguous amino acids. Fragments of the LRP5 polypeptide sequence may include antigenic determinants or epitopes useful for raising antibodies to a portion of the amino acid sequence. Alanine scans are commonly used to find and refine peptide motifs within polypeptides, this involving the systematic replacement of each residue in turn with the amino acid alanine, followed by an assessment of biological activity.
- Preferred fragments of LRP5 include those with any of the following amino acid sequences: SYFHLFPPPPSPCTDSS VDGRQNIKRAKDDGT EVLFTTGLIRPVALWDN IQGHLDFVMDILVFHS, which may be used for instance in raising or isolating antibodies.
- Variant and derivative peptides, peptides which have an amino acid sequence which differs from one of these sequences by way of addition, insertion, deletion or substitution of one or more amino acids are also provided by the present invention, generally with the proviso that the variant or derivative peptide is bound by an antibody or other specific binding member which binds one of the peptides whose sequence is shown.
- a peptide which is a variant or derivative of one of the shown peptides may compete with the shown peptide for binding to a specific binding member, such as an antibody or antigen-binding fragment thereof.
- a "derivative" of a polypeptide or a fragment thereof may include a polypeptide modified by varying the amino acid sequence of the protein, e.g. by manipulation of the nucleic acid encoding the protein or by altering the protein itself. Such derivatives of the natural amino acid sequence may involve one or more of insertion, addition, deletion or substitution of one or more amino acids, which may be without fundamentally altering the qualitative nature of biological activity of the wild type polypeptide. Also encompassed within the scope of the present invention are functional mimetics of active fragments of the LRP5 polypeptides provided (including alleles, mutants, derivatives and variants) .
- the term "functional mimetic” means a substance which may not contain an active portion of the relevant amino acid sequence, and probably is not a peptide at all, but which retains in qualitative terms biological activity of natural LRP5 polypeptide. The design and screening of candidate mimetics is described in detail below.
- polypeptide fragments for which sequence information is provided herein are provided as aspects of the present invention, for instance corresponding to functional domains.
- One such functional domain is the putative extracellular domain, such that a polypeptide fragment according to the present invention may include the extracellular domain of the polypeptide of which the amino acid sequence is shown in Figure 5 (e) or Figure 5 (c) . This runs to amino acid 1385 of the precursor sequence of Figure 5(c) .
- Another useful LRP5 domain is the cytoplasmic domain, 5207 amino acids shown in Figure 5(d) . This may be used in targeting proteins to move through the endocytotic pathway.
- a polypeptide according to the present invention may be isolated and/or purified (e.g. using an antibody) for instance 0 after production by expression from encoding nucleic acid (for which see below) .
- a polypeptide may be provided free or substantially free from contaminants with which it is naturally associated (if it is a naturally-occurring polypeptide) .
- a polypeptide may be provided free or 5 substantially free of other polypeptides.
- Polypeptides according to the present invention may be generated wholly or partly by chemical synthesis.
- the isolated and/or purified polypeptide may be used in formulation of a composition, which may include at least one additional component, for example a pharmaceutical composition including a pharmaceutically acceptable excipient, vehicle or carrier.
- a composition including a polypeptide according to the invention may be used in prophylactic and/or therapeutic treatment as discussed below.
- a polypeptide, peptide fragment, allele, mutant, derivative or variant according to the present invention may be used as an immunogen or otherwise in obtaining specific antibodies.
- Antibodies are useful in purification and other manipulation of polypeptides and peptides, diagnostic screening and therapeutic contexts. This is discussed further below.
- a polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function, e.g. binding to ligand, involvement in endocytosis, movement from an intracellular compartment to the cell surface, movement from the cell surface to an intracellular compartment.
- molecules may interact with the ligand binding portion of LRP5, the cytoplasmic portion of > OJ t to
- Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide.
- test substances Prior to or as well as being screened for modulation of activity, test substances may be screened for ability to interact with the polypeptide, e.g. in a yeast two-hybrid system (which requires that both the polypeptide and the test substance can be expressed in yeast from encoding nucleic acid) . This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide.
- the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals .
- the present invention extends in various aspects not only to a substance identified as a modulator of polypeptide activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for treatment (which may include preventative treatment) of IDDM or other disease, use of such a substance in manufacture of a composition for administration, e.g. for treatment of IDDM or other disease, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.
- a substance identified using as a modulator of polypeptide or promoter function may be peptide or non-peptide in nature.
- Non-peptide "small molecules" are often preferred for many in vivo pharmaceutical uses.
- a mimetic or mimick of the substance may be designed for pharmaceutical use.
- the designing of mimetics to a known pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a "lead" compound. This might be desirable where the active compound is difficult or expensive to synthesise or where it is unsuitable for a particular method of administration, e.g. peptides are not well suited as active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal.
- Mimetic design, synthesis and testing may be used to avoid randomly screening large number of molecules for a target property.
- the pharmacophore Once the pharmacophore has been found, its structure is modelled to according its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, X-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modelling process. In a variant of this approach, the three-dimensional structure of the ligand and its binding partner are modelled. This can be especially useful where the ligand and/or binding partner change conformation on binding, allowing the model to take account of this the design of the mimetic.
- a template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted.
- the template molecule and the chemical groups grafted on to it can conveniently be selected so that the mimetic is easy to synthesise, is likely to be pharmacologically acceptable, and to t
- Vectors may be plasmids, viral e.g. 'phage, or phagemid, as appropriate.
- plasmids viral e.g. 'phage, or phagemid, as appropriate.
- Molecular Cloning a Laboratory Manual: 2nd edition, Sambrook et al . , 1989, Cold Spring Harbor Laboratory Press .
- Many known techniques and protocols for manipulation of nucleic acid for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Ausubel et al . eds., John Wiley & Sons, 1992.
- a further aspect of the present invention provides a host cell containing nucleic acid as disclosed herein.
- the nucleic acid of the invention may be integrated into the genome (e.g. chromosome) of the host cell. Integration may be promoted by inclusion of sequences which promote recombination with the genome, in accordance with standard techniques.
- the nucleic acid may be on an extra-chromosomal vector within the cell.
- a still further aspect provides a method which includes introducing the nucleic acid into a host cell .
- the introduction which may (particularly for in vitro introduction) be generally referred to without limitation as "transformation", may employ any available technique.
- suitable techniques may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus .
- suitable techniques may include calcium chloride transformation, electroporation and transfection using bacteriophage .
- Marker genes such as antibiotic resistance or sensitivity genes may be used in identifying clones containing nucleic acid of interest, as is well known in the art.
- the introduction may be followed by causing or allowing expression from the nucleic acid, e.g. by culturing host cells (which may include cells actually transformed although more likely the cells will be descendants of the transformed cells) under conditions for expression of the gene, so that the encoded polypeptide is produced. If the polypeptide is expressed coupled to an appropriate signal leader peptide it may be secreted from the cell into the culture medium.
- a polypeptide may be isolated and/or purified from the host cell and/or culture medium, as the case may be, and subsequently used as desired, e.g. in the formulation of a composition which may include one or more additional components, such as a pharmaceutical composition which includes one or more pharmaceutically acceptable excipients, vehicles or carriers (e.g. see below) .
- a host cell containing nucleic acid according to the present invention e.g. as a result of introduction of the nucleic acid into the cell or into an ancestor of the cell and/or genetic alteration of the sequence endogenous to the cell or ancestor (which introduction or alteration may take place in vivo or ex vivo) , may be comprised (e.g.
- an organism which is an animal, particularly a mammal, which may be human or non-human, such as rabbit, guinea pig, rat, mouse or other rodent, cat, dog, pig, sheep, goat, cattle or horse, or which is a bird, such as a chicken.
- Genetically modified or transgenic animals or birds comprising such a cell are also provided as further aspects of the present invention.
- the present invention provides a non-human animal with a human LRP5 transgene within its genome.
- the transgene may have the sequence of any of the isoforms identified herein or a mutant, derivative, allele or variant thereof as disclosed.
- the heterologous human LRP5 sequence replaces the endogenous animal sequence.
- one or more copies of the human LRP5 sequence are added to the animal genome .
- the animal is a rodent, and most preferably mouse or rat .
- mutant, allele or variant sequence within cells of an organism, particularly when in place of a homologous endogenous sequence, may allow the organism to be used as a model in testing and/or studying the role of the LRP5 gene or substances which modulate activity of the encoded polypeptide and/or promoter in vitro or are otherwise indicated to be of therapeutic potential.
- An animal model for LRP5 deficiency may be constructed using standard techniques for introducing mutations into an animal germ-line.
- a vector carrying an insertional mutation within the LRP5 gene may be transfected into embryonic stem cells.
- a selectable marker for example an antibiotic resistance gene such as neoR, may be included to facilitate selection of clones in which the mutant gene has replaced the endogenous wild type homologue .
- Such clones may be also be identified or further investigated by Southern blot hybridisation. The clones may then be expanded and cells injected into mouse blastocyst stage embryos. Mice in which the injected cells have contributed to the development of the mouse may be identified by Southern blotting.
- mice having a heterozygous mutation in the LRP5 gene may be a suitable model for human individuals having one copy of the gene mutated in the germ line who are at risk of developing IDDM or other disease.
- Animal models may also be useful for any of the various diseases discussed elsewhere herein.
- host cells may be used as a nucleic acid factory to replicate the nucleic acid of interest in order to generate large amounts of it. Multiple copies of nucleic acid of interest may be made within a cell when coupled to an amplifiable gene such as dihyrofolate reductase (DHFR) , as is well known.
- DHFR dihyrofolate reductase
- Host cells transformed with nucleic acid of interest, or which are descended from host cells into which nucleic acid was introduced may be cultured under suitable conditions, e.g. in a fermentor, taken from the culture and subjected to processing to purifiy the nucleic acid. Following purification, the nucleic acid or one or more fragments thereof may be used as desired, for instance in a diagnostic or prognostic assay as discussed elsewhere herein.
- a further aspect of the present invention provides an antibody able to bind specifically to the polypeptide whose sequence is given in a figure herein.
- Such an antibody may be specific in the sense of being able to distinguish between the polypeptide it is able to bind and other human polypeptides for which it has no or substantially no binding affinity (e.g. a binding affinity of about lOOOx less) .
- Specific antibodies bind an epitope on the molecule which is either not present or is not accessible on other molecules.
- Antibodies according to the present invention may be specific for the wild-type polypeptide.
- Antibodies according to the invention may be specific for a particular mutant, variant, allele or derivative polypeptide as between that molecule and the wild-type polypeptide, so as to be useful in diagnostic and prognostic methods as discussed below. Antibodies are also useful in purifying the polypeptide or polypeptides to which they bind, e.g. following production by recombinant expression from encoding nucleic acid. Preferred antibodies according to the invention are isolated, in the sense of being free from contaminants such as antibodies able to bind other polypeptides and/or free of serum components . Monoclonal antibodies are preferred for some purposes, though polyclonal antibodies are within the scope of the present invention.
- Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof . to to _
- a mammal e.g. mouse, rat, rabbit, horse, goat, sheep or monkey
- VH and CHI domains the VH and CHI domains; the Fv fragment consisting of the VL and VH domains of a single arm of an antibody; the dAb fragment which consists of a VH domain; isolated CDR regions and F(ab')2 fragments, a bivalent fragment including two Fab fragments linked by a disulphide bridge at the hinge region.
- Single chain Fv fragments are also included.
- a hybridoma producing a monoclonal antibody according to the present invention may be subject to genetic mutation or other changes. It will further be understood by those skilled in the art that a monoclonal antibody can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or the complementarity determining regions (CDRs), of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP184187A, GB 2188638A or EP-A-0239400. Cloning and expression of chimeric antibodies are described in EP-A- 0120694 and EP-A-0125023.
- Hybridomas capable of producing antibody with desired binding characteristics are within the scope of the present invention, as are host cells, eukaryotic or prokaryotic, containing nucleic acid encoding antibodies (including antibody fragments) and capable of their expression.
- the invention also provides methods of production of the antibodies including growing a cell capable of producing the antibody under conditions in which the antibody is produced, and preferably secreted.
- the reactivities of antibodies on a sample may be determined by any appropriate means . Tagging with individual reporter molecules is one possibility.
- the reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals.
- the linkage of reporter molecules may be directly or indirectly, covalently, e.g. via a peptide bond or non-covalently . Linkage via a peptide bond may be as a result of recombinant expression of a gene fusion encoding antibody and reporter molecule .
- Suitable fluorochromes include fluorescein, rhodamine, phycoerythrin and Texas Red.
- Suitable chromogenic dyes include diaminobenzidine .
- Other reporters include macromolecular colloidal particles or particulate material such as latex beads that are coloured, magnetic or paramagnetic, and biologically or chemically active agents that can directly or indirectly cause detectable signals to be visually observed, electronically detected or otherwise recorded.
- These molecules may be enzymes which catalyse reactions that develop or change colours or cause changes in electrical properties, for example. They may be molecularly excitable, such that electronic transitions between energy states result in characteristic spectral absorptions or emissions. They may include chemical entities used in conjunction with biosensors. Biotin/avidin or biotin/streptavidin and alkaline phosphatase detection systems may be employed.
- antibodies according to the present invention include antibodies able to bind and/or which bind specifically, e.g. with an affinity of at least 10 "7 M, to one of the following peptides: SYFHLFPPPPSPCTDSS VDGRQNIKRAKDDGT EVLFTTGLIRPVALWDN IQGHLDFVMDILVFHS .
- Antibodies according to the present invention may be used in screening for the presence of a polypeptide, for example in a test sample containing cells or cell lysate as discussed, and may be used in purifying and/or isolating a polypeptide according to the present invention, for instance following production of the polypeptide by expression from encoding nucleic acid therefor. Antibodies may modulate the activity of the polypeptide to which they bind and so, if that u> uo to t -.. --.
- a sequence alteration may affect alternative splicing of mRNA.
- various LRP5 isoforms resulting from alternative splicing are provided by the present invention.
- Tests may be carried out on preparations containing genomic DNA, cDNA and/or mRNA. Testing cDNA or mRNA has the advantage of the complexity of the nucleic acid being reduced by the absence of intron sequences, but the possible disadvantage of extra time and effort being required in making the preparations.
- RNA is more difficult to manipulate than DNA because of the wide-spread occurrence of RN'ases.
- Nucleic acid in a test sample may be sequenced and the sequence compared with the sequence shown in any of the figures herein, to determine whether or not a difference is present. If so, the difference can be compared with known susceptibility alleles (e.g. as shown in Table 5 or Table 6) to determine whether the test nucleic acid contains one or more of the variations indicated, or the difference can be investigated for association with IDDM or other disease.
- nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.
- Nucleic acid may be screened using a variant- or allele-specific probe.
- a probe corresponds in sequence to a region of the LRP5 gene, or its complement, containing a sequence alteration known to be associated with IDDM or other disease susceptibility.
- specific hybridisation of such a probe to test nucleic acid is indicative of the presence of the sequence alteration in the test nucleic acid.
- more than one probe may be used on the same test sample .
- Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample. ' Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art .
- the PCR product may for instance be treated in a way that enables one to display the polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected.
- SSCP heteroduplex analysis may be used for screening DNA fragments for sequence variants/mutations. It generally involves amplifying radiolabelled 100-300 bp fragments of the gene, diluting these products and denaturing at 95°C. The fragments are quick-cooled on ice so that the DNA remains in single stranded form. These single stranded fragments are run through acrylamide based gels. Differences in the sequence composition will cause the single stranded molecules to adopt difference conformations in this gel matrix making their mobility different from wild type fragments, thus allowing detecting of mutations in the fragments being analysed relative to a control fragment upon exposure of the gel to X- ray film. Fragments with altered mobility/conformations may be directly excised from the gel and directly sequenced for mutation.
- Sequencing of a PCR product may involve precipitation with isopropanol, resuspension and sequencing using a TaqFS+ Dye terminator sequencing kit. Extension products may be electrophoresed on an ABI 377 DNA sequencer and data analysed using Sequence Navigator software.
- a further possible screening approach employs a PTT assay in which fragments are amplified with primers that contain the consensus Kozak initiation sequences and a T7 RNA polymerase promoter. These extra sequences are incorporated into the 5' primer such that they are in frame with the native coding sequence of the fragment being analysed. These PCR products are introduced into a coupled transcription/translation system. This reaction allows the production of RNA from the fragment and translation of this RNA into a protein fragment. PCR products from controls make a protein product of a wild type size relative to the size of the fragment being analysed. If the PCR product analysed has a frame-shift or nonsense mutation, the assay will yield a truncated protein product relative to controls.
- the size of the truncated product is related to the position of the mutation, and the relative region of the gene from this patient may be sequenced to identify the truncating mutation.
- An alternative or supplement to looking for the presence of variant sequences in a test sample is to look for the presence of the normal sequence, e.g. using a suitably specific oligonucleotide probe or primer. Use of oligonucleotide probes and primers has been discussed in more detail above.
- Allele- or variant-specific oligonucleotide probes or primers according to embodiments of the present invention may be selected from those shown in Table 4, Table 7 or Table 8.
- Approaches which rely on hybridisation between a probe and test nucleic acid and subsequent detection of a mismatch may be employed. Under appropriate conditions (temperature, pH etc.), an oligonucleotide probe will hybridise with a sequence which is not entirely complementary. The degree of base-pairing between the two molecules will be sufficient for them to anneal despite a mis-match.
- Various approaches are well known in the art for detecting the presence of a mismatch between two annealing nucleic acid molecules.
- RN'ase A cleaves at the site of a mismatch. Cleavage can be detected by electrophoresing test nucleic acid to which the relevant probe or probe has annealed and looking for smaller molecules (i.e. molecules with higher electrophoretic mobility) than the full length probe/test hybrid .
- an oligonucleotide probe that has the sequence of a to to
- a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for one or more particular variants of the polypeptide shown in a figure herein.
- a sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies) , specific for the polypeptide shown in a figure herein.
- the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding, before binding is determined, for instance using a reporter system as discussed. Where a panel of antibodies is used, different reporting labels may be employed for each antibody so that binding of each can be determined.
- a specific binding member such as an antibody may be used to isolate and/or purify its binding partner polypeptide from a test sample, to allow for sequence and/or biochemical analysis of the polypeptide to determine whether it has the sequence and/or properties of the polypeptide whose sequence is disclosed herein, or if it is a mutant or variant form.
- Amino acid sequence is routine in the art using automated sequencing machines.
- test sample containing one or more polypeptides may be provided for example as a crude or partially purified cell or cell lysate preparation, e.g. using tissues or cells, such as from saliva, faeces, or preferably blood, or for pre-natal testing from the amnion, placenta or foetus itself.
- administration is preferably in a "prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis to to , , , l on
- Targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.
- an agent may be be produced in target cells by expression from an encoding gene introduced into the cells, e.g. in a viral vector (see below).
- the vector may be targeted to the specific cells to be treated, or it may contain regulatory elements which are switched on more or less selectively by the target cells.
- Viral vectors may be targeted using specific binding molecules, such as a sugar, glycolipid or protein such as an antibody or binding fragment thereof.
- Nucleic acid may be targeted by means of linkage to a protein ligand (such as an antibody or binding fragment thereof) via polylysine, with the ligand being specific for a receptor present on the surface of the target cells.
- An agent may be administered in a precursor form, for conversion to an active form by an activating agent produced in, or targeted to, the cells to be treated.
- This type of approach is sometimes known as ADEPT or VDEPT; the former involving targeting the activating agent to the cells by conjugation to a cell-specific antibody, while the latter involves producing the activating agent, e.g. an enzyme, in a vector by expression from encoding DNA in a viral vector (see for example, EP-A-415731 and WO 90/07936) .
- Nucleic acid according to the present invention may be used in a method of gene therapy, to treat a patient who is unable to synthesize the active polypeptide or unable to synthesize it at the normal level, thereby providing the effect provided by the wild-type with the aim of treating and/or preventing one or more symptoms of IDDM and/or one or more other diseases.
- Vectors such as viral vectors have been used to introduce genes into a wide variety of different target cells. Typically the vectors are exposed to the target cells so that transfection can take place in a sufficient proportion of the cells to provide a useful therapeutic or prophylactic effect from the expression of the desired polypeptide.
- the transfected nucleic acid may be permanently incorporated into the genome of each of the targeted cells, providing long lasting effect, or alternatively the treatment may have to be repeated periodically.
- a variety of vectors, both viral vectors and plasmid vectors are known in the art, see e.g. US Patent No. 5,252,479 and WO 93/07282.
- viruses have been used as gene transfer vectors, including adenovirus, papovaviruses, such as SV40, vaccinia virus, herpesviruses, including HSV and EBV, and retroviruses, including gibbon ape leukaemia virus, Rous Sarcoma Virus, consualian equine enchephalitis virus, Moloney murine leukaemia virus and murine mammary tumourvirus .
- Many gene therapy protocols in the prior art have used disabled murine retroviruses.
- Disabled virus vectors are produced in helper cell lines in which genes required for production of infectious viral particles are expressed.
- Helper cell lines are generally missing a sequence which is recognised by the mechanism which packages the viral genome and produce virions which contain no nucleic acid.
- a viral vector which contains an intact packaging signal along with the gene or other sequence to be delivered e.g. encoding the LRP5 polypeptide or a fragment thereof is packaged in the helper cells into infectious virion particles, which may then be used for the gene delivery.
- Liposomes can encapsulate RNA, DNA and virions for delivery to cells. Depending on factors such as pH, ionic strength and divalent cations being present, the composition of liposomes may be tailored for targeting of particular cells or tissues. Liposomes include phospholipids t to -_. » ⁇
- EXAMPLE 1 CLONING OF LRP5 5
- Multipoint linkage analysis cannot localise the gene to a small region unless several thousand multiplex families are available. Instead, association mapping has been used for
- the transmission disequilibrium test measures association by assessing the deviation from 50% of the transmission of alleles from a marker locus from parents to affected children.
- the detection of association is dependent on the ancestry of each population studied to be as homogeneous as possible, in order to reduce the possiblity that the presence of several founder-chromosomes, decreasing the power to detect the association.
- a physical map of this region comprising approximately 500kb, was achieved by constructing a pac, bac and cosmid contig ( Figure 2) .
- the region was physically mapped by hybridisation of markers onto restriction-enzyme digested clones resolved through agarose, and Southern blotted. Further microsatellites (both published, and those isolated from the clones by microsatellite rescue) were analysed within 1289 families, from four different populations (UK, USA, Sardinia and Norway) .
- the LD detected at a polymorphic marker is influenced by allele frequency, and whether the mutation causing susceptibility to type 1 diabetes arose on a chromosome where the allele in LD is the same allele as that on protective or neutral chromosomes. In the case where the marker being analysed has the same allele in LD with both susceptible and protective genotypes, these will remain undetected by single point analysis, in effect cancelling each other out, and showing little or no evidence for LD with the disease locus. Unpredictability of the method arising from this has been noted already above.
- SNPs single nucleotide polymorphisms
- haplotypes are identified by sequencing individuals with specific haplotypes which have been identified from the microsatellite analysis: homozygous susceptible to type 1 diabetes, homozygous protective for type 1 diabetes, and controls.
- One of these SNPs may be the etiological mutation IDDM4, or may be in very strong linkage disequilibrium with the primary disease locus, and hence be at a peak of the refined curve.
- Cross-match analysis further reduces the number of candidate SNPs, as shown by the localisation of the IDDM2 mutation by this method (Bennett et al, 1995; Bennett and Todd, 1996) .
- This requires identification of distinct haplotypes or founder chromosomes, which have a different arrangement of alleles from the main susceptible or protective haplotypes, so that association or transmission of candidate SNP alleles can be tested in different haplotype backgrounds.
- the candidate mutations can be assessed for effects on gene function or regulation. In different populations different IDDM4 mutations may have arisen in the same gene.
- flanking regions of the associated region was sequenced (the 75kb core region and 125 kb of flanking DNA) .
- the DNA sequence also aids in gene identification and is complementary to other methods of gene identification such as cDNA selection or gene identification by DNA sequencing and comparative analysis of homologous mouse genomic DNA.
- DNA was prepared from either cosmids, BACs (Bacterial Artificial Chromosomes) , or PACs (PI Artificial Chromosomes) . Cells containing the vector were streaked on Luria-Bertani
- the insert band(s) was excised from the gel .
- the DNA was eluted from the gel slice by beta- Agarase (New England Biolabs, Beverly MA) digestion according to the manufacturer's instructions.
- the solution containing the DNA and digested agarose was brought to 50 mM Tris pH
- nebulizer 358.0, 15 mM MgCl2, and 25% glycerol in a volume of 2 ml and placed in a AERO-MIST nebulizer (CIS-US, Bedford MA) .
- the nebulizer was attatched to a nitrogen gas source and the DNA was randomly sheared at 10 psi for 30 sec.
- the sheared DNA was ethanol precipitated and resuspended in TE (10 mM Tris, 1 mM EDTA) .
- Adapters and DNA fragments less than 500 bp were removed by column chromatography using a cDNA sizing column (GIBCO/BRL, Gaithersburg, MD) according to the instructions provided by the manufacturer. Fractions containing DNA greater than 1 kb were pooled and concentrated by ethanol precipitation. The DNA fragments containing BstX I adapters were ligated into the BstX I sites of pSHOT II which was constructed by subcloning the BstX I sites from pcDNA II (Invitrogen, Carlsbad, CA) into the BssH II sites of pBlueScript (Stratagene, La Jolla, CA) .
- pSHOT II was prepared by digestion with BstX I restriction endonuclease and purified by agarose gel electrophoresis.
- the gel purified vector DNA was extracted from the agarose by following the Prep-A-Gene (BioRad, Richmond, CA) protocol.
- the digested vector was treated with calf intestinal phosphatase (GIBCO/BRL, Gaithersburg, MD) .
- Ligation reactions of the DNA fragments with the cloning vector were transformed into ultra-competent XL-2 Blue cells (Stratagene, La Jolla, CA) , and plated on LB agar plates supplemented with 100 ug/ml ampicillin.
- plasmid DNA Glycerol stocks were used to inoculate 5 ml of LB broth supplemented with 100 ug/ml ampicillin either manually or by using.
- a Tecan Genesis RSP 150 robot (Tecan AG, Hombrechtikon, Switzerland) programmed to inoculate 96 tubes containing 5 ml broth from the 96 wells. The cultures were grown overnight at 37°C with shaking to provide aeration. Bacterial cells were pelleted by centrifugation, the supernatant decanted, and the cell pellet stored at -20°C.
- Plasmid DNA was prepared with a QIAGEN Bio Robot 9600 (QIAGEN, Chatsworth CA) according to the Qiawell Ultra protocol.
- D ⁇ A sequence analysis was performed using the ABI PRISMTM dye terminator cycle sequencing ready reaction kit with AmpliTaq D ⁇ A polymerase, FS (Perkin Elmer, ⁇ orwalk, CT) .
- D ⁇ A sequence analysis was performed with M13 forward and reverse primers.
- the extension products were purified and analyzed on an ABI PRISM 377 automated sequencer (Perkin Elmer, ⁇ orwalk, CT) .
- Approximately 12 to 15 sequencing reactions were performed per kb of D ⁇ A to be examined e.g. 1500 reactions would be performed for a PAC insert of 100 kb.
- Phred/Phrap was used for D ⁇ A sequences assembly. This program was developed by Dr. Phil Green and licensed from the University of Washington (Seattle, WA) . Phred/Phrap consists of the following programs: Phred for base-calling, Phrap for sequence assembly, Crossmatch for sequence comparisons, Consed and Phrapview for visualization of data, and Repeatmasker for screening repetitive sequences. Vector and E. coli D ⁇ A sequences were identified by Crossmatch and removed from the D ⁇ A sequence assembly process. D ⁇ A sequence assembly was on a SUN Enterprise 4000 server running Solaris 2.51 operating system (Sun Microsystems Inc., Mountain View, CA) using default Phrap parameters. The sequence assemblies were further analyzed using Consed and Phrapview.
- the BLAST analysis identified a high degree of similarities (90-100% identical) over a length of greater than 100 bp between DNA sequences we obtained and a number of human EST sequences present in the database . These human EST sequences clustered into groups that are represented by accession numbers; R73322, R50627, F07016. In general, each EST cluster is presumed to represent a single gene. The DNA sequences in R73322 cluster of 424 nucleotides had a lower but significant degree of DNA sequence similarity to the gene encoding the LDL receptor related protein (GenBank accession number X13916) and several other members of the LDL receptor family. Therefore it was concluded that the sequences that were highly similar to EST R73322 encoded a member of the LDL receptor family.
- the probe hybridized to an approximately 5-5.5 kb mRNA transcript that is most highly expressed in placenta, liver, pancreas, and prostate. It is expressed at an intermediate level in lung, skeletal muscle, kidney, spleen, thymus, ovary, small intestine, and colon. The message is expressed at a low level in brain, testis, and leukocytes. In tissues where the transcript is highly expressed, e.g. liver and pancreas, additional bands of 7kb and 1.3 kb are observed.
- PCR based techniques were used to extend regions that were highly similar to ESTs and regions identified by exon prediction software (GRAIL) .
- the one technique utilized is a variation on Rapid Amplification of cDNA Ends (RACE) termed Reduced Complexity cDNA Analysis (RCCA) similar procedures are reported by Munroe et . al . (1995) PNAS 92: 2209-2213 and Wilfinger et. al . (1997) BioTechniques 22: 481-486.
- RACE Rapid Amplification of cDNA Ends
- RCCA Reduced Complexity cDNA Analysis
- a second technique that was used to extend cDNAs was PCR between regions that were identified in the genomic sequence of having the potential to be portions of a gene e.g. sequences that were very similar to ESTs or sequences that were identified by GRAIL. These PCR reactions were done on cDNA prepared from approximately 5 ug of mRNA (Clontech, Palo Alto, CA) with the SuperscriptTM choice system (Gibco/BRL, Gaithersburg, MD) . The first strand cDNA synthesis was primed using 1 ug of oligo (dT) 12 _ 18 primer and 25 ng of random hexamers per reaction. Second strand cDNA synthesis was performed according to the manufacturer's instructions .
- TaKaRa LA Taq Polymerase (PanVera, Madison WI) , 100 ng of each primer and 5 ul of the plasmid library at 0.2 ng/ml.
- the thermal cycling conditions were as follows: 92°C for 30 sec, followed by 32 cycles of
- a nested or semi-nested PCR reaction was performed using nested vector primers PBS 578R and PBS 838F and various gene specific primers (256F, 343F, 623R and 657R) .
- the PCR products were separated from the
- Extension of the 5 ' end RCCA analysis was utilized to obtain a number of clones extended 5' by using the internal gene specific primers as described previously.
- Several clonal extensions were isolated however most of the clones analyzed stopped within exon A.
- One clone extended past the 5' end of exon A but the sequence was contiguous with genomic DNA, since a body of evidence indicates an intron/exon boundary at the 5 ' end of exon A it appeared likely that this extension is a result of unprocessed intronic sequence.
- a second clone hlO extended past this point but diverged from the genomic DNA sequence. It was concluded that this represented a chimeric clone that was present in the original fetal brain cDNA library.
- cDNA was prepared using the Superscript Choice system (Gibco/BRL Gaithersburg, MD) according to the manufacturer's instructions. Phosphorylated Bst XI adapters (Invitrogen, San Diego, CA) were ligated to approximately 2 ug of mouse liver cDNA. The ligation mix was diluted and size-fractionated on a cDNA sizing column (Gibco/BRL Gaithersburg, MD) . Drops from the column were collected and the eluted volume from the column determined as described for the construction of shotgun libraries.
- the size-fractionated cDNA with the Bst XI linkers was ligated into the vector pSHOT II, described above, cut with the restriction endonuclease Bst XI, gel purified, and dephosphorylated with calf intestinal phosphatase (Gibco/BRL, Gaithersburg, MD) .
- the ligation containing approximately 10-20 ng of cDNA and approximately 100 ng of vector was incubated overnight at 14 °C.
- the ligation was transformed into XL-2 Blue Ultracompetent cells (Stratagene, La Jolla, CA. ) .
- the transformed cells were spread on twenty 133 mm Colony/Plaque Screen filters (DUpont/NEN, Boston, MA.) at a density of approximately 30,000 colonies per plate on Luria Broth agar plates supplemented with 100 ug/ml ampicillin (Sigma, St. Louis, MO.). The colonies were grown overnight and then replica plated onto two duplicate filters. The replica filters were grown for several hours at 37°C until the colonies were visible and processed for in situ hybridization of colonies according to established procedures (Maniatis, Fritsch and Sambrook, 1982) . A Stratalinker (Stratagene, La Jolla, CA.) was used to crosslink the DNA to the filter.
- a Stratalinker (Stratagene, La Jolla, CA.) was used to crosslink the DNA to the filter.
- the filters were hybridized overnight with greater than 1,000,000 cpm/ml probe in IX hybridization buffer (Gibco/BRL, Gaithersburg, MD) containing 50% formamide at 42 °C.
- the probe was generated from a PCR product derived from the human LRP5 cDNA using primers 512F and 878R. This probe was random prime labeled with the Amersham Rediprime kit (Arlington Heights, IL) in the presence of 50-100 uCi of 3000 Ci/mmole [alpha 32P]dCTP (Dupont/NEN, Boston, MA) and purified using a ProbeQuant G-50 spin column (Pharmacia/Biotech, Piscataway, NJ) . The filters were washed with 0.
- the additional 200 bp contains an open reading frame that begins at bp 112 ( Figure 16 (c) ) .
- the initiating codon has consensus nucleotides for efficient initiation of translation at both the -3 (purine) and +4 (G nucleotide) positions (Kozak, M. 1996, Mamalian Genome 7:563- 574) .
- This open reading frame encodes a peptide with the potential to act as a eukaryotic signal sequence for protein export (von Heijne, 1994, Ann. Rev. Biophys. Biomol. Struc. 23:167-192).
- the highest score for the signal sequence as determined by using the SigCleave program in the GCG analysis package generates a mature peptide beginning at residue 29 of isoform 1. Additional sites that may be utilized produce mature peptides beginning at amino acid residue 31 (the first amino acid encoded by exon A) or amino acid residues 32, 33, or 38.
- mouse cDNA clones isolated by nucleic acid hybridization contain 1.7 Kb of the 5' end of the Lrp3 cDNA ( Figure 16 (a) ) . This accounts for approximately one-third of the full length cDNA when compared to the human cDNA sequence.
- the remainder of the mouse Lrp3 cDNA was isolated using PCR to amplify products from mouse liver cDNA. PCR primers, Table 9, were designed based upon DNA sequences identified by the sequence skimming of mouse genomic clones, BACs 53-d- 8 and 131-p-15, which contain the mouse Lrp3 gene.
- BAC 53-d-8 was mapped by FISH analysis to mouse chromosome 19 which is syntenic with llql3. Sequence skimming of these clones identified DNA sequences that corresponded to the coding region of human LRP5 as well as the 3' untranslated region. This strategy resulted in the determination of a mouse cDNA sequence of 5059 nucleotides ( Figure 18(a)) which contains an open reading frame of 4842 nucleotides ( Figure 18 (b) ) that encodes a protein of 1614 amino acids ( Figure 18(c)). The putative ATG is in a sequence context favorable for initiation of translation (Kozak, M. 1996, Mamalian Genome 7:563-574).
- the cDNA sequences of human and mouse LRP5 display 87% identity.
- the open reading frame of the human LRP5 cDNA encodes a protein of 1615 amino acids that is 94% identical to the 1614 amino acid protein encoded by mouse Lrp3 ( Figure 18 (d) ) .
- the difference in length is due to a single amino acid deletion in the mouse Lrp3 signal peptide sequence.
- the signal peptide sequence is not highly conserved being less than 50% identical between human and mouse.
- the location of the putative signal sequence cleavage site is at amino acid residue 25 in the human and amino acid 29 in the mouse. Cleavage at these sites would result in mature human and mouse proteins of 1591 and 1586 amino acids, respectively, which are 95% identical (Figure 18 (e) ) .
- the high degree of overall sequence similarity argues strongly that the identified sequences are orthologs of the LRP5 gene. This hypothesis is further supported by the results of genomic Southern experiments (data not shown) .
- the human exon encoding a signal peptide was isolated from liver cDNA by PCR.
- the forward primer IF (Table 9) was used in combination with one of the following reverse primers: 218R, 265R, 318R, and 361R in a PCR reaction using Taq Gold polymerase (Perkin-Elmer, Norwalk, CT) and supplemented with either 3, 5, or 7% DMSO.
- Products were amplified for 40 cycles of 30 sec 95°C, 30 sec 58°C, and 1 min 72°C.
- the products were analyzed on an agarose gel and some of the reactions containing bands of the predicted size were selected for DNA sequence analysis and subcloning into pCR2.1 (Invitrogen, San Diego, CA) .
- exon A The derived DNA sequence of 139 nucleotides upstream of exon 2 (also known as exon A) contains an ATG that is in a context for efficient initiation of translation: an adenine OJ OJ t to ⁇ _!
- RT reverse transcriptase
- Taqara RNA PCR kit Panvera, Madison WI
- Human liver mRNA 50 ng was used as the template for a 10 ul reverse transcriptase reaction.
- One of the forward primers, Table 2, (Gl If, 2f, or 3f) was added along with the reagents for PCR amplification and the reaction was amplified for 30 cycles of 30 sec at 94°C, 30 sec at 60°C, and 2 min at 72 °C.
- This primary PCR reaction was then diluted 1:2 in water and 1 ul of the reaction was used in a second 20 ul reaction using nested primers.
- the reaction conditions for the second round of amplification were 30 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 2 min.
- the products were separated on an agarose gel and excised.
- the purified fragments were subcloned into pCR 2.1 (Invitrogen, Carlsbad, CA) , plasmid DNA was prepared, and the DNA sequence was determined.
- a second potential initiator methionine is present at nucleotide 453, this codon is in a context for efficient initiation of translation initiation (Kozak, M. (1996) Mamalian Genome 7:563-574) .
- the longest potential open reading frame for isoform 2 ( Figure 11 (c) ) encodes a splice variant contains a eukaryotic signal sequence at amino acid 153. The mature peptide generated by this splice variant would be lacking the first five spacer domains and a portion of the first EGF-like motif.
- the second isoform (isoform 3) consists of exon 1 followed by exon A ( Figure 12 (a) ) . It is not known whether exon 1 is the first exon of isoform 2.
- RACE extension of the 5 ' end of lrp5 Isoforms 4 and 5 RACE is an established protocol for the analysis of cDNA ends. This procedure was performed using the Marathon RACE template purchased from Clontech (Palo Alto, CA) . This was performed according to instructions using Clontech "Marathon” cDNA from fetal brain and mammary tissue. Two “nested” PCR amplifications were performed using the ELONGASETM long-PCR enzyme mix & buffer from Gibco-BRL (Gaithersburg, MD) .
- First round PCR used 2 microliters Marathon placenta cDNA template and 10 pmoles each of primers L217 and API. Thermal cycling was: 94°C 30 sec, 68°C 6 min, 5 cycles; 94°C 30 sec,
- the reaction conditions were 12 min at 95°C followed by 35 cycles of 95°C for 30 sec, 60°C for 30 sec, and 72 °C for 1 min 30 sec with approximately lOng of liver cDNA per 20 ul reaction.
- the primary reactions were diluted 20 fold in water and a second round of PCR using primer Gp If in combination with either 474r or 521r was done. Products were analyzed on a 2% agarose gel and bands of approximately 220 to 400 bp were subcloned into pCR 2.1 (Invitrogen, Carlsbad, CA) and analyzed by DNA sequence analysis.
- the open reading frame present in isoform 4 is the same as described for isoform 2 above ( Figure 11 (b) ) .
- a vectorette library was made from each clone by restricting each clone and ligating on a specific bubble linker (Munroe, D.J. et al . (1994) Genomics 19, 506) .
- PCR was carried out beween a primer (Not 1-A) specific for the linker, and a repeat motif (AC) UN, (where N is not A) , at an annealing temperature of 65°C.
- the PCR products were gel purified and sequenced using the ABI PRISM dye terminator cycle sequencing kit as previously described. From this sequence, a primer was designed, which was used in PCR with the Not 1-A primer. This was also sequenced, and a second PCR primer designed, (Table 8 ) so that both primers flanked the repeat motif, and were used for genotyping.
- SNP's Single nucleotide polymorphisms
- Primers were designed to specifically amplify genomic fragments, approximately 500 to 800 bp in length, containing specific regions of interest (i.e. regions that contained LRP5 exons, previously identified SNP's or GRAIL predicted exons) .
- regions of interest i.e. regions that contained LRP5 exons, previously identified SNP's or GRAIL predicted exons.
- forward and reverse primer pairs were tailed with sequences that correspond to the M13 Universal primer (5' -TGTAAAACGACGGCCAGT- 3') and a modified M13 reverse primer (5'-
- PCR products produced using the primer sets, mentioned above, were amplified in 50 ul reactions consisting of Perkin-Elmer 10 x PCR Buffer, 200 mM dNTP's, 0.5 ul of Taq Gold (Perkin-Elmer Corp., Foster City, CA) , 50 ng of patient DNA and 20 pmol/ml of forward and reverse primers. Cycling conditions were 95°C for 12 min; 35 cycles of 95°C for 30 sec, 57°C for 30 sec and 68°C for 2 min, followed by an extension of 72 °C for 6 min and a 4°C hold. Conditions were optimized so that only single DNA fragments were produced by these reaction.
- the PCR products were then purified for sequencing using QiaQuick strips or QiaQuick 96 well plates on the Qiagen robot (Qiagen Inc., Santa Clarita, CA) . This purification step removes the unincorporated primers and nucleotides.
- Direct BODIPY dye primer cycle sequencing was the method used to analyze the PCR products (Metzker et. al . (1996) Science 271, 1420-1422).
- a Tecan robot (Tecan, Research Triangle Park, NC) carried out the sequencing reactions using standard dye primer sequencing protocols (ABI Dye Primer Cycle Sequencing with AmpliTaq DNA Polymerase FS, Perkin-Elmer Corp., Foster City, CA) .
- the reactions were generated using the following cycling conditions on a DNA Engine thermal cycler (M.J. Research Inc., Watertown, MA), 15 cycles of 95°C for 4 sec, 55°C for 10 sec, and 70°C for 60 sec; followed by 15 cycles of 95°C for 4 sec, and 70°C for 60 sec. After cycling, samples were pooled, precipitated and dried down. The samples were resuspended in 3 ul of loading buffer and 2 ml were run on an ABI 377 Automated DNA sequencer.
- RFLP restriction fragment length polymorphisms
- forced RFLP PCR Li and Hood (1995) Genomics 26, 199-206; Haliassos et.al. (1989) Nuc . Acids Res. 17, 3608) and ARMS (Gibbs et.al. (1989) Nuc. Acids Res. 17, 2437-2448; Wu et. al . (1989) Proc. Natl. Acad. Sci.
- Haplotype analysis at IDDM4 Haplotype mapping has been used in conjunction with association mapping to identify regions of identity-by-descent (IBD) in founder populations, where (some) of the affected individuals in a founder population share not only the mutation, but also a quite large genomic haplotype (hence identical piece of DNA) surrounding the disease locus .
- Recombinant haplotypes can be utilised to delineate the region containing the mutation.
- haplotype analysis was undertaken in conjunction with association analysis in order to identify regions of IBD between haplotypes which are transmitted more often than expected, hence contain a susceptible allele at the aetiological locus; in contrast protective haplotypes will be transmitted less often than expected and contain a different (protective) allele at the aetiological locus.
- Evidence for a deviation in the expected transmission of alleles was shown with the two polymorphic markers D11S1917 and H0570POLYA .
- a distinct protective haplotype (A) has been identified (encompassing the 3-2 haplotype at D11S1917- H0570POLYA) , as well as a distinct susceptible haplotype (B) (encompassing the 2-3 haplotype at D11S1917-H0570POLYA ) .
- the susceptible haplotype is IBD with the protective haplotype, 3' of marker D11S1337 , indicating that the aetiological variant playing a role in type 1 diabetes does not lie within the identical region, localising it 5' of Exon E of the LRP-5 gene. This region that is IBD between the protective, and susceptible haplotypes prevents association analysis being undertaken, as no deviation in transmission to affected offspring would be detected.
- the rare susceptible haplotype (C) 3-3 at D11S1917 -H057 OPOLYA, can also be identified.
- Haplotype analysis with the additional markers in the region reveals that this rare susceptible haplotype is identical to the susceptible haplotype between UT5620 and 14L15CA, potentially localising the aetiological variant between UT5620 t to
- the full-length human LRP5 gene was cloned into the adenovirus transfer vector pdelElsplA-CMV-bGHPA containing the human Cytomegalovirus immediate early promoter and the bovine growth hormone polyadenylation signal to create pdehlrp3.
- This vector was used to construct an adenovirus containing the LRP5 gene inserted into the El region of the virus directed towards the 5' ITR.
- LRP5 demonstrates the ablility to bind and take up LDL (see below), but this activity is not a high level. Therefore, it is likely that LRP5 has the capacity to bind additional ligand (s).
- LRP5 ligands the extracellular domain consisting of the first 1399 amino acids of human LRP5 , or the corresponding region of mouse Lrp5 will be purified.
- a number of expression systems can be used these include plasmid based systems in Drosophila S2 cells, yeast and E. coli and viral based systems in mammalian cells and SF9 insect cells.
- a histidine tag will be used to purify LRP5 on a nickel column (Novagen, Madison WI) .
- a variety of resins may be used in column chromatography to further enrich soluble LRP5.
- LRP5 will be attached to a solid support e.g. a nickel to to -_. - ⁇
- adenovirus containing human LDLR positive control or 3.
- Each of these viruses were used to infect five C57 wild type and five C57 LDLR knockout mice.
- a pretreatment bleed, 8 days prior to injection of the virus was used to examine serum chemistry values prior to treatment.
- the animals were injected with virus.
- On day five following administration of the virus a second (treatment ) bleed was taken and the animals were euthanized for collection of serum for lipoprotein fractionation.
- tissues were harvested for in situ analysis, immuno- histochemistry, and histopathology.
- mice were maintained in a standard light/dark cycle and given a regular chow diet. The animals were fasted prior to serum collection. In certain experimental conditions it may be desirable to give animals a high fat diet.
- Standard clinical serum chemistry assays were performed to determine; serum triglycerides, total cholesterol, alkaline phosphatase, aspartate aminotransferase, alanine aminotransferase, urea nitrogen, and creatinine. Hematology was performed to examine the levels of circulating leukocytes, neutrophils, the percent lymphocytes, monocytes, and eosinophils, erythrocytes, platelets, hemoglobin, and percent hematocrit . Serum lipoproteins were fractionated into size classes using a Superose 6 FPLC sizing column and minor modifications of the procedure described by Gerdes et al . (Clin. Chim.
- LRP5 overexpression affects serum triglycerides and 1 ipopro teins
- the serum lipoprotein profile indicated that the VLDL particle class was decreased in wild type mice treated with LRP5 virus. Although the number of samples analyzed was not sufficient for statistical analyses, this result is consistent with the observed decrease in serum triglycerides . These results suggest that LRP5 has the potential to bind and internalize lipid rich particles, causing the decrease in serum triglycerides and VLDL particles. Therefore treatment with LRP5 or with therapeutic agents that increase the expression of LRP5 or the biological activity of LRP5 may be useful in reducing lipid rich particles and triglycerides in patients with diseases that increase triglyceride levels, e.g. type 2 diabetes and obesity.
- LRP5 in a state of elevated cholesterol an increase in the activity of LRP5 might reduce serum cholesterol levels . Therefore treatment with LRP5 or with therapeutic agents that increase either the expression of LRP5 or the biological activity of LRP5 may be useful in reducing cholesterol in patients with hypercholesterolemia .
- LRP5 overexpression may affect serum alkaline phospha tase levels
- Serum alkaline phosphatase levels can be dramatically elevated, e.g. 20 fold increase, as a consequence of an obstruction of the bile duct (Jaffe, M. S. and McVan, B., 1997, Davis 's laboratory and diagnostic test handbook. pub . F.A. Davis Philadelphia PA) .
- lower levels, up to a three fold increase of alkaline phosphatase can result from the inflammatory response that take place in response to an infectious agent in the liver, e.g. adenovirus. In animals treated with a control virus there was an approximately 2 -fold increase in alkaline phosphatase levels.
- alkaline phosphatase levels may be a consequence of the level of infection with the adenovirus, therefore, a possible explanation for the decrease in the animals treated with the LRP5 virus may simply be due to less virus in this treatment group.
- An indicator of the level of the viral infection is the appearance in the serum of the liver enzymes aspartate aminotransferase and alanine aminotransferase. These enzymes are normally found in the cytoplasm of cells and elevated in the serum when cellular damage occurs (Jaffe, M. S. and McVan, B., 1997, Davis' s laboratory and diagnostic test handbook. pub. F.A. Davis Philadelphia PA) .
- LRP5 can mediate LDL uptake. However, based on the modest level of activity, relative to the LDL-receptor, it does not appear that the primary activity of LRP5 is to mediate the uptake of LDL.
- the PEA-13 cell line (ATCC 2216-CRL) lacks the LRPl receptor. Mutant CHO cells lacking the LDL receptor have been described by Kingsley and Krieger ( Proceedings National Academy Sciences USA (1984) 81:5454). This cell line, known as ldlA7 , is particularly useful for the creation of stable transfectant cell lines expressing recombinant LRP5.
- COS cells were infected with an adenovirus containing human LRP5 cDNA. Three days after the infection the cells were harvested by scraping into phosphate buffered saline (Gibco/BRL Gaithersburg, MD) containing the protease inhibitors PMSF (lOOug/ml) , aprotinin (2 ug /ml) , and pepstatin A (1 ug/ml) . The cells were pelleted by a low speed spin, resuspended in phosphate buffered saline containing protease inhibitors and lysed by Dounce homogenization.
- Membrane proteins were fractionated by electrophoresis on a 10% Tris-glycine acrylamide gel (Novex, San Diego CA) . The fractionated proteins were transferred to PVDF paper (Novex, San Diego CA) according to the manufacturer's instructions.
- BAC clone 131-p-15 which contains the first two exons of LRP5 was sequenced extensively, i.e. approximately 6X coverage.
- BAC clone 53-d-8 contains sequences from exon D to exon V, however the level of sequence coverage of this clone was only approximately IX (skim sequencing) .
- the skim sequencing of mouse BAC 53-d-8 resulted in 76% of the exons being detected, however in some instances only a portion of an exon was present in the mouse sequence data.
- Northern blot analysis of probes derived from specific transcripts is used to survey tissues for the abundance of a particular transcript. More sensitive techniques such as RNase protection assays will be performed. Reagents from commercially available kits (Ambion, Inc. Austin TX) are used to prepare probes. The relative abundance of transcript that hybridizes to a probe radiolabeled with [alpha] 32P-UTP is analyzed by native and denaturing acrylamide gels (Novex Inc., San Diego, CA) . Primer extension assays are performed according to established procedures (Sambrook et. al . (1989) Molecular Cloning, Cold Spring Harbour Press, NY) using reverse primers derived from the 5' portion of the transcript. Isolation of other species homologs of LRP5 gene
- the LRP5 gene from different species are isolated by screening of a cDNA library with portions of the gene that have been obtained from cDNA of the species of 5 interest using PCR primers designed from the human LRP5 sequence.
- Degenerate PCR is performed by designing primers of 17-20 nucleotides with 32-128 fold degeneracy by selecting regions that code for amino acids that have low codon degeneracy e.g. Met and Trp. When selecting these primers
- PCR products are analyzed by DNA sequence analysis to confirm their similarity to human LRP5. The correct product is used to screen cDNA libraries by colony or plaque hybridization at high
- probes derived directly from the human LRP5 gene are utilized to isolate the cDNA sequence of LRP5 from different species by hybridization at reduced stringency.
- a cDNA library is generated as described above.
- the primers are numbered beginning at nucleotide 1 in Figure 55 (a) .
- Gl 2F TTCGTCTTGAACTTCCCAGC 0
- Gl 3F TCTTCTTCTCCAGAGGATGCA
- Gpl IF AGGCTGGTCTCAAACTCCTG
- PBS .578R CCAGGGTTTTCCCAGTCACGAC
- PBS .838F TTGTGTGGAATTGTGAGCGGATAAC
- PBS .873F CCCAGGCTTTACACTTTATGCTTCC
- ccgggtc ⁇ c/ATGGAG Ex l (6) (91) CCGCGG/gt ⁇ ggtgggc 1 (35051) tgcccc ⁇ c ⁇ g/CCTCGC Ex 2 (A) (391) TCACGG/gt ⁇ ccctg 2 (9408) cccgtc ⁇ c ⁇ g/GTACAT Ex 3 (B) (198) GTTCCG/gt ⁇ ggt ⁇ ccc 3 (6980) ctg ⁇ ctgc ⁇ g/GCAGAA Ex 4 (C) (197) CTTTCT/gtg ⁇ gtgccg 4 (1640) gttttccc ⁇ g /TCCACA Ex 5 (D) (132) AGGCAG/gtg ⁇ ggcggt 5 (20823) gtctcc ⁇ c ⁇ g/GAGCCG Ex 6 (E) (397) GATGGG/gt ⁇ g ⁇ cggg 6 (3213) tcttctcc ⁇ g/CCTCAT Ex 7
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Physical Education & Sports Medicine (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Rheumatology (AREA)
- Hematology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Obesity (AREA)
- Molecular Biology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Communicable Diseases (AREA)
- Urology & Nephrology (AREA)
- Hospice & Palliative Care (AREA)
- Endocrinology (AREA)
- Emergency Medicine (AREA)
- Oncology (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP54363598A JP4271735B2 (ja) | 1997-04-15 | 1998-04-15 | 新規のldl−レセプター |
| EP98917374A EP0988379B1 (en) | 1997-04-15 | 1998-04-15 | Ldl-receptor |
| DE69837542T DE69837542T2 (de) | 1997-04-15 | 1998-04-15 | Ldl-rezeptor |
| AU70614/98A AU733722B2 (en) | 1997-04-15 | 1998-04-15 | Novel LDL-receptor |
| US09/402,923 US6555654B1 (en) | 1997-04-15 | 1998-04-15 | LDL-receptor |
| CA2286313A CA2286313C (en) | 1997-04-15 | 1998-04-15 | Novel ldl-receptor |
| US10/331,907 US7244577B2 (en) | 1997-04-15 | 2002-12-31 | Method of screening for modulator of LRP5 activity |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US4355397P | 1997-04-15 | 1997-04-15 | |
| US60/043,553 | 1997-04-15 | ||
| US4874097P | 1997-06-05 | 1997-06-05 | |
| US60/048,740 | 1997-06-05 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09402923 A-371-Of-International | 1998-04-15 | ||
| US09/402,923 A-371-Of-International US6555654B1 (en) | 1997-04-15 | 1998-04-15 | LDL-receptor |
| US10/331,907 Division US7244577B2 (en) | 1997-04-15 | 2002-12-31 | Method of screening for modulator of LRP5 activity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1998046743A1 true WO1998046743A1 (en) | 1998-10-22 |
Family
ID=26720554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB1998/001102 Ceased WO1998046743A1 (en) | 1997-04-15 | 1998-04-15 | Novel ldl-receptor |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US6545137B1 (https=) |
| EP (1) | EP0988379B1 (https=) |
| JP (1) | JP4271735B2 (https=) |
| AT (1) | ATE359367T1 (https=) |
| AU (1) | AU733722B2 (https=) |
| CA (1) | CA2286313C (https=) |
| DE (1) | DE69837542T2 (https=) |
| ES (1) | ES2285767T3 (https=) |
| WO (1) | WO1998046743A1 (https=) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001077327A1 (en) * | 2000-04-05 | 2001-10-18 | Genome Therapeutics Corporation | THE HIGH BONE MASS GENE OF 11q13.3 |
| EP1212363A2 (en) * | 1999-08-05 | 2002-06-12 | Research Corporation Technologies, Inc | Il-16 antagonists |
| WO2001092891A3 (en) * | 2000-05-26 | 2002-07-25 | Genome Therapeutics Corp | Regulating lipid levels via the zmax1 or hbm gene |
| JP2003508074A (ja) * | 1999-09-03 | 2003-03-04 | サントル、ナショナール、ド、ラ、ルシェルシュ、シアンティフィク、(セーエヌエルエス) | 最も一般的な形態の常染色体性優性遺伝性痙性対麻痺に応答し得るspg遺伝子のクローニング、発現および同定 |
| GB2381790A (en) * | 2001-09-26 | 2003-05-14 | Glaxo Group Ltd | LDL-receptor polypeptides |
| WO2003075948A1 (fr) * | 2002-03-08 | 2003-09-18 | Anges Mg, Inc. | Nouvelle fonction de wnt et son application au traitement de maladies |
| WO2002092015A3 (en) * | 2001-05-17 | 2003-10-23 | Genome Therapeutics Corp | Reagents and methods for modulating dkk-mediated interactions |
| US6770461B1 (en) | 1998-10-23 | 2004-08-03 | Genome Therapeutics Corporation | High bone mass gene of 11q13.3 |
| US6780609B1 (en) | 1998-10-23 | 2004-08-24 | Genome Therapeutics Corporation | High bone mass gene of 1.1q13.3 |
| EP1313753A4 (en) * | 2000-08-18 | 2004-09-15 | Proskelia | REGULATORY GENE AND SYSTEM FOR USE IN THE DIAGNOSIS AND TREATMENT OF OSTEOPOROSIS |
| EP1401269A4 (en) * | 2001-05-11 | 2005-09-28 | Wyeth Corp | TRANSGENIC ANIMAL MODEL FOR MODULATING THE BONE MASS |
| EP1434783A4 (en) * | 2001-03-16 | 2006-06-07 | Lilly Co Eli | LP-mammalian proteins; RELATED REAGENTS |
| US7169559B2 (en) * | 2002-05-13 | 2007-01-30 | Fonterra Corporate Research and Development Ltd. | LDL receptor-related proteins 1 and 2 and treatment of bone or cartilage conditions |
| US7179462B2 (en) | 2000-06-02 | 2007-02-20 | University Of Connecticut Health Center | α (2) macroglobulin receptor as a heat shock protein receptor and uses thereof |
| US7186515B1 (en) | 2000-06-02 | 2007-03-06 | University Of Connecticut Health Center | Alpha(2) macroglobulin receptor as a heat shock protein receptor and uses thereof |
| US7449557B2 (en) | 2000-06-02 | 2008-11-11 | University Of Connecticut Health Center | Complexes of alpha (2) macroglobulin and antigenic molecules for immunotherapy |
| US7473770B2 (en) | 2003-11-17 | 2009-01-06 | Merck & Co., Inc. | Cynomolgus monkey dickkopf-4, nucleotides encoding same, and uses thereof |
| US7514594B2 (en) | 2001-05-11 | 2009-04-07 | Wyeth | Transgenic animal model of bone mass modulation |
| US7622553B2 (en) | 2003-11-17 | 2009-11-24 | Merck & Co., Inc. | Rhesus monkey dickkopf-1, nucleotides encoding same, and uses thereof |
| US7666581B2 (en) | 2001-08-20 | 2010-02-23 | University Of Connecticut Health Center | Methods for preparing compositions comprising heat shock proteins useful for the treatment of cancer and infectious disease |
| US7700101B2 (en) | 2001-05-17 | 2010-04-20 | Wyeth | Reagents and method for modulating Dkk-mediated interactions |
| US9173960B2 (en) | 2011-11-04 | 2015-11-03 | Novartis Ag | Methods of treating cancer with low density lipoprotein-related protein 6 (LRP6)—half life extender constructs |
| US9290573B2 (en) | 2010-05-06 | 2016-03-22 | Novartis Ag | Therapeutic low density lipoprotein-related protein 6 (LRP6) multivalent antibodies |
| US9428583B2 (en) | 2010-05-06 | 2016-08-30 | Novartis Ag | Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (LRP6) multivalent antibodies |
| WO2018220080A1 (en) | 2017-05-31 | 2018-12-06 | Boehringer Ingelheim International Gmbh | Polypeptides antagonizing wnt signaling in tumor cells |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7244577B2 (en) * | 1997-04-15 | 2007-07-17 | Merck & Co., Inc. | Method of screening for modulator of LRP5 activity |
| US20040221326A1 (en) * | 2001-05-11 | 2004-11-04 | Philip Babij | Transgenic animal model of bone mass modulation |
| US20030219793A1 (en) * | 2002-10-04 | 2003-11-27 | Carulli John P. | High bone mass gene of 11q13.3 |
| WO2005048913A2 (en) * | 2003-11-24 | 2005-06-02 | Gunnar Westin | Mutant lrp5/6 wnt-signaling receptors in cancer diagnosis, prognosis and treatment |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995030774A1 (en) * | 1994-05-05 | 1995-11-16 | Beckman Instruments, Inc. | Oligonucleotide repeat arrays |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5474796A (en) * | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| US5635177A (en) * | 1992-01-22 | 1997-06-03 | Genentech, Inc. | Protein tyrosine kinase agonist antibodies |
| AU1173995A (en) * | 1993-11-10 | 1995-05-29 | Arch Development Corporation | Ubiquitous nuclear receptor: compositions and methods |
| ES2169804T3 (es) * | 1995-06-23 | 2002-07-16 | Us Gov Health & Human Serv | Actividad despigmentante de la proteina señal aguti y peptidos de la misma. |
| IL151904A0 (en) | 2000-04-05 | 2003-04-10 | Genome Therapeutics Corp | THE HIGH BONE MASS GENE OF 11q13.3 |
-
1998
- 1998-04-15 DE DE69837542T patent/DE69837542T2/de not_active Expired - Lifetime
- 1998-04-15 JP JP54363598A patent/JP4271735B2/ja not_active Expired - Lifetime
- 1998-04-15 WO PCT/GB1998/001102 patent/WO1998046743A1/en not_active Ceased
- 1998-04-15 CA CA2286313A patent/CA2286313C/en not_active Expired - Lifetime
- 1998-04-15 EP EP98917374A patent/EP0988379B1/en not_active Expired - Lifetime
- 1998-04-15 AU AU70614/98A patent/AU733722B2/en not_active Expired
- 1998-04-15 US US09/060,299 patent/US6545137B1/en not_active Expired - Lifetime
- 1998-04-15 AT AT98917374T patent/ATE359367T1/de not_active IP Right Cessation
- 1998-04-15 ES ES98917374T patent/ES2285767T3/es not_active Expired - Lifetime
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995030774A1 (en) * | 1994-05-05 | 1995-11-16 | Beckman Instruments, Inc. | Oligonucleotide repeat arrays |
Non-Patent Citations (7)
| Title |
|---|
| DAVIES J. ET AL.: "A genome-wide search for human type 1 diabetes susceptibility genes", NATURE, vol. 371, 8 September 1994 (1994-09-08), pages 130 - 136, XP002076215 * |
| HILLIER L. ET AL.: "The WashU-Merck EST project, AC AA203279", EMBL DATABASE, 30 January 1997 (1997-01-30), Heidelberg, XP002076211 * |
| LUO D.: "Confirmation of three susceptibility genes to insulin-dependent diabetes mellitus: IDDM4, IDDM5, and IDDM8", HUMAN MOLECULAR GENETICS, vol. 5, no. 5, 1996, pages 693 - 698, XP002076216 * |
| RIBOZYME PHARM INC.: "AC T52084", EMBL DATABASE, 24 March 1997 (1997-03-24), Heidelberg, XP002076213 * |
| TODD J. AND FARRALL M.: "Panning for gold: genome-wide scanning for linkage in type 1 diabetes", HUMAN MOLECULAR GENETICS, vol. 5, 1996, pages 1443 - 1448, XP002076217 * |
| UNIV LEICESTER: "PCR primer WG2G4B, AC Q95283", EMBL DATABASE, 9 February 1996 (1996-02-09), Heidelberg, XP002076212 * |
| VAN DER ZEE A ET AL: "Genomic cloning of the mouse LDL receptor related protein/alpha 2-macroglobulin receptor gene.", GENOMICS, (1994 SEP 1) 23 (1) 256-9. JOURNAL CODE: GEN. ISSN: 0888-7543., XP002076214 * |
Cited By (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7285400B2 (en) | 1998-01-13 | 2007-10-23 | Genome Therapeutics Corporation | High bone mass gene of 11q13.3 |
| US6780609B1 (en) | 1998-10-23 | 2004-08-24 | Genome Therapeutics Corporation | High bone mass gene of 1.1q13.3 |
| US6770461B1 (en) | 1998-10-23 | 2004-08-03 | Genome Therapeutics Corporation | High bone mass gene of 11q13.3 |
| EP1212363A2 (en) * | 1999-08-05 | 2002-06-12 | Research Corporation Technologies, Inc | Il-16 antagonists |
| JP2003508074A (ja) * | 1999-09-03 | 2003-03-04 | サントル、ナショナール、ド、ラ、ルシェルシュ、シアンティフィク、(セーエヌエルエス) | 最も一般的な形態の常染色体性優性遺伝性痙性対麻痺に応答し得るspg遺伝子のクローニング、発現および同定 |
| JP2011254824A (ja) * | 1999-09-03 | 2011-12-22 | Centre National De La Recherche Scientifique (Cnrs) | 最も一般的な形態の常染色体性優性遺伝性痙性対麻痺に応答し得るspg遺伝子のクローニング、発現および同定 |
| EP1268775A1 (en) * | 2000-04-05 | 2003-01-02 | Genome Therapeutics Corporation | The high bone mass gene of 11q13.3 |
| EP1964921A3 (en) * | 2000-04-05 | 2008-12-03 | Oscient Pharmaceuticals Corporation | The high bone mass gene of 11q13.3 |
| JP2004515209A (ja) * | 2000-04-05 | 2004-05-27 | ゲノム セラピューティックス コーポレーション | 11q13.3の高骨量遺伝子 |
| AU2000256269B2 (en) * | 2000-04-05 | 2006-11-02 | Creighton University | The high bone mass gene of 11q13.3 |
| WO2001077327A1 (en) * | 2000-04-05 | 2001-10-18 | Genome Therapeutics Corporation | THE HIGH BONE MASS GENE OF 11q13.3 |
| JP2004523724A (ja) * | 2000-05-26 | 2004-08-05 | ゲノム セラピューティックス コーポレーション | Zmax1またはHBM遺伝子を介した脂質レベルの調節 |
| WO2001092891A3 (en) * | 2000-05-26 | 2002-07-25 | Genome Therapeutics Corp | Regulating lipid levels via the zmax1 or hbm gene |
| US7179462B2 (en) | 2000-06-02 | 2007-02-20 | University Of Connecticut Health Center | α (2) macroglobulin receptor as a heat shock protein receptor and uses thereof |
| US7186515B1 (en) | 2000-06-02 | 2007-03-06 | University Of Connecticut Health Center | Alpha(2) macroglobulin receptor as a heat shock protein receptor and uses thereof |
| US7449557B2 (en) | 2000-06-02 | 2008-11-11 | University Of Connecticut Health Center | Complexes of alpha (2) macroglobulin and antigenic molecules for immunotherapy |
| EP1313753A4 (en) * | 2000-08-18 | 2004-09-15 | Proskelia | REGULATORY GENE AND SYSTEM FOR USE IN THE DIAGNOSIS AND TREATMENT OF OSTEOPOROSIS |
| EP1434783A4 (en) * | 2001-03-16 | 2006-06-07 | Lilly Co Eli | LP-mammalian proteins; RELATED REAGENTS |
| US7416849B2 (en) | 2001-05-11 | 2008-08-26 | Oscient Pharmaceuticals Corporation | HBM variants that modulate bone mass and lipid levels |
| EP1401269A4 (en) * | 2001-05-11 | 2005-09-28 | Wyeth Corp | TRANSGENIC ANIMAL MODEL FOR MODULATING THE BONE MASS |
| US7514594B2 (en) | 2001-05-11 | 2009-04-07 | Wyeth | Transgenic animal model of bone mass modulation |
| US7700101B2 (en) | 2001-05-17 | 2010-04-20 | Wyeth | Reagents and method for modulating Dkk-mediated interactions |
| WO2002092015A3 (en) * | 2001-05-17 | 2003-10-23 | Genome Therapeutics Corp | Reagents and methods for modulating dkk-mediated interactions |
| JP2009142274A (ja) * | 2001-05-17 | 2009-07-02 | Oscient Pharmaceuticals Corp | Dkk媒介性相互作用を変調する試薬および方法 |
| JP2005512508A (ja) * | 2001-05-17 | 2005-05-12 | ゲノム セラピューティックス コーポレーション | Dkk媒介性相互作用を変調する試薬および方法 |
| US7666581B2 (en) | 2001-08-20 | 2010-02-23 | University Of Connecticut Health Center | Methods for preparing compositions comprising heat shock proteins useful for the treatment of cancer and infectious disease |
| GB2381790A (en) * | 2001-09-26 | 2003-05-14 | Glaxo Group Ltd | LDL-receptor polypeptides |
| WO2003075948A1 (fr) * | 2002-03-08 | 2003-09-18 | Anges Mg, Inc. | Nouvelle fonction de wnt et son application au traitement de maladies |
| US7169559B2 (en) * | 2002-05-13 | 2007-01-30 | Fonterra Corporate Research and Development Ltd. | LDL receptor-related proteins 1 and 2 and treatment of bone or cartilage conditions |
| US7622553B2 (en) | 2003-11-17 | 2009-11-24 | Merck & Co., Inc. | Rhesus monkey dickkopf-1, nucleotides encoding same, and uses thereof |
| US7473770B2 (en) | 2003-11-17 | 2009-01-06 | Merck & Co., Inc. | Cynomolgus monkey dickkopf-4, nucleotides encoding same, and uses thereof |
| US9290573B2 (en) | 2010-05-06 | 2016-03-22 | Novartis Ag | Therapeutic low density lipoprotein-related protein 6 (LRP6) multivalent antibodies |
| US9428583B2 (en) | 2010-05-06 | 2016-08-30 | Novartis Ag | Compositions and methods of use for therapeutic low density lipoprotein-related protein 6 (LRP6) multivalent antibodies |
| US9173960B2 (en) | 2011-11-04 | 2015-11-03 | Novartis Ag | Methods of treating cancer with low density lipoprotein-related protein 6 (LRP6)—half life extender constructs |
| USRE47860E1 (en) | 2011-11-04 | 2020-02-18 | Novartis Ag | Methods of treating cancer with low density lipoprotein-related protein 6 (LRP6)—half life extender constructs |
| WO2018220080A1 (en) | 2017-05-31 | 2018-12-06 | Boehringer Ingelheim International Gmbh | Polypeptides antagonizing wnt signaling in tumor cells |
Also Published As
| Publication number | Publication date |
|---|---|
| AU733722B2 (en) | 2001-05-24 |
| DE69837542D1 (de) | 2007-05-24 |
| ES2285767T3 (es) | 2007-11-16 |
| EP0988379B1 (en) | 2007-04-11 |
| JP4271735B2 (ja) | 2009-06-03 |
| JP2002501376A (ja) | 2002-01-15 |
| AU7061498A (en) | 1998-11-11 |
| US6545137B1 (en) | 2003-04-08 |
| ATE359367T1 (de) | 2007-05-15 |
| EP0988379A1 (en) | 2000-03-29 |
| CA2286313A1 (en) | 1998-10-22 |
| DE69837542T2 (de) | 2008-01-31 |
| CA2286313C (en) | 2011-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU733722B2 (en) | Novel LDL-receptor | |
| AU707636B2 (en) | Materials and methods relating to the identification and sequencing of the BRCA2 cancer susceptibility gene and uses thereof | |
| US6537775B1 (en) | Gene involved in cadasil, method of diagnosis and therapeutic application | |
| WO2001066129A1 (en) | Substances for the treatment of spinal muscular atrophy | |
| JP2001521041A (ja) | 良性の家族性新生児痙攣(bfnc)および他の癲癇において突然変異されたkcnq2およびkcnq3−カリウムチャンネル遺伝子 | |
| US7244577B2 (en) | Method of screening for modulator of LRP5 activity | |
| US6225451B1 (en) | Chromosome 11-linked coronary heart disease susceptibility gene CHD1 | |
| JP2003530814A (ja) | 不整脈に関連するヒトmink遺伝子突然変異 | |
| JP2010047588A (ja) | 新規膜貫通蛋白質をコードする遺伝子 | |
| EP1124572B1 (en) | Genes and proteins predictive and therapeutic for renal disease and associated disorders | |
| EP0870041B1 (en) | KVLQT1 - A LONG QT SYNDROME GENE WHICH ENCODES KVLQT1 WHICH COASSEMBLES WITH minK TO FORM CARDIAC Iks POTASSIUM CHANNELS | |
| US6555654B1 (en) | LDL-receptor | |
| EP0815197B1 (en) | Long qt genes and method for diagnosing or preventing the occurrence of long qt syndrome | |
| US6362326B1 (en) | 11 cby genomic sequence | |
| WO1997008308A9 (en) | Batten disease gene | |
| GB2307477A (en) | Materials and methods relating to the identification and sequencing of the BRCA2 cancer susceptibility gene and uses thereof | |
| CA2325663A1 (en) | Novel mutations in the freac3 gene for diagnosis and prognosis of glaucoma and anterior segment dysgenesis | |
| AU2476301A (en) | DB the receptor for leptin nucleic acids encoding the receptor, and uses thereof | |
| CA2312697A1 (en) | Cadherin-like polypeptides, methods and compositions related thereto | |
| WO2000005361A1 (en) | Human sbpsapl gene with homology to the prosaposin family of neurotrophic factors | |
| EP1222264A1 (en) | Human sit4 associated proteins like (sapl) proteins and encoding genes; uses thereof | |
| WO2001079467A2 (en) | Identification of a renal nadph oxidase | |
| JPH10117791A (ja) | ヒトgタンパク質結合受容体hlyaz61 | |
| MXPA00010172A (en) | Novel mutations in the freac3 | |
| JP2002262893A (ja) | Sbhunc50ポリペプチドおよびsbhunc50ポリヌクレオチド |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2286313 Country of ref document: CA Ref country code: CA Ref document number: 2286313 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 543635 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 70614/98 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1998917374 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09402923 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 1998917374 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 70614/98 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1998917374 Country of ref document: EP |