WO1994002644A9 - Detection in situ d'acides nucleiques utilisant l'amplification 3sr - Google Patents

Detection in situ d'acides nucleiques utilisant l'amplification 3sr

Info

Publication number
WO1994002644A9
WO1994002644A9 PCT/US1993/006716 US9306716W WO9402644A9 WO 1994002644 A9 WO1994002644 A9 WO 1994002644A9 US 9306716 W US9306716 W US 9306716W WO 9402644 A9 WO9402644 A9 WO 9402644A9
Authority
WO
WIPO (PCT)
Prior art keywords
probe
percent
cells
sir
solution
Prior art date
Application number
PCT/US1993/006716
Other languages
English (en)
Other versions
WO1994002644A1 (fr
Filing date
Publication date
Priority claimed from US07/916,068 external-priority patent/US5521061A/en
Application filed filed Critical
Priority to AU47751/93A priority Critical patent/AU4775193A/en
Publication of WO1994002644A1 publication Critical patent/WO1994002644A1/fr
Publication of WO1994002644A9 publication Critical patent/WO1994002644A9/fr

Links

Definitions

  • the inventions described herein concern the detection of nucleic acids through the use of nucleic acid probes.
  • RNA molecules that signify infection other diseases, and genetic disorders may be detected by hybridization reactions in which the probe reacts with the RNA molecule of interest.
  • a particularly useful approach is to use such hybridization reactions in situ, a procedure where the cells or viruses being analyzed are kept intact and the hybridization reaction takes place within the cell. Frequently, however, the number of copies of the RNA molecules to be detected is small, indeed only a single copy may be present in a given cell. The smaller the copy number, the more difficult it is to detect the RNA molecule of interest.
  • RNA polymerases bind to the promoters and proceeds to generate multiple RNA transcripts of one of the strands of the DNA molecule. New rounds of amplification take place using the multiple RNA transcripts as starting material.
  • RNA molecule of interest are those that result in cells that have undergone chromosomal translocation, either interchromoso al or intrachromosomal, in particular those whose origin of transcription is at or near the junction point created by the joining of two normally separated chromosomal fragments.
  • Nucleic acid technology has been used to detect nucleic acids created by chromosomal translocations ( M. J. Embleton, et aL, cited above; Fritsch et ah, U.S. patent 4,725,536; Stephenson et aL, U.S. patent 4,681,840.)
  • RNA molecule of interest is one transcribed from a chromosomal DNA segment containing a point mutation.
  • RNA molecules that only occur in cells that have undergone chromosomal translocation, especially various types of tumor cells.
  • 3SR probes or primers that are specific for the translocation junction region of the analyte RNA molecules.
  • Other inventions are the use of permeation and signal enhancers, the use of background reducers, and the use of improved probes.
  • the present invention is, in part, the 3SR amplification process to detect RNA molecules in situ.
  • the invention is also the use of one or more of the following inventions to improve the speed and/or sensitivity of the 3SR in situ process: permeation enhancers during the hybridization process, signal enhancers to enhance fluorescent probe signal, background reducers during fluorimetric detection of probes, free radical scavengers to reduce background fluorescence, multiple reporter groups per probe, and analogues of reporter groups to reduce hybridization background.
  • the invention is also the use of short probes that will only hybridize to sequences that span the translocation junctions on RNA molecules from cells that have undergone interchromosomal or intrachromosomal chromosomal translocation, or the use of short probes that will hybridize only to sequences that contain a particular point mutation.
  • an "analyte RNA molecule” is a molecule that the assay is designed to detect.
  • RNA molecule is an RNA molecule that is generated by using the amplification process. It will either have a nucleotide sequence complementary to all or part of an RNA analyte molecule or have a nucleotide sequence equivalent to all or part of an analyte RNA molecule.
  • a "probe” is a molecule that comprises an oligonucleotide and usually also a reporter moiety, the reporter being detectable, the oligonucleotide hybridizable to an amplification RNA molecule.
  • Reporter moieties can be radioactive, fluorescent, chemiluminescent, enzymes (e.g., alkaline phosphatase, horseradish peroxidase, or other enzymes that catalyze colorimetric reactions), or ligands (such as biotin or haptenated digoxigenin readable with an antibody) that can react specifically to ligand-specific binding molecules (such as streptavidin) linked to directly detectable moieties that are, for example, radioactive, fluorescent, chemiluminescent, or enzymes.
  • enzymes e.g., alkaline phosphatase, horseradish peroxidase, or other enzymes that catalyze colorimetric reactions
  • ligands such as biotin or haptenated digoxigenin readable with an antibody
  • ligand-specific binding molecules such as streptavidin
  • a first nucleotide sequence is "complementary" to a second nucleotide sequence if "Watson-Crick" base-pairing rules define the relationship between the two sequences: wherever there is a guanine (G) in one sequence, there is a cytosine (C) in the other sequence and wherever there is an adenine in one sequence there is either a thymine (T) or a uracil (U) in the other sequence.
  • G guanine
  • C cytosine
  • T thymine
  • U uracil
  • hybrid is a double-stranded (or partially double-stranded) molecule formed by two nucleic acid molecules wherein one molecule has a nucleotide sequence complementary to a sequence in the other molecule.
  • a first nucleotide sequence is "the equivalent" of a second nucleotide sequence if either they are identical or they are identical except for the fact that one sequence is a DNA sequence and the other an RNA sequence wherein uracil replaces thymine.
  • chromosomal translocation junction When a new or altered chromosome is created from two chromosomal segments that came together because of translocation, the point at which the two segments came together is the " chromosomal translocation junction.”
  • Nucleotide sequence is a term intended to cover a sequence where there is some atom (e.g., sulfur) other than phosphorus at some of the positions where internucleoside phosphorus normally occur.
  • a "translocation junction-spanning RNA molecule” is an RNA molecule (such as an hnRNA or mRNA molecule) comprising nucleotide sequences transcribed from portions of a chromosome on both sides of a chromosomal translocation junction.
  • a translocation junction-spanning mRNA molecule can, for example, be created in a cell by cellular processing of a translocation junction-spanning hnRNA molecule.
  • a "translocation junction-spanning RNA segment” is any RNA molecule segment that comprises nucleotide sequences transcribed from portions of a chromosome on both sides of a chromosomal translocation junction.
  • a "translocation junction-spanning amplification RNA molecule” is an amplification RNA molecule if part or all of its nucleotide sequence is complementary to or equivalent to a junction-spanning RNA molecule or RNA segment.
  • a “primer” is an oligonucleotide which is extended into a longer molecule by reverse transcriptase in the 3SR process.
  • Intrachromosomal chromosomal translocation is a translocation that arises when one or more alterations within a single chromosome creates two adjacent chromosome segments from two segments that are not adjacent in normal cells. Alterations that can cause interchromosomal chromosomal translocations include deletions of a chromosome segment, duplication of such a segment, and rearrangement or transposition of such a segment.
  • Interchromosomal chromosomal translocation is a translocation that arises when a segment of one chromosome combines with one or more segments of another chromosome.
  • a "point mutation” is mutation in a chromosome wherein a single base (e.g., guanine, cytosine, thymine, or adenine) normally present at a certain position in the chromosome's base sequence is replaced by another base (for example: cytosine, thymine, or adenine, if the base is normally guanine).
  • Point mutations of particular interest are those associated with a disease or genetic defect.
  • the use of the processes of the inventions herein for detecting a point mutation as a diagnostic or prognostic tool is also one of the present inventions.
  • a "point mutation-spanning" RNA molecule or segment is an RNA molecule or segment comprising a nucleotide sequence transcribed from a chromosomal nucleotide sequence comprising a point mutation and nucleotides on both sides of said mutation.
  • a "point mutation-spanning" probe or primer is a probe or primer that comprises a nucleotide sequence complementary or equivalent to a chromosomal nucleotide sequence comprising a point mutation and nucleotides on both sides of said mutation.
  • a "translocation junction-spanning primer” is a primer that has a nucleotide sequence complementary to or equivalent to a junction-spanning RNA segment.
  • In situ is a term used to describe processes (e.g., hybridization or 3SR) that take place inside a cell or virus that is essentially intact; the cell or virus is frequently one that has been treated with a cross-linking or precipitating fixative, many but not all of which are named herein.
  • translocation junction-spanning probe is a probe that has a nucleotide sequence complementary to or equivalent to a junction-spanning RNA segment.
  • a "biological entity” as used herein is either a cell or a virus.
  • the 3SR process is a process utilizing a reverse transcriptase, a DNA-dependent RNA polymerase, an RNase H, oligonucleotide primers, deoxyribonucleoside triphosphates (deoxyadenosine 5'-triphosphate, deoxycytidine 5'-triphosphate, deoxyguanosine 5'-triphosphate, and deoxythymidine 5'-triphosphate; dATP, dCTP, dGTP, and dTTP), ribonucleoside triphosphates (adenosine 5'-triphosphate, cytidine 5'- triphosphate, guanosine 5'-triphosphate, uridine 5'-triphosphate; ATP, CTP, GTP, UTP) and appropriate reagents such as a buffer, salts, and divalent cations, so as to generate multiple copies of at least part of an analyte RNA molecule or the complement of an analyt
  • One primer will be complementary to part of the analyte RNA molecule of interest, the other will be equivalent to part of the analyte RNA molecule of interest. At least one of the primers will have a portion that is not complementary or equivalent to part of the analyte RNA molecule, but rather is one strand of a double-stranded promoter (or binding and transcription initiation site) for a DNA-dependent RNA polymerase.
  • the process proceeds because one of the primers hybridizes to the analyte RNA molecule and then, by using the reverse transciptase, that primer is extended so that a cDNA copy of at least part of the analyte RNA molecule is formed.
  • the analyte RNA molecule is then destroyed by the RNase H.
  • the second primer is annealed to the cDNA molecule and that primer is extended by the reverse transcriptase to form a second DNA strand complementary to the cDNA molecule.
  • the second DNA strand will have a nucleotide sequence equivalent to part of the original analyte RNA molecule.
  • the result of the foregoing will be a double-stranded template DNA molecule.
  • the double-stranded template DNA molecule formed by the successive extensions of the two primers will have one or two promoters for a DNA-dependent RNA polymerase. If the first primer has one strand of such a promoter, then the reverse transcriptase will make the second strand of the promoter when it extends the second primer. If the second primer has one strand of such a promoter, the reverse transcriptase will, simultaneous with its extension of the second primer, further extend the cDNA molecule to complete the second strand of the promoter.
  • the 3SR process continues with the DNA polymerase making amplification RNA molecules each of which is complementary to a strand of the template DNA molecule.
  • the amplification molecules so formed can themselves be amplified by the enzymes and primers present just as the analyte molecule was amplified.
  • the invention is a "3SR in situ process", which is a process of detecting an analyte RNA molecule in a biological entity (especially a cell and preferably eukaryotic; especially human) which process comprises the steps of:
  • DNA-dependent RNA polymerase preferably prokaryotic
  • an RNase H preferably prokaryotic
  • a first primer and a second primer each a DNA oligonucleotide (and also the necessary deoxyribonucleoside and ribonucleoside triphosphates and reaction solution reagents such as buffers, salts, divalent cations), so as to generate amplification molecules that have a nucleotide sequence complementary or identical to a sequence of nucleotides in said analyte RNA molecule ("amplification step”), 2) forming hybrids between probe molecules and said amplification molecules in said biological entity (“hybridization step”), and
  • the first primer comprises a nucleotide sequence complementary to a first nucleotide sequence of the analyte RNA molecule
  • the second primer comprises a nucleotide sequence equivalent to a second nucleotide sequence the analyte RNA molecule
  • said first nucleotide sequence is positioned in the analyte RNA molecule at a location between said second nucleotide sequence and the 3' end of the analyte molecule
  • at least one of said two primers comprises a promoter nucleotide sequence for said polymerase
  • the probe comprises an oligonucleotide with a nucleotide sequence complementary to an nucleotide sequence in one of said amplification molecules.
  • the foregoing process is particularly suited to detecting translocation-junction spanning RNA molecules in cells that have undergone chromosomal translocation. This is a result of the fact that amplification of an analyte molecule will occur only if it contains a nucleotide sequence complementary to that of the first primer and a nucleotide sequence equivalent to that of the second primer: if those two analyte molecule nucleotide sequences are chosen so that one is on the "3' side" of the translocation junction while the other is on the "5' side of that junction", normal cells will not have a molecule that can be amplified.
  • the specificity of the process can be improved, in cases where the analyte molecule has a translocation junction, by choosing a probe so that it comprises a nucleotide sequence that is both a translocation junction-spanning probe and relatively short. If that latter sequence is a sufficiently short, it will have to completely hybridize to be stable: only cells that have undergone chromosomal translocation will produce analyte molecules to which a translocation junction-spanning probe is completely complementary as regards nucleotide sequence.
  • the process for detecting translocations can be used to detect point mutations, by using point mutation-spanning probes or primers instead of translocation junction- spanning probes or primers.
  • junction-spanning probe can also be extended by using a translocation junction-spanning primer.
  • step (2) is done by hybridizing reporter- probes to amplification RNA molecules generated by step (1), each of said reporter probes comprising both a reporter group that is detectable and an oligonucleotide comprising a base sequence complementary to a base sequence in said amplification RNA molecules.
  • Primers serve as primers for reverse transcriptase.
  • the promoter region of a promoter nucleotide sequence if present, will serve as one half of a DNA-dependent
  • RNA polymerase promoter the other half will be an DNA complementary in base sequence to the promoter region.
  • the primer will have a promoter region that will serve as one half of a DNA-dependent RNA polymerase promoter.
  • a junction-spanning primer or probe when a junction-spanning primer or probe is hybridized to a junction-spanning RNA molecule in the cell, then the hybridization is done under conditions (temperature, time, ionic strength; etc.) wherein the probe will not hybridize to a molecule that is not a junction-spanning molecule.
  • This selectivity of hybridization is accomplished by appropriate choice of the length of the primer or probe, as well as appropriate choice of the hybridization conditions according to the following principles:
  • any pair of single-stranded molecules if one has within itself a nucleotide sequence that is complementary to a nucleotide sequence in the second molecule, and both of those sequences are N nucleotides long (the total length of either molecule can be greater than N) then the molecules will form a hybrid only if N is larger than some critical value.
  • the critical value will depend partly on the hybridization conditions (temperature, choice of solvent, etc.) and partly on the nucleotide composition of the complementary sequences. By varying the hybridization conditions and/or the base sequences of the probe molecules, one can vary the critical value of N. By routine experimentation, one can determine the critical value for any set of hybridization conditions and target sequence thereby perform the processes of this invention.
  • N must exceed a critical value provides a basis for detecting nucleic acid sequences that include a junction point.
  • the nucleic acid of normal cells will have both parts of such a sequence but the two parts will not be joined. Therefore if the probe is complementary to a sequence of no more than N-l nucleotides (or a sequence of no more then N-3 nucleotides, which is preferred) on one side of the junction point and complementary to a sequence of no more than N-l nucleotides (or a sequence of no more than N-3 nucleotides, which is preferred) on the other side of the junction point, it will not hybridize to normal cell nucleic acids.
  • a translocation junction spanning probe or primer have a nucleotide sequence complementary to that of a translocation junction-spanning segment 15 to 50 nucleotides in length (more preferably, 20 to 35 nucleotides in length).
  • one half of the junction-spanning segment to which the probe or primer is complementary should be on one side of the translocation junction containing that segment (implying that the other half will be on the other side of that junction).
  • the invention is also the use of one or more of the following inventions to improve the speed and/or sensitivity of the 3SR in situ process: permeation enhancers during the hybridization process, signal enhancers to enhance fluorescent probe signal, background reducers during fluorimetric detection of probes, free radical scavengers to reduce background fluorescence, multiple reporter groups per probe, and analogues of reporter groups to reduce hybridization background.
  • permeation enhancers during the hybridization process signal enhancers to enhance fluorescent probe signal
  • background reducers during fluorimetric detection of probes background reducers during fluorimetric detection of probes
  • free radical scavengers to reduce background fluorescence
  • multiple reporter groups per probe multiple reporter groups per probe
  • analogues of reporter groups to reduce hybridization background.
  • a permeation enhancer is used such that step (2) is done in a solution comprising a compound selected from the group dimethyl sulfoxide (DMSO), an alcohol, an aliphatic alkane, an alkene, a cyclodextrin, a fatty acid ester, an amide or lactam, and an organic silane.
  • DMSO dimethyl sulfoxide
  • an alcohol an aliphatic alkane
  • an alkene an alkene
  • a cyclodextrin a fatty acid ester
  • an amide or lactam an organic silane
  • That designation is useful for distinguishing such an invention from a "signal enhancer-modified" process, described below, wherein the enhancing compound is added after the cells or viruses have been removed from the assay solution, especially when the enhancing compound is present during the fluorimetric measurement which is the final step in such an assay.
  • the assay solution used in step (2) comprises a nucleic acid probe and DMSO (2 to 20 percent) and one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty acid ester (2 to 20 percent) of the formula R ! (COO)R 2 , an amide or lactam (2 to 15 percent) of the formula R 3 (NH)(CO)R 4 , and an organic silane (2 to 20 percent) of the formula (SiR 5 R 6 R 7 )N(SiR 8 R 9 R 10 ),
  • the assay solution used in step (2) comprises a nucleic acid probe and DMSO (2 to 20 percent) and one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty acid ester (2 to 20 percent) of the formula R ⁇ COO ⁇ , an amide or lactam (2 to 15 percent) of the formula R 3 (NH)(CO)R 4 , and an organic silane (2 to 20 percent) of the formula (SiR 5 R 6 R 7 )N(SiR 8 R 9 R ⁇ 0 ), (SiR 5 R 6 R 7 )-(SiR 8 R 9 R 10 ),
  • the assay solution contains about 10 percent Triton X-100(v/v).
  • the only compound selected from the group is DMSO and the volume of DMSO is between 2 and 20 percent of that of the assay solution (v/v); it is particularly preferred that the volume of DMSO is about 10 percent of that of the assay solution (v/v).
  • the concentration of a compound be kept low enough so that none of it precipitates out of solution and so that no other compound in the assay solution precipitates.
  • Alkanes, especially squalane and those similar in structure to squalane or larger than squalane, and alcohols, especially oleyl alcohol and those similar in structure or larger than oleyl alcohol, may-depending on what other ingredients are present-partially precipitate out of the assay solution when added to concentrations of 10 percent or higher.
  • Preferred compounds include squalane, dodecyl alcohol, beta-cyclodextrin, isopropyl palmitate, 1,2-propanediol, hexamethyldisiloxane, and oleyl alcohol, pyrrolidinone, and squalane.
  • About 10% DMSO with about 10% pyrrolidinone is a preferred combination.
  • About 10% DMSO with 5% squalane and 5% pyrrolidinone is another preferred combination.
  • step (3) of the 3SR in situ process comprises at least three steps 3A, 3B, and 3C, such that 3A is performed prior to step 3B, and 3B is performed before or almost simultaneously with step 3C, as follows:
  • the signal enhancing compound selected from the group, an alcohol, an aliphatic alkane, a sugar, a fatty acid ester, an amide or lactam, and an organic silane.
  • Light quanta emitted by a fluorescent moiety of the probe molecule is considered to be quanta generated directly by the target-bound probe molecule.
  • Light quanta emitted as a result of cleavage of a chemical bond within a reporter group (e.g., isoluminol) in a chemiluminescent group is also considered to be a photon that is emitted directly by a reporter group.
  • Light quanta emitted by a scintillation fluid as a result of a radiant energy being emitted by a radioactive reporter group is considered to be quanta generated indirectly by the reporter group.
  • the signal enhancer be added to the solution in which the cell is suspended while the signal detection is made (the "detection solution”); i.e., during step (3c).
  • the detection solution i.e., during step (3c).
  • the detection solution comprises one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty acid ester (2 to 20 percent) of the formula R-(COO)R 2 , an amide or lactam (2 to 15 percent) of the formula R 3 (NH)(CO)R 4 , and an organic silane (2 to 20 percent) of the formula R 5 SiOSiR 6 , the combined volumes of DMSO and the compounds selected from the group not being more than 30 percent of the assay solution (v/v).
  • Preferred compounds include squalane, beta-cyclodextrin, , hexamethyldisiloxane, and oleyl alcohol, pyrrolidinone, squalene, and especially isopropyl palmitate, 1,2- propanediol and dodecyl alcohol. With these preferred compounds, increases in the ratio of target-generated signal to background signal of up to about three- to four-fold 5 are achievable. About 10% DMSO with about 10% pyrrolidinone is a preferred combination. About 10% DMSO with 5% squalane and 5% pyrrolidinone is another preferred combination. Notations used
  • R j (COO)R 2 stands for compounds with the structural formula
  • a kit in accordance with this aspect of the invention would comprise a probe molecule and a compound selected from the group dimethylsulfoxide (DMSO), an alcohol, an aliphatic alkane, a cyclodextrin, a fatty acid ester, an amide or lactam, and an organic silane.
  • another kit would comprise a probe molecule and a solution comprising one or more compounds selected from the group, DMSO, an alcohol, an aliphatic alkane, a cyclodextrin; a fatty acid ester, an amide or lactam, and an organic silane, the volumes of compounds totalling not more than 20 percent of the solution (v/v).
  • R 15 R 2 , R 3 , R 4 ,R 5 , R 6 , R 7 , R 8 , R 9 and R 10 are alkyl hydrocarbon structures.
  • R j and R 2 may be covalently joined to form a ring structure.
  • R 3 and R 4 may be covalently joined to form a ring structure.
  • a percent designated in parenthesis after a compound refers to the compound's concentration expressed as percent of the assay solution (v/v).
  • the alcohol has between 2 and 40 carbon atoms; that aliphatic alkane has between 10 and 60 carbon atoms; that the alkene has between 10 and 60 carbon atoms, that R j plus R 2 together have between 3 and 20 carbon atoms and, where R j and R 2 are not covalently joined so as to form a ring, R j and R 2 each have at least one carbon atom; that R 3 plus R 4 together have between 2 and 20 carbon atoms and, where R 3 and R 4 are not covalently joined so as to form a ring, R 3 and R 4 each have at least one carbon atom; and that R 5 , R 6 , R 7 , R 8 , R 9 and R 10 , each have at least one carbon atom, that the six alkyl carbon structures,R 5 , R 6 , R 7 , R 8 , R 9 and R 10 , together have no more than 20 carbon atoms.
  • the alcohol has between 3 and 30 carbon atoms
  • the aliphatic alkane has between 20 and 40 carbon atoms
  • R. plus R 2 together have between 3 and 10 carbon atoms and, where R j and R 2 are not covalently joined so as to form a ring, R r and R 2 each have at least 3 carbon atoms;
  • R 3 plus R 4 together have between 3 and 10 carbon atoms and, where R 3 and R 4 are not covalently joined so as to form a ring, R 3 and R 4 each have at least 1 carbon atom; and R 5 , R 6 , R 7 , R 8 , R 9 and R 10 , each have at least one carbon atom, that the six alkyl carbon structures,R 5 , R 6 , R 7 , R 8 , R 9 and R 10 , together have no more than 10 carbon atoms.
  • Preferred alkenes for use as permeation enhancers are those where the ratio of carbon-carbon double bonds to carbon-carbon single bonds is less than one to three.
  • the ratio is less than one in ten.
  • step 3 comprises at least three steps 3A, 3B, and 3C, wherein step 3A takes place before step 3B and step 3B is performed prior to or essentially simultaneously with step 3C, as follows:
  • step (3C) measuring the amount of light emitted at emission wavelengths of the fluorescent probe; wherein at a time after the commencement of step (1) and prior to the termination of step (3C), a background-reducing compound is present in the solution within which the cells are suspended; the background-reducing compound comprising a light absorbing moiety with a structure different than that of the fluorescent dye moiety of the fluorescent probe; the background-reducing compound having an absorption wavelength range (the range of wavelengths over which it absorbs light when the process is performed) that overlaps that part of the emission wavelength range of the fluorescent probe (the range of wavelengths over which light is emitted by the probe) in which the amount of light is measured in step (3C).
  • absorption wavelength range the range of wavelengths over which it absorbs light when the process is performed
  • the background-reducing compound be in the solution in which the cells (or virus) are is suspended in steps (3B) and (3C).
  • a light- absorbing compound to be an effective background reducer with regard to a range of wavelengths, it is preferred that it have an average molar extinction coefficient in that range that is at least 2 percent as great as the average molar extinction coefficient of Trypan Blue in the range 520 nm to 560 nm; it is more preferred that it have a molar extinction coefficient in that range that is at least 10 percent as great as the average molar extinction coefficient of Trypan Blue in the range 520 nm to 560 nm.
  • Light in the present context refers to light that is detected by a photomultiplier tube, photodiode, phototransistor, flow cytometer or an observer or camera using a fluorescent microscope. As such, light will normally be light in the visible range, but if for particular purposes the cytometer or microscope is altered to detect photons with energies greater or lower than that of visible light, then such photons are also considered to fall within the term "light” for present purposes.
  • the light absorbing moiety of the background-reducing compound because it has a different structure than the fluorescent dye moiety of the fluorescent probe, will normally have the desirable property that, if it emits light at all (i.e., it is a fluorescent compound), will have an emission spectrum different from that of the fluorescent moiety (i.e., as regards a given amount of light of a given wavelength that has been absorbed, there will be differences in the intensity of light emitted as a function of wavelength).
  • this embodiment of the invention is particularly effective partly because the background-reducing compound binds to at least some of the same non-specific targets as the probe does and, because the background-reducing compound and the probe are in close proximity, the background-reducing compound will absorb emissions from the probe. Additionally, the background-reducing compound will absorb light emitted due to autofluorescence by non-probe molecules in the cells. After absorbing light emitted by either nonspecifically bound probe or autofluorescing molecules, the background compound may emit light at its own emission wavelengths. The light emitted by the specifically bound probe molecules is absorbed to a lesser extent by the background-reducing compounds; therefore, the overall sensitivity of the analytical process is improved.
  • the process further comprises a wash step between the steps numbered (3A) and (3B) above.
  • a wash step can be performed by centrifuging the cells or viruses out of the solution in which they are suspended, then suspending them in a wash solution, and then centrifuging the cells or viruses out of the wash solution.
  • a wash solution is generally a probe-free solution, it may or may not have the background reducing compound suspended in it.
  • the cells should remain in the probe-free solution comprising the background- reducing compound for a time great enough to allow them to absorb the background- reducing compound. Five minutes is a convenient time for that purpose, but there is wide latitude as to what length of time is used.
  • the probe will comprise a fluorescent dye. It can also comprise, covalently attached to the dye, a single-stranded nucleic acid (DNA or RNA) moiety. A moiety is part of a molecule. For example, the portion of a probe that has been contributed by a nucleic acid is a nucleic acid moiety; the portion that has been contributed by the fluorescent dye is the fluorescent dye moiety.
  • the covalent attachment may occur via a linker, where the dye and the nucleic acid molecule (or antibody) are linked at different sites to the linker molecule.
  • Emission and absorption maximum wavelength data have been published for many dyes and other light absorbing compounds (see, for example, the Merck Index or the catalog of Aldrich Chemical Company, Milwaukee, Wisconsin). Such data is suggestive of which compounds can be useful, but not definitive. A scanning fluorimeter will give an entire emission or absorption spectrum. Some background- reducing compounds are listed below for some probe dyes. The efficacy of a background-reducing compound as regards a given probe dye can, however, be tested relatively easily. Fluorescein, which is frequently used as a fluorescent probe dye, has a maximum absorption wavelength at approximately 488 nm and maximum emission wavelength at approximately 525 nm.
  • Light-absorbing compounds that are good background reducers include azo dye derivatives that have a polyaromatic conjugate moiety and, on that moiety, have one or more polar groups such as a nitro group (-N0 2 ), a sulfonyl group (-S0 3 ), or an amino group (-NH 2 ). They are probably good because they tend to bind to the same proteins and membranes as the non-specifically bound probes.
  • probe dyes for which this invention is useful are flourescein, FITC, Texas Red, Coumarin, Rhodamine, Phycoerythrin, and Perci-P (or Per-C-P).
  • fluorescein fluorescein
  • FITC fluorescein isothiocyanate
  • the background reducing compounds for use with the probe dye are Naphthol Blue Black and Palatine Fast Black WAN.
  • the background reducing compounds of value might differ from those used with fluorescein- or FITC-labeled probes. It is preferred that, in the emission wavelength range of the probe dye that will be detected by the fluorimeter, fluorescent microscope or flow cytometer, the background reducing compound have an average molar extinction coefficient at least two percent (more preferably 10 per cent) that of Trypan Blue in the range 520 nm to 560 nm.
  • the background-reducer can be present at a concentration between 0.0002% and 0.10% (w/v).
  • step (3) comprises exposing the hybridized probe to light of wavelengths that are fluorescent absorption wavelengths of the hybridized probe, and detecting light of a wavelengths that are fluorescent emission wavelengths of the hybridized probe.
  • the free radical scavenger is present in reaction mixture used to carry out step (2).
  • the free radical scavenger be chosen to meet the condition that, during step (3) of the process, the amount of light emitted by the scavenger does not exceed the scavenger-caused decrease in autofluorescence. Whether a scavenger meets that condition for a given combination of fluorescent absorption and fluorescent emission wavelengths can be determined by performing the process twice, once without the scavenger and once with the scavenger (in both cases, the probe may be omitted from the process).
  • Free radical scavengers include compounds in the following four classes:
  • H donors Compounds that are hydrogen donors.
  • Preferred hydrogen donors are compounds with thiol groups, especially those linked to aromatic groups; e,g, thiophenol.
  • these compounds have a structure so that stearic hindrance prevents them from reacting with each other instead of the free radical that has to be scavenged.
  • Vitamin E (a preferred scavenger) is a compound in this class.
  • a free radical scavenger can be defined by its ability to act as a free radical scavenger under defined conditions. If FRS stands for the compound to be tested as a free radical scavenger, then the following three-step assay can be used to confirm that
  • FRS is a free radical scavenger
  • FRS and 10 mg trichoroacetyl peroxide are mixed in 5 ml dimethylformamide such that the molar ratio of FRS to trichoroacetyl peroxide is 2:1.
  • the time, M minutes, is chosen so that if Vitamin E is tested in the assay, the percentage of Vitamin E that is converted to C1 3 C- Vitamin E is less than 100.
  • M is expected to be less than 10 minutes.
  • the relative scavenging activities of two compounds can be calculated by comparing the amounts of C1 3 C-FRS formed when the two compounds are tested in the assay under identical conditions. If the amount of C1 3 -FRS formed with a compound is 20 percent of that formed when vitamin E and another compound
  • the scavenging activity of the compound is 20 percent of that of vitamin E.
  • the assay for measuring scavenging activity is based on a series of reactions wherein the treatment at 80 °C causes breakdown of one molecule of trichloroacetyl peroxide to produce two molecules of the free radical, C1 3 C*, which then reacts with the free radical scavenger to produce C1 3 C-FRS.
  • a fluorescent absorption wavelength of a probe or compound is a wavelength of radiation (especially ultraviolet or visible light) that can be absorbed by the probe or compound and, if absorbed, can result in subsequent emission of radiation (especially visible light) by that probe or compound at a wavelength longer than the fluorescent absorption wavelength.
  • the aforementioned longer wavelength is referred to as a "fluorescent emission wavelength.”
  • a fluorescent absorption wavelength is preferably in the range of about 420 nm to 460 nm.
  • the fluorescent emission wavelength is preferably in the range of about 450 nm to 690 nm.
  • the probe population is exposed to a range of absorption wavelengths and the emitted light is monitored at a range of emission wavelengths.
  • a fluorescent probe or compound is one that has fluorescent absorption wavelengths and fluorescent emission wavelengths.
  • free radical scavengers that have a free radical scavenging activity at least 1% of that of Vitamin E are preferred (scavenging activity per mole of scavenger. If the scavenger molecule is a polymer in which each repeated unit has scavenging activity then the molar concentration of the repeated unit is the pertinent variable); those that have a free radical scavenging activity at least 20 percent that of Vitamin E are even more preferred; most preferred are those that have a activity at least as great as that of
  • the fluorimetric process is normally applied substantially simultaneously to a large number of cells.
  • step (3C) comprises measuring light emitted at wavelengths between about 520 nm and 560 nm (especially at about
  • step (3B) most preferably where the absorption wavelengths of step (3B) are less than 520 nm.
  • a preferred embodiment of the fluorimetric process further comprises a wash step between the steps numbered (2) and (3).
  • a wash step can be performed by centrifuging the cell out of the solution in which it is suspended, then suspending it in a wash solution, and then centrifuging it out of the wash solution.
  • a wash solution is generally a probe-free solution.
  • the free radical scavenger not be a fluorescent molecule that emits light at the fluorescent emission wavelength of the probe. In particular, it is preferred that the free radical scavenger neither absorb light at the fluorescent absorption wavelength of the probe nor emit light at the fluorescent emission wavelength of the probe.
  • the solution that is used in step (3) comprises a fluorescent probe, a free radical scavenger and a fixative. If a free radical scavenger is added to the cocktail, its preferred concentration is from 0.1% to 10%
  • the probe comprises a single- stranded nucleic acid moiety and a plurality of reporter moieties such that each of the reporter moieties is covalently linked by means of a linker moiety to an intervening atom linked to an internucleoside phosphorus atom of the nucleic acid moiety.
  • An internucleoside phosphorous atom is one that is located between two nucleosides as opposed to being attached, at the 5' or 3' end of the oligonucleotide, to only one nucleoside.
  • the reporter moiety is a dye molecule; especially preferred is that the reporter moiety be a fluorescent dye moiety. A fluorescent dye can be detected in a flow cytometer or under a microscope fitted for detection of fluorescence.
  • the length of the probe be less than about 40 nucleotides. If the probe had seven dye molecules, each with molecular weights between about 500 and 600, and seven linker moieties with a molecular weight similar to that of the acetamido moiety (about 60) and 40 nucleotides with an average molecular weight of about 345, then the molecular weight of the labeled probe would be about 20,000.
  • a probe should normally be at least about 15 bases long for specific hybridization to take place.
  • probes used to detect nucleic acids, especially RNA, in the cell cytoplasm probes of not more than 200 nucleotides in length (molecular weight of not more than about 100,000) are preferred although larger oligonucleotides, for example, 1000 nucleotides long can be used.
  • the dye ring nearest the linker moiety will be separated from the phosphorus atom by at least two atoms (i.e., the "separation length" will be at least two atoms.
  • separation lengths of 3 to 30 atoms are preferred. Separation lengths of 3 to 10 atoms are particularly preferred.
  • the average number of nucleosides separating a dye-bound phosphorous atom from the next phosphorus atom along the oligonucleotide backbone be at least four atoms. More preferably, each phosphorous atom is separated from the next phosphorus atom along the oligonucleotide by at least six atoms.
  • the intervening atom between the linker moiety and the internucleoside phosphorous atom can, for example, be an oxygen atom, a sulfur atom, or a nitrogen atom. If the intervening atom is an oxygen atom, one has an internucleoside phosphotriester linkage.
  • the intervening atom is a sulfur atom, one has a an internucleoside phosphorothioate triester linkage. If the intervening atom is a nitrogen atom, one has an internucleotide phosphoroamidate triester internucleoside linkage.
  • the triester linkage involve the diester linkage found along the backbone of naturally occurring nucleic acids plus a third ester linkage between the phosphorus atom and the intervening atom (the atom intervening between the phosphorus atom and the linker moiety).
  • the linker moiety can be an acetamido moiety.
  • the number of atoms separating the dye molecule ring from the internucleoside phosphorus atom will be four (the nitrogen and two carbon atoms of the acetamido moiety plus the intervening sulfur atom).
  • the linker moiety can be an aminohexyl moiety.
  • the dye is fluorescein
  • the number of atoms separating the dye molecule ring nearest the linker from the internucleoside phosphorus atom will be eight, the nitrogen and six carbon atoms of the linker moiety plus the intervening nitrogen atom.
  • the dye molecule is fluorescein isothiocyanate, an additional two atoms, the nitrogen and carbon atoms contributed by the isothiocyanate moiety, will separate the dye molecule ring nearest the linker from the phosphorus atom.
  • the hybrid molecule will be formed because the nucleic acid strand of the probe hybridizes to a nucleic acid strand of the target as a result of the fact that those two strands have a nucleoside sequence complementary to each other (e.g., the nucleoside's base, adenine complementary to either uracil or thymine in the other nucleoside, guanine complementary to cytosine), it not being necessary, however, that the entire nucleoside sequence of the probe be complementary to the entire nucleoside sequence of the target.
  • the nucleoside's base e.g., the nucleoside's base, adenine complementary to either uracil or thymine in the other nucleoside, guanine complementary to cytosine
  • the fluorescent dye can be chosen as desired.
  • Commonly used fluorescent dyes are 5-(2-(iodoacetyl)amino)ethyl)amino) naphthalene- 1-sulfonic acid, 5-iodoacetamidofluorescein, 6-iodoacetamidofluorescein, tetramethylrhodamine-5-iodoacetamide, tetramethylrhodamine-6-iodoacetamide, monobromobimane, erythrosin-5-iodoacetamide, 7-diethylamino-3-((4'-iodoacetylamino) phenyl)-4-methylcoumarin, 4'-((iodoacetylamino)methyl)fluorescein, erythrosin-5- iodoacetamide, biotin iodoacetamide, N-(l-pyren
  • Monobromobiimine is a poor choice for in situ hybridization of eukaryotes, possibly because it does not efficiently pass through the cellular membranes. It is important that the reporter moiety be stably linked to the nucleic acid probe moiety under conditions of the hybridization assay, give an adequate signal and, if it is a fluorescent dye, have usable excitation and emission wavelengths.
  • a reporter dye molecule will preferably have a molecular weight in the range 400 to 700, but dyes with molecular weights between 700 and 1500 can be used.
  • step (2) an aromatic reporter group is part of the probe molecule, and before step (3) is completed, the cell is incubated with a structural analogue of the reporter group.
  • the analogue is present in the same solution used to hybridize probe molecules to the amplification molecules in the cell; furthermore step (3) is performed in a manner that will detect the reporter group but not the analogue (e.g., with a fluorescent probe, by using excitation and/or emission wavelengths that will lead to detection of the reporter group but not the analogue).
  • the reporter group is a cyclic compound.
  • the cyclic group comprises an unsaturated bond.
  • the cyclic group is an aromatic compound (one or more benzene rings).
  • the analogue is in excess as regards the reporter group; it is highly preferred that there be at least 10 times as much analogue as reporter group.
  • the invention works because the analogue competes with the reporter group for nonspecific binding sites.
  • an additional mechanism may involve aurin binding to the active site of proteins that would bind the reporter group.
  • the analogue is selected so that it retains most or all of the structural features of the reporter group.
  • the analogue may additionally have structural features not present in the probe.
  • the analogue should be able to permeate a cell or virus.
  • analogues that are aurin derivatives (rosolic acid derivatives)
  • the analogues have a polar functional group such as a -C0 2 , -NH 2 , -OH, or -S0 3 group, on an aromatic group; examples are chromoxane cyanine R and Chrome Azurol S.
  • a subgroup of preferred analogues are those that block the NH 2 groups on lysines.
  • Fluorescent reporter groups are detected by allowing the reporter group to absorb energy and then emit some of the absorbed energy; the emitted energy is then detected.
  • Chemiluminescent reporter groups are detected by allowing them to enter into a reaction, e.g., an enzymatic reaction, that results in energy in the form of light being emitted.
  • reporter groups e.g., biotin are detected because they can bind to groups such as streptavidin which are bound, directly or indirectly to enzymes, e.g. (alkaline phosphatase or horse radish peroxidase that can catalyze a detectable reaction.)
  • enzymes e.g. (alkaline phosphatase or horse radish peroxidase that can catalyze a detectable reaction.)
  • Fluorescent groups with which this invention can be used include fluorescein (or
  • Chemiluminescent groups with which this invention can be used include isoluminol (or 4-aminophthalihydrazide; See catalogues of Aldrich Chemical Co. for 1990-91, or see Molecular Probes, Inc. catalogue)
  • step (4) comprises measuring light emitted at wavelengths between about 520 nm and 560 nm (especially at about 520 nm), most preferably where the absorption wavelengths of step (3) are less than 520 nm.
  • a preferred embodiment of the fluorimetric process further comprises a wash step between the steps numbered (2) and (3).
  • a wash step can be performed by centrifuging the cell out of the solution in which it is suspended, then suspending it in a wash solution, and then centrifuging it out of the wash solution.
  • a wash solution is generally a probe-free solution.
  • the solution that is used in step (2) comprises a probe (comprising a reporter group), an analogue of the reporter group, a and a fixative. Such a probe solution is itself an invention.
  • an analogue is added to the solution used for step (2) its preferred concentration is from 0.01 to 0.5% w/v (especially about 0.05 to 0.01%).
  • Preferred combinations are fluorescein or a rhodamine derivative in combination with aurin, a derivative thereof or Napachrome Green.
  • the nucleic acid probe may be DNA, RNA, or oligonucleotides or polynucleotides comprised of DNA or RNA.
  • the DNA or RNA may be composed of the bases adenosine, uridine, thymidine, guanine, cytosine, or any natural or artificial chemical derivatives thereof.
  • the probe is capable of binding to a complementary or mirror image target cellular genetic sequence through one or more types of chemical bonds, usually through hydrogen bond formation.
  • Nucleic acid probes may be detectably labeled prior to addition to the hybridization solution. Alternatively, a detectable label may be selected which binds to the hybridization product. Probes may be labeled with any detectable group for use in practicing the invention. Such detectable group can be any material having a detectable physical or chemical property. Particularly useful are enzymatically active groups, such as enzymes (see Clin. Chem.. 22:1243 (1976)), enzyme substrates (see British Pat. Spec. 1,548,741), coenzymes (see U.S. Patents Nos. 4,230,797 and 4,238,565) and enzyme inhibitors (see U.S. Patent No. 4,134,792); fluorescers (see Clin. Chem..
  • Biotin labeled nucleotides can be incorporated into DNA or RNA by nick translation, enzymatic, or chemical means. The biotinylated probes are detected after hybridization using avidin/streptavidin, fluorescent, enzymatic or colloidal gold conjugates. Nucleic acids may also be labeled with other fluorescent compounds, with 6716
  • Nucleic acids may also be labeled by means of attaching a protein. Nucleic acids cross-linked to radioactive or fluorescent histone HI, enzymes (alkaline phosphatase and peroxidases), or single-stranded binding (SSBP) protein may also be used. To increase the sensitivity of detecting the colloidal gold or peroxidase products, a number of enhancement or amplification procedures using silver solutions may be used.
  • PhotobiotinTM labeling of probes is preferable to biotin labeling.
  • the analyte RNA can be located in a biological entity that is either a cell or a virus.
  • the cell or virus may be suspended in solution and not immobilized on a solid support.
  • the cell or virus may be immobilized on a solid support.
  • the cell or virus may be part of a tissue section (histologic section).
  • the target cell is immobilized on a solid surface during hybridization.
  • the target cell is suspended in liquid during the entire process and not immobilized on a solid surface.
  • Use of conventional flow cytometry instruments is especially facilitated with the present inventions.
  • the cells containing the analyte nucleic acid molecules may be eukaryotic cells
  • prokaryotic cells e.g., bacteria
  • plant cells or any other type of cell.
  • prokaryotic cells e.g., bacteria
  • plant cells or any other type of cell.
  • They can be simple eukaryotes such as yeast or derived from complex eukaryotes such as humans.
  • the analyte RNA may be in a non-enveloped virus or an enveloped virus (having a non-enveloped membrane such as a lipid protein membrane).
  • the analyte RNA may be viral RNA.
  • viruses e.g., human immunodeficiency virus
  • complementary analyte RNA strands can exist simultaneously in a single cell.
  • a viral nucleic acid target can be part of a virus, in which case the virus may or may not be inside a cell.
  • a viral nucleic acid target may not be part of a virus, but may be inside a cell.
  • the hybridization assay can be done for targets in biological entities in liquid suspension, in cells on slides or other solid supports, in tissue culture cells, and in tissue sections.
  • the biological entity can come from solid tissue (e.g., bone marrow, nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes, testes, cervix, and brain) or cells present in membranes lining various tracts, conduits and cavities (such as the gastrointestinal tract, urinary tract, vas deferens, uterine cavity, uterine tube, vagina, respiratory tract, nasal cavity, oral cavity, pharynx, larynx, trachea, bronchi and lungs) or cells in an organism's fluids (e.g., urine, stomach fluid, sputum, blood and lymph fluid) or stool.
  • solid tissue e.g., bone marrow, nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes
  • Fixatives and hybridization of fixed cells are discussed in PCT applications WO 90/02173 and WO 90/02204. Fixatives should provide good preservation of cellular morphology and both accessibility and hybridizability of hybridization targets (and, if desired, accessibility and immunoreactivity of antigens.)
  • Precipitation fixatives include ethanol, acetic acid, methanol, acetone, and combinations thereof.
  • Cross-linking fixatives include paraformaldehyde, glutaraldehyde and formaldehyde. Cross-linking fixatives, must be used under conditions where they do not form networks that trap nucleic acids or modify them covalently so as to destroy their hybridizability.
  • a fixative may be selected from the group consisting of any precipitating agent or cross-linking agent used alone or in combination, and may be aqueous or non-aqueous.
  • the fixative may be selected from the group consisting of formaldehyde solutions, alcohols, salt solutions, mercuric chloride sodium chloride, sodium sulfate, potassium dichromate, potassium phosphate, ammonium bromide, calcium chloride, sodium acetate, lithium chloride, cesium acetate, calcium or magnesium acetate, potassium nitrate, potassium dichromate, sodium chromate, potassium iodide, sodium iodate, sodium thiosulfate, picric acid, acetic acid, paraformaldehyde, sodium hydroxide, acetones, chloroform, glycerin, thymol, etc.
  • the fixative will comprise an agent which fixes the cellular constituents through a precipitating action and has the following characteristics: the effect is reversible, the cellular (or viral) morphology is maintained, the antigenicity of desired cellular constituents is maintained, the nucleic acids are retained in the appropriate location in the cell, the nucleic acids are not modified in such a way that they become unable to form double or triple stranded hybrids, and cellular constituents are not affected in such a way so as to inhibit the process of nucleic acid hybridization to all resident target sequences.
  • the cross linking agents when used are preferably less than 10% (v/v).
  • the hybridization solution used for step (2) of the process of detecting an analyte RNA molecule may typically comprise a chaotropic denaturing agent, a buffer, a pore forming agent, a hybrid stabilizing agent.
  • the chaotropic denaturing agents Robotson,
  • D. W. and Grant, M. E. (1966), J. Biol. Chem. 241: 4030; Hamaguchi, K. and Geiduscheck, E. P. (1962), J. Am. Chem. Soc. 84: 1329) include formamide, urea, thiocyanate, guanidine, trifluoroacetate, trichloroacetate, tetramethylamine, perchlorate, and sodium* iodide. Any buffer which maintains pH at least between 7.0 and 8.0 is preferred.
  • the pore-forming agent is for instance, a detergent such as Brij 35, Brij 58, sodium dodecyl sulfate, CHAPS or Triton X-100.
  • Triton X-100 appear to permit probe entry through the plasma membrane but not the nuclear membrane.
  • sodium desoxycholate will allow probes to traverse the nuclear membrane.
  • nuclear membrane pore-forming agents are avoided.
  • Such selective subcellular localization contributes to the specificity and sensitivity of the assay by decreasing or eliminating probe hybridization to complimentary nuclear sequences when the target biopolymer is located in the cytoplasm.
  • Hybrid stabilizing agents such as salts of mono- and di-valent cations are included in the hybridization solution to promote formation of hydrogen bonds between complimentary sequences of the probe and its target biopolymer.
  • sodium chloride at a concentration from 0.15 M to 1 M is used.
  • nucleic acids unrelated to the target biopolymers are added to the hybridization solution.
  • Solid supports which may be utilized include, but are not limited to, glass, Scotch tape (3M), nylon, Gene Screen Plus (New England Nuclear) and nitrocellulose. Most preferably glass microscope slides are used.
  • Kits for performing the various inventions herein can be constructed by packaging and/or bottling various compounds and reagents for the inventions and placing the package(s) and/or bottle(s) in a single container, preferably with instructions on how to perform the process of the invention.
  • Basic kits would have reagents useful for the 3SR process, such as the necessary enzymes and preferably also the deoxyribonucleosides and ribonucleosides.
  • Reagents for hybridization would be included, such as a formamide-containing buffer.
  • the hybridization reagents would preferably include one or more of the following: a permeation enhancer of the present inventions, a free radical scavenger, and a reporter group analogue.
  • a preferred kit would also have a background reducer, such as Evans Blue, for use during fluorimetric measurements.
  • Another embodiment of the kit would include a signal enhancer.
  • Specialized kits would contain primers and probes for specific diagnostic purposes, such as a translocation or infecting viral RNA.
  • Reagents can be purchased from any of a variety of sources including Aldrich Chemical Co., Milwaukee, Wisconsin; Sigma Chemical Co., St. Louis, Missouri;
  • PEG 4000 polyethylene glycol (ca. 4000 Mol. Wt.)
  • Ficoll nonionic polysucrose Pulcoll nonionic polysucrose (Pharmacia) Percoll colliodal PVP-coated silica ⁇ CAS # 65455-52-9 ⁇ Triton X-100 octyl phenoxy polyethylene glycol (a polyoxyethylene ether) ⁇ CAS
  • Solutions SSC has the following composition: 0.15 M NaCl, 0.15 M sodium citrate, pH 7.0.
  • 2x SSC is composed so that upon a 1:1 dilution with water, SSC would be produced; lOx SSC is composed so that upon a 1:10 dilution with water, SSC would be produced.
  • 0.1 x SSC is SSC diluted 1:10 with water.
  • SUB Fixation solution F used in flow cytometry, has the following ingredients: 4 volumes ("vol”) of ethanol plus 5 vol of 1 x PBS solution plus 1 vol of glacial acetic acid.
  • Wash solution #1 has the following composition: 0.4 M guanidinium isothiocyanate, 0.1% Triton X-100, 0.1 X SSC, in deionized water.
  • Wash solution #2 has the following composition: 0.1% Triton X-100, 0.1% SSC, in deionized water.
  • PBS is phosphate-buffered saline and has the formula, 0.136 M NaCl, 0.003M KC1, 0.008M Na 2 HP0 4 - 7H 2 0, 0.001 M KH 2 P0 4 .
  • Table 2 is illustrative of the types of diseases that can be detected by using the present inventions. It is not intended to place a limit on the types of diseases or translocations that can be detected by the present inventions.
  • proximal dell5q Prader-Willi syndrome t(l;15)(p36.2;pll.2) generalized muscular hypotonia (X;5)(pll.2;q35.2) Incontinentia pigmenti (2ql3) rhabdomyosarcoma t(16;21)(qll;pll) Trisomy 16p t(l:19) Pre-B cell acute lymphoblastic leukemias t(15;17) Acute promyelocytic leukemia (APL) t(l;7)(pll;pll) acute myeloid leukemia or myelodysplasia (8q24 14q32) Burkitt's lymphoma
  • ALL congenital acute lymphoblastic leukemia
  • FAB M4 acute myelomonocytic leukemia
  • FAB M3 childhood ALL 46,XY,t(3q;llq),t(7q;19p),t(15;17)(q26;q22) ANLL
  • Cells from the K562 human chronic myelogenous leukemia-blast crisis cell line in medium plus 10% fetal bovine serum were used. 3 x IO 7 cells were centrifuged at 5 minutes at 250 X g. The supernatant fluid was aspirated and the cells were resuspended in phosphate-buffered saline after 3 minutes at room temperature. The cells were centrifuged for 5 minutes, the supernatant fluid was aspirated and the cells were resuspended in 4% paraformaldehyde. After incubation for 3 minutes at room temperature the cells were dehydrated through graded alcohol.
  • the cells were centrifuged for 5 minutes, the 4% paraformaldehyde was aspirated, and resuspended in 1 ml DEPC-treated 30% ethanol.
  • DEPC diethylpyrocarbonate
  • After 3 minutes at room temperature 0.8 ml of 100% ethanol was added to adjust the ethanol concentration to 60%.
  • 1.8 ml of 100% ethanol was added to bring the concentration to 80% ethanol.
  • 11.4 ml 100% ethanol was added to produce 95% ethanol.
  • the cells were then centrifuged for 5 minutes, the ethanol aspirated and they were resuspended in 4.5 ml 100% ethanol. After 3 minutes at room temperature, the cells were serially rehydrated.
  • the cells were spun in a microcentrifuge for 2 minutes at 1500 rpm, the supernatant fluid aspirated, and the cells resuspended in ml Proteinase K (10 ug/ml) in DEPC-treated 2 mM CaCl 2 , 20 mM Tris-Cl pH 7. After 15 minutes digestion at 42°, the cells were centrifuged 2 minutes at 1500 rpm and resuspended in 1 ml DEPC- treated PBS. The cells were spun 2 minutes at 1500 rpm, the supernatant fluid aspirated, and resuspended in 1 ml DEPC-treated PBS.
  • the cells were centrifuged 2 minutes at i500 rpm, the supernatant aspirated, and 100 microliters 3SR solution containing bcr- and abl- 3SR primers (each at 250 ng/100 ul) and the enzymes and buffers for the 3SR reaction were added.
  • the 3SR reaction solution had Tris-HCl (40 mM, pH 8.1), MgCl 2 (30 mM), KC1 (20 mM), DTT (10 mM), spermidine (4 mM), ATP (7 mM), CTP (7 mM), GTP (7 mM), UTP (7 mM), dATP (1 mM), dCTP (1 mM), dGTP (1 mM), TTP (1 mM).
  • the 5':bcr primer had the nucleotide sequence: AATTTAATACGACTCACTATAGGGATCAGGGTGCACAGCCGCAACGGC
  • the 3':abl primer had the nucleotide sequence: AATTTAATACGACTCACTATAGGGATCGGCTTCACTCAGACCCTGAGG
  • the enzymes in the 3SR reaction were AMV reverse transcriptase (30 units/lOOul) and T7 RNA polymerase (100 units/100 ul), and E. coli RNase H (3 units/100 ul). After 2 hours at 42°C, 1.4 ml DEPC-treated PBS was added, and 0.5 ml aliquots were transferred to each of three microcentrifuge tubes. The cells were spun 2 minutes at 1500 rpm, the solution aspirated, and the hybridization probes were added.
  • the negative probe designated NR, was derived from the nitrogen reductase gene found in bacteria and was known to not hybridize to nucleic acid within eucaryotic cells.
  • the L6-26 probe had the sequence: CGCTGAAGGGCTTCTTCCTTATTGAT
  • the K28-26 probe had the sequence: CGCTGAAGGGCTTTTGAACTCTGCTT
  • the oligodeoxynucleotides were synthesized (Applied Biosystems DNA Synthesizer Model 380 B using the recommended A.B.I. reagents), and in the last stage an aminohexyl phosphate linker was attached to the 5 ' end.
  • the 5 ' -aminohexyl oligodeoxynucleotides were then coupled to a fluorescein dye (FITC) as described elsewhere herein and purified by Waters HPCL using a baseline 810 chromatography work station.
  • FITC fluorescein dye
  • the pelleted cells was added 50 ul of a hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4 1 ug/ul sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25mM DTT, 4M guanidinium isothiocyanate, 15X Ficol/PVP, and the probe (NR, 28S, or a combination of K28-26 and L6-26, the combination being referred to here as the K28+L6 probe) added at a concentration of 2.5 ug ml.
  • a hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4 1 ug/ul sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25mM DTT, 4M guanidinium isothiocyanate, 15X Ficol/PVP, and the probe (NR, 28S,
  • the cells were incubated 1 minute at 95° to denature the 3SR products and the probes were annealed at 42° for 30 min. Proper washing after the hybridization reaction is essential to eliminate background due to nonspecific binding of the probes.
  • the cells were incubated at 42° in ml of Wash A solution, consisting of 0.1X SSC, 0.4M guanidinium isothiocyanate, and 0.1% Triton X-100.
  • the tubes were mixed on a vortex mixer, and spun in a microcentrifuge for 2 min at 1500 rpm. The supernatant was removed, and to the pellet was added 1 ml of Wash B solution at 42° consisting of 0.1X SSC, 0.2% Triton X-100.
  • the cells were mixed on a vortex mixer and spun 2 min at 1500 rpm. After aspiration of Wash B, the cells were suspended in 250 uL of 0.0025% Evans Blue (added as a background reducer) in PBS, mixed on a vortex mixer, and analyzed on a Coulter Profile flow cytometer.
  • the cells were analyzed on Profile II TM made by Coulter Instruments.
  • the instrument uses a 488nm argon laser, a 525nm band pass filter for FL1 and a 635nm band pass filter for the counterstain.
  • the sample containing the negative probe was analyzed first and the quad-stats were set so that a small percentage of the cells fell in the upper-right quadrant.
  • the sample analyzed with the positive probe was analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats were set correctly and the two samples had been handled identically, any number of cells (above the control level) that were recorded in the upper right quadrant were scored as positive.
  • the list mode data was later reanalyzed using LISTVIEW software and the light scatter gate was adjusted to include 100% of the cellular events.
  • a cursor was selected so that 93.5% were lower than the selected level when the NR probe was used, and 99% were higher than that level when the K28+L6 probe was used.
  • K562 cells can be obtained from the American Type Culture Collection, Rockville Maryland, listed as K-562 cells, ATCC CCL 243.
  • Example 2 Demonstration that 25-base oligomers hybridize while 6- to 12-base oligomers do not under the hybridization conditions of this Example
  • the H9 cell line was used in the following experiment. Cultured cells were washed with nuclease-free Phosphate Buffered Saline (PBS) and placed in a single cell suspension at a concentration that resulted in clearly separated cells. The cells were spun down to a pellet and the supernatant, drained off. The cells were resuspended in 40% ethanol, 50% PBS, and 10% glacial acetic acid and left for 12-16 hours at 4°C. After fixation, the cells were spun to remove the fixative and then washed once in IX PBS and resuspend in 2X SSC. The cells should be used immediately.
  • PBS nuclease-free Phosphate Buffered Saline
  • NR 25-AL was derived from the nitrogen reductase gene found in bacteria and was known to not hybridize to nucleic acid within eukaryotic cells.
  • the DNA sequences for these two probes used are shown in Table 4 below. Twelve base, ten base, eight base, and six base oligomers, derived from these 25-base oligomers were also prepared with the sequences shown in the Table 4 below. All sequences displayed in the Examples have the 5' end as the left end of the sequence.
  • oligodeoxynucleotides were synthesized (Applied Biosystems DNA Synthesizer
  • hybridization procedure to pelleted cells was added 50 ⁇ l of an hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4, 1 ⁇ g ⁇ l sheared DNA, 3% (v/v) Triton X-100 (alcohol derivative of polyoxylene ether, see Aldrich Chemical Co. catalogue for 1990-91), 5% PEG 4000 (polyethylene glycol), 25 mM DTT (dithiothreitol), 0.4 M guanidinium isothiocyanate, 15X Ficoll/PVP, and the probe added at a concentration of 2.5 ⁇ g/ml. Hybridizations were carried out at 42°C for 30 minutes.
  • 500X Ficoll/PVP is 5g of Ficoll type 400 (polysucrose 400,000 mol wt) plus 5 g of PVP (polyvinylpyrollidone) dissolved in water to a total volume of 100 ml; 15X Ficoll/PVP is 500X Ficoll/PVP diluted with water by a factor of 15/500.
  • the cells were analyzed on a Profile IITM made by Coulter Instruments.
  • the Instrument uses a 488nm argon laser, a 525nm band pass filter for FL1 and a 635nm band pass filter for the counterstain.
  • the sample containing the negative probe was analyzed first and the quad-stats were set so that less than 0.01% of the cells fell in the upper-right quadrant.
  • the sample analyzed with the positive probe was analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats were set correctly and the two samples had been handled identically, any number of cells (above 0.01%) that were recorded in the upper right quadrant were scored as positive.
  • H9 cells Approximately 500,000 H9 cells were equally divided into two tubes and fixed as described above. For one of these sample aliquots was added a hybridization solution containing a positive probe (28S) and to the other a negative probe (NR), corresponding to the same size as the positive probe as in the list in Table 4 above. Following hybridization and washing, flow cytometry was performed.
  • 28S positive probe
  • NR negative probe
  • Example 3 Permeation Enhancers and Signal Enhancers Flow cytometry A Coulter Profile II flow cytometer is used for flow cytometry. With FITC as the probe dye, the filter for LFL3 is a 635 nm long pass filter and the filter for LFLl is a 540 bp filter; the excitation wavelength is 488 nm. PMTl and PMT3 settings are adjusted as required. A typical useful setting when fluorescein is the dye moiety is to have a PMTl setting of 1100, a PMT3 setting of 900, and color compensation (PMTl, PMT3) of 15 percent.
  • a hybridization cocktail "HC” is a solution with the following composition: 5X SSC, 15X Ficoll/PVP, 0.16 M sodium phosphate buffer (pH6), 1 mg/ml sheared salmon sperm DNA, 10% Triton X-100, 0.4 M guanidinium isothiocyanate, 30% (v/v) formamide, 10 mM ethylene diamine tetraacetic acid (“EDTA”), 1.5% polyethylene glycol (“PEG”), 25 mM DTT (dithiothreitol), and 5 to 10 ug/ml (microgram/ml) probe.
  • 5X SSC 15X Ficoll/PVP
  • 0.16 M sodium phosphate buffer (pH6) 0.16 M sodium phosphate buffer
  • 1 mg/ml sheared salmon sperm DNA 10% Triton X-100
  • 0.4 M guanidinium isothiocyanate 30% (v/v) formamide
  • a hybridization cocktail "HC-DMSO” is a solution with the following composition: 5X SSC, 15X Ficoll/PVP, 0.16 M sodium phosphate buffer (pH6), 1 mg/ml sheared salmon sperm DNA, 10% Triton X-100, 0.4 M guanidinium isothiocyanate, 30% (v/v) formamide,
  • 500X Ficoll/PVP is 5 g of Ficoll type 400 (polysucrose, 400,000 mol wt) plus 5 g of PVP (polyvinylpyrrolidone) diluted to a total volume of 100 ml with water; 15X Ficoll/PVP is 500X Ficoll/PVP diluted with water by a factor of 15/500.
  • the 28S RNA probe is specific for ribosomal RNA and has the nucleoitde sequence of the 28S-25-AL probe described herein.
  • the NR probe is specific for the nitrogen reductase gene found in bacteria and not eukaryotic cells. It has the nucleotide sequence of the NR-25-AL probe described herein.
  • Steps 1-6 “Liquid in situ Cell Preparation and Hybridization Protocol” (steps 1-6): 1. Cells are fixed in solution F, then resuspended in 2x SSC.
  • the cells are spun out of solution and resuspended in an assay solution (consisting of the hybridization cocktail HC alone or in combination with a compound or compounds being tested as an enhancer.)
  • the following four subparts (a), (b), (c) and (d) of this example can be done by using the probes and cells (after RNA amplification and hybridization) of Example 1, or any similarly sized probes with cells that have sufficient RNA to be detected (if the cells have sufficient RNA in the absence of amplification, then the subparts can also be performed (see, for example, subpart (b).)
  • the effect of adding both an alkane (squalane) and an additional compound is demonstrated as follows: The Slide In Situ Cell Preparation and hybridization is followed.
  • the hybridization cocktail consists of 8 volumes of HC-DMSO, one volume of squalane, and one volume of squalane and one volume of additional compound.
  • the additional compound is one of the following: dodecyl alcohol (an alcohol), beta-cyclodextrin (a sugar), isopropyl palmitate (a fatty acid ester), 1,2-propanediol (an alcohol), pyrrolidinone (a lactam), hexamethyldisiloxane (an organic silane), or oleyl alcohol (an alcohol).
  • dodecyl alcohol an alcohol
  • beta-cyclodextrin a sugar
  • isopropyl palmitate a fatty acid ester
  • 1,2-propanediol an alcohol
  • pyrrolidinone a lactam
  • a signal intensity of 2 is assigned to the slide observed for the control sample. All other slides are rated 1,2,3 or 4 in comparison to the control sample slide, depending on whether the intensity was 0.5, 1.0, 1.5, or 2 times that of the control sample slide, respectively.
  • the data was analyzed by flow cytometry.
  • the Liquid In situ Cell Preparation and Hybridization Protocol was followed.
  • the cells used were Hela cells.
  • the probes used were a 28S RNA probe and an NR probe. Each probe had an FITC moiety linked to its 5' end by an Aminolink crosslinker molecule (aminohexyl; purchased from Applied Biosystems, Inc.).
  • the 28S RNA probe is a target-specific probe specific for ribosomal RNA fluorescence obtained with it represents the sum of fluorescence from target-bound probe, non-specifically bound probe and autofluorescence from cellular molecules.
  • the NR probe is specific for a plant nucleic acid sequence and, in the current Example, the fluorescence obtained with it represent the sum of fluorescence from non-specifically bound probe and autofluorescence.
  • the hybridization cocktail consisted of nine volumes of HC-DMSO plus one volume of additional compound. In the control sample, one volume of water replaced the one volume of additional compound. As a result, in all samples, the concentration of DMSO was 9 percent (v/v). Table 6
  • the ratio, 28S/NR is the ratio of the mean LFLl observed with the 28S RNA probe to the mean LFLl observed with the NR probe.
  • the results in the "28S RNA probe” and "NR probe” columns give the mean LFLl observed with the 28S RNA and NR probes, respectively.
  • the hybridization cocktail consists of 9 volumes of HC-DMSO, a half volume of squalane, and a half volume of an additional compound.
  • the additional compound is one of the following: dodecyl alcohol (an alcohol), beta-cyclodextrin (a sugar), isopropyl palmitate (a fatty acid ester), 1,2-propanediol (an alcohol), pyrrolidinone (a lactam), hexamethyldisiloxane (an organic silane), or oleyl alcohol (an alcohol).
  • the additional compound is replaced by water, so that the hybridization compound consisted of 9 volumes of HC-DMSO, a half volume of squalane, and a half volume of water.
  • the cocktail consists of nine volumes of HC-DMSO and one volume of water. As a result, in all samples, there is 9 percent DMSO (v/v). When present, squalane is present at 5 percent. When present, the additional compound is present at 5%. The ratio of the mean LFLl for signal obtained using the probe specific for the analyte RNA molecules to the mean LFLl for signal obtained using the NR probe is measured.
  • the additional compound is selected from one of the following: water (control), 1,2 propanediol, hydroxypropylcyclodextrin, hexamethyldisiloxane, dodecyl alcohol, pyrrolidinone, isopropyl palmitate, oleyl alcohol, squalane, and squalene (an alkene).
  • Mounting solution consists of 0.1% 1,4 diphenylamine (antifade) in 50% glycerol (v/v), and nuclear stain Hoechst
  • a purpose of this Example was to determine whether a compound functioned as a background reducer; i.e., whether it decreased the amount of light emitted by non- specifically bound probe molecules and autofluorescing molecules without causing a similar decrease in the amount of light emitted by specifically bound probe molecules.
  • the NR probe was a DNA 25-mer that binds to part of the bacterial nitrogen reductase gene; its nucleic acid moiety has the nucloeotide sequence of probe NR-25-AL described herein.
  • the 28S RNA probe was a DNA 25-mer that binds to 28s ribosomal RNA; its nucleic acid moiety has the nucleotide sequence of probe 28S-25-AL described herein.
  • the probes were synthesized and in the last stage an aminohexyl linker was attached to the 5' end phosphate.
  • the 5' aminohexyl oligodeoxynucleotides were then coupled to a FITC dye molecule (from Molecular Probes) and purified by HPLC.
  • a Coulter Profile II flow cytometer was used as in Example 3.
  • Hybridization cocktail HC was as in Example 3 except for the following changes: 3% Triton X-100 (v/v), 5% PEG.
  • the staining dye solution had the following composition: 0.002 % staining dye (w/v) in 1 x PBS.
  • the staining dye if useful as and used as a background-reducer, can be present at a concentration between 0.0002% and 0.10% (w/v).
  • the cells are preferably incubated with the background reducing compound between 20° C and 46° and from 2 min up to 8 hours. Some staining dyes are also background-reducing compounds. Most also function as a counterstain.
  • the staining dye solution had the same composition as the flow buffer for the
  • H9 cells are a human-derived lymphoma cell line (ATCC No. CRL 8543).
  • the amount of light emitted will be the sum of the amount of light emitted by two sources: nonspecifically bound probe molecules and autofluorescing molecules. In other words, the amount of light emitted is background light.
  • the amount of light emitted is the sum of light emitted from three sources: specifically bound probe, nonspecifically bound probe and autofluorescing molecules. In other words, the amount of light emitted is target-specific light plus background light.
  • A is the amount of light emitted when the 28S probe is used and B is the amount of light emitted when the NR probe is used.
  • A/B is measured when no compound is added as a background reducer.
  • the ratio A/B be maximized. Additionally, the amount of probe-specific light must be sufficiently high to be useful. The amount of probe specific light is (A - B). It can be seen that there is still an appreciable amount of probe specific light when the background reducing compound is used.
  • the HC cocktail varied from sample to sample only as regards the probe used.
  • Three types of probes were used: an NR probe, an HIV probe and a 28S RNA probe. Each probe had fluorescein linked to the probe's oligonucleotide.
  • step (6) a "Count vs. LFLl" histogram was generated. ("Count” refers to cell count.) This histogram was used as the basis for determining whether the compound tested was an effective background reducer. Additional histograms and an FS/SS plot were also generated but were not used as the basis for determining background reduction; they are not shown or summarized here.
  • Table 8 Summary of results of Count vs. LFLl histogram in Fig. 1
  • Ratio of means, 28S/NR is the ratio of the mean for the NR probe to the mean for the 28S probe.
  • Hybridization cocktail HC had the ingredients described elsewhere herein with the following modifications: 3% Triton X-100 (v/v; Triton X-100 is an alcohol derivative of polyoxyethylene ether, see Aldrich Chemical Co. catalogue for 1990-91) and 5% PEG 4000 were used. If a free radical scavenger is added to the cocktail, its preferred concentration is from 0.1% to 10% (v/v).
  • the temperature for the hybridization reaction preferably between 30° C and 46° C; the time preferably is between 5 minutes and 16 hours.
  • ALEX cells are a human cell line.
  • the NR probe was a fluorescein-labeled NR-25-AL probe described elsewhere herein.
  • the 28S RNA probe was a fluorescein labeled DNA oligomer specific for a human 28S RNA nucleotide sequence and described elsewhere herein. In both cases, an aminohexyl linker was attached to the 5' end phosphate and that linker was then coupled to an FITC molecule.
  • ALEX cells were fixed in solution F, then resuspended in 2 x SSC.
  • the cells were spun out of solution and resuspended in hybridization cocktail HC.
  • the HC cocktail varied from sample to sample only as regards to the free radical scavenger present (if any was added at all).
  • step (6) a "Count vs. LFLl" histogram was generated. ("Count” refers to cell count.) This histogram was used as the basis for determining whether the compound tested was an effective autofluorescence reducer. Additional histograms and an FS/SS plot were also generated but were not used as the basis for determining autofluorescence reduction; they are not shown or summarized here.
  • Added Compound is the compound added (at 5% v/v for liquids such as Vitamin E, at 5g/100 ml for solids) to the assay cocktail.
  • An indicator of autofluorescence reduction due to a free radical scavenger is the difference between the mean LFLl intensity using just cocktail and the mean LFLl intensity using cocktail plus a free-radical scavenger.
  • Another indicator is the difference between the mean LFL3 intensity using just cocktail and the mean LFL3 intensity using cocktail plus a free radical scavenger.
  • Tempo, thiophenol, and vitamin E are free radical scavengers that are effective autofluorescence reducers for the combination of fluorescent absorption emission wavelengths utilized in this Example.
  • a second experiment the procedure of the first experiment was followed except that uninfected H9 cells were used instead of ALEX cells, and either the NR probe or the 28S RNA probe was present in the HC cocktail at a concentration of 10 ug/ml (microgram/ml).
  • the NR probe was specific for a bacterial nitrogen reductase gene not present in human cells. It was used as a negative control.
  • the 28S RNA probe was specific for a human 28S RNA sequence.
  • Table B and C show results obtained with an FITC-labeled DNA probe specific for HIV sequences in H9- (uninfected) and H9+ (HIV infected) cells.
  • Table 4 the results were done with and without Evans Blue in the solution containing the cells during flow cytometry.
  • oligonucleotide 200 ug of dried oligonucleotide is dissolved in 100 ul of 50 mM phosphate buffer, pH 7.0, to form a first solution. Then one mg of iodoacetamido-fluorescein is combined with 100 ul of dry DMF (i.e., 100 percent DMF) in a second solution. The two solutions are mixed together and shaken overnight. This results in an oligonucleotide to iodoacetamido-fluorescein ratio of 1:5. After the overnight incubation, the labeled oligonucleotide is precipitated with ethanol and 3 M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye.
  • the desired fractions are collected.
  • the liquid phase is then removed under vacuum.
  • the crude material is then purified with HPLC.
  • oligonucleotide 200 ug of dried oligonucleotide are dissolved in 100 ul of 50 mM phosphate buffer, pH 7.0, to form a first solution.
  • One mg of iodoacetamido-fluorescein is combined with 100 ul of dry DMF to create a 200 ul reaction mixture.
  • the two solutions are mixed together and shaken overnight. This results in an oligonucleotide to acetamido-fluorescein ratio of 1:5 in the reaction mixture.
  • One mg of iodoacetamido-fluorescein is again combined with 100 ul of dry DMF and this 100 ul is combined with the 200 ul reaction mixture.
  • Another 100 ul of 50 mM phosphate buffer is added to the 400 ul of reaction mixture and the reaction is allowed to continue for another 6 hours.
  • the product is isolated as in Example 7.
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Abstract

Procédé de détection de molécules d'ARN in situ à l'aide du procédé d'amplification 3SR, par exemple lorsque les molécules sont des molécules de translocation-jonction-recouvrantes dans des cellules qui ont été soumises à la translocation chromosomique. Des modifications dudit procédé, qui augmentent son efficacité, sont également décrites.
PCT/US1993/006716 1992-07-17 1993-07-16 Detection in situ d'acides nucleiques utilisant l'amplification 3sr WO1994002644A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU47751/93A AU4775193A (en) 1992-07-17 1993-07-16 In situ detection of nucleic acids using 3sr amplification

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
US91589492A 1992-07-17 1992-07-17
US91592792A 1992-07-17 1992-07-17
US91590092A 1992-07-17 1992-07-17
US91589392A 1992-07-17 1992-07-17
US91618392A 1992-07-17 1992-07-17
US07/916,183 1992-07-17
US07/916,068 US5521061A (en) 1992-07-17 1992-07-17 Enhancement of probe signal in nucleic acid-mediated in-situ hybridization studies
US07/915,900 1992-07-17
US07/915,927 1992-07-17
US07/916,068 1992-07-17
US07/915,893 1992-07-17
US07/915,894 1992-07-17

Publications (2)

Publication Number Publication Date
WO1994002644A1 WO1994002644A1 (fr) 1994-02-03
WO1994002644A9 true WO1994002644A9 (fr) 1994-10-27

Family

ID=27560342

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/006716 WO1994002644A1 (fr) 1992-07-17 1993-07-16 Detection in situ d'acides nucleiques utilisant l'amplification 3sr

Country Status (4)

Country Link
AU (1) AU4775193A (fr)
IL (2) IL106380A0 (fr)
MX (1) MX9304354A (fr)
WO (1) WO1994002644A1 (fr)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2792332B1 (fr) * 1999-04-14 2001-07-27 Labonord Procede de preparation d'une suspension cytologique
DE10006662A1 (de) 2000-02-15 2001-08-23 Antigen Produktions Gmbh Gefäß zur Nukleinsäureanalytik
CN107207480B (zh) 2015-01-20 2021-06-25 生物检索技术股份有限公司 香豆素基化合物及相关方法
ES2974904T3 (es) * 2015-04-30 2024-07-02 Sakura Finetek Usa Inc Métodos para reducir la evaporación durante temperatura elevada
CA2983930C (fr) * 2016-04-15 2023-05-02 Sakura Finetek U.S.A., Inc. Procedes de reduction de l'evaporation en cas de temperatures elevees

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5166195A (en) * 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides

Similar Documents

Publication Publication Date Title
US5521061A (en) Enhancement of probe signal in nucleic acid-mediated in-situ hybridization studies
JP4527789B2 (ja) 増加した標的特異的ｔｍを持つ修飾オリゴヌクレオチドを用いた核酸配列の検出および増幅のための方法
EP2636757B1 (fr) Compositions et procédés pour la détection d'aberrations chromosomiques avec de nouveaux tampons d'hybridation
EP0192168B1 (fr) Essai de double-hybridation en phase solution pour déterminer les séquences de polynucléotides
AU673813B2 (en) Non-radioactive hybridization assay and kit
AU646635B2 (en) In-situ hybridization in suspension for detection or separation of cells
GB2293238A (en) Primers for replication and/or amplification reactions
WO2006083925A2 (fr) Sequences universelles fortement orthogonales pour des dosages d'acide nucleique
US5582982A (en) Background-reducing compounds for probe-mediated fluorimetric flow cytometric assays
JPH02135100A (ja) 特異的核酸配列の検出方法
Bauman et al. Cytochemical hybridization with fluorochrome-labeled RNA. II. Applications.
CA2084405A1 (fr) Detection de l'adn/arn par polarisation de fluorescence
US5665546A (en) Free radical scavengers useful for reducing autoflourescence in fixed cells
US5501952A (en) Analogues of reporter groups as background reducers in hybridization assays
WO1994002644A9 (fr) Detection in situ d'acides nucleiques utilisant l'amplification 3sr
WO1994002644A1 (fr) Detection in situ d'acides nucleiques utilisant l'amplification 3sr
WO2005107430A2 (fr) Regulation interne pour hybridation in situ
WO1996000234A1 (fr) Sondes d'hybridation centromeres
WO1994002500A1 (fr) Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique
WO1995019449A1 (fr) Populations de sondes d'hybridation non adjacentes
EP0729518B1 (fr) Amorces et sondes destinees a l'amplification et a la detection de l'acide nucleique du cytomegalovirus
WO1994002640A1 (fr) Sondes d'acide nucleique marquees par plusieurs reporters
WO1995002699A1 (fr) Analogues de groupes rapporteurs servant d'attenueurs de fond dans les bioanalyses d'hybridations
Mahalingam et al. In situ polymerase chain reaction detection of varicella zoster virus in infected cells in culture
WO1994002641A1 (fr) Analogues de groupes reporters utilises comme reducteurs de fond dans des essais d'hybridation