WO1995019450A1 - Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes - Google Patents

Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes Download PDF

Info

Publication number
WO1995019450A1
WO1995019450A1 PCT/US1994/000482 US9400482W WO9519450A1 WO 1995019450 A1 WO1995019450 A1 WO 1995019450A1 US 9400482 W US9400482 W US 9400482W WO 9519450 A1 WO9519450 A1 WO 9519450A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
background
cell
compound
fluorescent
Prior art date
Application number
PCT/US1994/000482
Other languages
English (en)
Inventor
Michael Lee Cubbage
Shyh Chen Ju
Nagindra Prashad
William Dugald Weber
Joel Bresser
Original Assignee
Aprogenex, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aprogenex, Inc. filed Critical Aprogenex, Inc.
Priority to AU62957/94A priority Critical patent/AU6295794A/en
Priority to PCT/US1994/000482 priority patent/WO1995019450A1/fr
Publication of WO1995019450A1 publication Critical patent/WO1995019450A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6841—In situ hybridisation
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label

Definitions

  • FIELD OF THE INVENTION This invention pertains to the reduction of background fluorescence in fluorimetrically- monitored assays for specific molecules in biological cells and viruses.
  • a cell is incubated with a target-specific probe that is attached to a fluorescent dye and subsequently the probe molecules that have bound to the target are detected fluorimetrically. Detection is normally accomplished with a flow cytometer or microscope.
  • assays are useful to detect viral nucleic acids, human genes of interest, and specific cellular or viral antigens.
  • a cell In the first steps of a typical fluorimetric measurement, a cell is exposed to light with a wavelength that the probe dye can absorb. The dye will then emit the light at a longer wavelength.
  • a significant problem is that the light emitted by a probe-treated cell will not exclusively originate from fluorescent probe molecules bound to specific target molecules. Rather some of the light emitted will be from probe molecules that have bound non-specifically; additionally, light will be emitted by cellular molecules. If the probe molecule has a nucleic acid moiety, probe specificity derives from the fact that a target nucleic acid in the cell has a base sequence that is complementary to that of the probe.
  • the probe and target nucleic acids enter into a double-stranded hybrid molecule relatively efficiently.
  • the probe molecule will, to some extent, bind to nucleic acid molecules that are not perfectly complementary to the probe, to protein molecules, and to other non-nucleic acid molecules in the cell. Such binding is referred to collectively as non-specific background binding and the light emitted by probes involved in such binding is non-specific background emission.
  • the probe has an antibody moiety, specificity derives from the fact that the antibody will react with a specific antigen. Non-specific binding can also occur, however.
  • the fluorescent probes in the cell there are cellular molecules which have the capacity to absorb and emit light. Such emitted light is referred to as autofluorescence, and the molecules which produce it are autofluorescing molecules.
  • the present invention involves the discovery of compounds useful as background reducers in fiuorimetric in situ assays.
  • cell treatment procedures such as cell fixation need not be as detrimental to cell integrity as would be the case without the use of the background reducers.
  • the cells retain their structural integrity for a longer time, as consideration particularly important for flow cytometry.
  • the present inventions are processes whereby the use of appropriate light absorbing molecules at an appropriate stage of the assay procedure leads to decreased non-specific emission of light and or decreased autofluorescence.
  • LFL1" histograms generated using sulforhodamine 101 hydrate as a background-reducing compound, of uninfected human H9 cells that had been incubated with a fiuorescein-nucleic acid probe specific for the plant nitrogen reductase gene, (our sample # 6112).
  • Fig. 2. "Count vs. LFL1" histograms, generated using sulforhodamine 101 hydrate as a background-reducing compound, of uninfected human H9 cells that had been incubated with a fiuorescein-nucleic acid probe specific for 28S ribosomal RNA. (our sample # 6114) Fig. 3. LFL3 vs, LFL1 plot, HTV-infected cells; without a background-reducing compound, (our sample #2063)
  • the invention is an analytical process whereby the number of probe molecules bound to a biological entity (i.e., a cell or virus) is used as a measure of the amount of target molecules in that entity.
  • the process comprises the steps of: (1) incubating a biological entity with a fluorescent probe in solution;
  • a background-reducing compound is present in the solution within which the biological entity is suspended; said background-reducing compound comprising a light absorbing moiety with a structure different than that of the fluorescent dye moiety of the fluorescent probe; said background-reducing compound having an absorption wavelength range (the range of wavelengths over which it absorbs light when the process is performed) that includes of the emission wavelengths of the fluorescent probe (the range of wavelengths over which light is emitted by the probe) at which the amount of light is measured in step (4).
  • a light-absorbing compound For a light-absorbing compound to be an effective background reducer with regard to a range of wavelengths, it is preferred that it have an average molar extinction coefficient in that range that is at least 2 percent as great as the average molar extinction coefficient of Trypan Blue in the range 520 nm to 560 nm; it is more preferred that it have a molar extinction coefficient in that range that is at least 10 percent as great as the average molar extinction coefficient of Trypan Blue in the range 520 nm to 560 nm.
  • the light absorbing moiety of the background-reducing compound because it has a different structure than the fluorescent dye moiety of the fluorescent probe, will normally have the desirable property that, if it emits light at all (i.e., it is a fluorescent compound), will have an emission spectrum different from that of the fluorescent moiety (i.e., as regards a given amount of light of a given wavelength that has been absorbed, there will be differences in the intensity of light emitted as a function of wavelength).
  • the background-reducing compound will diffuse onto and into the biological entity. Therefore, if the background- reducing compound is added to a solution prior to steps (3) and (4), and is not in the solution used for steps (3) and (4), there will be residual amounts of the background-reducing compound in or on the entity during steps (3) and (4) and some beneficial effect will be obtained. Nevertheless, it is preferable that the background-reducing compound be in the solution in which the entity are suspended in steps (3) and (4).
  • the analytical process is normally applied substantially simultaneously to a large number of cells or viruses.
  • the amount of light emitted will be used as the basis for determining whether target molecules are present in a cell. If the amount of light emitted exceeds a certain specified amount, the cell is considered to have target molecules.
  • the invention is effective partly because the background- reducing compound binds to at least some of the same non-specific targets as the probe does and, because the background-reducing compound and the probe are in close proximity, the background-reducing compound will absorb emissions from the probe. Additionally, the background-reducing compound will absorb light emitted due to autofluorescence by non- probe molecules in the biological entity. After absorbing light emitted by either nonspecifically bound probe or autofluorescing molecules, the background compound may emit light at its own emission wavelengths. As will be seen from the Examples below, the light emitted by the specifically bound probe molecules is absorbed to a lesser extent by the back-reducing compounds; therefore, the overall sensitivity of the analytical process is improved.
  • steps (3) and (4) both take place while the cell or virus is still resuspended in the probe-free solution containing the background reducing compound.
  • the cells or viruses should remain in the probe-free solution comprising the background-reducing compound for a time great enough to allow them to absorb the background-reducing compound. Five minutes is a convenient time for that pu ⁇ ose, but there is wide latitude as to what length of time is used. It is preferred that fluorescence measured within 45 min of addition of background reducer; however, if the background reducer is in the solution used for steps (3) and (4), one can wait up to 24 hours to do fluorescent measurement.
  • the process further comprises a wash step between the steps numbered (2) and (3) above.
  • a wash step can be performed by centrifuging the cells or viruses out of the solution in which they are suspended, then suspending them in a wash solution, and then centrifuging the cells or viruses out of the wash solution.
  • a wash solution is generally a probe-free solution, it may or may not have the background reducing compound suspended in it.
  • the probe will comprise a fluorescent dye. It can also comprise, covalently attached to the dye, either a single-stranded nucleic acid (DNA or RNA) moiety or an antibody moiety. A moiety is part of a molecule.
  • the portion of a probe that has been contributed by a nucleic acid is a nucleic acid moiety; the portion that has been contributed by the fluorescent dye is the fluorescent dye moiety.
  • the covalent attachment may occur via a linker, where the dye and the nucleic acid molecule (or antibody) are linked at different sites to the linker molecule.
  • the probe may comprise an entity that, converts a non-fluorescent moiety to a fluorescent moiety ("fluorescent” and "non-fluorescent” referring to the moiety's properties at the emisson wavelengths that are to be monitored in the hybridization assay).
  • a fluorescent moiety such an entity could be an enzyme.
  • Enzymes that will convert a nonfluorescent (or relatively nonfluorescent) moiety to a fluorescent moiety include, but are not limited to, alkaline phosphatase, ⁇ -trypsin, ⁇ -trypsin, thrombin, factor Xa, N-acetylglucosaminidase isoenzyme A, lysozyme and ⁇ -chymotrypsin.
  • AttoPhosTM (sold by JBL scientific, San Luis Obispo, CA 93401; excitation wavelengths 430-440 nm, emission wavelengths 550-560 nm) and 4- methylumbelliferyl phosphate ("4-MUP"; sold by USB, PO Box 22400, Cleveland, Ohio 44122; excitation, 370 nm, emission, 430 nm), are non-fluorewscent compouns that can be converted to fluorescent compounds by alkaline phosphatase.
  • 4-Methylumbelliferyl p- o guanidinbenzoate (sold by SAF Bulk chemicals, St. Louis. Missouri) can be converted from a
  • CA U.S.A.
  • CA U.S.A.
  • Another example is (1- dimethoxytrityloxy-3-fluorenylmethoxycarbonylamino-hexan-2-methylsuccinoyl)-long chain alkyl amino moiety linked to controlled pore glass ("3'-Amino-Modifier C7 CPG; sold by Glen Research, Sterling, VA); it is used to create an aminohexyl linker.
  • N-Fmoc-O'-DMT- 2 -cyanoethoxydiisopropylaminophophinyl-3-amino-l,2-propanediol (Aminomodifier II, sold by Clontech Laboratories, Inc., Palo ALto, CA, U.S.A.; see Nelson, Nucleic Acids Research, Vol 17, page7179 (1989)); it is used to create an aminopropyl linker.
  • the enzyme may be linked to the oligonucleotide indirectly via an antibody, streptavidin or similar molecule.
  • the antibody would be specific for a moiety covalently linked to the probe, such as digoxigenin, and the streptavidin would be specific for biotin covalently linked to the probe.
  • a the invention is exemplified by a compound-conversion embodiment that is a process of measuring the amount of target molecules in a biological entity, which process comprises the steps of:
  • step (4) measuring the amount of light emitted at emission wavelengths of said fluorescent compound; wherein during steps (3) and (4) the biological entity is in a solution (optionally, said second solution) that comprises a background-reducing compound; wherein said biological entity is a cell or a virus; said background-reducing compound comprising a light-absorbing moiety with a structure different than that of the fluorescent compound; said background-reducing compound having an abso ⁇ tion wavelength range that includes the emission wavelengths of the fluorescent compound at which the amount of light is measured in step (4).
  • the probe can have the ability to convert the nonfluorescent compound to a fluorescent compound because the probe comprises an enzyme capable of effecting such conversion.
  • the probe is therefore a "fluorescent probe" because it is a probe that is detected by a fluorimetric measurement, albeit one that does not measure fluorescence from the probe moiety itself, but rather of a compound that will only fluoresce if converted to a fluorescent compound by the probe's enzyme.
  • the fluorescent compound will not actually fluoresce, of course, unless it is first exposed to energy (e.g., light) of appropriate wavelength.
  • step (2) is performed for the same reason it is generally performed in hybridization or other assays by those skilled in the art: in order to help eliminate probes that are not bound to their intended target and that therefore are a source of undesired background in the assay. That step may involve one or more intermediate “wash steps”; e.g., the biological entity in the solution denoted the "first solution” is transferred to one or more wash solutions before being in the solution denoted the Such hybridization procedures are known. They are, for example, described in more detail in PCT applications WO 90/02173 and WO 90/02204, and U.S. Patent No. 5,225,326, inco ⁇ orated by reference herein.
  • one preferred mounting solution (the one that the cells are immersed in for performance of the fluorescent measurements) is one with a background reducer dissolved along with 0.1 % 1,4 phenylenediamine antifade and 1 ⁇ g/ml Hoechst (dye# 33258) in a solution of 50% glycerol and 50% PBS.
  • the target molecules can be in any biological cell.
  • the cells can come from solid tissue (e.g., nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes, testes, cervix, and brain) or cells present in membranes lining various tracts, conduits and cavities
  • the cells containing the target molecules may be eukaryotic cells (e.g., human cells), prokaryotic cells (e.g.bacteria), plant cells, or any other type of cell. They can be simple eukaryotes such as yeast or be derived from more complex eukaryotes such as humans.
  • the target molecules can be in a non-enveloped virus or an enveloped virus (having an enveloping membrane such as a lipid-protein membrane).
  • the hybridization assay may be done with fixed cells (or fixed viruses).
  • Useful precipitation fixatives include ethanol, acetic acid, methanol, acetone and combinations thereof. Fixatives and hybridization of fixed cells, in general, are discussed in PCT international applications, WO 90/02173 and WO 90/02204 of Research Development Co ⁇ . Fixatives that provide good preservation of cellular mo ⁇ hology and preservation and accessibility of antigens, and high hybridization efficiency.
  • the fixative may contain a compound which fixes the cellular components by cross-linking these materials together, for example, parafomaldehyde, glutaraldehyde or formaldehyde.
  • Cross-linking agents while preserving ultrastructure, often reduce hybridization efficiency; they form networks trapping nucleic acids and antigens and rendering them inaccessible to probes and antibodies. Some also covalently modify nucleic acids preventing later hybrid formation.
  • the hybridization solution may typically comprise a chaotropic denaturing agent, a buffer, a pore forming agent, a hybrid stabilizing agent.
  • the chaotropic denaturing agents include formamide, urea, thiocyanate, guanidine, trichloroacetate, tetramethylamine, perchlorate, and sodium iodide. Any buffer which maintains pH at least between 7.0 and 8.0 may be utilized.
  • the pore forming agent is for instance, a detergent such as Brij 35, Brij 58, sodium dodecyl sulfate, CHAPSTM Triton X-100.
  • the pore-forming agent is chosen to facilitate probe entry through plasma, or nuclear membranes or cellular compartmental structures. For instance, 0.05% Brij 35 or 0.1% Triton X-100 will permit probe entry through the plasma membrane but not the nuclear membrane. Alternatively, sodium desoxycholate will allow probes to traverse the nuclear membrane.
  • nuclear membrane pore-forming agents are avoided. Such selective subcellular localization contributes to the specificity and sensitivity of the assay by eliminating probe hybridization to complementary nuclear sequences when the target biopolymer is located in the cytoplasm.
  • Agents other than detergents such as fixatives may serve this function.
  • Hybrid stabilizing agents such as salts of mono- and di-valent cations are included in the hybridization solution to promote formation of hydrogen bonds between complementary sequences of the probe and its target biopolymer.
  • nucleic acids unrelated to the target biopolymers are added to the hybridization solution.
  • Supports which may be utilized include, but are not limited to, glass, Scotch tape (3M), nylon, Gene Screen Plus (New England Nuclear) and nitrocellulose. Most preferably glass microscope slides are used. The use of these supports and the procedures for depositing specimens thereon will be obvious to those of skill in the art. The choice of support material will depend upon the procedure for visualization of cells or viruses and the quantitation procedure used. Some filter materials are riot uniformly thick and, thus, shrinking and swelling during in situ hybridization procedures is not uniform. In addition, some supports which autofluoresce will interfere with the determination of low level fluorescence. Glass
  • second solution When the biological entity is in the various solutions, it may be immobilized on a slide but it may, if desired, no be immobilized on a slide but rather be suspended in solution.
  • Nucleic acid probes can be used against a variety of nucleic acid targets, viral, prokaryotic, and eukaryotic.
  • the target may be a DNA target such as a gene (e.g., oncogene), control element (e.g., promoter, repressor, or enhancer), or sequence coding for ribosomal RNA, transfer RNA, or RNase P.
  • the target may be RNA such as RNA, ribosomal RNA, RNase P, tRNA, a viral genome or complementary copy thereof.
  • the target may be a "nucleic acid amplification product," i.e., a nucleic acid molecule, either DNA or RNA, which is the result of introducing an enzyme or enzymes into the cell so that such enzymes will make an nucleic acid molecule complementary to one already present in the cell.
  • a nucleic acid amplification product i.e., a nucleic acid molecule, either DNA or RNA
  • PCR polymerase chain reaction
  • a viral nucleic acid target may be part of a virus, in which case the virus may or may not be inside a cell.
  • a viral nucleic acid target may not be part of a virus, but may be inside a cell.
  • the processes of this invention can be done for targets in biological entities that are either in liquid suspension, on slides or other solid supports, or in tissue sections. microscope slides are most preferable as a solid support since they have high signal-to-noise ratios and can be treated to better retain tissue.
  • the cell is a human cell and the probe is specific for the nucleic acid of a virus (viral nucleic acid), especially one considered pathogenic for humans.
  • viral nucleic acid either RNA or DNA
  • the probe is specific for a human gene of interest or an RNA transcript of such a gene.
  • staining dye is used here for dyes that are incubated with the cell after the hybridization step has been completed. (“Probe dyes" are part of probes and are incubated with the cells during the hybridization step.) Some staining dyes are effective background reducers; many are also effective as counterstains.
  • Emission and abso ⁇ tion maximum wavelength data have been published for many dyes and other light absorbing compounds (see, for example, the Merck Index or the catalog of Aldrich Chemical Company, Milwaukee, Wisconsin). Such data is suggestive of which compounds can be useful, but not definitive. A scanning fluorimeter will give an entire emission or abso ⁇ tion spectrum. Some background-reducing compounds are hsted below for some probe dyes. The efficacy of a background-reducing compound as regards a given probe dye can, however, be tested relatively easily using the procedures set forth in the Examples below. Fluorescein, which is frequently used as a fluorescent probe dye, has a maximum abso ⁇ tion wavelength at approximately 488 nm and maximum emission wavelength at approximately 525 nm.
  • Light-absorbing compounds that are good background reducers include azo dye derivatives that have a polyaromatic conjugate moiety and, on that moiety, have one or more polar groups such as a nitro group (-NO 2 ), a sulfonyl group (-SO 3 ), or an amino group (-NH 2 ). They are probably good because they tend to bind to the same proteins and membranes as the non-specifically bound probes.
  • a few of the many probe dyes for which this invention is useful are flourescein, FITC, Texas Red, Coumarin, Rhodamine, Phycoerythrin, and Perci- P.
  • fluorescein or fluorescein isothiocyanate (FITC)
  • FITC fluorescein isothiocyanate
  • Texas Red Some background-reducing compounds for use with the probe dye, Texas Red are Naphthol Blue Black and Palatine Fast Black WAN.
  • the background reducing compounds of value might differ from those used with fluorescein- or FTTC-labeled probes. It is preferred that, in the emission wavelength range of the probe dye that will be detected by the fluorimeter, fluorescent microscope or flow cytometer, the background reducing compound have an average molar extinction coefficient at least two percent (more preferably 10 per cent) that of
  • kits useful for carrying out the inventions Such a kit would comprise a fluorescent-labeled probe and a background reducing compound appropriate for use with such a probe in carrying out the process inventions set forth here.
  • the HTV probe was a mixture of non-overlapping DNA 25-mers covering the regions 126-3375, 4401-5150, 5176-5400, 5426-5650, 5676-7775, and 8150-8500, as specified under the locus name HIVBH102 in Gen Bank" 1 Release 65.0.
  • a "25-mer” is an oligonucleotide containing 25 bases.
  • the NR probe was a DNA 25-mer that binds to part of the bacterial nitrogen reductase gene; its nucleic acid moiety has the sequence, TACGCTCGATCCAGCTATCAGCCGT (SEQ ID NO:l). (For all sequences described, the 5' end is at the left end.)
  • the 28s RNA probe was a DNA 25-mer that binds to 28s ribosomal RNA; its nucleic acid moiety has the sequence, ATCAGAGTAGTGGTATTTCACCGGC (SEQ ID NO:2).
  • the probes were synthesized (Applied Biosystems DNA Synthesizer Model 380 B using the recommended A.B.I, reagents) and in the last stage an aminohexyl linker was attached to the 5' end phosphate.
  • the 5' aminohexyl oligodeoxynucleotides were then coupled to a FTTC dye molecule (from Molecular Probes) and purified by HPLC.
  • a Coulter Profile II flow cytometer was used.
  • the filter for FL3 was a 635 long pass filter; i.e., it allows any light over 635 nm wavelength to pass.
  • a 540 bp (40) filter was used; i.e., only light with a wavelength between 520 nm and 560 nm is allowed to pass.
  • the excitation wavelength was 488 nm.
  • PMT1 and PMT3 settings were adjusted as convenient for each experiment.
  • a typical useful combination is a PMT1 setting of 1100 and a PMT3 setting of 900, with a color compensation, PMT1-PMT3, of 15%. Solutions used in the Examples
  • Fixation solution F had the following ingredients: 4 volumes ethanol, 5 volumes of 1 x
  • Hybridization cocktail HC had the following ingredients: 5 x SSC; 30 % Formamide (v/v); 3 % Triton X-100 (v/v); 0.4 M Guanidinium isothiocyanate; 0.16 M sodium phosphate buffer (pH 6); 15 x Ficoll/PVP; 1 mg ml sheared salmon sperm DNA; 10 mM EDTA; 25 mM DTT; 5% PEG 4000; 10 ug/ml (microgram/ml) probe.
  • 5 x SSC 30 % Formamide (v/v); 3 % Triton X-100 (v/v); 0.4 M Guanidinium isothiocyanate
  • 0.16 M sodium phosphate buffer (pH 6) 15 x Ficoll/PVP; 1 mg ml sheared salmon sperm DNA; 10 mM EDTA; 25 mM DTT; 5% PEG 4000; 10 ug/ml (microgram/ml) probe.
  • 500 x PVP is 5 g of Ficoll type 400 (polysucrose 400,000 mol. wt.) plus 5 g of PVP (polyvinylpyrrolidinone) dissolved in water to a total volume of 100 ml; 15 x Ficoll PVP indicates that 500 x Ficoll/PVP is diluted with water by a factor of 15/500.
  • Wash solution #1 had the following composition: 0.4 M guanidinium isothiocyanate; 0.1 % Triton X-100 (an alcohol derivative of polyoxyethylene ether, see Aldrich Chemical
  • Wash solution #2 had the following composition: 0.1 % Triton X-100 (v/v); 0.1 x SSC; in deionized water.
  • the staining dye solution had the following composition: 0.002 % staining dye (w/v) in 1 x PBS (phosphate buffered saline; 0.136 M NaCl, 0.003 M KC1, 0.008 M Na 2 HPO 4 .7H 2 O, 0.001 M KH 2 PO 4 ).
  • the staining dye if useful as and used as a background-reducer, can be present at a concentration between 0.0002% and 0.10% (w/v).
  • the cells are preferably incubated with the background reducing compound between 20° C and 46° and from 2 min up to 8 hours. Some staining dyes are also background-reducing compounds. Most also functioned as a counterstain.
  • the staining dye solution had the same composition as the flow buffer for the FAScan.
  • 1 x SSC had the following composition: 0.15 M NaCl, 0.15 M sodium citrate, pH 7.0. 2 x SSC was composed so that upon a 1:1 dilution with water, SSC would be produced; 10 X
  • SSC was composed so that upon a 1:10 dilution with water, SSC would be produced.
  • Useful reagents and solutions for executing the inventions described herein include 10% dodecyl alcohol in the solution analyzed cytofluorimetrically; 5% (v/v) Vitamin E in the hybridization cocktail used where the assay target is in a biological entity; about 8% DMSO (v/v) with about 5% or 10% squalane and about 5% or 10% pyrrolidinone in the hybridization cocktail when the target is in a biological entity; 5 ⁇ l of 1 M (1 molar) DTT and 5 ⁇ l of Proteinase K (1 mg/ml) solution are added to 100 ⁇ l of cocktail and the hybridization reactin is run, for example, at 42°C for 5 min, then at 95°C for 5 min, and then at 42°C for 2 min, when the target is in a biological entity; and/or about 0.05% or 0.10% aurintricarboxylic acid (or 1 - 10 mg/ml basic fuchsin) in the hybridization cocktail when the target is a biological entity and
  • Probes where the target is in a biological entity can be made as phosphorothioate oligonucleotides, each 30-mer having four sulfur atoms, using an Applied Biosystem (ABI) DNA Synthesizer, Model 380B and the recommended ABI reagents.
  • the sulfur atoms may be located as follows: one is at the extreme 5' end of the probe, a second is between the 7th and 8th nucleosides (counting from the 5' end), the third is between the 22nd and 23rd nucleosides, and the fourth is between the 29th and 30th nucleosides.
  • the sulfur atoms of the polysulfurized oligonucleotides can then coupled to a fluorescent dye, iodoacetamido- fluorescein.
  • a fluorescent dye iodoacetamido- fluorescein.
  • 200 ⁇ g of dried oligonucleotide is dissolved in 100 ⁇ l of 250 mM Tris buffer, pH 7.4 to form a first solution.
  • one mg of iodoacetamido-fluorescein is combined with 100 ⁇ l of dry dimethylformamide (i.e., 100 percent DMF) in a second solution.
  • dry dimethylformamide i.e., 100 percent DMF
  • the labeled oligonucleotide is precipitated with ethanol and 3M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye. The desired fractions are then collected. The liquid phase is then removed under vacuum. The crude material is then purified with HPLC (high performance liquid chromatography).
  • probes against both strands of a double-stranded target can be used, provided that the probes are "out-of phase" along the map of the target so that any probe is not complementary in base sequence to more than about 15 nucleotides of a probe to the other strand of the target. In that way, probes hybridize to the target and not to each other.
  • probes are labelled at both their 3' and 5' ends with an aminohexyl linker, and tetramethylrhodamine is the dye attached to each linker, it is preferred to use 25-mers and space the targets along a given strand by five base pairs; and if both strands of a target are hybridized to, the end-over-end overlap of probes to opposite strands can be about 10 bases.
  • AcH2 cells are a human-derived lymphoma cell line.
  • H9 cells are a human-derived lymphoma cell line (ATCC No. CRL 8543).
  • Reagents can be purchased from any of a variety of sources including Aldrich Chemical Co., Milwaukee, Wisconsin, Sigma Chemical Co., St. Louis, Missouri, Molecular Probes, Inc., Eugene, Oregon, Clontech, Palo Alto, California, Kodak, Rochester, NY, and SPectrum Chemical Manufacturing Co ⁇ ., Gardenea, California.
  • a pu ⁇ ose of this Example was to determine whether a compound functioned as a background reducer; i.e., whether it decreased the amount of light emitted by non-specifically bound probe molecules and autofluorescing molecules without causing a similar decrease in the amount of light emitted by specifically bound probe molecules.
  • an "NR" probe was used as a test for non-specific binding. This oligonucleotide probe binds specifically to DNA sequences within the plant nitrogen reductase gene.
  • a "28S" probe As a test for specific binding, a "28S" probe was used. This oligonucleotide probe binds specifically to the cell's ribosomal 28S RNA .
  • the amount of light emitted will be the sum of the amount of light emitted by two sources: nonspecifically bound probe molecules and autofluorescing molecules. In other words, the amount of light emitted is background light.
  • the amount of light emitted is the sum of light emitted from three sources: specifically bound probe, nonspecifically bound probe and autofluorescing molecules. In other words, the amount of light emitted is target-specific light plus background light.
  • a B the ratio of the ratio emitted when the 28S probe is used and B is the amount of light emitted when the NR probe is used.
  • A/B the ratio of the ratio A/B is measured when no compound is added as a background reducer.
  • the ratio A B be maximized. Additionally, the amount of probe-specific light must be sufficiently high to be useful. The amount of probe
  • Uninfected H9 cells were fixed in solution F, then resuspended in 2x SSC. 2. The cells were spun out of solution and resuspended in hybridization cocktail HC.
  • the HC cocktail varied from sample to sample only as regards the probe used.
  • Three types of probes were used: an NR probe, an ⁇ IV probe and a 28S RNA probe. Each probe had fluorescein linked to the probe's oligonucleotide.
  • step (6) a "Count vs. LFL1 " histogram was generated.
  • Counter refers to cell count.
  • This histogram was used as the basis for determining whether the compound tested was an effective background reducer. Additional histograms and an FS/SS plot were also generated but were not used as the basis for determining background reduction; they are not shown or summarized here. Examples of Count vs. LFLl histograms that were generated using sulforhodamine 101 hydrate as a staining dye are shown in Fig. 1 (NR probe) and Fig. 2 (28S probe). Tables 2 and 3 summarize the results in these Figs.
  • Ratio of means, 28S/NR is the ratio of the mean for the NR probe to the mean for the 28S probe.
  • Example 4 Example 1 is followed except as modified as follows:
  • the probe is linked to alkaline phosphatase as follows:
  • Oligonucleotides are synthesized on a DNA Synthesizer (e.g., Applied Biosystems DNA Synthesizer Model 380 B using the recommended A.B.I. reagents) and in the last stage an aminohexyl phosphate linker is attached to the 5' end. 50 ⁇ g, 5.795 nmole, of the 5'- aminohexyl oligodeoxynucleotides is dissolved in 12.41 ⁇ l of linker buffer, consisting of 100 mM sodium borate, 2 mM EDTA pH 8.25.
  • linker buffer consisting of 100 mM sodium borate, 2 mM EDTA pH 8.25.
  • Example 4 is followed except that instead of alkaline phospatase, lysozyme is used and the substrate in the solution is 4-methylumbelliferyl ⁇ -d-N,N',N"-triacetylchitotriose, the conversion to a fluorescent compound is carried out at pH 5 in a buffer with ionic strength of
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE cDNA to rRNA
  • HYPOTHETICAL N

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des dosages visant des molécules spécifiques de cellules biologiques. Dans ces dosages, on utilise des molécules appropriées absorbant la lumière à une étape appropriée de la procédure, pour diminuer l'émission de lumière non spécifique et/ou pour diminuer l'autofluorescence.
PCT/US1994/000482 1994-01-14 1994-01-14 Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes WO1995019450A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU62957/94A AU6295794A (en) 1994-01-14 1994-01-14 Background-reducing compounds for probe-mediated (in-situ) fluorimetric assays
PCT/US1994/000482 WO1995019450A1 (fr) 1994-01-14 1994-01-14 Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1994/000482 WO1995019450A1 (fr) 1994-01-14 1994-01-14 Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes

Publications (1)

Publication Number Publication Date
WO1995019450A1 true WO1995019450A1 (fr) 1995-07-20

Family

ID=22242194

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/000482 WO1995019450A1 (fr) 1994-01-14 1994-01-14 Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes

Country Status (2)

Country Link
AU (1) AU6295794A (fr)
WO (1) WO1995019450A1 (fr)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4192917A (en) * 1979-04-05 1980-03-11 Massachusetts General Hospital Process for rosetting human B lymphocytes with Rhesus monkey erythrocyte
US4658020A (en) * 1979-04-26 1987-04-14 Ortho Pharmaceutical Corporation Monoclonal antibody to human helper T cells
US4770992A (en) * 1985-11-27 1988-09-13 Den Engh Gerrit J Van Detection of specific DNA sequences by flow cytometry
US4968601A (en) * 1988-02-09 1990-11-06 The United States Of America As Represented By The Dept. Of Health & Human Services Method for diagnosing latent viral infection
US5073497A (en) * 1989-06-30 1991-12-17 Caribbean Microparticles Corporation Microbead reference standard and method of adjusting a flow cytometer to obtain reproducible results using the microbeads
US5118602A (en) * 1987-08-26 1992-06-02 The Regents Of The University Of California Feline T-lymphotropic lentivirus assay
US5177073A (en) * 1988-09-30 1993-01-05 Baylor Research Institute Therapeutic compositions derived from photoactive compounds
US5215971A (en) * 1986-12-19 1993-06-01 Medivir Ab Antiviral pharmaceutical composition comprising 5-substituted pyrimidine nucleosides

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4192917A (en) * 1979-04-05 1980-03-11 Massachusetts General Hospital Process for rosetting human B lymphocytes with Rhesus monkey erythrocyte
US4658020A (en) * 1979-04-26 1987-04-14 Ortho Pharmaceutical Corporation Monoclonal antibody to human helper T cells
US4770992A (en) * 1985-11-27 1988-09-13 Den Engh Gerrit J Van Detection of specific DNA sequences by flow cytometry
US5215971A (en) * 1986-12-19 1993-06-01 Medivir Ab Antiviral pharmaceutical composition comprising 5-substituted pyrimidine nucleosides
US5118602A (en) * 1987-08-26 1992-06-02 The Regents Of The University Of California Feline T-lymphotropic lentivirus assay
US4968601A (en) * 1988-02-09 1990-11-06 The United States Of America As Represented By The Dept. Of Health & Human Services Method for diagnosing latent viral infection
US5177073A (en) * 1988-09-30 1993-01-05 Baylor Research Institute Therapeutic compositions derived from photoactive compounds
US5073497A (en) * 1989-06-30 1991-12-17 Caribbean Microparticles Corporation Microbead reference standard and method of adjusting a flow cytometer to obtain reproducible results using the microbeads

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
FEDERATION OF EUROPEAN BIOCHEMICAL SOCIETIES, Volume 319, Number 1,2, issued March 1993, BENJOUAD et al., "Cytotoxic Effect on Lymphocytes of Tat from Human Immunodeficiency Virus (HIV-1)", pages 119-124. *

Also Published As

Publication number Publication date
AU6295794A (en) 1995-08-01

Similar Documents

Publication Publication Date Title
US5521061A (en) Enhancement of probe signal in nucleic acid-mediated in-situ hybridization studies
US5582982A (en) Background-reducing compounds for probe-mediated fluorimetric flow cytometric assays
CA1285330C (fr) Detection d'analytes par transfert d'energie
EP2636757B1 (fr) Compositions et procédés pour la détection d'aberrations chromosomiques avec de nouveaux tampons d'hybridation
JP2819830B2 (ja) インサイチューハイブリダイゼーション法
US5665546A (en) Free radical scavengers useful for reducing autoflourescence in fixed cells
WO1990010715A1 (fr) Hybridation in situ en suspension pour la detection ou la separation de cellules
Bauman et al. Cytochemical hybridization with fluorochrome-labeled RNA. II. Applications.
US5652093A (en) Analogues of reporter groups as background reducers in binding assays
EP0558740B1 (fr) Composition de sondage destinee a l'identification de genomes, et procedes associes
JP2001502881A (ja) 高分子ペプチドプローブ及びその使用
WO1995019450A1 (fr) Composes attenuant la fluorescence du fond dans des dosages fluorimetriques effectues in situ a l'aide de sondes
WO1994002644A1 (fr) Detection in situ d'acides nucleiques utilisant l'amplification 3sr
WO1994002640A1 (fr) Sondes d'acide nucleique marquees par plusieurs reporters
WO1995019449A1 (fr) Populations de sondes d'hybridation non adjacentes
AU707818B2 (en) Micelle protection assay
WO1994002644A9 (fr) Detection in situ d'acides nucleiques utilisant l'amplification 3sr
WO1994002643A1 (fr) Sondes d'acide nucleique et leur utilisation dans la detection d'acides nucleiques bicatenaires
WO1995002699A1 (fr) Analogues de groupes rapporteurs servant d'attenueurs de fond dans les bioanalyses d'hybridations
WO1994002641A1 (fr) Analogues de groupes reporters utilises comme reducteurs de fond dans des essais d'hybridation
WO1991003718A1 (fr) Procede tres sensible servant a detecter la peroxydase
JP2003254967A (ja) 標的核酸の検出方法
JPH0657160B2 (ja) ハイブリダイゼーション検定法
JP2003250599A (ja) 標的核酸の検出方法
JP2003304880A (ja) 標的核酸の検出方法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR BY CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU LV MG MN MW NL NO NZ PL PT RO RU SD SE SK UA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase