WO1997020047A1 - Methods and compositions for the diagnosis and treatment of cancer - Google Patents
Methods and compositions for the diagnosis and treatment of cancer Download PDFInfo
- Publication number
- WO1997020047A1 WO1997020047A1 PCT/US1996/019083 US9619083W WO9720047A1 WO 1997020047 A1 WO1997020047 A1 WO 1997020047A1 US 9619083 W US9619083 W US 9619083W WO 9720047 A1 WO9720047 A1 WO 9720047A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- gene
- cell
- tumor
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4746—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used p53
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus
Definitions
- the present invention is related generally to the field of cancer biology.
- the invention relates to compositions and methods of treatment for squamous cell carcinoma.
- an animal model for the examination of microscopic residual tumors and tumor seeding into body cavities, as well as methods for treatment thereof.
- Balancing rates of cell proliferation and cell death is important in maintaining normal tissue homeostasis. Disruption of this balance may be a major factor in the multistep process of tumorigenesis, and inhibition of apoptosis, or programmed cell death, is one cause of this disruption. The effects of such defects are catastrophic, causing over half a million deaths annually in the United States alone.
- mutations of the p53 gene a tumor suppressor, in the etiology of many human cancers. Reports have demonstrated that growth of several different human cancer cell lines, including representatives of colon cancer, glioblastoma, breast cancer, osteosarcoma and lung cancer can be functionally suppressed by viral-mediated transfer of a wild-type p53 gene. Induction of exogenous p53 expression of wild-type p53 has been shown to induce apoptosis in colon cancer cell lines and in human lung cancer spheroids, suggesting a role for p53 in programmed cell death.
- SCCHN squamous cell carcinoma of the head and neck
- a method for treating a subject with squamous cell carcinoma comprising the steps of (a) providing an expression construct comprising a promoter functional in eukaryotic cells and a polynucleotide encoding a p53, wherein the polynucleotide is positioned sense to and under the control of the promoter; and (b) contacting the expression construct with the squamous cell carcinoma in vivo.
- the squamous cell carcinoma may be a head and neck carcinoma.
- the endogenous p53 of the squamous cell carcinoma may or may not be mutated.
- the expression construct preferably is a viral vector, such as a retroviral vector, an adenoviral vector and an adeno-associated viral vector, with a replication-deficient adenoviral vector being most preferred.
- the p53 gene is tagged so that expression of p53 from the expression vector can be detected.
- a preferred tag is an immunologic one, such as a continuous antibody epitope.
- the method may further comprise surgical resection of the tumor, with additional contacting of the tumor bed, or "artificial body cavity,” with the expression construct after resection.
- the volume used to contact the tumor bed is about 3 ml. to about 10 ml.
- the amount of adenovirus administered in each contacting is about 10 7 , 10 8 , IO 9 , 10 10 , IO 11 or IO 12 pfu.
- Continuous perfusion of the expression construct also is contemplated.
- the amount of construct delivered in continuous perfusion will be determined from the amount delivered via injections so as to approximate the same total dosage over a given time period, although somewhat greater total dosages may be achieved using continuous perfusion.
- the expression construct is injected into an natural body cavity such as the mouth, pharynx, esophagus, larynx, trachea, pleural cavity, peritoneal cavity, or hollow organ cavities including the bladder, colon or other visceral organs.
- a method for determining the effectiveness of a therapy on microscopic residual cancer comprising (a) providing a rodent with an incision into subcutaneous tissue; (b) seeding the incision with tumor cells; (c) treating the rodent with a therapeutic regimen; and(d) assessing the impact of the regimen on the development of tumors.
- the incision may be sealed following step (b) and prior to step (c).
- the regimen may comprise introduction of a therapeutic composition into the incision, the incision being reopened after sealing and resealed after introduction of said therapeutic composition.
- FIG. 1 Transduction efficiency of SCCHN cell lines Tu-138 (closed triangles) and Tul77 (closed squares). A recombinant ⁇ -gal adenovirus was used to infect the cells at different MOI ranging from 10 to 100. The percentages of ⁇ -gal-positive cells were obtained from scoring 500 cells each on replicate dishes.
- FIG. 2A and FIG. 2B Inhibition of SCCHN cell growth in vitro.
- FIG. 2A Growth curve of mock-infected Tu-138 cells (closed circles), dl312-infected cells (closed triangles), and Ad5CMV-/?55-infected cells (closed squares).
- FIG. 2A Growth curve of mock-infected Tu-138 cells (closed circles), dl312-infected cells (closed triangles), and Ad5CMV-/?55-infected cells (closed squares).
- FIG. 3A, FIG. 3B, FIG. 3C and FIG. 3D Composite Growth Curve of four SCCHN cell lines.
- FIG. 3A Tu-138.
- FIG. 3B Tu-177.
- FIG. 3C MDA 686-LN.
- FIG. 3D MDA 886. Mock infected cells (closed circles), dl312-infected cells (closed triangle), and Ad5CMV-/?55 infected cells (closed square). The mean of cell counts per triplicate wells following infection were plotted against the number of days since infection; bars, SEM.
- FIG. 4 Growth curve of normal fibroblast cell line. Mock-infected cells (closed circle), dl312-infected cells (closed triangle), and Ad5CMV-/?53-infected cells (closed square).
- FIG. 5A and FIG. 5B Composite growth curve of SCCHN cell lines.
- FIG. 5A Tu-138;
- FIG. 5B MDA 686LN; Mock infected cells (open square), d!312 infected cells (open triangle), and Ad5CMV- ?55 infected cells (open circle).
- three dishes of cells were trypsinized and counted. The mean of cell counts per triplicate dishes were plotted against the number of hours post-infection; bars, SEM.
- FIG. 6A and FIG. 6B Labeling of DNA breaks in apoptotic cells with biotinylated-dUTP by TUNEL method. Following infection, flow cytometric analysis for apoptosis was performed in a time course study.
- FIG. 6A Tu-138 cells which are infected with dl312, a replication-defective adenovirus (panel 1-panel 4), Tu-138 cells infected with the wild-type p53 adenovirus (panel 5- panel 8).
- FIG. 6B Tu-138 cells which are infected with dl312, a replication-defective adenovirus (panel 1-panel 4), Tu-138 cells infected with the wild-type p53 adenovirus (panel 5- panel 8).
- MDA 686LN cells which are infected with dl312, a replication-defective adenovirus (A-D), MDA 686LN cells infected with the wild-type p53 adenovirus (E-H).
- Ap stands for apoptosis.
- FIG. 7A and FIG. 7B Composite growth curve of SCCHN cell line.
- FIG. 7A Tu-138;
- FIG. 7B MD686LN; Mock infected cells (open circles), dl312 infected cells (closed triangles), Ad5CMV- ?J3 infected cells (open squares) and Ad5CMV-/?J3-FLAG infected cells (closed squares).
- three dishes of cells were trypsinized and counted. The mean of cell counts per triplicate dishes were plotted against the number of hours post-infection; bars, SEM.
- the present invention is designed to provide gene therapeutic methodologies that permit a more complete and effective treatment of SCCHN, specifically, by attacking microscopic residual carcinoma.
- This methodology may be used alone or as an adjunct to more conventional treatments such as chemo- or radiotherapy or surgical intervention.
- an animal model specifically designed to address microscopic residual carcinoma, as well as microscopic tumor seeding of body cavities the present inventor has demonstrated efficacy of these methods. The details of the invention are described more completely below . More generally, it now has been observed that p53 gene therapy of cancers may be effective regardless of the p53 status of the tumor cell.
- p53 is intended to refer to the exemplified p53 molecules as well as all p53 homologues from other species.
- Wild ⁇ type and mutant p53 refer, respectively, to a p53 gene expressing normal tumor suppressor activity and to a p53 gene lacking or having reduced suppressor activity and/or having transforming activity.
- mutant p53's are not merely sequence variants but rather, are those variants showing altered functional profiles.
- p53 is currently recognized as a tumor suppressor gene (Montenarh, 1992). High levels have been found in many cells transformed by chemical carcinogenesis, ultraviolet radiation, and several viruses, including SV40.
- the p53 gene is a frequent target of mutational inactivation in a wide variety of human tumors and is already documented to be the most frequently-mutated gene in common human cancers (Mercer, 1992). It is mutated in over 50% of human NSCLC (Hollestein et al. , 1991) and in a wide spectrum of other tumors. While tumors containing a mutated p53 gene are a preferred target according to the present invention, the utility of the claimed p53 expression vectors extends to the treatment of tumors having wild-type or functional p53.
- the present inventor has determined that p53 expression can limit the growth of tumors expressing a functional p53 product, and even induce apoptosis in such cells.
- the p53 status of a tumor is not essential for practice of the present invention.
- This phenomenon is not limited to SCCHN tumors, but may be applied to a wide variety of malignancies including gliomas, sarcomas, carcinomas, leukemias, lymphomas and melanoma, including tumors of the skin, liver, testes, bone, brain, pancreas, head and neck, stomach, liver, lung, ovary, breast, colon, prostate and bladder.
- the p53 gene encodes a 375-amino-acid phosphoprotein that can form complexes with viral proteins such as large-T antigen and ElB.
- the protein is found in normal tissues and cells, but at concentrations which are minute by comparison with many transformed cells or tumor tissue.
- wild-type p53 appears to be important in regulating cell growth and division. Overexpression of wild-type p53 has been shown in some cases to be anti-proliferative in human tumor cell lines. Thus p53 can act as a negative regulator of cell growth (Weinberg, 1991) and may directly suppress uncontrolled cell growth or indirectly activate genes that suppress this growth. Thus, absence or inactivation of wild-type p53 may contribute to transformation. However, some studies indicate that the presence of mutant p53 may be necessary for full expression of the transforming potential of the gene.
- wild-type p53 is recognized as a centrally important growth regulator in many cell types, its genetic and biochemical traits appear to have a role as well. Mis-sense mutations are common for the p53 gene and are essential for the transforming ability of the oncogene. A single genetic change prompted by a point mutation can create carcinogenic p53. Unlike other oncogenes, however, p53 point mutations are known to occur in at least 30 distinct codons, often creating dominant alleles that produce shifts in cell phenotype without a reduction to homozygosity. Additionally, many of these dominant negative alleles appear to be tolerated in the organism and passed on in the germ line. Various mutant alleles appear to range from minimally dysfunctional to strongly penetrant, dominant negative alleles (Weinberg, 1991).
- the polynucleotides according to the present invention may encode an entire p53 gene, a functional p53 protein domain, or any p53 polypeptide.
- "Complementary" polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairin .
- complementary sequences means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have a complementary nucleotide at thirteen or fourteen positions. Naturally, sequences which are "completely complementary” will be sequences which are entirely complementary throughout their entire length and have no base mismatches.
- an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., a ribozyme) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.
- the polynucleotides may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organism. In other embodiments, however, the polynucleotides may be complementary DNA (cDNA). cDNA is DNA prepared using messenger RNA (mRNA) as template. Thus, a cDNA does not contain any interrupted coding sequences and usually contains almost exclusively the coding region(s) for the corresponding protein. In other embodiments, the polynucleotide may be produced synthetically. -l i ⁇
- lt may be advantageous to combine portions of the genomic DNA with cDNA or synthetic sequences to generate specific constructs. For example, where an intron is desired in the ultimate construct, a genomic clone will need to be used. Introns may be derived from other genes in addition to p53.
- the cDNA or a synthesized polynucleotide may provide more convenient restriction sites for the remaining portion of the construct and, therefore, would be used for the rest of the sequence.
- the human and mouse DNA sequence for p53 is provided in SEQ ID NO: l and SEQ ID NO: 3 respectively, with the corresponding amino acids being provided in SEQ ID NO: 2 and SEQ ID NO:4, respectively.
- the present invention is not limited to use of the provided polynucleotide sequence for p53 but, rather, includes use of any naturally-occurring variants.
- the present invention also encompasses chemically synthesized mutants of these sequences.
- sequences that have between about 50% and about 75 % , or between about 76% and about 99% of nucleotides that are identical to the nucleotides disclosed herein will be preferred.
- Sequences that are within the scope of "a /?53-encoding polynucleotide” are those that are capable of base-pairing with a polynucleotide segment set forth above under intracellular conditions.
- the p53 encoding sequences may be full length genomic or cDNA copies, or large fragments thereof.
- the present invention also may employ shorter oiigonucleotides of p53.
- Sequences of 17 bases long should occur only once in the human genome and, therefore, suffice to specify a unique target sequence. Although shorter oligomers are easier to make and increase in vivo accessibility, numerous other factors are involved in determining the specificity of base-pairing. Both binding affinity and sequence specificity of an oligonucleotide to its complementary target increases with increasing length. It is contemplated that oiigonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 base pairs will be used, for example, in the preparation of p53 mutants and in PCR reactions.
- Oiigonucleotides which contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity (Wagner et al. , 1993).
- Bioly functional equivalent protein or peptide is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule and still result in a molecule with an acceptable level of equivalent biological activity.
- Biologically functional equivalent peptides are thus defined herein as those peptides in which certain, not most or all, of the amino acids may be substituted.
- the N-terminus of the pl6 protein it is contemplated that only about 16 or more preferably, about 5 amino acids may be changed within a given peptide.
- a plurality of distinct proteins/peptides with different substitutions may easily be made and used in accordance with the invention.
- Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
- An analysis of the size, shape and type of the amino acid side-chain substituents reveals that arginine, lysine and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape.
- arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as biologically functional equivalents .
- hydropathic index of amino acids may be considered.
- Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+ 1.9); alanine (+ 1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (- 0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (- 3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
- hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte & Doolittle, 1982, incorporated herein by reference). It is known that ceratin amino acids may be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within ⁇ 2 is preferred, those which are within + 1 are particularly preferred, and those within +0.5 are even more particularly preferred.
- an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent protein.
- the following hydrophilicity values have been assigned to amino acid residues: arginine ( + 3.0); lysine (+3.0); aspartate ( + 3.0 ⁇ 1); glutamate ( + 3.0 ⁇ 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2) glycine (0); threonine (-0.4); proline (-0.5 + 1); alanine (-0.5); histidine (-0.5) cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8) tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).
- expression construct is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed.
- the transcript may be translated into a protein, but it need not be.
- expression includes both transcription of a p53 gene and translation of a p53 mRNA into a p53 protein product.
- expression only includes transcription of the nucleic acid encoding a p53 or its complement.
- the polynucleotide encoding the p53 polynucleotide will be under the transeriptional control of a promoter.
- a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the host cell, or introduced synthetic machinery, that is required to initiate the specific transcription of a gene.
- the phrase "under transeriptional control” means that the promoter is in the correct location in relation to the polynucleotide to control RNA polymerase initiation and expression of the polynucleotide.
- promoter will be used here to refer to a group of transeriptional control modules that are clustered around the initiation site for RNA polymerase II.
- Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transeriptional activator or repressor proteins.
- At least one module in each promoter functions to position the start site for RNA synthesis.
- the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
- promoter elements regulate the frequency of transeriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
- the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.
- the particular promoter that is employed to control the expression of a p53 polynucleotide is not believed to be critical, so long as it is capable of expressing the polynucleotide in the targeted cell at sufficient levels.
- a human cell it is preferable to position the polynucleotide coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell.
- a promoter might include either a human or viral promoter.
- the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter and the Rous sarcoma virus long terminal repeat can be used to obtain high-level expression of the p53 polynucleotide.
- CMV cytomegalovirus
- the use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of polynucleotides is contemplated as well, provided that the levels of expression are sufficient to produce a growth inhibitory effect.
- a promoter with well-known properties, the level and pattern of expression of a polynucleotide following transfection can be optimized. For example, selection of a promoter which is active in specific cells, such as tyrosinase (melanoma), alpha-fetoprotein and albumin (liver tumors). CC 10 (lung tumor) and prostate-specific antigen (prostate tumor) will permit tissue-specific expression of p53 polynucleotides.
- Table 2 lists several elements/promoters which may be employed, in the context of the present invention, to regulate the expression of p53 constructs. This list is not intended to be exhaustive of all the possible elements involved in the promotion of p53 expression but, merely, to be exemplary thereof.
- Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transeriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transeriptional proteins .
- enhancers The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
- Eukaryotic Promoter Data Base EPDB any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of a p53 construct.
- Use of a T3, T7 or SP6 cytoplasmic expression system is another possible embodiment.
- Eukaryotic cells can support cytoplasmic transcription from certain bacteriophage promoters if the appropriate bacteriophage polymerase is provided, either as part of the delivery complex or as an additional genetic expression vector.
- NCAM Neural Cell Adhesion Molecule
- SAA Human Serum Amyloid A
- a promoter that is regulated in response to specific physiologic signals can permit inducible expression of the p53 construct.
- expression is inducible by tumor necrosis factor.
- Table 3 illustrates several promoter/inducer combinations:
- TPA Collagenase Phorbol Ester
- TPA Stromelysin Phorbol Ester
- the delivery of an expression vector in a cell may be identified in vitro or in vivo by including a marker in the expression vector.
- the marker would result in an identifiable change to the transfected cell permitting easy identification of expression.
- a drug selection marker aids in cloning and in the selection of transformants.
- enzymes such as herpes simplex virus thymidine kinase (tk) (eukaryotic) or chloramphenicol acetyltransferase (CAT) (prokaryotic) may be employed.
- Immunologic markers also can be employed.
- the selectable marker employed is not believed to be important, so long as it is capable of being expressed along with the polynucleotide encoding p53. Further examples of selectable markers are well known to one of skill in the art.
- the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
- the inventor has employed the SV40 polyadenylation signal in that it was convenient and known to function well in the target cells employed.
- Also contemplated as an element of the expression construct is a terminator. These elements can serve to enhance message levels and to minimize read through from the construct into other sequences.
- the expression construct comprises a virus or engineered construct derived from a viral genome.
- viruses to enter cells via receptor-mediated endocytosis and, in some cases, integrate into the host cell chromosomes, have made them attractive candidates for gene transfer in to mammalian cells.
- expression vectors need not be viral but, instead, may be any plasmid, cosmid or phage construct that is capable of supporting expression of encoded genes in mammalian cells, such as pUC or Bluescript plasmid series.
- the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of re verse- transcription (Coffin, 1990).
- the resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins.
- the integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
- the retroviral genome contains three genes - gag, pol, and env - that code for capsid proteins, polymerase enzyme, and envelope components, respectively.
- a sequence found upstream from the gag gene, termed ⁇ functions as a signal for packaging of the genome into virions.
- Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).
- a nucleic acid encoding a p53 is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
- a packaging cell line containing the gag, pol and env genes but without the LTR and ⁇ components is constructed (Mann et ai , 1983).
- Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al. , 1975).
- a novel approach designed to allow specific targeting of retrovirus vectors was recently developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification could permit the specific infection of hepatocytes via sialoglycoprotein receptors.
- a different approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al. , 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al. , 1989).
- Adenoviruses Human adenoviruses are double- stranded DNA tumor viruses with genome sizes of approximate 36 kb (Tooze, 1981). As a model system for eukaryotic gene expression, adenoviruses have been widely studied and well characterized, which makes them an attractive system for development of adenovirus as a gene transfer system. This group of viruses is easy to grow and manipulate, and they exhibit a broad host range in vitro and in vivo. In lytically infected cells, adenoviruses are capable of shutting off host protein synthesis, directing cellular machineries to synthesize large quantities of viral proteins, and producing copious amounts of virus.
- the El region of the genome includes EIA and ElB which encode proteins responsible for transcription regulation of the viral genome, as well as a few cellular genes.
- E2 expression including E2A and E2B, allows synthesis of viral replicative functions, e.g. DNA-binding protein, DNA polymerase, and a terminal protein that primes replication.
- E3 gene products prevent cytolysis by cytotoxic T cells and tumor necrosis factor and appear to be important for viral propagation.
- Functions associated with the E4 proteins include DNA replication, late gene expression, and host cell shutoff.
- the late gene products include most of the virion capsid proteins, and these are expressed only after most of the processing of a single primary transcript from the major late promoter has occurred.
- the major late promoter exhibits high efficiency during the late phase of the infection (Stratford-Perricaudet and Perricaudet, 1991a).
- adenovirus-derived vectors offer excellent potential for the substitution of large DNA fragments when used in connection with cell lines such as 293 cells.
- Ad5-transformed human embryonic kidney cell lines (Graham, et al.. 1977) have been developed to provide the essential viral proteins in trans. The inventor thus reasoned that the characteristics of adenoviruses rendered them good candidates for use in targeting cancer cells in vivo (Grunhaus & Horwitz, 1992).
- an adenovirus system for delivering foreign proteins to a cell include (i) the ability to substitute relatively large pieces of viral DNA by foreign DNA; (ii) the structural stability of recombinant adenoviruses; (iii) the safety of adenoviral administration to humans; and (iv) lack of any known association of adenoviral infection with cancer or malignancies; (v) the ability to obtain high titers of the recombinant virus; and (vi) the high infectivity of Adenovirus.
- adenovirus vectors over retroviruses include the higher levels of gene expression. Additionally, adenovirus replication is independent of host gene replication, unlike retroviral sequences. Because adenovirus transforming genes in the El region can be readily deleted and still provide efficient expression vectors, oncogenic risk from adenovirus vectors is thought to be negligible (Grunhaus & Horwitz, 1992).
- adenovirus gene transfer systems are based upon recombinant, engineered adenovirus which is rendered replication-incompetent by deletion of a portion of its genome, such as El , and yet still retains its competency for infection. Sequences encoding relatively large foreign proteins can be expressed when additional deletions are made in the adenovirus genome. For example, adenoviruses deleted in both El and E3 regions are capable of carrying up to 10 Kb of foreign DNA and can be grown to high titers in 293 cells (Stratford- Perricaudet and Perricaudet, 1991a). Su ⁇ risingly persistent expression of transgenes following adenoviral infection has also been reported.
- Adenovirus-mediated gene transfer has recently been investigated as a means of mediating gene transfer into eukaryotic cells and into whole animals. For example, in treating mice with the rare recessive genetic disorder ornithine transcarbamylase (OTC) deficiency, it was found that adenoviral constructs could be employed to supply the normal OTC enzyme. Unfortunately, the expression of normal levels of
- Attempts to use adenovirus to transfer the gene for cystic fibrosis transmembrane conductance regulator (CFTR) into the pulmonary epithelium of cotton rats have also been partially successful, although it has not been possible to assess the biological activity of the transferred gene in the epithelium of the animals
- Rosenfeld et al. showed lung expression of al-antitrypsin protein but again showed no physiologic effect. In fact, they estimated that the levels of expression that they observed were only about 2% of the level required for protection of the lung in humans, i.e., far below that necessary for a physiologic effect.
- the gene for human ⁇ l-antitrypsin has been introduced into the liver of normal rats by intraportal injection, where it was expressed and resulted in the secretion of the introduced human protein into the plasma of these rats (Jaffe et al. ,
- viral vectors may be employed as expression constructs in the present invention.
- Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al. , 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and he ⁇ esviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al. , 1988; Horwich et al. , 1990).
- the expression vector In order to effect expression of p53 constructs, the expression vector must be delivered into a cell. As described above, the preferred mechanism for delivery is via viral infection where the expression vector is encapsidated in an infectious adenovirus particle.
- Non-viral methods for the transfer of expression vectors into cultured mammalian cells include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al., 1986; Potter et al. , 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al., 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al.
- the adenoviral expression vector may simply consist of naked recombinant vector. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. For example, Dubensky et al. (1984) successfully injected polyomavirus DNA in the form of CaPO 4 precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection.
- Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of CaPO 4 precipitated plasmids results in expression of the transfected genes. It is envisioned that DNA encoding an p53 construct may also be transferred in a similar manner in vivo.
- Another embodiment of the invention for transferring a naked DNA expression vector into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al. , 1987). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al. , 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.
- Selected organs including the liver, skin, and muscle tissue of rats and mice have been bombarded in vivo (Yang et al. , 1990; Zelenin et al , 1991). This may require surgical exposure of the tissue or cells, to eliminate any intervening tissue between the gun and the target organ. DNA encoding a p53 construct may be delivered via this method.
- the expression vector may be entrapped in a liposome.
- Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phosphoiipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated are lipofectamine-DNA complexes.
- Liposome-mediated polynucleotide delivery and expression of foreign DNA in vitro has been very successful.
- Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
- Nicolau et al. (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection.
- the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
- the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al, 1991).
- HMG-1 nuclear non-histone chromosomal proteins
- the liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
- expression vectors have been successfully employed in transfer and expression of a polynucleotide in vitro and in vivo, then they are applicable for the present invention.
- a bacteriophage promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacteriophage polymerase.
- Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent.
- ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu, 1987) and transferrin (Wagner et al , 1993).
- the delivery vehicle may comprise a ligand and a liposome.
- a ligand for example, Nicolau et al (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, inco ⁇ orated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes.
- an adenoviral expression vector also may be specifically delivered into a cell type such as lung, epithelial or tumor cells, by any number of receptor-ligand systems, with or without liposomes.
- epidermal growth factor (EGF) may be used as the receptor for mediated delivery of p53 construct in many tumor cells that exhibit upregulation of EGF receptor.
- Mannose can be used to target the mannose receptor on liver cells.
- antibodies to CD5 (CLL), CD22 (lymphoma), CD25 (T-cell leukemia) and MAA (melanoma) can similarly be used as targeting moieties.
- gene transfer may more easily be performed under ex vivo conditions.
- Ex vivo gene therapy refers to the isolation of cells from an animal, the delivery of a polynucleotide into the cells, in vitro, and then the return of the modified cells back into an animal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues. Anderson et al , U.S. Patent 5,399,346, and inco ⁇ orated herein in its entirety, disclose ex vivo therapeutic methods. During ex vivo culture, the expression vector can express the p53 construct. Finally, the cells may be reintroduced into the original animal, or administered into a distinct animal, in a pharmaceutically acceptable form by any of the means described below.
- an adenoviral expression vector according to the present invention it will be necessary to prepare the complex as a pharmaceutical composition appropriate for the intended application. Generally this will entail preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities that could be harmful to humans or animals. One also will generally desire to employ appropriate salts and buffers to render the complex stable and allow for complex uptake by target cells.
- compositions of the present invention comprise an effective amount of the expression vector, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. Such compositions also are referred to as inocula.
- pharmaceutically acceptable refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be inco ⁇ orated into the compositions.
- Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- the expression vectors and delivery vehicles of the present invention may include classic pharmaceutical preparations.
- Administration of therapeutic compositions according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal. vaginal or topical.
- administration will be by orthotopic, intradermal, intraocular, subcutaneous, intramuscular, intraperitoneal or intravenous injection.
- Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients.
- compositions of the present invention are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified.
- a typical composition for such pu ⁇ ose comprises a pharmaceutically acceptable carrier.
- the composition may contain 10 mg, 25 mg, 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline.
- Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
- Intravenous vehicles include fluid and nutrient replenishers.
- Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components the pharmaceutical composition are adjusted according to well known parameters.
- Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like.
- the compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
- the route is topical, the form may be a cream, ointment, salve, liquid or spray.
- an effective amount of the therapeutic agent is determined based on the intended goal, for example (i) inhibition of tumor cell proliferation or (ii) elimination of tumor cells.
- unit dose refers to physically discrete units suitable for use in a subject, each unit containing a predetermined-quantity of the therapeutic composition calculated to produce the desired responses, discussed above, in association with its administration, i.e. , the appropriate route and treatment regimen.
- the quantity to be administered both according to number of treatments and unit dose, depends on the subject to be treated, the state of the subject and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual.
- this is accomplished by drip system.
- repeated application would be employed.
- delayed release formulations could be used that provided limited but constant amounts of the therapeutic agent over and extended period of time.
- continuous perfusion of the region of interest may be preferred. This could be accomplished by catheterization, post-operatively in some cases, followed by continuous administration of the therapeutic agent.
- the time period for perfusion would be selected by the clinician for the particular patient and situation, but times could range from about 1-2 hours, to 2-6 hours, to about 6-10 hours, to about 10-24 hours, to about 1-2 days, to about 1-2 weeks or longer.
- the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by single or multiple injections, adjusted for the period of time over which the injections are administered. It is believed that higher doses may be achieved via perfusion, however.
- Clinical Protocol for SCCHN A clinical protocol has been developed to facilitate the treatment of SCCHN disease using the adenoviral constructs discussed below in the examples.
- patients having histologic proof of squamous cell carcinoma of the head and neck will be selected.
- Patients may, but need not have received previous chemo-, radio- or gene therapies.
- patients will have adequate bone marrow function (defined as peripheral absolute granulocyte count of > 2,000/mm 3 and platelet count of 100,000/mm 3 ), adequate liver function (bilirubin _ ⁇ _ 1.5 mg/dl) and adequate renal function (creatinine ⁇ 1.5 mg/dl).
- the protocol calls for single dose administration, via intratumoral injection, of a pharmaceutical composition containing between IO 6 and 10 infectious particles of a p53 adenovirus expression construct.
- the volume administered will be 4-10 ml (preferably 10 ml), while for tumors ⁇ 4 cm, a volume of 1-3 ml will be used (preferably 3 ml).
- Multiple injections will be delivered for a single dose, in 0.1-0.5 ml volumes, with spacing of approximately 1 cm or more.
- the treatment course consists of about six doses, delivered over two weeks. Upon election by the clinician, the regimen may be continued, six doses each two weeks, or on a less frequent (monthly, bimonthly, quarterly, etc.) basis. Where patients are eligible for surgical resection, the tumor will be treated as described above for at least two consecutive two- week treatment courses. Within one week of completion of the second (or more, e.g. , third, fourth, fifth, sixth, seventh, eighth, etc.) course, the patient will receive surgical resection. Prior to close of the incision, 10 ml of a pharmaceutical composition containing the p53 adenovirus expression construct (10 6 -10 9 infectious particles) will be delivered to the surgical site (operative bed) and allowed to remain in contact for at least 60 minutes.
- the wound is closed and a drain or catheter placed therein.
- additional 10 ml of the pharmaceutical composition is administered via the drain and allowed to remain in contact with the operative bed for at least two hours. Removal by suction is then performed, and the drain removed at a clinically appropriate time.
- One of the prime sources of recurrent SCCHN is the residual, microscopic disease that remains at the primary tumor site, as well as locally and regionally, following tumor excision.
- a cancer may be removed by surgical excision, creating a "cavity. " Both at the time of surgery, and thereafter (periodically or continuously), the therapeutic composition of the present invention is administered to the body cavity. This is, in essence, a “topical” treatment of the surface of the cavity.
- the volume of the composition should be sufficient to ensure that the entire surface of the cavity is contacted by the expression construct.
- administration simply will entail injection of the therapeutic composition into the cavity formed by the tumor excision.
- mechanical application via a sponge, swab or other device may be desired. Either of these approaches can be used subsequent to the tumor removal as well as during the initial surgery.
- a catheter is inserted into the cavity prior to closure of the surgical entry site. The cavity may then be continuously perfused for a desired period of time.
- the "topical" application of the therapeutic composition is targeted at a natural body cavity such as the mouth, pharynx, esophagus, larynx, trachea, pleural cavity, peritoneal cavity, or hollow organ cavities including the bladder, colon or other visceral organs.
- a natural body cavity such as the mouth, pharynx, esophagus, larynx, trachea, pleural cavity, peritoneal cavity, or hollow organ cavities including the bladder, colon or other visceral organs.
- the treatment targets microscopic disease in the cavity, but incidentally may also affect a primary tumor mass if it has not been previously removed or a pre-neoplastic lesion which may be present within this cavity.
- a variety of methods may be employed to affect the "topical" application into these visceral organs or cavity surfaces.
- the oral cavity in the pharynx may be affected by simply oral swishing and gargling with solutions.
- topical treatment within the larynx and trachea may require endoscopic visualization and topical delivery of the therapeutic composition.
- Visceral organs such as the bladder or colonic mucosa may require indwelling catheters with infusion or again direct visualization with a cystoscope or other endoscopic instrument.
- Cavities such as the pleural and peritoneal cavities may be accessed by indwelling catheters or surgical approaches which provide access to those areas.
- Another aspect of the present invention involves the monitoring of p53 expression following administration of the therapeutic composition. Because destruction of microscopic tumor cells cannot be observed, it is important to determine whether the target site has been effectively contacted with the expression construct. This may be accomplished by identifying cells in which the expression construct is actively producing the p53 product. It is important, however, to be able to distinguish between the exogenous p53 and that present in tumor and non-tumor cells in the treatment area. Tagging of the exogenous p53 with a tracer element would provide definitive evidence for expression of that molecule and not an endogenous version thereof.
- the FLAG polypeptide is an octapeptide (AspTyrLysAspAspAspAspLys) and its small size does not disrupt the expression of the delivered gene therapy protein.
- the coexpression of FLAG and the protein of interest is traced through the use of antibodies raised against FLAG protein.
- immunologic marker systems such as the 6XHis system (Qiagen) also may be employed.
- 6XHis system Qiagen
- any linear epitope could be used to generate a fusion protein with p53 so long as (i) the immunologic integrity of the epitope is not compromised by the fusion and (ii) the functional integrity of p53 is not compromised by the fusion.
- HS-tK simplex-thymidine kinase
- compositions of the present invention To kill cells, such as malignant or metastatic cells, using the methods and compositions of the present invention, one would generally contact a "target" cell with an expression vector and at least one DNA damaging agent. These compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell. This process may involve contacting the cells with the expression vector and the DNA damaging agent(s) or factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the p53 expression vector and the other includes the DNA damaging agent.
- the p53 treatment may precede or follow the DNA damaging agent treatment by intervals ranging from minutes to weeks.
- the DNA damaging factor and p53 expression vector are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the DNA damaging agent and expression vector would still be able to exert an advantageously combined effect on the cell.
- both agents are delivered to a cell in a combined amount effective to kill the cell.
- DNA damaging agents or factors are defined herein as any chemical compound or treatment method that induces DNA damage when applied to a cell. Such agents and factors include radiation and waves that induce DNA damage such as, ⁇ -irradiation, X-rays, UV-irradiation, microwaves, electronic emissions, and the like.
- chemotherapeutic agents function to induce DNA damage, all of which are intended to be of use in the combined treatment methods disclosed herein. Chemotherapeutic agents contemplated to be of use, include, e.g.
- the invention also encompasses the use of a combination of one or more DNA damaging agents, whether radiation-based or actual compounds, such as the use of X-rays with cisplatin or the use of cisplatin with etoposide.
- the use of cisplatin in combination with a p53 expression vector is particularly preferred.
- the tumor cells In treating cancer according to the invention, one would contact the tumor cells with a DNA damaging agent in addition to the expression vector. This may be achieved by irradiating the localized tumor site with DNA damaging radiation such as X-rays, UV-light, g-rays or even microwaves.
- the tumor cells may be contacted with the DNA damaging agent by administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a DNA damaging compound such as, adriamycin, 5-fluorouracil, etoposide, camptothecin, actinomycin-D, mitomycin C, or more preferably, cisplatin.
- the DNA damaging agent may be prepared and used as a combined therapeutic composition, or kit, by combining it with ap53 expression vector, as described above.
- Agents that directly cross-link polynucleotides, specifically DNA, are envisaged and are shown herein, to eventuate DNA damage leading to a synergistic antineoplastic combination.
- Agents such as cisplatin, and other DNA alkylating may be used.
- Cisplatin has been widely used to treat cancer, with efficacious doses used in clinical applications of 20 mg/m for 5 days every three weeks for a total of three courses. Cisplatin is not absorbed orally and must therefore be delivered via injection intravenously, subcutaneously, intratumorally or intraperitoneally.
- Agents that damage DNA also include compounds that interfere with DNA replication, mitosis and chromosomal segregation.
- chemotherapeutic compounds include adriamycin, also known as doxorubicin, etoposide, verapamil, podophyllotoxin, and the like. Widely used in a clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg/m at 21 day intervals for adriamycin, to 35-50 mg/m " for etoposide intravenously or double the intravenous dose orally.
- Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 weeks), to single doses of 2000 to 6000 roentgens.
- Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
- the chemo- or radiotherapy may be directed to a particular, affected region of the subject's body.
- systemic delivery of the expression vector or the DNA damaging agent may be appropriate in certain circumstances, for example, where extensive metastasis has occurred.
- Cytokine therapy also has proven to be an effective partner for combined therapeutic regimens. Various cytokines may be employed in such combined approaches.
- cytokines examples include IL-lct IL-l ⁇ , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-ll , IL-12, IL-13, TGF- ⁇ , GM-CSF, M-CSF, G-CSF, TNF ⁇ , TNF ⁇ , LAF, TCGF, BCGF, TRF, BAF, BDG, MP, LIF, OSM, TMF, PDGF, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ . Cytokines are administered according to standard regimens, as described below, consistent with clinical indications such as the condition of the patient and relative toxicity of the cytokine.
- any other tumor-related gene conceivably can be targeted in this manner, for example, p21 , pl6, p27, F ⁇ F, Dp family of genes, Rb, APC, DCC, NF-1 , NF-2, WT-1 , MEN-I, MEN-II, BRCA1 , VHL, FCC, MCC, other ras molecules, myc, neu, raf, erb, src, fins, jun, trk, ret, gsp, hst, bcl, and abl.
- p53 therapy with an antibody-based gene therapy treatment involving the use of a single-chain antibody construct in which the antibody binds to any of the foregoing molecules, or in combination with genes encoding one or more of the cytokines listed above. It also may be advantageous to combine p53 with other genes that have been implicated in apoptotic processes, e.g. , adenovirus EIA, Bax, Bcl-X s , etc.
- kits This generally will comprise selected adenoviral expression vectors. Also included may be various media for replication of the expression vectors and host cells for such replication. Such kits will comprise distinct containers for each individual reagent.
- the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred.
- the expression vector may be formulated into a pharmaceutically acceptable syringeable composition.
- the container means may itself be an inhalent, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area of the body, such as the lungs, injected into an animal, or even applied to and mixed with the other components of the kit.
- the components of the kit may also be provided in dried or lyophilized forms.
- reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.
- kits of the present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained.
- a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained.
- the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/ administration or placement of the ultimate complex composition within the body of an animal.
- an instrument may be an inhalent, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
- Carcinoma may refer to a single cell or a multicellular tumor mass. In microscopic disease, the “tumor” will consist or one or a few carcinoma cells which cannot be observed with the naked eye.
- the animal model described herein is particularly advantageous mimicking (i) the post surgical environment of head and neck cancer patients, particularly in advanced stages of disease and (ii) the body cavity of an affected subject wherein microscopic carcinoma has been established.
- the model similar to other animal models for cancer, derives from inoculation of tumor cells into an animal.
- a distinction lies in the creation, subcutaneously, of a pouch that is a physiologic equivalent of a natural body cavity or a post-surgical cavity created by the excision of a tumor mass.
- the instant inventions exemplifies nude mice as the model organism. Virtually any animal may be employed, however, for use according to the present invention. Particularly preferred animals will be small mammals that are routinely used in laboratory protocols. Even more preferred animals will be those of the rodent group, such as mice, rats, guinea pigs and hamsters. Rabbits also are a preferred species. The criteria for choosing an animal will be largely dependent upon the particular preference of an investigator.
- tissue flap means any incision in the flesh of the animal that exposes the target tissue. It is generally preferred that an incision be made in the dorsal flank of an animal, as this represents a readily accessible site. However, it will be understood that an incision could well be made at other points on the animal, and the choice of tissue sites may be dependent upon various factors such as the particular type of therapeutics that are being investigated.
- carcinoma cells either individually or in microscopic tumors, are contacted with the tissue site.
- the most convenient manner for seeding the cancer cells into the tissue site is to apply a suspension of tissue culture media containing the cells to the exposed tissue. Cancer cell application may be achieved simply using a sterile pipette or any other convenient applicator. Naturally, this procedure will be conducted under sterile conditions.
- 2.5 x 10 SCCHN cells are inoculated into the exposed tissue flap of a nude mouse.
- the number of cells will be dependent upon various factors, such as the size of the animal, the site of incision, the replicative capacity of the tumor cells themselves, the time intended for tumor growth, the potential anti-tumor therapeutic to be tested, and the like. Although establishing an optimal model system for any particular type of tumor may require a certain adjustment in the number of cells administered, this in no way represents an undue amount of experimentation. Those skilled in the area of animal testing will appreciate that such optimization is required.
- Tu-138 and Tu-177 were both established at the Department of Head and Neck Surgery, M.D. Anderson Cancer Center. Tu-138 and Tu-177 were established from a gingivo-labial moderately differentiated squamous carcinoma and a poorly differentiated squamous carcinoma of the larynx, respectively. Both cell lines were developed via primary explant technique and are cytokeratin positive and tumorigenic in athymic nude and SCID mice. These cells were grown in DMEM/F12 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) with penicillin streptomycin.
- FBS heat-inactivated fetal bovine serum
- the recombinant p53 adenovirus (Ad5CMV-p53) (Zhang et al, 1994) contains the cytomegalovirus (CMV) promoter, wild-type p53 cDNA, and SV40 polyadenylation signal in a mini-gene cassette inserted into the El-deleted region of modified adenovirus type 5 (Ad5).
- CMV cytomegalovirus
- Ad5 cytomegalovirus
- Concentrated virus was dialyzed, aliquoted and stored at -80 C. Infection was carried out by addition of the virus in DMEM/F12 medium and 2% FBS to cell monolayers, the cells were incubated at 37 C for 60 min with constant agitation, then complete medium (DMEM/F12/10% FBS) was added and the cells were incubated at 37°C for the desired length of time.
- RNA was isolated by the acid-guanidinium thiocyanate method of (Chomczynski and Sacchi, 1987). Northern analyses were performed on 20 ⁇ g of total RNA.
- the membrane was hybridizated with a p53 cDNA probe labeled by the random primer method in 5 x SSC/5X Denhardt's solution/0.5% SDS/denatured salmon sperm DNA (20 ⁇ g/ml). The membrane was also stripped and reprobed with GAPDH cDNA for RNA loading control. The relative quantities of p53 expressed were determined by densitometer (Molecular Dynamics Inc., Sunnyvale, CA).
- the membrane was blocked with Blotto/Tween (5 % nonfat dry milk, 0.2% Tween 20, 0.02% sodium azide in phosphate-buffered saline) and probed with the primary antibodies, mouse anti-human p53 monoclonal antibody P Abl 801 and mouse anti-human ⁇ -actin monoclonal antibody (Amersham), and the secondary antibody, horseradish peroxidase-conjugated goat anti-mouse IgG (Boehringer Mannheim, Indianapolis, IN). The membrane was processed and developed as the manufacturer suggested. Immunohistochemical Analysis. The infected cell monolayers were fixed with 3.8% formalin and treated with 3 % H 2 O 2 in methanol for 5 min.
- Immunohistochemical staining was performed by using the Vectastain Elite kit (Vector, Burlingame, CA). The primary antibody used was the an ⁇ -p53 antibody
- the biotinylated horseradish peroxidase ABC complex reagent was used to detect the antigen-antibody complex. Preadso ⁇ tion controls were used in each immunostaining experiment. The cells were then counterstained with Harris hematoxylin (Sigma Chemical Co . , St . Louis , MO) .
- Cell Growth Assay Cells were plated at a density of 2x10 4 cells/ml in 6-well plates in triplicate. Cells were infected with either wild-type (Ad5CMV-p53) or replication-deficient adenovirus as a control. Cells were harvested every 2 days, counted and their viability was determined by trypan blue exclusion.
- the levels of the 2.8-kb endogenous p53 mRNA detected in the samples isolated from mock-infected cells and from the cells infected with a replication-defective adenovirus, dl312 were similar. Up to 10-fold higher levels of exogenous 1.9-Kb p53 mRNA were present in the cells infected with Ad5CMV-p53, indicating that the exogenous p53 cDNA was successfully transduced into these cells and efficiently transcribed. Interestingly, the level of endogenous p53 mRNA in these cells was 5-fold higher than in the experimental controls. Northern blots exhibited no evidence of Ad5CMV-p53 (DNA) contamination of RNA.
- Ad5CMV-/?53 is abbreviated as p53; dl312 as an abbreviation for Ad5(dl312).
- Dulbecco's modified Eagle's medium (DMEM/F12) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and penicillin/streptomycin. Recombinant Adenovirus Preparation and Infection; Cell Growth Assay; Western Blot Analysis. All the procedures have been previously described in Example 1. Cell growth assays were all performed in triplicate.
- the immunostaining reaction was visualized by using 0.5% DAB in PBS containing 0.01 % hydrogen peroxide (pH 7.6), counterstained with 0.01 % toluidine blue, dehydrated, cleared, and mounted in Permount.
- immunoperoxidase staining was performed, using the same method as on test samples, on a known positive cytospin of a tissue culture of a squamous carcinoma cell line as well as on a negative rabbit monoclonal antibody control.
- Example 1 described the in vitro inhibition of cell growth by Ad5CMV- ?55 in SCCHN cell lines with endogenously mutated p53. This present example is to determine whether
- SCCHN cell lines with endogenous wild-type p53 would be similarly affected.
- the effect of Ad5CMW-p53 on nonmalignant fibroblasts is also investigated.
- cell line Tu-138 infected with the p53 adenovirus showed high levels of p53 protein following transduction and served as a control.
- the level of p53 expression remained similar in both mock-infected and dl312 infected cells.
- the Ad5CM W-p53 infected fibroblasts showed higher levels of p53 protein than that of the control cells. This result indicates that the p53 gene is efficiently translated into normal fibroblasts infected with Ad5CMV-/?55 as evidenced by production of immunoreactive p53 protein.
- the protein expression and transduction efficiency of cytospins of Ad5CMW-p53 infected fibroblasts were verified by immunohistochemical analysis.
- This fibroblast cell line exhibited normal growth rate and mo ⁇ hology, independent of the intervention (mock, replication-defective virus, or Ad5CMW-p53) (FIG. 4). These experiments were repeated twice and also verified in other normal human fibroblast cell lines.
- Tu-138 (homozygous mutation p53) 8/8 8/8 0/8 Tu-177 (homozygous mutation p53) 8/8 8/8 0/8 686- LN (homozygous wild-type p53) 5/8 5/8 0/8 886 (homozygous wild-type p53) 6/6 6/6 2/6
- implants of 4.0 x IO 6 or more cells significantly increased the establishment of subcutaneous implants as compared to the tumor implantation of 2.5 x 10' cells (P ⁇ 0.01), even when treated at the surgical site with Ad5CMW-p53 48 h after inoculation. Allowing implanted cells to establish for 72 or 96 h prior to the Ad5CMV-/?55 intervention similarly increased tumor take.
- Dose-response experiments established that 10 8 and 109 PFU of the Ad5CMV-p53 were equally effective in inhibiting tumor burdens of 2.5 x 10 cells implanted for 48 h (FIG. 6). Endogenous p53 status of implanted tumor cell lines (whether homozygous mutated or wild-type p53) had little impact on the effectiveness of the Ad5CMV-p53 in the cessation of tumor development.
- DNA Fragmentation Analysis Following incubation with wild-type p53 adenovirus as well as replication defective adenovirus controls at various time intervals, cells were harvested, resuspended in 300 ⁇ l of PBS with the addition of 3 ml of extraction buffer (10 mM Tris, pH 8.0, 0.1M EDTA, 20 ⁇ g/ml RNAse, 0.5% SDS) and incubated at 37°C for 1-2 h. At the end of incubation, proteinase K was added to a final concentration of 100 ⁇ g/ml and the solution placed in a 50°C water bath for at least 3 h.
- extraction buffer 10 mM Tris, pH 8.0, 0.1M EDTA, 20 ⁇ g/ml RNAse, 0.5% SDS
- DNA was extracted once with equal volume of 0.5 M Tris (pH 8.0) saturated phenol then the extraction repeated with phenol/chloroform. Precipitated DNA was analyzed in a 1 % agarose gel.
- Cell Fixation For TUNEL method, the cells were fixed in 1 % formaldehyde in PBS (pH 7.4) for 30 min on ice. Cells were then washed with 3 ml of PBS, resuspended in 70% ice-cold ethanol and stored at -20°C until used. For cell-cycle analysis, cells were fixed in 70% ice-cold ethanol only.
- Terminal Deoxynucleotidyl Transferase Assay The assay was performed according to Gorczyca et al, procedure (Gorczyca et al , 1993). Briefly, after fixation and washing, cells were resuspended in 50 ⁇ l of TdT buffer containing 0.2 M sodium cacodylate (pH 7.0), 2.5 mM Tris-HCl, 2.5 mM C 0 C1 2 (Sigma Chemical Company, St.
- the cells were incubated in the solution at 37°C for 30 min, rinsed in PBS, and resuspended in 100 ⁇ l of, FITC, the staining solution containing 4X SSC, 0.1 % Triton X-100 and 2.5 ⁇ g/ml fluoresceined avidin (Vector Labs. Inc. , Burlingame, CA). Tubes were incubated for 30 min in the dark at room temperature. Cells were rinsed in PBS with 0.1 % Triton X-100 and resuspended in 0.5 ml PBS containing propidium iodide (5 ⁇ g/ml) and 70 ⁇ l (1 mg/ml) RNAse. Tubes were incubated in the dark on ice for 30 min prior to flow cytometric analysis.
- Sections were then incubated in a moist chamber at 37°C for 1 h with an end-labeling cocktail including the following: terminal deoxynucleotidyl transferase 0.5 unit/ ⁇ l; biotinylated dUTP, 0.06 mM; 5X tdt buffer, 10 ⁇ l; double-distilled water up to 50 ⁇ l.
- the reaction was terminated by immersing the slides in a buffer containing 300 mM NaCl and 30 mM NaCitrate in double-distilled water. After the slides were washed in PBS, sections were incubated with horseradish peroxide-conjugated avidin for 1 h at 37°C in a moist chamber. Staining was developed using 3,3'-diaminobenzidine and sections were counterstained with methyl green.
- Examples above demonstrate that the wild-type p53 gene can be efficiently transduced into SCCHN cell lines by a recombinant adenoviral vector. Consequently, the insulted tumor cells lose their ability to proliferate in vitro as well as in vivo. The suppression effect is independent of the endogenous p53 status of the cell lines. Previous growth rate analyses were carried out through a week period. The present example investigates the early effects of the wild-type p53 on SCCHN cells growth (i.e. earlier time intervals, hours).
- DNA fragmentation analysis One of the characteristic markers in apoptosis that distinguishes it from necrosis is the biochemically observable appearance of the ladder of DNA fragments.
- DNA fragmentation analysis was performed. Chromosomal DNA extracted from the viable cells following the replication-defective or the wild-type p53 adenovirus infection were subjected to agarose gel electrophoresis. The appearance of DNA fragments equivalent to approximately 200 bp and their multiples was noticed in both cell lines.
- fragmented DNA appeared at 22 h following the p53 adenovirus infection in Tu-138 cell line whereas in the MDA 686LN cell line, fragmented DNA were visible at 30 h and more evident at 48 h following the wild-type p53 adenovirus infection. No detectable fragmented DNA emerged from the mock-infected and dl312-infected cells.
- TUNEL terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling
- the inventor sought to determine whether the growth suppression is, in part, due to the cell cycle arrest by the induced p21 protein or primarily a result of apoptosis.
- Western blotting showed that the p21 protein was induced in the wild-type p53 adenovirus infected SCCHN cells.
- cell cycle analyses indicated that despite the elevated level of p21 protein in the 53 adenovirus infected cells, there was no significant accumulation of cells at the Gj stage when compared to S phase.
- a linker with Accl-Kpnl compatible ends containing the sequence of the FLAG peptide including a stop codon was then ligated into the digested plasmid to create the p53-FLAG fusion gene.
- the resulting p53-FLAG fusion gene was then cloned into an expression vector with the human CMV promoter and SV polyadenylation signal.
- the final construct was subsequently inserted into a shuttle vector pXCJL. l ((Zhang et al , 1994) to generate a recombinant p53-FLAG adenovirus.
- the fourth flap served as a control and was randomized to either PBS or the replication defective adenovirus (DL312).
- RNA after Infection with AdCMV-/?53 and AdCMV-p53- FLAG Virus Both Tu-138 and MDA 686-LN were examined for expression of p53 mRNA. Total RNA was isolated after adenovirus infection. Northern blot analysis was performed. Similar levels of exogenous AdCM ⁇ -p53 mRNA were detected between AdCM V-p53 and AdCMV-/?53-FLAG infected cells. The level of p53 mRNA expression following infection with AdCMW-p53 and AdCMV- 53-FLAG were comparable for Tu-138 and for MDA 686-LN. Variation of intensity is felt to be related to loading dose.
- Endogenous expression of p53 mRNA is seen in lanes 2 and 3 in the mutated p53 cell line, Tu-138. There was no significant endogenous p53 mRNA expression in the MDA 686-LN cell line, which is wild-type for the p53 gene.
- the Tu-138 and MDA 686-LN cells infected with the Ad- CMV-p53 were also tested. No change in p53 protein expression was noted in either the replication defective adenovirus infected cells or in the mock infection group.
- the level of p53-FLAG protein expression appeared to be similar to that expressed following p53 antibody probing, but no detectable band was noted in those cells infected with the AdCM V-p53 virus.
- the mock and DL312 infected cells exhibited no detectable level of the immunoreactive p53 or FLAG protein in either cell line.
- Tu-138 and MDA 686-LN cell lines have been detailed above.
- the Tu-138 cell line has an endogenously mutated p53 gene and the MDA 686-LN cell line possesses the wild-type p53 gene.
- This study sought to determine if any difference in efficacy would be seen following recombination of the AdCMV-p53 virus by inserting the FLAG sequence.
- Mean tumor size was 637 +/- 113 mm 3 , 392 +/- 109 mm 3 , and 193 +/- 74 mm 3 for those flaps treated with 10 8 , IO 9 , and 10 10 pfu of the AdCMV-p53-FLAG respectively.
- Each animal was compared against itself using a paired t test and a significant dose response effect was noted at p ⁇ 0.05 in all comparisons except between the flap treated with IO 9 and 10 10 pfu.
- the greater the amount of virus the greater the tumor growth inhibition visualized.
- the effects of AdCM r -p53 were compared to that of the AdCMV-/?53-FLAG. No significant difference in activity was noted.
- Staining intensity and the number of cells staining positively was directly proportional to the amount of virus used in the infection. Controls were negative for staining with both p53 and FLAG antibodies in the MDA 686-LN cells. Endogenous staining for p53 was noted in the Tu-138 tumor cells. A histologic specimen stained with Hematoxylin and Eosin, the p53 antibody, and the FLAG antibody. The characteristic cytoplasmic staining with the FLAG M2 antibody contrasted with the intranuclear staining of the p53 antibody. This is the first time that the FLAG M2 antibody has been proven to be effective on paraffin-embedded fixed tissue. The staining demonstrates that the tumor suppressive effect is directed by the exogenous therapy, and that in an in vivo model one can identify the exogenous therapy using the applied FLAG system.
- a 53 year-old male patient presents with an inoperable SCCHN tumor of the head.
- the tumor mass is approximately 6.5 cm diameter.
- the patient receives a first treatment with 10 8 infectious particles of an adenovirus 7 ?53 expression construct, diluted in sterile phosphate buffered saline, via eight distinct intratumoral injections (total volume 10 ml). Every three days, the patient receives an identical treatment, until a total of six treatments have been given.
- a 44 year-old female patient presents with an operable SCCHN tumor of the neck.
- the tumor mass is approximately 2.5 cm diameter.
- the patient receives a first treatment with 5 X 10 infectious particles of an adenovirus p53 expression construct, diluted in sterile phosphate buffered saline, via three distinct intratumoral injections (total volume 3 ml). Every three days, the patient receives an identical treatment, until a total of six treatments have been given. Three days after the sixth treatment, the tumor is excised. The tumor bed is bathed in 6 ml of sterile phosphate buffered saline for 60 min.
- the inoculum is removed, the wound closed, and a drain left in the tumor bed.
- 5 X 10 infectious particles of an adenovirus »53 expression construct diluted in sterile phosphate buffered saline (total volume 3 ml) are infused via the drain.
- the inoculum is removed by suction. Sixth months following termination of treatment no primary, local or regional tumors are observed.
- adenoviral vector containing the normal "wild-type" p53 gene was delivered in logorithmically increasing doses in patients with biopsy-confirmed recurrent squamous carcinoma of the head and neck. Direct tumoral injections were performed three times weekly for two consecutive weeks. Patients were stratified into two groups: 1) resectable recurrent disease, 2) unresectable recurrent disease.
- the adenoviral vector also was delivered intraoperatively and 72 hours following the surgical procedure via retrograde catheter infusion.
- Study Subjects Twenty-one patients with advanced recurrent squamous carcinomas of the upper aerodigestive tract with an Eastern Cooperative Oncology Group performance status 2 patients were entered into one of two study arms consisting of patients with resectable (Group 1 ) or non-resectable (Group 2) recurrent malignancies. The characteristics of the study subjects and dosage of adenoviral vector are shown in Tables 6 and 7, respectively. The women all had negative pregnancy tests and all patients used contraceptive methods. Informed consent was obtained from all patients prior to study entry.
- Gene-Transfer Vector The present study employed a replication-defective adenovirus serotype 5 vector with an enhancer (cytomegalovirus)-promoter designated Ad5CMVp53.
- Ad5CMVp53 a replication-defective adenovirus serotype 5 vector with an enhancer (cytomegalovirus)-promoter designated Ad5CMVp53.
- Three lots of adenoviral vector with plaque-forming units (PFU) ranging from 10 to 10 were produced by good manufacturing practices at Magenta, Inc. and Introgen Therapeutics, Inc. and shipped frozen (-70°C) to the University of Texas, M.D. Anderson Cancer Center. Each lot was efficacious for transduction utilizing western blotting as well as an in vitro tumor cell suppression growth assays.
- Vector was thawed and diluted in phosphate-buffered saline (vehicle) immediately prior to gene transfer and transported to patient rooms at 4°C.
- the adenoviral vector was administered to five cohorts of patients each, and logarithmically increasing doses. Dosage increases were established following two weeks of observation of the last patient treated at the prior dose. Following entry of the first six patients into the study, three patients were entered at each dosage level independent of the resectable or unresectable group the patient had been stratified to.
- the dose of biologic vector is described in terms of the total dose (in plaque-forming units). The estimated number of vectors administered per malignant epithelial cell was not approximated. The total volume of administration is shown in Table 7. The volume of adenoviral vector injected into the solid malignancies was determined by the clinical and radiographic estimated tumor volume.
- the vector was directly injected into the recurrent squamous carcinomas under direct vision and by manual palpation. Injections were spaced at 1 centimeter increments across masses. After gene transfer, the subject remained under close observation for at least 1-1/2 hours. Respiratory and body secretion isolation were maintained for 72 hours following the final gene transfer of vector.
- the urine and serum samples were monitored for disseminated adenoviral vector utilizing viral culture of 293 cells as well as polymerase chain reactions (PCR) using primers that amplify the Elb region of the adenovirus and the 5' end of the wild-type p53 gene which were specific to the vector.
- PCR polymerase chain reactions
- PCR products were then southern transfered to improve viral detection to 1-5 viral particles as well as verify PCR product specificity. Positive and negative controls were assayed in each reaction.
- Ad5CMV-p53 adenoviral DNA was extracted from 0.5-ml aliquots of serum or urine by a method modified from Cunningham et al, (1995). Briefly, distilled water was added to make 1 ml, and they were precipitated with 30% polyethyleneglycol (PEG). Since SDS alone was not sufficient to release the viral DNA from its particle, proteinase K was added to the SDS at 50°C for 2-16 hours following the PEG precipitation (Norder et al, 1990). The samples were extracted with phenol, and viral DNA was precipitated with ethanol in the presence of glycogen (Cunningham et al, 1995)..
- PEG polyethyleneglycol
- the precipitated DNA was recovered by centrifuging at 14000 g for 10 minutes at 4°C, resuspended in 0.3 ml of distilled water, and reprecipitated with ethanol.
- the DNA pellet was rinsed with 70% ethanol, vacuum-dried, and dissolved in 10 ⁇ l of distilled water. Samples were either analyzed immediately or stored at -20 until used. Extraction of nucleic acids was performed under biologic safety cabinet hoods to prevent possible cross- contamination of specimens.
- PCR Reactions on DNA Isolated from Serum Samples were designed for specific amplification of the p53 gene from the adenoviral vector.
- the upper primer (5'-CACTGCCCAACAACACCA-3 ⁇ SEQ ID NO:5) corresponds to the 3' end of the p53 gene and the lower primer (5'-GCCACGCCCACACATTT-3' SEQ ID NO:6) corresponds to the ElB region of adenovirus type 5 (nucleotides 3517 to 3533 of the wild-type sequence).
- Each PCR reaction tube contained 0.2 mM of each oligonucleotide, 0.4 mM dNTPs, IX TaqPlus Long low salt buffer (from Stratagene), 0.6 ⁇ l TaqPlus Long (5U/ml) (from Stratagene), and 5 ⁇ l of test DNA.
- the samples were placed in an MJ Research Peltier Thermal Cycler (PTC-200) programmed for 93°C for 3 minutes, with the following three-step profile: 93°C for 30 seconds, 65°C for 45 seconds and 72°C for 45 seconds for a total of 30 or 35 cycles.
- PCR Polymerase Chain Reaction
- PCR Polymerase Chain Reaction
- the PCR was performed in a 20- ⁇ l volume containing 2 mM MgCl 2 , 50 mM KCI, 0.1% Triton X-l 00, 200 ⁇ M each of deoxyribonucleoside triphosphates (dNTP), 10 mM Tris-HCl (pH 9.0), 5 ⁇ M each of the primers, and 1.7 units of Taq DNA polymerase (Promega).
- the reactions were carried out at 94°C for 30 sec, 58°C for 30 sec, and 72°C for 60 sec for 35 cycles, followed by a 10-min extension at 72°C.
- the PCR primers were selected from the sequence of the Ad5CMV-p53 with the sense primer located at the 3' end of the p53 cDNA (5'-GCCTGTCCTGGGAGAGACCG-3 ⁇ SEQ ID NO:7). and the antisense primer was selected from the ElB region of adenovirus type 5 (5'- CCCTTAAGCCACGCCCACAC-3', SEQ ID NO:8).
- the PCR product (an 838-bp fragment) was separated on 1% agarose gel. The same PCR product was subcloned into pCR-Script vector (Stratagene), sequenced, and the gel purified insert was used as a probe to detect the PCR product.
- the PCR was performed in a 20- ⁇ l volume containing 2 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4 , 10 mM KCI, 0.1% Triton X- 100, 20 mM Tris-HCl (pH 8.8), 0.1 mg/ml bovine serum albumin, 200 ⁇ M each of deoxyribonucleoside triphosphates (dNTP), 5 ⁇ M each of the primers, and 2.5 units of TaqPlus long DNA polymerase (Stratagene). The reactions were carried out at 93°C for 60 sec, and then 93°C for 30 sec, 65°C for 45 sec, and 72°C for 45 sec for 35 cycles, followed by a 10-min extension at 72°C.
- the PCR primers were selected from the sequence of the Ad5CMV-p53 with the sense primer located at the 3' end of the p53 cDNA (5*-CACTGCCCAACAACACCA-3 ⁇ SEQ ID NO:9), and the antisense primer was selected from the ElB region of adenovirus type 5 (5'- GCCACGCCCACACATTT-3", SEQ ID NO: 10).
- the PCR product (an 724-bp fragment) was separated on 1% agarose gel.
- Southern Blot Analysis In the Southern blot used to verify the PCR product's specificity, the DNA in the gel was denatured and neutralized before blotting to nylon membrane (Hybond-N+, Amersham) by capillary abso ⁇ tion. The membrane was prehybridized for 15 min at 65°C in Rapid-hyb buffer (Amersham) and hybridized in the same buffer containing P-labeled probe for 1-2 h. The membrane was washed in 0.1 x SSC and 0.1% SDS at room temperature twice, and again twice at 65 °C (15 min per wash). The washed membrane was exposed to x-ray film at -70°C for 1-16 h with intensifying screen.
- Rapid-hyb buffer Amersham
- Controls and scoring of test samples The following controls were included with every batch of samples.
- two "negative" serum controls pooled and aliquoted serum from Introgen employees
- two positive controls consisting of negative serum spiked with Opfu or 100 pfu of AdCMV-p53 virus were employed. This was done to obtain a window of sensitivity where the 10 (and 100) pfu controls were positive, but the negative controls were negative. If the negative controls were positive, the PCR was repeated with only 30 cycles. If the 10 pfu control was negative, the DNA was further purified with an additional ethanol precipitation, and the PCR was repeated. The above two steps always placed the experimental parameters into the appropriate sensitivity window.
- Pulverized tissue was transferred to a glass tissue homogenizer (Fisher Scientific, Pittsburgh, PA) containing 1 ml TRI reagent (Molecular Research, Cincinnati, OH) per 50 mg tissue, and homogenized by five to ten up and down strokes with a Teflon pestle.
- a glass tissue homogenizer Fisher Scientific, Pittsburgh, PA
- 1 ml TRI reagent Molecular Research, Cincinnati, OH
- RNA pellets were recovered by centrifugation at 12,000 x g for 15 min at 4°C, washed once with 75% ethanol, air dried, dissolved in diethyl pyrocarbonate (DEPC)-treated water and quantitated by measuring the absorbance at 260 nm. Contaminating DNA was removed by incubating up to 50 ⁇ g RNA with 60 U DNase I (Pharmacia, Piscataway, NJ) for 25 min at 37°C in a total reaction volume of 260 ⁇ l.
- DEPC diethyl pyrocarbonate
- RNA was then extracted with phenol xhloroform, ethanol precipitated, washed once with 75% ethanol, pelleted by centrifugation at maximum speed in a microfuge for 15 min at 4°C, air dried, resuspended in DEPC-water, and stored at -80°C.
- the quality of RNA was assessed by running samples on an ordinary non-denaturing 0.8% agarose gel and visualizing the 28S and 18S ribosomal bands by ethidium bromide staining.
- Reverse transcription was performed using 1.5 ⁇ g total cellular RNA in a 23.5 ⁇ l reaction mix containing 1 1 1 ng random hexamers (Gibco BRL, Grand Island, NY), 40 units RNase inhibitor (Boehringer Mannheim, Indianapolis, IN), 0.4 mM of each dNTP (Perkin Elmer, Foster City, CA), and 300 units of Superscript II RNase H " reverse transcriptase (Gibco BRL) in 1 x RT buffer (50 mM Tris pH 8.3, 75 mM potassium chloride, 3 mM magnesium chloride, and 20 mM dithiothreitol).
- RNA and random hexamers were heated to 70°C for 10 min and cooled on ice before the rest of the reaction mix was added. The reaction was incubated at 25°C for 5 min with 200 units reverse transcriptase, and then an additional 10 min at 25°C following addition of another 100 units reverse transcriptase, to facilitate primer annealing, before incubating at 42°C for 50 min. The RT-reactions were terminated by heat inactivating the reverse transcriptase for 15 min at 70°C. RNA complementary to cDNA was removed by digestion with 1 unit RNase H (Boehringer Mannheim) for 20 min at 37°C.
- RNase H Boehringer Mannheim
- RNA from the head and neck squamous cell carcinoma (HNSCC) line TU167 infected with recombinant adenovirus Ad5CM -p53 (multiplicity of infection of 100:1) was used as a positive control for detecting virally transcribed p53, and TU167 cells infected with the variant adenovirus vector dl312 (1 ) that does not contain the p53 transeriptional unit was used as a negative control.
- PCR was performed in a reaction volume of 30 ⁇ l containing 0.2 mM of each dNTP, 1.5 mM magnesium chloride, 1 unit taq polymerase (Promega, Madison, WI), and 0.5 mM of each primer CMV2 (5' GGTGCATTGGAACGCGGATT, SEQ ID NO: 1 1 ) and P53EX3 (5' GGGGACAGAACGTTGTTTTC, SEQ ID NO: 12) in 1 x PCR buffer (50 mM potassium chloride, 10 mM Tris pH 9.0, 0.1% Triton X-l 00). Primers CMV2 and P53EX3 amplify a 295-base fragment specific to the adenovirus derived p53 transcript. PCR conditions for detecting Ad5CMV-p53 transcripts were as follows:
- PCR was also performed using RT products from parallel reactions in which no reverse transcriptase was added.
- RT-PCR specific for glyceraldehyde-3-phosphate dehydrogenase was performed in order to check the integrity of the RT reactions.
- a 3 ⁇ l volume of the RT reaction was diluted in 30 ⁇ l of PCR mix containing 0.2 mM of each DNTP, 2 mM magnesium chloride, 1 unit taq polymerase, and 0.5 mM of each primer GAPDH 1 (5' ACGGATTTGGTCGTATTGGG, SEQ ID NO: 13) and GAPDH2 (5' TGATTTTGGAGGGATCTCGC, SEQ ID NO: 14) in 1 x PCR buffer.
- the GAPDH primers span 3 exons in the human GAPDH gene and amplify a 231 -base product specific for mRNA.
- PCR conditions to detect GAPDH were as follows: 94°C for 1 min, followed by 94°C for 30 sec, 60°C for 12 sec, 72°C for 1 min for 35 cycles, and 72°C for 7 min extension time.
- PCR was performed using a Perkin Elmer Gene Amp 9600 thermocylcer, and all primers were commercially synthesized (Genosys, Woodlands, TX).
- Peroxidase staining procedure was done using ABC Elite kits (Vector Laboratories,
- TUNEL Assay for DNA Fragmentation was performed using the Apoptag PLUS kit (Oncor, Gaithersburg, M.D.) according to instructions provided by the manufacturer. Slides were counterstained with .4% methelene green.
- Cytopathic Effect Assay Procedure Patient urine samples also were monitored for the presence of Ad5p53 by an assay in which any virus in the sample is allowed to infect a recipient cell monolayer. Those cells are monitored for the appearance of a cytopathic effect (CPE): the cells round up and detach from the surface.
- CPE cytopathic effect
- the urine samples were thawed in an ice bath, and an aliquot was mixed 1 : 1 with DMEM and sterile-filtered using a 0.22 ⁇ m syringe filter. A 350 ⁇ l aliquot of this 1 : 1 mix was slowly added to each well after removing the growth medium. The plate was gently rocked 15 minutes later. After 30 minutes, 2.0 mis of DMEM plus 10% FBS was added to each well to dilute the sample. On day 3 (72 hours later) and day 6 of the assay, 0.5 ml aliquots of fresh medium were added to each well, to help maintain the cell monolayer for the maximum 6-7 days.
- the time at which CPE is detected in each patient sample indicates the level of Ad5p53 in that sample.
- Reco binant Competent Adenovirus Reco binant Competent Adenovirus.
- the adenoviral p53 used in the clinical trial was tested for the presence of RCA using A549 cells by the Biotechnology Services Division of Microbiological Associates, Inc., (Rockville, Maryland).
- Adenoviral -vector DNA was detected by PCR in serum as well as urine samples from patients up to 48 hours following gene transfer.
- the detection limit for vector is 1-5 viral particles.
- Viral DNA was isolated in urine among patients undergoing gene transfer at each viral dosage, but not detected after 48 hours following gene transfer. Serum detection of viral DNA increased with increasing viral dosage above 10 PFU, but was also not detectable 48 hours following gene transfer.
- Urine samples were first analyzed for infectious virus, measured CPE on cell monolayers, prior to PCR nucleotide analysis
- the virus present in the urine was applied to 293 cells as described above, in order to monitor the CPE, which is observed as the cells round up and become from the petri dish.
- CPE was identified rarely in specimens.
- CPE was found late in overlay cultures (greater tnan six days) and these results were considered equivocable. In no instance was CPE confirmed by PCR and Southern blot transfer of the same urine sample for detected adenoviral nucleotides.
- PCR analysis demonstrated viral DNA greater than two months following 10 Ad5CMVp53 gene transfer in skin, cardiac muscle, lung, and testicular tissues in snap frozen autopsy specimens carefully sampled to prevent cross-contamination between tissues. Renal parenchyma, adrenal glands and pancreatic tissues did not show viral DNA sequences specific for this vector. Immunohistochemical analysis of these autopsy specimens (did not reveal evidence of wild-type p53 protein product overexpression).
- Adenovirus serotype 5 antibodies were induced in all patients following repeat injections of the vector. However, transduction efficiency was not found to be significiantly altered comparing the initial cycle of gene transfer and subsequent cycles. Mild tumor injection site erythema was recognized beginning at 3 x 10 PFU., however these local reactions did not limit vector tolerance. No evidence of systemic hypersensitivity was found in any patients despite repeat viral dosing for as much as six consecutive months in a 10 9 PFU-treated patient.
- adenovirally mediated gene transfer of wild-type p53 is safe and can effectively transduce cancer and normal cells via direct tumoral injections or intraoperative instillation of vector. None of the patients exhibited toxicity that might limit vector administration or dose escalation. Transgene product expression was unaltered despite development of a systemic antibody response. The local inflammatory responses found pathologically within resected tumor specimens may, in fact, be beneficial.
- Boshart et al. "A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus," Cell, 41 :521-530, 1985.
- Fridman et al "The minimal fragments of c-Raf-1 and NF1 that can suppress a v-Haras-induced phenotype," J. Biol. Chem., 269:30105-30108, 1 94.
- Hermonat and Muzycska "Use of adenoassociated virus as a mammalian DNA cloning vector: Transduction of neomycin resistance into mammalian tissue culture cells," Proc. Nat'l Acad. Sci. USA, 81 :6466-6470, 1984.
- Herz and Gerard "Adenovirus-mediated transfer of low density lipoprotein receptor gene acutely accelerates cholesterol clearance in normal mice,” Proc. Nat'l Acad. Sci. USA 90:2812-2816, 1993.
- Kaneda et al "Increased expression of DNA cointroduced with nuclear protein in adult rat liver," Science, 243:375-378, 1989.
- Ragot et al "Efficient adenovirus-mediated transfer of a human minidystrophin gene to skeletal muscle of mdx mice," Nature, 361 :647-650, 1993.
- Ramqvist et al "Wild-type p53 induces apoptosis in a Burkitt lymphoma (BL) line that carries mutant p53 " Oncogene, 8: 1495-1500, 1993.
- Tur-Kaspa et al "Use of electroporation to introduce biologically active foreign genes into primary rat hepatocytes," Mol. Cell Biol, 6:716-718, 1986.
- Wijsman et al "A new method to detect apoptosis in parriffin section: in situ end-labeling of fragmented DNA," J Histochem. Cytochem. , 41 :7-12, 1993.
- CAAAACCTAC CAGGGCAGCT ACGGTTTCCG TCTGGGCTTC TTGCATTCTG GGACAGCCAA 60
- CAAAACTTAC CAGGGCAACT ATGGCTTCCA CCTGGGCTTC CTGCAGTCTG GGACAGCCAA 60 ⁇
- TCCCCACTGA CAGCCTCCCA CCCCCATCTC TCCCTCCCCT GCCTTTTGGG TTTTGGGTCT 960
- a method for treating a subject with a malignancy comprising the steps of:
- said viral vector is selected from the group consisting of a retroviral vector, an adenoviral vector and an adeno-associated viral vector.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Wood Science & Technology (AREA)
- Toxicology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| NZ324168A NZ324168A (en) | 1995-11-30 | 1996-11-27 | Improved methods for the treatment of squamous cell carcinomas by providing expression construct comprising functional p53 and CMV promoter and method for determining effectiveness of the therapy on residual cancer |
| KR1019980704074A KR19990071795A (ko) | 1995-11-30 | 1996-11-27 | 암 진단 및 치료를 위한 방법과 조성물 |
| JP9520700A JP2000501394A (ja) | 1995-11-30 | 1996-11-27 | ガンの診断および処置のための方法および組成物 |
| AU11263/97A AU722042B2 (en) | 1995-11-30 | 1996-11-27 | Methods and compositions for the diagnosis and treatment of cancer |
| PL96327009A PL186018B1 (pl) | 1995-11-30 | 1996-11-27 | Sposoby i kompozycje do diagnozowania i leczenia nowotworu |
| SK705-98A SK70598A3 (en) | 1995-11-30 | 1996-11-27 | Methods and compositions for the diagnosis and treatment of cancer |
| DE69636120T DE69636120T2 (de) | 1995-11-30 | 1996-11-27 | Verfahren und zusammensetzungen zur behandlung von krebs |
| EP96942100A EP0863984B1 (en) | 1995-11-30 | 1996-11-27 | Methods and compositions for the treatment of cancer |
| NO19982481A NO982481L (no) | 1995-11-30 | 1998-05-29 | Fremgangsmater og blandinger for diagnose og behandling av kreft |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US781095P | 1995-11-30 | 1995-11-30 | |
| US60/007,810 | 1995-11-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1997020047A1 true WO1997020047A1 (en) | 1997-06-05 |
Family
ID=21728237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1996/019083 Ceased WO1997020047A1 (en) | 1995-11-30 | 1996-11-27 | Methods and compositions for the diagnosis and treatment of cancer |
Country Status (19)
| Country | Link |
|---|---|
| US (3) | US20020077313A1 (https=) |
| EP (1) | EP0863984B1 (https=) |
| JP (1) | JP2000501394A (https=) |
| KR (1) | KR19990071795A (https=) |
| CN (2) | CN101028523A (https=) |
| AT (1) | ATE325872T1 (https=) |
| AU (1) | AU722042B2 (https=) |
| CA (1) | CA2238829A1 (https=) |
| CZ (1) | CZ296810B6 (https=) |
| DE (1) | DE69636120T2 (https=) |
| DK (1) | DK0863984T3 (https=) |
| ES (1) | ES2264145T3 (https=) |
| HU (1) | HUP9902068A3 (https=) |
| NO (1) | NO982481L (https=) |
| NZ (1) | NZ324168A (https=) |
| PL (1) | PL186018B1 (https=) |
| RU (1) | RU2174409C2 (https=) |
| SK (1) | SK70598A3 (https=) |
| WO (1) | WO1997020047A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004078987A1 (en) * | 2003-03-06 | 2004-09-16 | Zhaohui Peng | A recombinant constructed by a virus vector and a human tumor suppressor gene and its use |
| US7736674B2 (en) | 2005-01-07 | 2010-06-15 | Biolex Therapeutics, Inc. | Controlled release compositions for interferon based on PEGT/PBT block copolymers |
Families Citing this family (71)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2278399T3 (es) * | 1996-11-20 | 2007-08-01 | Introgen Therapeutics, Inc. | Metodo mejorado para la produccion y purificacion de vectores adenovirales. |
| US6689600B1 (en) | 1998-11-16 | 2004-02-10 | Introgen Therapeutics, Inc. | Formulation of adenovirus for gene therapy |
| RU2219553C2 (ru) * | 2001-10-18 | 2003-12-20 | Ростовский научно-исследовательский онкологический институт | Способ определения эффективности аутогемохимиотерапии рака ректосигмоидного отдела прямой кишки и сигмовидной кишки, а также аутогемохимиотерапии в сочетании с свч-гипертермией рака прямой кишки |
| GB0212046D0 (en) * | 2002-05-24 | 2002-07-03 | Glaxo Group Ltd | Vaccines |
| CA2496918A1 (en) * | 2002-08-28 | 2004-03-11 | Introgen Therapeutics Inc. | Chromatographic methods for adenovirus purification |
| US20050032728A1 (en) * | 2002-12-17 | 2005-02-10 | Sidney Kimmel Cancer Center | Tumor suppression through bicistronic co-expression of p53 and p14ARF |
| EP1587544A4 (en) * | 2002-12-27 | 2006-05-10 | Introgen Therapeutics Inc | P53 TREATMENT OF PAPILLOMA VIRUSES AND CELLS TRANSFORMED BY CARCINOGEN IN HYPERPLASTIC LESIONS |
| US7534427B2 (en) * | 2002-12-31 | 2009-05-19 | Immunomedics, Inc. | Immunotherapy of B cell malignancies and autoimmune diseases using unconjugated antibodies and conjugated antibodies and antibody combinations and fusion proteins |
| RU2234099C1 (ru) * | 2003-03-18 | 2004-08-10 | Российская медицинская академия последипломного образования | Способ дифференциальной диагностики стадий канцерогенеза |
| RU2242936C1 (ru) * | 2003-04-21 | 2004-12-27 | Ростовский научно-исследовательский онкологический институт | Способ лечения рака легкого |
| US7749698B2 (en) * | 2004-02-23 | 2010-07-06 | Novartis Ag | p53 wild-type as biomarker for the treatment with mTOR inhibitors in combination with a cytotoxic agent |
| CA2557326A1 (en) * | 2004-02-24 | 2005-09-09 | Introgen Therapeutics, Inc. | Combination of ad-p53 and chemotherapy for the treatment of tumours |
| CN100333797C (zh) * | 2005-01-26 | 2007-08-29 | 彭朝晖 | 重组腺病毒p53制品在肿瘤治疗中的新用途 |
| RU2245551C1 (ru) * | 2004-04-23 | 2005-01-27 | Белохвостов Александр Сергеевич | Способ диагностики онкологических заболеваний |
| RU2263494C1 (ru) * | 2004-06-08 | 2005-11-10 | ГУ НИИ глазных болезней РАМН | Способ моделирования меланомы роговицы |
| MX2007002415A (es) * | 2004-08-31 | 2007-04-23 | Novartis Ag | Uso de midostaurina para el tratamiento de tumores estromales gastrointestinales. |
| CA2592177A1 (en) * | 2005-01-21 | 2006-07-27 | Genentech, Inc. | Fixed dosing of her antibodies |
| AU2006207987B2 (en) * | 2005-01-27 | 2011-09-15 | Novartis Vaccines And Diagnostics Inc. | Methods for treating renal cell carcinoma |
| AU2006246259B2 (en) * | 2005-05-06 | 2010-02-11 | Orthosoft Inc. | RF system for tracking objects |
| WO2007090125A2 (en) * | 2006-01-30 | 2007-08-09 | Introgen Therapeutics, Inc. | Prognostic factors for anti-hyperproliferative disease gene therapy |
| EP2426142A3 (en) | 2006-10-16 | 2012-06-13 | Genelux Corporation | Modified vaccinia virus strains for use in a diagnostic and therapeutic method |
| US20080299182A1 (en) * | 2007-03-01 | 2008-12-04 | Shuyuan Zhang | Methods and formulations for topical gene therapy |
| WO2008150496A2 (en) * | 2007-05-31 | 2008-12-11 | Genelux Corporation | Assay for sensitivity to chemotherapeutic agents |
| RU2371202C2 (ru) * | 2007-07-30 | 2009-10-27 | Государственное учреждение научно-исследовательский институт онкологии Томского Научного центра Сибирского отделения Российской академии медицинских наук (ГУ НИИ онкологии ТНЦ СО РАМН) | Способ радионуклидной диагностики рака молочной железы |
| MX2010008168A (es) | 2008-01-25 | 2011-02-24 | P53 Inc | Biomarcadores p53. |
| US8314068B2 (en) * | 2008-04-14 | 2012-11-20 | University Hospitals Of Cleveland | P2X7 inhibition of epithelial cancers and papillomas |
| WO2009139921A2 (en) * | 2008-05-16 | 2009-11-19 | Genelux Corporation | Microorganisms for preventing and treating neoplasms accompanying cellular therapy |
| CN102361985B (zh) * | 2008-12-04 | 2017-06-20 | 库尔纳公司 | 通过抑制肿瘤抑制基因的天然反义转录物治疗肿瘤抑制基因相关性疾病 |
| RU2384845C1 (ru) * | 2008-12-18 | 2010-03-20 | ФГУП Государственный научно-исследовательский институт особо чистых биопрепаратов ФМБА | Способ диагностики онкологических заболеваний |
| EP2391638B1 (en) * | 2009-02-02 | 2018-06-27 | GlaxoSmithKline Biologicals SA | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
| US9050276B2 (en) | 2009-06-16 | 2015-06-09 | The Trustees Of Columbia University In The City Of New York | Autism-associated biomarkers and uses thereof |
| RU2395234C1 (ru) * | 2009-07-24 | 2010-07-27 | Учреждение Российской Академии Наук Институт Молекулярной Биологии Им. В.А. Энгельгардта Ран (Имб Ран) | ОПРЕДЕЛЕНИЕ СНИЖЕНИЯ УРОВНЯ мРНК ГЕНА ZG16 КАК СПОСОБ ДИАГНОСТИКИ РАКА ТОЛСТОЙ КИШКИ И НАБОР ДЛЯ ЕГО ОСУЩЕСТВЛЕНИЯ |
| WO2012051567A2 (en) | 2010-10-15 | 2012-04-19 | The Trustees Of Columbia University In The City Of New York | Obesity-related genes and their proteins and uses thereof |
| ES2746554T3 (es) | 2010-11-02 | 2020-03-06 | Univ Columbia | Métodos para tratar los trastornos de pérdida de cabello |
| CN114262690A (zh) | 2011-04-15 | 2022-04-01 | 吉恩勒克斯公司 | 减毒的痘苗病毒的克隆毒株及其使用方法 |
| CN102352368B (zh) * | 2011-09-29 | 2013-12-04 | 苏州大学 | Ing4与osm双基因共表达载体及其应用 |
| AU2012348332B2 (en) * | 2011-12-08 | 2017-06-29 | Haifeng Chen | Vectors harboring toxic genes, methods and uses therefor |
| JP6052914B2 (ja) | 2012-01-12 | 2016-12-27 | シナプティクス インコーポレイテッド | 単層容量型イメージングセンサ |
| CA2862038C (en) * | 2012-02-15 | 2021-05-25 | Aileron Therapeutics, Inc. | Peptidomimetic macrocycles |
| US10039777B2 (en) | 2012-03-20 | 2018-08-07 | Neuro-Lm Sas | Methods and pharmaceutical compositions of the treatment of autistic syndrome disorders |
| EP3459565A1 (en) | 2012-03-29 | 2019-03-27 | The Trustees of Columbia University in the City of New York | Methods for treating hair loss disorders |
| CA2907152A1 (en) | 2013-03-15 | 2014-09-25 | The Trustees Of Columbia University In The City Of New York | Fusion proteins and methods thereof |
| MX2015013658A (es) * | 2013-03-27 | 2016-02-18 | Ge Healthcare As | Metodo y reactivo para preparar una composicion diagnostica. |
| CA2915973A1 (en) * | 2013-06-18 | 2014-12-24 | Dnatrix, Inc. | Treatment of brain cancer with oncolytic adenovirus |
| US9552089B2 (en) | 2013-08-07 | 2017-01-24 | Synaptics Incorporated | Capacitive sensing using a matrix electrode pattern |
| US10042489B2 (en) | 2013-09-30 | 2018-08-07 | Synaptics Incorporated | Matrix sensor for image touch sensing |
| US9298325B2 (en) | 2013-09-30 | 2016-03-29 | Synaptics Incorporated | Processing system for a capacitive sensing device |
| US20150091842A1 (en) | 2013-09-30 | 2015-04-02 | Synaptics Incorporated | Matrix sensor for image touch sensing |
| US9459367B2 (en) | 2013-10-02 | 2016-10-04 | Synaptics Incorporated | Capacitive sensor driving technique that enables hybrid sensing or equalization |
| US9274662B2 (en) | 2013-10-18 | 2016-03-01 | Synaptics Incorporated | Sensor matrix pad for performing multiple capacitive sensing techniques |
| US9081457B2 (en) | 2013-10-30 | 2015-07-14 | Synaptics Incorporated | Single-layer muti-touch capacitive imaging sensor |
| US9682123B2 (en) | 2013-12-20 | 2017-06-20 | The Trustees Of Columbia University In The City Of New York | Methods of treating metabolic disease |
| US9798429B2 (en) | 2014-02-28 | 2017-10-24 | Synaptics Incorporated | Guard electrodes in a sensing stack |
| CN104357408A (zh) * | 2014-03-13 | 2015-02-18 | 哈尔滨博翱生物医药技术开发有限公司 | 一种重组新城疫病毒及其应用 |
| US10133421B2 (en) | 2014-04-02 | 2018-11-20 | Synaptics Incorporated | Display stackups for matrix sensor |
| US9927832B2 (en) | 2014-04-25 | 2018-03-27 | Synaptics Incorporated | Input device having a reduced border region |
| US9690397B2 (en) | 2014-05-20 | 2017-06-27 | Synaptics Incorporated | System and method for detecting an active pen with a matrix sensor |
| LT3201234T (lt) | 2014-09-30 | 2019-03-12 | Diadem S.R.L. | Antikūnas, surišantis linijinį žmogaus p53 epitopą, ir jo panaudojimas diagnostikai |
| EP3778644A3 (en) | 2014-12-23 | 2021-06-02 | The Trustees of Columbia University in the City of New York | Fgfr-tacc fusion proteins and methods thereof |
| US10175827B2 (en) | 2014-12-23 | 2019-01-08 | Synaptics Incorporated | Detecting an active pen using a capacitive sensing device |
| US10990148B2 (en) | 2015-01-05 | 2021-04-27 | Synaptics Incorporated | Central receiver for performing capacitive sensing |
| US9939972B2 (en) | 2015-04-06 | 2018-04-10 | Synaptics Incorporated | Matrix sensor with via routing |
| US9720541B2 (en) | 2015-06-30 | 2017-08-01 | Synaptics Incorporated | Arrangement of sensor pads and display driver pads for input device |
| US9715304B2 (en) | 2015-06-30 | 2017-07-25 | Synaptics Incorporated | Regular via pattern for sensor-based input device |
| US10095948B2 (en) | 2015-06-30 | 2018-10-09 | Synaptics Incorporated | Modulation scheme for fingerprint sensing |
| CN205028263U (zh) | 2015-09-07 | 2016-02-10 | 辛纳普蒂克斯公司 | 一种电容传感器 |
| US10037112B2 (en) | 2015-09-30 | 2018-07-31 | Synaptics Incorporated | Sensing an active device'S transmission using timing interleaved with display updates |
| US10067587B2 (en) | 2015-12-29 | 2018-09-04 | Synaptics Incorporated | Routing conductors in an integrated display device and sensing device |
| CN106933400B (zh) | 2015-12-31 | 2021-10-29 | 辛纳普蒂克斯公司 | 单层传感器图案和感测方法 |
| WO2018071814A1 (en) | 2016-10-14 | 2018-04-19 | The Trustees Of Columbia University In The City Of New York | Methods of treating alcohol abuse disorder |
| RU2760993C1 (ru) * | 2021-02-15 | 2021-12-02 | Сергей Александрович Никитин | Способ рентгеновской терапии рака легких |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995012660A2 (en) * | 1993-10-29 | 1995-05-11 | Board Of Regents, The University Of Texas System | Recombinant p53 adenovirus methods and compositions |
| WO1995028948A1 (en) * | 1994-04-25 | 1995-11-02 | Board Of Regents, The University Of Texas System | Compositions comprising dna damaging agents and p53 |
Family Cites Families (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4740463A (en) * | 1984-04-13 | 1988-04-26 | Massachusetts Institute Of Technology | Methods and artificial genes for antagonizing the function of an oncogene |
| ZA858044B (en) * | 1984-11-01 | 1987-05-27 | American Home Prod | Oral vaccines |
| US4748022A (en) * | 1985-03-25 | 1988-05-31 | Busciglio John A | Topical composition |
| US4822605A (en) * | 1986-02-18 | 1989-04-18 | Exovir, Inc. | Compositions and methods employing the same for the treatment of viral and cancerous skin lesions and the like |
| US5055400A (en) * | 1986-11-26 | 1991-10-08 | University Of Guelph | Leukotoxin gene of pasteurella haemolytica |
| US5166320A (en) * | 1987-04-22 | 1992-11-24 | University Of Connecticut | Carrier system and method for the introduction of genes into mammalian cells |
| US4980289A (en) * | 1987-04-27 | 1990-12-25 | Wisconsin Alumni Research Foundation | Promoter deficient retroviral vector |
| US5532220A (en) * | 1987-08-31 | 1996-07-02 | The Regents Of The University Of California | Genetic mechanisms of tumor suppression |
| US5017524A (en) * | 1989-02-13 | 1991-05-21 | Iscar Ltd. | Ceramic cutting tool |
| US6800617B1 (en) * | 1989-03-29 | 2004-10-05 | The Johns Hopkins University | Methods for restoring wild-type p53 gene function |
| US5362623A (en) * | 1991-06-14 | 1994-11-08 | The John Hopkins University | Sequence specific DNA binding by p53 |
| US6677312B1 (en) * | 1989-03-29 | 2004-01-13 | The Johns Hopkins University | Methods for restoring wild-type p53 gene function |
| US5527676A (en) * | 1989-03-29 | 1996-06-18 | The Johns Hopkins University | Detection of loss of the wild-type P53 gene and kits therefor |
| US5328470A (en) * | 1989-03-31 | 1994-07-12 | The Regents Of The University Of Michigan | Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor |
| US5585362A (en) * | 1989-08-22 | 1996-12-17 | The Regents Of The University Of Michigan | Adenovirus vectors for gene therapy |
| WO1992015680A1 (en) * | 1991-03-06 | 1992-09-17 | Board Of Regents, The University Of Texas System | Methods and compositions for the selective inhibition of gene expression |
| US5252479A (en) * | 1991-11-08 | 1993-10-12 | Research Corporation Technologies, Inc. | Safe vector for gene therapy |
| FR2688514A1 (fr) * | 1992-03-16 | 1993-09-17 | Centre Nat Rech Scient | Adenovirus recombinants defectifs exprimant des cytokines et medicaments antitumoraux les contenant. |
| US5496731A (en) * | 1993-03-25 | 1996-03-05 | Xu; Hong-Ji | Broad-spectrum tumor suppressor genes, gene products and methods for tumor suppressor gene therapy |
| TW442569B (en) * | 1993-10-25 | 2001-06-23 | Canji Inc | Recombinant adenoviral vector |
| JP3816518B2 (ja) * | 1994-06-10 | 2006-08-30 | ジェンベク、インコーポレイティッド | 相補的なアデノウイルスベクター系と細胞系 |
-
1996
- 1996-11-27 RU RU98111928/14A patent/RU2174409C2/ru active
- 1996-11-27 KR KR1019980704074A patent/KR19990071795A/ko not_active Ceased
- 1996-11-27 AT AT96942100T patent/ATE325872T1/de active
- 1996-11-27 WO PCT/US1996/019083 patent/WO1997020047A1/en not_active Ceased
- 1996-11-27 NZ NZ324168A patent/NZ324168A/en not_active IP Right Cessation
- 1996-11-27 HU HU9902068A patent/HUP9902068A3/hu unknown
- 1996-11-27 CN CNA2007100051249A patent/CN101028523A/zh active Pending
- 1996-11-27 AU AU11263/97A patent/AU722042B2/en not_active Expired
- 1996-11-27 JP JP9520700A patent/JP2000501394A/ja not_active Ceased
- 1996-11-27 DK DK96942100T patent/DK0863984T3/da active
- 1996-11-27 ES ES96942100T patent/ES2264145T3/es not_active Expired - Lifetime
- 1996-11-27 CZ CZ0165798A patent/CZ296810B6/cs not_active IP Right Cessation
- 1996-11-27 SK SK705-98A patent/SK70598A3/sk unknown
- 1996-11-27 EP EP96942100A patent/EP0863984B1/en not_active Expired - Lifetime
- 1996-11-27 PL PL96327009A patent/PL186018B1/pl unknown
- 1996-11-27 DE DE69636120T patent/DE69636120T2/de not_active Expired - Lifetime
- 1996-11-27 CN CNB961995858A patent/CN1308450C/zh not_active Expired - Lifetime
- 1996-11-27 CA CA002238829A patent/CA2238829A1/en not_active Abandoned
-
1998
- 1998-05-29 NO NO19982481A patent/NO982481L/no not_active Application Discontinuation
-
2001
- 2001-10-01 US US09/968,958 patent/US20020077313A1/en not_active Abandoned
-
2003
- 2003-03-24 US US10/395,864 patent/US20030166603A1/en not_active Abandoned
-
2005
- 2005-08-09 US US11/200,527 patent/US20060035857A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995012660A2 (en) * | 1993-10-29 | 1995-05-11 | Board Of Regents, The University Of Texas System | Recombinant p53 adenovirus methods and compositions |
| WO1995028948A1 (en) * | 1994-04-25 | 1995-11-02 | Board Of Regents, The University Of Texas System | Compositions comprising dna damaging agents and p53 |
Non-Patent Citations (5)
| Title |
|---|
| CLAYMAN ET AL: "IN VIVO MOLECULAR THERAPY WITH P53 ADENOVIRUS FOR MICROSCOPIC RESIDUAL HEAD AND NECK SQUAMOUS CARCINOMA", CANCER RESEARCH, vol. 55, 1 January 1995 (1995-01-01), pages 1 - 6, XP002027382 * |
| DATABASE CHEMICAL ABSTRACTS FILE SERVER STN KARLSRUHE; CHIANG ET AL: "EXPRESSION AND PURIFICATION OF GENERAL TRANSCRIPTION FACTORS BY FLAG EPITOPE-TAGGING AND PEPTIDE ELUTION", XP002027384 * |
| LIU ET AL: "APOPTOSIS INDUCTION MEDIATED BY WILD-TYPE P53 ADENOVIRAL GENE TRANSFER IN SQUAMOUS CELL CARCINOMA OF THE HEAD AND NECK", CANCER RESEARCH, vol. 55, 15 July 1995 (1995-07-15), pages 3117 - 3122, XP002027381 * |
| LIU ET AL: "GROWTH SUPPRESSION OF HUMAN HEAD AND NECK CANCER CELLS BY THE INTRODUCTION OF A WILD-TYPE P53 GENE VIA A RECOMBINANT ADENOVIRUS", CANCER RESEARCH, vol. 54, 15 July 1994 (1994-07-15), pages 3662 - 3667, XP002027383 * |
| PEPT.RES., vol. 6, no. 2, 1993, pages 62 - 64 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004078987A1 (en) * | 2003-03-06 | 2004-09-16 | Zhaohui Peng | A recombinant constructed by a virus vector and a human tumor suppressor gene and its use |
| US7736674B2 (en) | 2005-01-07 | 2010-06-15 | Biolex Therapeutics, Inc. | Controlled release compositions for interferon based on PEGT/PBT block copolymers |
| US7867518B2 (en) | 2005-01-07 | 2011-01-11 | Biolex Therapeutics, Inc. | Controlled release compositions for interferon based on PEGT/PBT block copolymers and method for preparation thereof |
| US8163307B2 (en) | 2005-01-07 | 2012-04-24 | Biolex Therapeutics, Inc. | Controlled release compositions for interferon based PEGT/PBT block copolymers and method for preparation thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CZ165798A3 (cs) | 1998-12-16 |
| EP0863984B1 (en) | 2006-05-10 |
| PL186018B1 (pl) | 2003-09-30 |
| DE69636120D1 (de) | 2006-06-14 |
| CZ296810B6 (cs) | 2006-06-14 |
| RU2174409C2 (ru) | 2001-10-10 |
| AU722042B2 (en) | 2000-07-20 |
| KR19990071795A (ko) | 1999-09-27 |
| SK70598A3 (en) | 1999-04-13 |
| NO982481D0 (no) | 1998-05-29 |
| US20020077313A1 (en) | 2002-06-20 |
| AU1126397A (en) | 1997-06-19 |
| CN101028523A (zh) | 2007-09-05 |
| DE69636120T2 (de) | 2006-11-30 |
| US20060035857A1 (en) | 2006-02-16 |
| ATE325872T1 (de) | 2006-06-15 |
| US20030166603A1 (en) | 2003-09-04 |
| DK0863984T3 (da) | 2006-08-28 |
| NO982481L (no) | 1998-07-29 |
| JP2000501394A (ja) | 2000-02-08 |
| PL327009A1 (en) | 1998-11-09 |
| HUP9902068A2 (hu) | 1999-10-28 |
| CN1308450C (zh) | 2007-04-04 |
| CN1207771A (zh) | 1999-02-10 |
| NZ324168A (en) | 2004-11-26 |
| HUP9902068A3 (en) | 2001-02-28 |
| ES2264145T3 (es) | 2006-12-16 |
| CA2238829A1 (en) | 1997-06-05 |
| EP0863984A1 (en) | 1998-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU722042B2 (en) | Methods and compositions for the diagnosis and treatment of cancer | |
| AU694216B2 (en) | Compositions comprising DNA damaging agents and P53 | |
| US6251871B1 (en) | P16 expression constructs and their application in cancer therapy | |
| WO1998030585A9 (en) | Use of pea3 in tumor suppression | |
| CA2277880A1 (en) | Use of pea3 in tumor suppression | |
| US6482803B1 (en) | Modification of mutated P53 gene in tumors by retroviral delivery of ribozyme A | |
| WO1997016547A1 (en) | ADENOVIRUS-ANTISENSE K-ras EXPRESSION VECTORS AND THEIR APPLICATION IN CANCER THERAPY | |
| WO1997016547A9 (en) | ADENOVIRUS-ANTISENSE K-ras EXPRESSION VECTORS AND THEIR APPLICATION IN CANCER THERAPY | |
| US7163925B1 (en) | p16 expression constructs and their application in cancer therapy | |
| EP1724350A1 (en) | Method and compositions for the diagnosis and treatment of cancer | |
| HK1100393A (en) | Method and compositions for the diagnosis and treatment of cancer | |
| US6331284B1 (en) | P202 is a tumor suppressor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 96199585.8 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU BA BB BG CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 324168 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1996942100 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 70598 Country of ref document: SK |
|
| ENP | Entry into the national phase |
Ref document number: 2238829 Country of ref document: CA Ref document number: 2238829 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV1998-1657 Country of ref document: CZ |
|
| ENP | Entry into the national phase |
Ref document number: 1997 520700 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1019980704074 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 1996942100 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: PV1998-1657 Country of ref document: CZ |
|
| WWP | Wipo information: published in national office |
Ref document number: 1019980704074 Country of ref document: KR |
|
| WWR | Wipo information: refused in national office |
Ref document number: 1019980704074 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2006-114 Country of ref document: CZ |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1996942100 Country of ref document: EP |
|
| WWG | Wipo information: grant in national office |
Ref document number: PV1998-1657 Country of ref document: CZ |