WO1998021320A9 - VARIANTES D'ACTIVATEUR PLASMINOGENE DE TYPE TISSULAIRE (t-PA): COMPOSITIONS ET TECHNIQUES D'UTILISATION - Google Patents

VARIANTES D'ACTIVATEUR PLASMINOGENE DE TYPE TISSULAIRE (t-PA): COMPOSITIONS ET TECHNIQUES D'UTILISATION

Info

Publication number
WO1998021320A9
WO1998021320A9 PCT/US1997/020226 US9720226W WO9821320A9 WO 1998021320 A9 WO1998021320 A9 WO 1998021320A9 US 9720226 W US9720226 W US 9720226W WO 9821320 A9 WO9821320 A9 WO 9821320A9
Authority
WO
WIPO (PCT)
Prior art keywords
protein
single chain
ser
fibrin
factor
Prior art date
Application number
PCT/US1997/020226
Other languages
English (en)
Other versions
WO1998021320A2 (fr
WO1998021320A3 (fr
Filing date
Publication date
Application filed filed Critical
Priority to CA002271697A priority Critical patent/CA2271697C/fr
Priority to EP97952176A priority patent/EP0950095A2/fr
Priority to JP52266198A priority patent/JP2001505765A/ja
Priority to US09/600,985 priority patent/US6706504B1/en
Priority to AU55850/98A priority patent/AU735519B2/en
Publication of WO1998021320A2 publication Critical patent/WO1998021320A2/fr
Publication of WO1998021320A3 publication Critical patent/WO1998021320A3/fr
Publication of WO1998021320A9 publication Critical patent/WO1998021320A9/fr

Links

Definitions

  • the invention comprises protein single chain variants of tissue type plasminogen activator, also referred to as t-PA as well as nucleic acids encoding such protein single chain variants of tissue type plasminogen activator.
  • the t-PA protein variants have higher zymogenicity than the wild-type single chain t-PA form.
  • PA variant compositions are also described.
  • Tissue-type plasminogen activator is a serine protease that plays a critical role in the process of fibrinolysis, the dissolution of clots, by activating plasminogen to the protease plasmin.
  • t-PA has been fully identified and characterized by underlying DNA sequence and deduced arnino acid sequence. See Pennica et al., Nature, 301: 214 (1983) and U.S. Pat. No. 4,853,330, issued Aug. 1, 1989, the teachings of both of which are incorporated by reference.
  • Fig. 1A The nucleotide sequence and deduced primary arnino acid sequence of human t-PA is depicted in Fig. 1A, Fig. IB and Fig. lC.
  • the group of arnino acid residues from -35 to -1 preceding the sequence of the mature t-PA is the "pro" sequence.
  • the mature t-PA molecule (arnino acid residues 1-527) contains five domains that have been defined with reference to homologous or otherwise similar structures identified in various other proteins such as trypsin, chymotrypsin, plasminogen, prothrombin, fibronectin, and epidermal growth factor (EGF).
  • ⁇ domains have been designated, starting at the N-terminus of the arnino acid sequence of mature t-PA, as 1) the finger region (F) that has variously been defined as including arnino acid residues 1 to about 44, 2) the growth factor region (G) that has been variously defined as stretching from about arnino acid residues 45 to 91 (based upon its homo logy with EGF), 3) kringle one (Kl) that has been defined as stretching from about arnino acid residue 92 to about arnino acid residue
  • kringle two that has been defined as stretching from about arnino acid residue 180 to about arnino acid residue 261, and 5) the so-called serine protease domain (P) that generally has been defined as stretching from about arnino acid residue 264 to the C-terminal end of the molecule at arnino acid residue 527.
  • K2 kringle two
  • P serine protease domain
  • the finger domain has been characterized as containing a sequence of at least major importance for high binding affinity to fibrin. (This activity is thought important for the high specificity that t-PA displays with respect to clot lysis at the locus of a fibrin-rich thrombus.)
  • the growth factor-like region likewise has been associated with cell surface binding activity.
  • the kringle 2 region also has been strongly associated with fibrin binding and with the ability of fibrin to stimulate the activity of t-PA.
  • the serine protease domain is responsible for the enzymatic cleavage of plasminogen to produce plasmin.
  • t-PA is unusual among proteases in the level of the enzymatic activity of its precursor.
  • proteases are synthesized as zymogens, inactive precursors that must either be proteolytically processed or bind to a specific co-factor to develop substantial catalytic activity.
  • the increase in catalytic efficiency after zymogen activation, or zymogenicity, is dramatic in almost all cases, although varying widely among individual members of the chymotrypsin family.
  • strong zymogens i.e., those having high zymogenicity, such as trypsinogen, chymotrypsinogen, or plasminogen are almost completely inactive, with measured zymogenicities of 10 4 to 10 6 (Robinson, N. C, Neurath, H., and Walsh, K. A.
  • the zymogenicity expressed as the ratio of the activity of the mature cleaved two-chain enzyme to that of the single chain precursor form, is only 5-10 for wild-type t-PA, in contrast to other precursors of other proteases that have little or no catalytic activity.
  • the single chain form of wild-type t-PA is not a true zymogen.
  • variants are described in EPO Pat. Publ. No. 199,574 that have arnino acid substitutions at the proteolytic cleavage sites at positions 275, 276, and 277.
  • These variants characterized preferentially as t-PA variants having an arnino acid other than arginine at position 275, are referred to as protease-resistant one-chain t-PA variants in that, unlike natural t-PA, which can exist in either a one-chain or two-chain form, they are resistant to protease cleavage at position 275 and are therefore not converted metabolically in vivo into a two- chain form.
  • plasminogen activators comprise one domain capable of interacting with fibrin and the protease domain of urokinase, with one embodiment being urokinase altered to make it less susceptible to forming two-chain urokinase. See WO 88/05081 published Jul. 14, 1988.
  • Glycosylation mutants at positions 117-119, 184-186, and 448—450 exhibited higher specific activity as the mole percent carbohydrate was reduced. See EPO Pub. No. 227,462 published Jul. 1, 1987. This patent application additionally discloses using an assay of fibrin/fibrin degradation products and teaches that one may also modify the t-PA molecule at positions 272-280 or delete up to 25 amino acids from the C-terminus.
  • t-PA mutants with Asn 119, Ala 186 and Asn 450 which have the N-glycosylation sites selectively removed by DNA modification but contain residual O-linked carbohydrate, were found to be about two-fold as potent as melanoma t-PA in an in vitro lysis assay. See EPO Publ. No. 225,286 published Jun. 10, 1987.
  • t-PA can be modified both in the region of the first kringle domain and in the growth factor domain, resulting in increased circulatory half-life.
  • t-PA can be deleted from t-PA to result in a variant having slower clearance from plasma. Browne et al., J. Biol. Chem., 263: 1599-1602 (1988). Also, t-PA can be modified, without adverse biological effects, in the region of amino acids 67 to 69 of the mature, native t-PA, by deletion of certain amino acid residues or replacement of one or more amino acids with different amino acids. See EPO Pat. Publ. No. 240,334 published Oct. 7,
  • the present invention provides single chain variant t-PA proteins having at least two substitutions of basic amino acid residues by neutral or acidic amino acid residues, compared to the wild-type human t-PA, as well as polynucleotides encoding such single chain variant t- PA proteins.
  • the single chain variant t-PA proteins of the present invention have the R275 amino acid residue substituted by an amino acid residue chosen from the group consisting of glycine, seririe, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid.
  • the single chain variant t-PA proteins of the present invention have the R275 amino acid residue substituted by an amino acid residue chosen from the group consisting of an aspartic acid residue and a glutamic acid residue, and most preferably by a glutamic acid residue.
  • the single chain variant t-PA proteins of the present invention have additionally at least one other basic amino acid residue in the serine protease region residue substituted by a non-basic amino acid such that the salt bridge interaction normally found in wildtype single chain t-PA between aspartate 477 and lysine 429 is disrupted.
  • basic amino acids are replaced with polar or acidic amino acids, and more preferably, amino acid residues chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid and glutamic acid.
  • the salt bridge interaction between aspartate 477 and lysine 429 can be disrupted by a substitution at position 477 or 429, or by an appropriate substitution at a position within the serine protease region that provides an alternative salt bridge interaction partner for at least one of aspartate 477 and lysine 429.
  • the H417 amino acid residue is substituted by an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid.
  • the single chain variant t-PA proteins of the present invention have both the R275 amino acid residue and the H417 amino acid residue substituted by an amino acid residue chosen from the group consisting of an aspartic acid residue and a glutamic acid residue.
  • Two exemplary preferred single chain variant t-PA proteins are the t-PA variants designated as R275E,H417E and R275E,H417D.
  • the K429 amino acid residue is substituted by an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid.
  • the single chain variant t-PA proteins of the present invention have both the R275 amino acid residue and the K429 amino acid residue substituted by an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid.
  • One preferred single chain variant t-PA protein is the t-PA variant designated as R275E,K429Y.
  • the single chain variant t-PA proteins of the present invention exhibit greater zymogenicity, expressed as the ratio of the activity of the mature cleaved two-chain enzyme to that of the single chain precursor form, than that of the wild type single chain t-PA protein.
  • the single chain variant t-PA proteins of the present invention have zymogenicity of at least 10, preferably about 50 to about 200.
  • the single chain variant t-PA proteins of the present invention exhibit a greater fibrin stimulation factor, expressed as the ratio of the catalytic efficiencies in the presence and absence of fibrin, compared to the wild type single chain t-PA protein.
  • the single chain variant t-PA proteins of the present invention have a fibrin stimulation factor of at least 7,000, preferably about 20,000 to about 50,000.
  • the single chain variant t-PA proteins of the present invention exhibit a reduced inhibition by plasminogen activator inhibitor 1 (PAI-1) to the wild type single chain t-PA protein.
  • PAI-1 plasminogen activator inhibitor 1
  • the single chain variant t-PA proteins of the present invention are at least a factor of
  • the single chain variant t-PA proteins of the present invention exhibit a greater fibrin selectivity factor, expressed as the ratio of the catalytic efficiencies in the presence fibrin to that in the presence of fibrinogen, compared to the wild type single chain t-PA protein.
  • Preferred embodiments of the single chain variant t-PA proteins of the present invention have a fibrin selectivity factor of at least 10, preferably at least 50, more preferably at least 100.
  • Figs. 1A, IB and 1C show the nucleotide sequence and deduced amino acid sequence of the full-length human t-PA cDNA
  • Fig. 2 is a graphical representation of the results of standard chromogenic assays of plasminogen activation in the presence of buffer (open squares), DESAFLB (open diamonds), fibrinogen (open circles), cyanogen bromide fragments of fibrinogen (open triangles) or the stimulatory peptide P368 (hatched squares).
  • wild-type t-PA refers to the t-PA protein naturally occurring in humans. While this human t-PA is exemplified by the amino acid sequence depicted in Figs.
  • t-PA Variant Compositions 1A, IB and 1C, the term wild-type t-PA should be understood to encompass naturally occurring allelic variations.
  • the t-PA variant cDNAs and the corresponding expressed recombinant proteins of this invention are useful compounds that function in the serine protease-mediated control of fibrinolysis as described herein.
  • the t-PA variant cDNAs of the present invention contain at least one nucleotide substitution to generate a t-PA cDNA that encodes a noncleavable single chain t-PA variant, i.e., not cleavable by plasmin under normal conditions.
  • the nucleotide substitution results in a substitution of a glutamic acid (E) for an arginine (R) at amino acid residue 275 (or position 15 using the chymotrypsin numbering system) in the t-PA precursor that is responsible for creating a noncleavable variant.
  • Positions 15, 144, 156, and 194 of the chymotrypsin numbering system correspond to positions 275, 417, 429, and 477, respectively, in the t-PA numbering system as depicted in Fig. 1.
  • the variants which are substitution mutants, are designated by the single letter code of the wild type human t-PA amino acid residue, the position of the residue relative to the amino terminus of the mature human t-PA as depicted in Fig. 1, followed by the single letter code of the amino acid residue substituted for the amino acid residue in mature human t-PA.
  • the substitution of glutamic acid for arginine at position 275 is designated as R275E.
  • Equivalent substitutions generating noncleavable single chain t-PA are known in the art (Higgins, D.L., et al., (1990) Thrombosis Res. 57: 527-539).
  • the variant cDNAs of the present invention further comprise at least one other nucleotide substitution at a separate site to create a t-PA variant having at least two amino acid substitutions.
  • Preferred cDNA variants include at least one nucleotide substitution that results in an amino acid substitution of an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid for a histidine at amino acid residue position 417.
  • Preferred embodiments are designated R275E,H417D and R275E,H417E.
  • a further cDNA variant comprises at least one nucleotide substitution resulting in the substitution of an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid for the lysine (K) at amino acid residue position 429.
  • an amino acid residue chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid, and glutamic acid for the lysine (K) at amino acid residue position 429.
  • One such preferred embodiment is designated R275E,K429Y.
  • the variant t-PA cDNAs of the present invention are useful for generating the recombinant expressed variant t-PAs described above.
  • the variant t- PA cDNAs have therapeutic uses in gene therapy as described below.
  • the invention includes embodiments such as expression vectors or plasmids in which the cDNAs for encoding variant t-PAs are operably linked to provide for the expression of recombinant variant t-PAs for use in the methods as described below.
  • One preferred embodiment is the expression of a variant t-PA protein by COS 1 cells comprising pSVT7 expression vector operably linked to a polynucleotide encoding the variant protein.
  • Constitutive and inducible expression vectors are disclosed.
  • transiently and stably transfected cells contain cDNA encoding variant t-PAs.
  • the resultant recombinant expressed t-PA variants described herein are characterized as having one or more of the following structural and functional properties: 1)
  • the t-PA variant is in the form of a noncleavable single chain protein containing an R275E amino acid substitution or equivalents thereof that prevent cleavage by t-PA activating enzymes; 2)
  • the t- PA variant exhibits increased resistance to inhibition by the serpin plasminogen activator inhibitor, type I (PAI-1); 3)
  • the t-PA variants has diminished catalytic activity on substrates, such as plasminogen, in the absence of co-factors, such as fibrin; 4)
  • the t-PA variants exhibit enhanced stimulation by fibrin; 5)
  • the t-PA variants exhibit comparable catalytic activity to substrates, such as plasminogen, in the presence of co-factors, such as fibrin; and 6)
  • the t-PA variants thus are effective at local fibrinolysis function without extensive systemic proteolysis thereby
  • Preferred recombinant expressed t-PA variants thus include R275E,H417D, R275E,H417E and R275E,K429Y, and conservative substitutions thereof.
  • conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another, the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of one basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another.
  • “conservative substitution” also includes the use of a chemically derivatized residue in place of a non-derivatized residue provided that such protein displays the requisite binding activity.
  • “Chemical derivative” refers to a subject protein having one or more residues chemically derivatized by reaction of a functional side group.
  • Such derivatized molecules include for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t- butyloxycarbonyl groups, chloroacetyl groups or formyl groups.
  • Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine. Also included as chemical derivatives are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids.
  • 4-hydroxyproline may be substituted for proline; 5 -hydroxy lysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine.
  • D-amino acids may also be included in place of one or more L-amino acids.
  • basic amino acids i.e., arginine, lysine and histidine are replaced with non-basic amino acids.
  • basic amino acids are replaced with polar or acidic amino acids, i.e. amino acid residues chosen from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid and glutamic acid.
  • non-basic amino acids replacing particular basic amino acids in mature wild type human t-PA may be chosen from the group of non-basic amino acids generally, preferably from the group consisting of glycine, serine, threonine, asparagine, tyrosine, glutamine, aspartic acid and glutamic acid, and more preferably from the group consisting of tyrosine, aspartic acid and glutamic acid,
  • the use of aspartic acid instead of glutamic acid to replace an histidine residue is a conservative substitution.
  • Preferred variants are R275E,H417D and R275E,H417E, described in Example 1 and the R275E,K429Y variant, described in " Example 2.
  • the expressed recombinant t-PA variants having at least two amino acid substitutions e.g., R275E,H417D, R275E,H417E and R275E,K429Y, further exhibit unique properties.
  • R275E and R275E,H417E are activated by both fibrinogen and fibrin while R275E,K429Y is activated primarily by fibrin and is not sensitive to fibrinogen. The latter is also more resistant than the R275E,H417D and R275E,H417E variants to inhibition by PAI-1.
  • t-PA variant cDNA and recombinant expressed variant proteins described above are useful in a number of methodological aspects as described in Examples 1 and 2.
  • the isolated cDNA clones are useful in an expression vector system to produce encoded t-PA variant proteins of this invention.
  • PA variant cDNA operably linked therein, including cells containing the expression vectors, are contemplated for generating the recombinant expressed variant proteins of this invention.
  • the recombinant expressed t-PA variants of the present invention are useful in diagnostic assays to detect fibrin and fibrin degradation products that have altered activities. The assays are thus indicated in thrombotic conditions.
  • Other diagnostic applications, incuding kits comprising antibodies against the t-PA variants are familiar to one of ordinary skill in the art.
  • the t-PA variant cDNAs of the present invention are useful in genetic therapeutic applications for use in ameliorating thrombotic disorders including both acute and chronic conditions.
  • Acute conditions include among others both heart attack and stroke while chronic situations include those of arterial and deep vein thrombosis and restenosis.
  • Preferred therapeutic compositions thus include the cDNA compounds themselves as naked DNA, presented as part of a viral vector delivery system or other vector-based gene expression delivery system, presented in a liposome delivery system and the like.
  • the recombinant expressed t-PA variant proteins of the present invention are contemplated as thrombolytic therapeutic agents for ameliorating the same conditions outlined above.
  • the selection of the particular t-PA variant is determined by the desired therapeutic outcome. For example, the fibrinogen-mediated activation of endogenous human t-PA is activated by bleeding which then results in a widespread undesired systemic response.
  • the t-PA variant namely R275E,K429Y, that is primarily activated by fibrin and not fibrinogen.
  • a composition for use as thrombolytic therapeutic agents generally a physiologically effective amount of the t-PA variant protein in a pharmaceutically suitable excipient.
  • the thrombolytic therapeutic agents are administered in single or multiple doses. If "bolus" doses are administered, doses of about 0.01 to about 0.6 mg/kg will typically be administered, preferably doses of about 0.05 to about 0.2 mg/kg, with subsequent administrations of about
  • t-PA blood level of about 3 microgram/ml.
  • dosage depend on the condition to be treated.
  • a composition of variant t-PA in a gel composition is useful in preventing the formation of adhesions.
  • Oligonucleotide directed site specific mutagenesis was performed by the method of Zoller and Smith (Zoller, M. I., and Smith, M. (1984) DNA 3, 479-488) as modified by
  • H417D 5' - CTACGGCAAGGACGAGGCCTTGT - 3' (SEQ ID NO: 8)
  • H417E 5' - CTACGGCAAGGAGGAGGCCTTGT - 3' (SEQ ID NO: 9)
  • ssDNA corresponding to the entire 290 bp Sad - Smal fragment was fully sequenced to assure the presence of the desired mutation and the absence of any additional mutations.
  • the sequence corresponding to the 290 bp Sacl - Smal fragment of the H417D mutation is shown in SEQ ID NO: 5; the corresponding sequence of the H417E mutation is shown in SEQ ID NO: 6.
  • Replicative form (RF) DNA was prepared for appropriate phage, and the mutated 290 bp Sacl - Sm ⁇ l fragments were recovered after digestion of RF DNA with S ⁇ cl and Smal and electrophoresis of the digestion products on an agarose gel.
  • the isolated, mutated S ⁇ cl - Smal fragments were used to replace the corresponding fragment in full length cDNAs encoding wild type human t-PA or t-PA/R275E to yield new, full length cDNAs encoding t-PA/H417D; t-PA/H417E; t-PA/R275E,H417D (SEQ ID NO: 1); and t-PA/R275E,H417E (SEQ ID NO: 2).
  • the direct chromogenic assay utilized the substrate methylsulfonyl-D-cyclohexyltyrosyl- glycyl-arginine-p-nitroaniline (Spectrozyme t-PA, American Diagnostica) and was performed as previously described (Strandberg, L., and Madison, E. L. (1995) J. Biol. Chem. 270, 23444- 23449; Smith, J. W., Tachias, K., and Madison, E. L. (1995) J. Biol. Chem. 270, 30486-
  • Second order rate constants for the inhibition of wild type human t-PA and variant t- PA were measured under pseudo-first order conditions as previously described. Briefly, enzyme and inhibitor were preincubated at 23 degrees Celsius for periods of time varying from 0 - 30 minutes. Following preincubation, the mixtures were diluted, and the residual enzymatic activity was measured in a standard indirect chromogenic assay. For each enzyme, the concentrations of enzyme and inhibitor and the times of preincubation were chosen to yield several data points for which the residual enzymatic activity varied between 20% and 80% of the initial activity. Data were analyzed by plotting the natural logarithm of the ratio (residual activity/initial activity) versus time of preincubation and measuring the resulting slopes. Division of this slope by -[I] yielded the second order rate constants shown.
  • histidine 417 of t-PA was replaced by either an aspartate or glutamate residue to yield two variants: t-PA/H417D and t- PA/H417E.
  • Accurate measurement of the enzymatic activity toward plasminogen of the single chain form of these two variants proved difficult, however, because the plasmin produced in this assay rapidly converted the single chain enzymes into their mature, two-chain form by cleaving the R275-I276 peptide bond. Consequently, to overcome this technical difficulty, we also constructed noncleavable forms of the two mutated enzymes by introducing the additional mutation R275E into the existing mutants.
  • Wild type human t-PA, t-PA/R275E, and all four variants containing mutations at position 417 were expressed by transient expression of COS-1 cells. Since this procedure yielded predominantly single chain enzymes, two-chain t-PAs were generated by treating the enzyme preparations with plasmin-Sepharose (Strandberg, L., and Madison, E. L. (1995) J. Biol. Chem. 270, 23444-23449). Quantitative conversion of the enzymes into their mature, two-chain form was confirmed by SDS-PAGE. As expected, variants containing the mutation R275E were synthesized and secreted exclusively as single chain enzymes and were not cleaved by plasmin-Sepharose.
  • fibrin stimulation of two-chain t-PA may occur through a single mechanism; stimulation of single chain t-PA by fibrin co-factors, however, appears to utilize at least two distinct mechanisms.
  • fibrin apparently stimulates both single- and two-chain t-PA through a templating mechanism resulting in formation of a ternary complex which greatly augments the local concentration of enzyme and substrate.
  • H417D and H417E mutations were a selective reduction of the activity of single chain t-PA in the absence of fibrin and, consequently, an increase in the zymogenicity of the enzyme.
  • this effect could be mediated either by stabilizing a less active, new conformation of single chain t-PA or by shifting the equilibrium between one or more existing conformations, with distinct activities, towards the less active conformation.
  • Wild type, two-chain t-PA possesses a fibrin stimulation factor, defined as the ratio of the catalytic efficiencies in the presence and absence of fibrin, of approximately 460 (Table IV above).
  • the two-chain variants display similar stimulation factors of 290 (t-PA/H417D) and 410 (t-PA/H417E).
  • Single chain wild type t-PA, with a fibrin stimulation factor of 6300, is stimulated to a substantially greater degree than the two-chain enzymes, presumable reflecting the ability of fibrin to stimulate the single chain enzymes not only through a templating mechanism but also by inducing nonproteolytic zymogen activation. Stimulation of single chain t-PA is further enhanced by the H417D or H417E mutations.
  • fibrin stimulation factors for single chain t-PA/R275E,H417D and t-PA/H417E are 48,200 and 25,400, respectively (Table IV above).
  • Enhanced fibrin stimulation of the variants did not result from increased activity in the presence of fibrin but rather from decreased activity in the absence of a stimulator, an observation consistent with the belief that the effects of these mutations are mediated by disruption of a salt bridge between Lys 429 and Asp 477 in single chain t-PA.
  • the single chain form of a zymogen-like variant of t-PA is expected to exhibit reduced activity not only towards substrates (Tables I and III, above) but also towards specific inhibitors.
  • PAI-1 serpin plasminogen activator inhibitor
  • both variants containing mutations at position 417 exhibited resistance to inhibition by PAI-1.
  • the second order rate constant for inhibition by PAI-1 of t-PA/R275E,H417D or t-PA/R275E,H417E was reduced by factors of approximately 12 or 9, respectively, compared with t-PA/R275E.
  • t-PA exhibits unusually high catalytic activity as a single chain enzyme and consequently very low zymogenicity.
  • a closely related enzyme urokinase urokinase (u-PA) exhibits much lower catalytic activity as a single chain enzyme and substantially higher zymogenicity.
  • u-PA urokinase
  • An important finding of this study is that the presence or absence of a favorable electrostatic interaction between residues at positions 417 and 429 appears to be the major determinant of this key functional distinction between the two human plasminogen activators.
  • the zymogenicity of wild type t-PA, u-PA, and t-PA containing an aspartate at position 417 are approximately 9, 250, and 150, respectively.
  • t-PA/R275E,H417D exhibits substantially enhanced fibrin stimulation, resistance to inhibition by PAI-1, and significantly increased zymogenicity, a useful combination of properties that enhances the therapeutic utility of the enzyme.
  • Example 2 Site Directed Mutagenesis And Construction Of Expression Vectors Encoding Variants Of T-PA.
  • Oligonucleotide directed site specific mutagenesis was performed as described in
  • Example 1 The K429Y mutation was introduced into the 290 bp Sad - Smal fragment of cDNA encoding t-PA that had been previously subcloned into bacteriophage M13mpl8.
  • the mutagenic primer had the following nucleotide sequence:
  • the isolated, mutated Sad - Smal fragment was used to replace the corresponding fragment in full length cDNAs encoding wild type t-PA or t-PA/R275E to yield new, full length cDNAs encoding t-PA/K429Y and t-PA/R275E,K429Y.
  • cDNAs encoding t-PA, t-PA/R275E, t-PA/K429Y, and t-PA/R275E,K429Y were ligated into the transient expression vector pSVT7 and then introduced into COS cells by electroporation using a Bio Rad Gene pulser as described in Example 1. Following electroporation, cells were incubated overnight at 37 degrees Celsius in DMEM containing 10%) fetal calf serum and 5mM sodium butyrate. Cells were then washed with serum free medium and incubated in DMEM for 48 hours at 37 degrees Celsius. After the incubation with serum free media, conditioned media were collected and enzyme concentrations were determined by ELISA.
  • Wild type and mutated variants of t-PA were purified using an FPLC system and a 1 ml HiTrap chelating column (Pharmacia Biotech). The column was charged with 0.1 M CuSO 4 solution, washed with 5 - 10 ml distilled water, and equilibrated with start buffer (0.02 M NaHPO 4 , pH 7.2, 1 M NaCl and 1 mM Imidizole). Conditioned medium containing wild type or variants of t-PA was adjusted to 1 M NaCl and injected into the column with a 50 ml superloop (Pharmacia Biotech).
  • the direct chromogenic assay utilized the substrate methylsulfonyl-D- cyclohexyltyrosyl-glycyl-arginine-p-nitroaniline (Spectrozyme t-PA, American Diagnostica) and was performed as described in Example 1.
  • Indirect chromogenic assays of t-PA utilized the substrates lys-plasminogen (American Diagnostica) and Spectrozyme PL (American Diagnostica) and were performed as previously described in Example 1. Assays were performed both in the presence and absence of the co- factor DESAFIB (American Diagnostica).
  • Standard indirect chromogenic assays were performed. Briefly, 0.25 - lng of enzyme, 0.2 ⁇ M lys-plasminogen and 0.62 mM Spectrozyme PL were present in a total volume of 100 ⁇ l. Assays were performed either in the presence of buffer, 25 ⁇ g/ml DESAFIB, 100 ⁇ g/ml fibrinogen, 100 ⁇ g/ml cyanogen bromide fragments of fibrinogen (American Diagnostica), or
  • P368 100 ⁇ g/ml of the stimulatory, thirteen amino acid peptide P368.
  • P368 was kindly provided by Marshall Runge (University of Texas Medical Center, Galveston, TX.). Assays were performed in microtiter plates, and the optical density at 405 ran was measured every 30 seconds for one hour in a Molecular Devices Thermomax. Reactions were performed at 37 degrees Celsius. Measurement of second order rate constants for inhibition by PAI-1.
  • Second order rate constants for the inhibition of wild type and mutated t-PA were measured under pseudo-first order conditions as described in Example 1. Oligonucleotide directed site specific mutagenesis was used to produce a mutation of
  • Lys 429 of t-PA that selectively suppressed the catalytic activity of single chain t-PA.
  • Lysine 429 was replaced by a tyrosine residue to yield t-PA/K429Y.
  • a noncleavable form of the mutated enzyme was constructed by introducing the additional mutation R275E into the existing mutant to yield the R275E,K429Y variant.
  • Wild type t-PA, t-PA/R275E, t-PA/K429Y, and t-PA/R275E,K429Y were expressed by transient expression in COS 1 cells as described in Example 1. Since this procedure yielded predominantly single chain enzymes, two-chain t-PAs were generated by treating the enzyme preparations with plasmin-Sepharose. Quantitative conversion of the enzymes into their mature, two-chain form was confirmed by SDS-PAGE. As previously demonstrated, variants containing the mutation R275E were synthesized and secreted exclusively as single chain enzymes and were not cleaved by plasmin-Sepharose.
  • the zymogenicity defined as the ratio of the activities of the two-chain to that of the single chain form of a particular enzyme, was approximately 2.5 for wild type t-PA.
  • this ratio increased to approximately 117 (Table VI).
  • the K429Y mutation had little effect on the activity of two-chain t-PA toward plasminogen; however, this mutation significantly reduced the catalytic efficiency of single chain t-PA (Table VII below).
  • the activity of single chain t-PA/R275E,K429Y was reduced by a factor of 17.
  • the activities of two-chain t-PA and t-PA/K429Y differed by a factor of only 1.2.
  • the extent of fibrin stimulation displayed by the single chain form of t- PA/R275E,K429Y is significantly greater than that displayed by wild type t-PA.
  • Wild type, two-chain t-PA possesses a fibrin stimulation factor, defined as the ratio of the catalytic efficiencies in the presence and absence of fibrin, of approximately 250 (Table IX below).
  • the two-chain t-PA/K429Y variant displays a similar stimulation factor of 230.
  • Single chain wild type t-PA, with a fibrin stimulation factor of 3800 is stimulated to a substantially greater degree than the two-chain enzymes, presumable reflecting the ability of fibrin to stimulate the single chain enzymes not only through a templating mechanism but also by inducing nonproteolytic zymogen activation.
  • Stimulation of single chain t-Pa is further enhanced by the K429Y mutation.
  • the fibrin stimulation factor for single chain t-PA/R275E,K429Y is approximately 26,000.
  • Enhanced fibrin stimulation of the variant did not result from increased activity in the presence of fibrin but rather from decreased activity in the absence of a stimulator, an observation consistent with our proposal that the effects of these mutations are mediated by disruption of a salt bridge between Lys 429 and Asp 477 in single chain t-PA.
  • the mutated enzyme t-PA/R275E,K429Y is not only stimulated to a significantly greater extent by soluble fibrin than t-PA (Table IX above), but it is also substantially more discriminating among fibrin co-factors than the wild type enzyme (Fig. 2).
  • the two-chain form of both wild type t-PA and t-PA/K429Y are strongly stimulated by soluble fibrin monomers (DESAFIB), fibrinogen, CNBr fragments of fibrinogen, and a 13 amino acid peptide (P368).
  • Single chain t-PA/R275E is stimulated strongly by soluble fibrin and fibrinogen and moderately by the CNBr fragments and peptide P368.
  • single chain t-PA/R275E,K429Y although dramatically stimulated by fibrin monomers, is virtually nonresponsive to fibrinogen, CNBr fragments of fibrinogen, peptide P368.
  • fibrin selectivity factor The ratio of the specific activity of a plasminogen activator in the presence of fibrin to that in the presence of fibrinogen, or "fibrin selectivity factor", is one indication of the "clot selectivity" an enzyme will demonstrate in vivo. An enzyme with enhanced fibrin selectivity can accomplish efficient thrombolysis while displaying decreased systemic activity. Under the conditions of the assays reported here, the fibrin selectivity is 1.5 for two-chain t-PA, 1.5 for two-chain t-PA/K429Y, and 1.0 for single chain t-PA/R275E. The fibrin selectivity factor for single chain t-PA/R275E,K429Y, however, is 146. This double mutant, therefore, is approximately two orders of magnitude more discriminating between fibrin and fibrinogen than either single or two-chain wild type t-PA.
  • the " single chain form of a zymogen-like variant of t-PA is expected to exhibit reduced activity not only towards substrates (Tables VI and VIII above) but also towards specific inhibitors.
  • the second order rate constant for inhibition of the single chain form of both t- PA/R275E and t-PA/R275E,K429Y by the serpin plasminogen activator inhibitor, type 1 (PAI-1), the primary physiological inhibitor of t-PA is shown in Table X below.
  • PAI-1 serpin plasminogen activator inhibitor
  • Table X As expected, t-PA/R275E,K429Y exhibited resistance to inhibition by PAI-1.
  • the second order compared with t-PA/R275E.
  • PA R275E,K429Y is significantly more fibrin stimulated and substantially more fibrin selective than either single or two-chain, wild type t-PA.
  • Single chain t-PA/R275E,K429Y also exhibits marked resistance to inhibition by PAI-1. It is believed that the effects of this mutation are mediated by disruption of a critical salt bridge formed by Lys 429 and Asp 477 that has been predicted to be present in single- but not two-chain t-PA. The primary role of this putative salt bridge is believed to be stabilization of the active conformation of single chain t-PA.
  • Two-chain t-PA/K429Y, therefor, as demonstrated in this study, is expected to maintain high enzymatic activity.
  • Example t- PA/R275E,K429Y exhibits significantly enhanced fibrin stimulation, dramatically increased discrimination among fibrin co-factors, marked resistance to inhibition by PAI-1, and substantially increased zymogenicity, a combination of properties that enhance the therapeutic utility of the enzyme.
  • TITLE OF INVENTION TISSUE TYPE PLASMINOGEN ACTIVATOR (t-PA) VARIANTS HAVING ZYMOGEN CHARACTERISTICS: COMPOSITIONS AND METHODS OF USE
  • ORGANISM Homo sapiens
  • xi SEQUENCE DESCRIPTION: SEQ ID NO : 1 :
  • Glu Val Glu Lys Tyr lie Val His Lys Glu Phe Asp Asp Asp Thr Tyr 355 360 365 Asp Asn Asp lie Ala Leu Leu Gin Leu Lys Ser Asp Ser Ser Arg Cys
  • Asp Asn Asp lie Ala Leu Leu Gin Leu Lys Ser Asp Ser Ser Arg Cys 370 375 380 Ala Gin Glu Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Ala Asp
  • Glu Val Glu Lys Tyr lie Val His Lys Glu Phe Asp Asp Asp Thr Tyr 355 360 365 Asp Asn Asp lie Ala Leu Leu Gin Leu Lys Ser Asp Ser Ser Arg Cys 370 375 380
  • MOLECULE TYPE CDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG 290
  • CAGACTGTAC CCATCCAGCC GCTGCACATC ACAACATTTA CTTAACAGAA CAGTCACCGA 120
  • GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG 290
  • GGGCATCATC AGCTGGGGCC TGGGCTGTGG ACAGAAGGAT GTCCCGGGTG 290
  • CAGACTGTAC CCATCCAGCC GCTGCACATC ACAACATTTA CTTAACAGAA CAGTCACCGA 120
  • MOLECULE TYPE cDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE NO
  • ORIGINAL SOURCE
  • MOLECULE TYPE cDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE NO

Abstract

La présente invention concerne des variantes du facteur plasminogène tissulaire qui font preuve d'une amélioration notable de la stimulation de la fibrine, d'une discrimination considérablement accrue entre cofacteurs de la fibrine, d'une résistance marquée à l'inhibition par PAI-1, et d'une zymogénicité sensiblement accrue, une combinaison de propriétés qui renforcent l'utilité thérapeutique de l'enzyme.
PCT/US1997/020226 1996-11-12 1997-11-12 VARIANTES D'ACTIVATEUR PLASMINOGENE DE TYPE TISSULAIRE (t-PA): COMPOSITIONS ET TECHNIQUES D'UTILISATION WO1998021320A2 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA002271697A CA2271697C (fr) 1996-11-12 1997-11-12 Variantes d'activateur plasminogene de type tissulaire (t-pa): compositions et techniques d'utilisation
EP97952176A EP0950095A2 (fr) 1996-11-12 1997-11-12 VARIANTES D'ACTIVATEUR PLASMINOGENE DE TYPE TISSULAIRE (t-PA): COMPOSITIONS ET TECHNIQUES D'UTILISATION
JP52266198A JP2001505765A (ja) 1996-11-12 1997-11-12 組織型プラスミノーゲンアクチベーター（ｔ―ＰＡ）の変異体：組成物およびその使用方法
US09/600,985 US6706504B1 (en) 1996-11-12 1997-11-12 Tissue type plasminogen activator (t-PA) variants: compositions and methods of use
AU55850/98A AU735519B2 (en) 1996-11-12 1997-11-12 Tissue type plasminogen activator (t-PA) variants: compositions and methods of use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US3065596P 1996-11-12 1996-11-12
US60/030,655 1996-11-12

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US09/600,985 A-371-Of-International US6706504B1 (en) 1996-11-12 1997-11-12 Tissue type plasminogen activator (t-PA) variants: compositions and methods of use
US09600985 A-371-Of-International 1997-11-12
US10/705,633 Division US6869778B2 (en) 1996-11-12 2003-11-10 Tissue type plasminogen activator (t-PA) variants: compositions and methods of use

Publications (3)

Publication Number Publication Date
WO1998021320A2 WO1998021320A2 (fr) 1998-05-22
WO1998021320A3 WO1998021320A3 (fr) 1998-07-09
WO1998021320A9 true WO1998021320A9 (fr) 1998-08-27

Family

ID=21855292

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/020226 WO1998021320A2 (fr) 1996-11-12 1997-11-12 VARIANTES D'ACTIVATEUR PLASMINOGENE DE TYPE TISSULAIRE (t-PA): COMPOSITIONS ET TECHNIQUES D'UTILISATION

Country Status (6)

Country Link
EP (1) EP0950095A2 (fr)
JP (1) JP2001505765A (fr)
CN (1) CN1244894A (fr)
AU (1) AU735519B2 (fr)
CA (1) CA2271697C (fr)
WO (1) WO1998021320A2 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU8864398A (en) * 1997-08-13 1999-03-08 Boehringer Mannheim Gmbh Plasminogen activator with enhanced zymogenic power and reduced fibrin linking
EP2948167A4 (fr) * 2013-01-22 2016-10-19 Univ Tennessee Res Foundation Anticorps activateurs du plasminogène tissulaire et leurs méthodes d'utilisation
CN114736948B (zh) * 2022-06-10 2022-11-08 深圳市帝迈生物技术有限公司 一种α2-抗纤溶酶活性测定试剂盒

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2581652B1 (fr) * 1985-04-22 1989-12-22 Genentech Inc Nouveaux mutants de l'activateur tissulaire du plasminogene humain
US5108901A (en) * 1988-09-02 1992-04-28 Genentech, Inc. Tissue plasminogen activator having zymogenic or fibrin specific properties

Similar Documents

Publication Publication Date Title
US5147643A (en) DNA sequences encoding human t-PA substituted at position 275 or at positions 275 and 277 and pharmaceutical compositions
EP0370036B1 (fr) FACTEUR VII/VIIa MODIFIE
AU626323B2 (en) Tissue plasminogen activator having zymogenic or fibrin specific properties
BG60253B2 (bg) Човешки тъканен плазминогенен активатор
US4935237A (en) Processes for the preparation of t-PA mutants
US5840564A (en) Tussue plasminogen activator having zymogenic or fibrin specific properties
JPH07147984A (ja) ポリクリングルプラスミノーゲン活性化因子をコードする遺伝子およびそれを含有するベクター
CA2165977A1 (fr) Mutants pro-urokinase
US5270198A (en) DNA molecules encoding variants of tissue plasminogen activators, vectors, and host cells
US5338546A (en) Tissue plasminogen activator variants with decreased clearance
US6706504B1 (en) Tissue type plasminogen activator (t-PA) variants: compositions and methods of use
EP0323149B1 (fr) Vecteurs et composés pour l'expression de formes zymogéniques de protéine C
AU735519B2 (en) Tissue type plasminogen activator (t-PA) variants: compositions and methods of use
WO1998021320A9 (fr) VARIANTES D'ACTIVATEUR PLASMINOGENE DE TYPE TISSULAIRE (t-PA): COMPOSITIONS ET TECHNIQUES D'UTILISATION
US5258180A (en) Tissue plasminogen activator having fibrin specific properties and deletion of amino acids 466-970, compositions and methods of treatment
FI114102B (fi) Menetelmä trombiinin vaikutuksesta pilkkoutuvan plasminogeenianalogin valmistamiseksi
US5156969A (en) Tissue plasminogen activator variant with deletion of amino acids 466-470 having fibrin specific properties
US5037646A (en) Processes for the treatment of vascular disease
US5688664A (en) Thrombin activatable plasminogen analogues
US5736134A (en) Tissue plasminogen activator variants
EP0400054A1 (fr) Sequences de genes modifiees codant pour des activateurs de plasminogenes tissulaires modifies et molecules ainsi produites
Wallén et al. Effects of structural modifications on the properties of tissue plasminogen activator (tPA)
MXPA99000966A (en) Plasminogen activator capable of being activated by thrombin