WO1996000234A1 - Sondes d'hybridation centromeres - Google Patents

Sondes d'hybridation centromeres Download PDF

Info

Publication number
WO1996000234A1
WO1996000234A1 PCT/US1995/007995 US9507995W WO9600234A1 WO 1996000234 A1 WO1996000234 A1 WO 1996000234A1 US 9507995 W US9507995 W US 9507995W WO 9600234 A1 WO9600234 A1 WO 9600234A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
sequence
nucleotides
letter
nucleotide sequences
Prior art date
Application number
PCT/US1995/007995
Other languages
English (en)
Inventor
Michael Lee Cubbage
Nagindra Prashad
Joel Bresser
Mark Blick
Original Assignee
Aprogenex, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aprogenex, Inc. filed Critical Aprogenex, Inc.
Priority to AU28716/95A priority Critical patent/AU2871695A/en
Publication of WO1996000234A1 publication Critical patent/WO1996000234A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6841—In situ hybridisation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the field of the invention is the detection of nucleic acids by using hybridization procedures.
  • the detection of nucleic acids by hybridization procedures is a valuable medical diagnostic procedure, especially when dealing with intact cells, i.e., in in. situ procedures. li can, for example, be used to detect viruses, classify microorganisms, and detect genetic defects and gene expression. In many such cases, it is of interest to identify human chromosomes by hybridization procedures.
  • the centromeric regions of human chromosomes offer potentially useful targets for hybridization because the centromeric base sequences are frequently repeated multiple times within a centromere.
  • centromere probes has been disclosed in European Patent Office applications EP 0511750A1 and EP 0473253A1.
  • a probe specific for Chromosome X, and having the 25-nucleotide sequence TCGAAACGGG TATATGCTCA CGTAA was one of the probes reported in EP 0511750A1.
  • a high quality centromeric probe is one that results in well-defined and high intensity dots of detectable signal ("tight dots") when it hybridizes to a cell. It is not obvious in advance, however, that any given centromeric probe will be specific for a defined target and produce only tight dots. Indeed, for some centromeres, it is not obvious if any high quality probes can be constructed. Centromeric sequences (or sequences sufficiently similar so that they at least weakly hybridize to the probes) can also appear in non-centromeric regions or other centromeric regions. Furthermore, even if some probes are individually useful, it does not necessarily follow that a pool of several probes for the same centromeric region will also be useful. BRIEF SUMMARY OF THE INVENTION
  • the inventions are probes and probe populations for the centromeres of the human X chromosome, Y human chromosome, chromosome 1, chromosome 13, chromosome 18, and chromosome 21. Additionally, the inventions include processes for using those probes and probe populations for chromosome identification, as well as kits designed to assist carrying our such processes.
  • An "end-labelled probe” is one in which a reporter moiety is covalently linked to the nucleotide or nucleoside located at the 3' end, the 5' end, or both the 3' and 5' ends, of the oligonucleotide moiety of a probe.
  • Linkage may be direct (as when an atom of the reporter moiety is directly linked to an atom of the oligonucleotide moiety) or via a linker group, as when an atom of the reporter moiety is directly linked to an atom of a linker moiety and an atom of the oligonucleotide moiety is also directly linked to an atom of that linker moiety.
  • PCR refers to the polymerase chain reaction, an amplification process that uses oligonucleotide primers and a Taq polymerase, (see, for example, PCR protocols: a Guide to Methods and Applications, M. A. Innis et al., Eds., Academic Press, San Diego, California, 1990).
  • 3SR is an amplification system that uses oligonucleotide primers, a reverse transcriptase, DNA-dependent RNA polymerase, and RNase H (J.C. Guatelli et al, Proc. Nail. Acad. Sci. USA, 87, 1874 (1990).)
  • TAS is a transcription-based amplification system that uses oligonucleotide primers, a reverse transcriptase, and DNA-dependent RNA polymerase.
  • LCR LCR
  • LAR LAR
  • LAS refers to "ligation chain reaction”, “ligation amplification reaction”, and “ligation-based amplification system” respectively, reactions which rely on a DNA ligase to join oligonucleotides that bind to a target (K.J. Barringer et al, Gene 89, 1 17 (1990); D.Y. Wu and R.B. Wallace, Genomics, 4, 560 (1989)).
  • RNA bacteriophage enzyme uses that RNA bacteriophage enzyme to effect amplification. (P. M. Lizardi et al. Bio/Technology 6. 1197 (1988)).
  • a "moiety" is part of a molecule. When a moiety links two molecular entities together, it may be referred to as a "linker moiety”.
  • die includes any molecule or molecular moiety that can be detected fluorimetrically or spectrophotometrically, especially though not necessarily in the visible range of wavelengths.
  • a probe specific for the centromeric region of the X chromosome is useful in determining whether a cell is of female origin (therefore having two X chromosomes) or male origin (therefore having only one X chromosome). Additionally, certain types of abnormal cells, such as aneuploid cells that have one or more extra chromosomes or have less than a normal complement of chromosomes, can be identified when such chromosomes involve the X chromosome, the Y chromosome, chromosome 1, chromosome 13, chromosome 18, or chromosome 21.
  • abnormalities are cells with two X and one Y chromosome, cells with one X and two Y chromosomes, cells with one X chromosome but no Y chromosome, or trisomies for chromosome 1 , chromosome 13, chromosome 18, or chromosome 21.
  • Any centromeric probe is useful because, in conjunction with a second marker, it can be used to identify chromosomal translocation that results in either an abnormal linkage or unlinking of the two markers.
  • the current invention is an oligonucleotide probe population specific for a target that is the human chromosome X-linked alpha satellite repetitive DNA 2.0 kb repeat, said probe population comprising at least three different probes, each having a probe nucleotide sequence different from the nucleotide sequences of the other two probes and not complementary to the nucleotide sequences of the other two probes, each of said three probe nucleotide sequences complementary to a sequence of 13 to 30 nucleotides (more preferably 20 to 30 nucleotides, most preferably 25 nucleotides) in said target (13 nucleotides is the approximate minimum number needed to achieve a stable hybrid molecule; increasing the lower limit from 13 to 20 nucleotides insures that there is a closer structural similarity to the sequences in the preferred group of 16 4 sequences below; 30 nucleotides is an approximate upper limit so that the probe does not deviate too much from the preferred sequences in the group of sixteen below), such that
  • each of said three probe nucleotide sequences that is less than 25 nucleotides being the same as one of the foregoing sixteen probe nucleotide sequences, such that, in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing sixteen probe nucleotide sequences.
  • each of the individual probes in the group of 16 specified sequences is itself an invention.
  • the exceptions are the sequence TCGAAACGGG TATATGCTCA CGTAA and its complement, that sequence having already been disclosed as noted above.
  • the phrase, "TCGAAACGGG TATATGCTCA CGTAA and its complement” refers to the nucleotide sequence "TCGAAACGGGTATATGCTCACGTAA", a sequence of 25 nucleotides and its complement, the sequence
  • TTACGTGAGCATATACCCGTTTCGA another sequence of 25 nucleotides. All sequences herein are written, left-to-right, in the 5' to 3' direction. In its complement, the T (or U) of a sequence is replaced by an A, an A by a T (or U), a G by a C, and a C by a G, and after all of the bases (T, A, G, C) have been replaced accordingly, the sequence of the nucleotides is reversed for purposes of representation so that, left to right, the nucleotides are in a 5' to 3' direction.
  • probe population reflects the fact that, even if all the probe molecules that are added to the target cells in an assay are identical in structure, many
  • probe molecules will be in the volume of liquid in which the cells are suspended or immersed during the hybridization assay. That will be true regardless of whether or not the probe molecules all have the same nucleotide sequence. In many probe populations, not all the probe molecules will have the identical sequence. In such cases, the probe population will have "a population of nucleotide sequences"; i.e., two more different nucleotide sequences.
  • the current invention is an oligonucleotide probe population specific for a target that is the human Y-chromosome specific repetitive DNA Family (DYZ1) sequence, said probe population comprising at least three different probes, each having a probe nucleotide sequence different from the nucleotide sequences of the other two probes and not complementary to the nucleotide sequences of the other two probes, each of said three probe nucleotide sequences complementary to a sequence of 13 to 30 nucleotides (more preferably 20 to 30 nucleotides, most preferably 25 nucleotides) in said target, such that each of said three probe nucleotide sequences that is 25 or more nucleotides comprises a sequence selected from the following group of sixteen probe nucleotide sequences, GAGCCCTTTC AATTTGAGTC CATTC and its complement,
  • each of said three probe nucleotide sequences that is less than 25 nucleotides being the same as part of one of the foregoing sixteen probe nucleotide sequences, such that, in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing sixteen probe nucleotide sequences.
  • the invention is an oligonucleotide probe population specific for a target thai is the human alphoid repetitive DNA LI.84 mapping to chromosome 18, said probe population comprising at least two different probes whose nucleotide sequences are partially complementary to each other, each having a probe nucleotide sequence different from the nucleotide sequence of the other and not completely complementary to the sequence of the other probe, each of said two probe nucleotide sequences complementary to a sequence of 13 to 30 nucleotides (more preferably 20 to 30 nucleotides, most preferably 25 nucleotides) in said target, such that each of said two probe nucleotide sequences that is 25 or more nucleotides comprises a sequence selected from the following group of four nucleotide sequences,
  • each of said two probe nucleotide sequences that is less than 25 nucleotides being the same as part of one of the foregoing four probe nucleotide sequences, such that, in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing four probe nucleotide sequences.
  • the invention is an oligonucleotide probe population specific for a target that is the human chromosome 1 III DNA fragment, 5' end, 132 BP repeat, said probe population comprising at least two different probes, each having a probe nucleotide sequence different from the nucleotide sequence of the other and not completely complementary to the nucleotide sequence of the other probe, each of said two probe nucleotide sequences complementary to a sequence of 13 to 30 nucleotides (more preferably 20 to 30 nucleotides, most preferably 25 nucleotides) in said target, such that each of said two probe nucleotide sequences that is 25 or more nucleotides comprises a sequence selected from the following group of four nucleotide sequences,
  • each of said probe nucleotide sequences that is less than 25 nucleotides being the same as part of one of the foregoing sixteen probe nucleotide sequences, such that, in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing four probe nucleotide sequences.
  • Each of the individual probes in the group of four specified sequences for chromosome 1 is itself an invention.
  • the invention is an oligonucleotide probe population specific for a target that is human alphoid repetitive DNA LI.26 mapping to chromosomes 13 and 21 , said probe population comprising at least three different probes, each having a probe nucleotide sequence different from the nucleotide sequence of the other two probes and not completely complementary to the nucleotide sequence of the other two probe, each of said three probe nucleotide sequences complementary to a sequence of 13 to 30 nucleotides in said target, such that each of said probe nucleotide sequences that is 25 or more nucleotides comprises a sequence selected from the following group of six nucleotide sequences, AATTCAAATA AAAGGTAGAC AGCAG and its complement, CCCATAAAAA CGAGACAGAA GGATT and its complement, GATATTTAGA TTGCTTTAAC GATAT and its complement, when a probe is DNA but where the letter T is replaced by the letter U if the probe is RNA.
  • each of said probe nucleotide sequences that is less than 25 nucleotides being the same as part of one of the foregoing six probe nucleotide sequences, such that in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing six probe sequences.
  • Chromosomes 13 and 21 is itself an invention.
  • probe populations such as "An oligonucleotide probe population specific for a target that is the human chromosome X-linked alpha satellite repetitive DNA 2.0 kb repeat"
  • the type such that, in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing sixteen probe nucleotide sequences. That limitation guarantees that the preferred sixteen probe sequences will account for at least half of the sequences in the population specific for the target and thereby guarantee that they will make a significant contribution to the quality (i.e., specificity) of the probe population.
  • An illustration of how one determines whether, in the probe population, the sum of the lengths of the probe nucleotide sequences is not more than twice the sum contributed by the foregoing sixteen probe nucleotide sequences, is the following; If there are five different probe nucleotide sequences in the probe population specific for the target, three of which are 25 nucleotides in length and a member of the group of 16 probe sequences, two of which are 40 nucleotides in length and not members of the group of 16 probe sequences, then the sum of the lengths of the probe nucleotides is 155 (i.e., 3 times 25 plus 2 times 40) and the contribution of the preferred 16 nucleotide sequences is 75 (i.e., 3 times 25).
  • the target may be a centromere region or an amplification product thereof, such as the product of PCR, ligation chain reaction, ligation amplification reaction, ligation-based amplification system.
  • the centromeric probes each have a size that does not exceed 40 nucleotides.
  • the invention is a process of using the probes and/or probe populations that are aspects of this invention to detect a nucleic acid target molecule in a human cell or chromosome spread, which process comprises the steps of (1) co-incubating the human cell or chromosome spread with an oligonucleotide probe or probe population (described herein) that is specific for a target is a region of centromere of human chromosome 1 or 13 or 18 or 21 or the X or Y human chromosome,
  • step (1) detecting the oligonucleotide probe molecules that arc hybridized to the target molecules inside the cell or in the chromosome spread; such that step (1) is performed under conditions that allow the oligonucleotide probe to hybridize to the target molecule.
  • the invention is a kit for analyzing human chromosomes, said kit comprising a probe population (or probe) that is an aspect of the current invention and that will detect a centromeric region of either chromosome 1, chromosome 13, chromosome 18, chromosome 21, chromosome X, or chromosome Y, said kit further comprising either instructions for using said probe population to detect a human chromosome or an indication that a use for said probe population is to detect a human chromosome or centromere.
  • a probe population that is specific for a particular centromeric region can retain its specificity even if it is mixed with other DNA molecules.
  • the probe 10 population may be mixed in with an excess of DNA that does not bind specifically to the DNA of the target cells of interest. That would be the case where the target cells are human cells and there is an excess of human Cot DNA or salmon sperm DNA, the reason for human Cot DNA or the salmon DNA being to block the probe population from non- specific binding sites in the target cells.
  • probe population retaining its specificity even when mixed with other DNA molecules is when there are two (or more) probe populations mixed together. If the two populations are labeled with distinguishable reporter groups, e.g., fluorescent dyes that emit different colors, then both populations retain their specificity. Simultaneous use of multiple reporter groups has been disclosed in PCT application
  • a probe population may also retain its specificity for a particular centromeric region even if one or more of the probe molecules each have two (or more) different types of DNA sequences.
  • part of a probe molecule may be a nucleotide sequence specific for a particular target region (that being the "probe nucleotide sequence") and a second nucleotide sequence (referred to as a "reporter nucleotide sequence") that does not hybridize to the target DNA, but rather exists as a single-stranded "tail” in solution after the probe nucleotide sequence hybridizes to a target sequence.
  • the reporter nucleotide sequence can function as part of the reporter system.
  • the reporter nucleotide sequence may act as a target for other nucleic acid molecules that are linked to fluorescent moieties or biotin moieties further bindable to streptavidin covalently linked to fluorescent moieties) (e.g., Schneider et al., PCT application PCT/US 86/02719).
  • the reporter nucleotide sequence may act as a target for other nucleic acid molecules that , or act as a promoter for a polymerase (such as RNA polymerase or a DNA polymerase) in an amplification system (e.g., Loewy et al, EP application 8931 1834.9; M. S. Urdea, PCT application, PCT/US91/00213).
  • the probes of this invention are also useful probes when the target is purified DNA.
  • a purified nucleic acid is considered here to be one that has been extracted from a cell or has been synthesized in vitro in a cell-free system. Many procedures have been published for hybridizing probes to such purified nucleic acids. Generally, if the target is a DNA molecule, its strands are separated in whole or in part by heat or other means before the hybridization step takes place. The hybridization can take place with the target in solution phase or immobilized on a solid support (e.g., nitrocellulose paper for DNA, nylon for RNA) by well-established procedures.
  • a solid support e.g., nitrocellulose paper for DNA, nylon for RNA
  • the hybridizations vary considerably, depending in part on the level of specificity desired. Some examples are the Southern Blot procedure ( J. Mol. Biol., 98, 503-517
  • a hybrid molecule comprising a probe molecule and a target molecule is formed because the probe has a nucleotide sequence complementary to a nucleotide sequence of the target molecule (e.g., an adenine complementary to either a uracii or a thymine in the other strand, a guanine complementary to a cytosine in the other strand). It is not necessary, however, that the entire nucleotide (or nuclcoside) sequence of the probe be complementary to the entire nucleotide sequence of the target.
  • a nucleotide sequence complementary to a nucleotide sequence of the target molecule e.g., an adenine complementary to either a uracii or a thymine in the other strand, a guanine complementary to a cytosine in the other strand. It is not necessary, however, that the entire nucleotide (or nuclcoside) sequence of the probe be complementary to the entire nucle
  • the nucleic acid moiety of a probe molecule is normally single-stranded and may be DNA, RNA.
  • the DNA or RNA may be composed of the bases adenosine, uridine, thymidine, guanine, cytosine, or any natural or artificial chemical derivatives thereof.
  • Probes that are RNA can be made using a DNA synthesizer from Applied Biosystems, Inc., Foster City, CA, USA, with RNA reagents supplied by that company.
  • reporter moieties are fluorescers (see Clin. Chem.. 25_:353 (1979); chromophores; luminescers such as chemiluminescers and bioluminescers (see Clin. Chem.. 25:512 (1979)); specifically bindable ligands; and reporter moieties that are radioactive because part of their structure is a radioisotope such as 3 H, 35 S, 32 P, 125 I and , C.
  • Other reporter moieties are ones that are enzyme substrates (see British Pat. Spec. 1,548,741), coenzymes (sec U.S. Patents Nos. 4,230,797 and 4,238,565) and enzyme inhibitors (see U.S. Patent
  • Biotinylated probes e.g. by PhotobiotinTM labeling of probes are detected after hybridization using fluorescent, enzymatic or colloidal gold conjugates of avidin/strcptavidin.
  • Nucleic acids may also be labeled with immunodetectable reporter moieties such as digoxigenin detectable with anti-digoxigenin antibodies.
  • reporter moiety is a dye molecule; especially preferred is that the reporter moiety be a fluorescent dye moiety.
  • a fluorescent dye can be detected in a flow cytometer or under a microscope fitted for detection of fluorescence.
  • Preferred dyes for use as reporter moieties are fluorescent dyes that absorb light in the visible range and emit light in the visible range.
  • probes bound to the target are detected by exposing the target-bound probe to light at a wavelength that is absorbed by the dye, and detecting the light emitted by the dye moiety.
  • Another preferred reporter group is an enzyme such as alkaline phosphatase or horse radish peroxidase. If such enzymes are linked to the probe (either covalently prior to hybridization or noncovalently after hybridization, possibly as part of a complex involving other moieties such as biotin and streptavidin, they can be used to convert nondetectable (under the conditions of the assay) precursors to detectable products that serve as a signal that hybridization has taken place.
  • an enzyme such as alkaline phosphatase or horse radish peroxidase.
  • reporter group that can be detected by a nonfluorescent method is biotin, which can be detected on the basis of its ability to bind to second compound, streptavidin, which in turn can be linked to enzymes such as alkaline phosphatase or horse radish peroxidase that are detectable on the basis of their ability to react with a substrate.
  • Moieties that participate in chemiluminescent reactions ⁇ e.g., 3-aminophthalhydrazide ("luminol"), 4-methoxy-4-(3-phosphatephenyl)-spiro-( 1 ,2-dioxetane-3,2'-adamantane) disodium salt, and moieties that react with antibodies are also among the possibilities for reporter moieties.
  • a probe should normally be at least about 13 bases long for specific hybridization to take place.
  • the hybridization assay can also be done for targets in biological entities in liquid suspension, for targets in cells on slides or other solid supports, for targets in tissue culture cells, and for targets in tissue sections.
  • the biological entity can come from solid tissue (e.g., nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes, tesles, cervix, bone marrow, and brain) or cells present in membranes lining various tracts, conduits and cavities (such as the gastrointestinal tract, urinary tract, vas deferens, uterine cavity, uterine tube, vagina, respiratory tract, nasal cavity, oral cavity, pharynx, larynx, trachea, bronchi and lungs) or cells in an organism's fluids (e.g., urine, stomach fluid, sputum, blood and lymph fluid) or stool.
  • solid tissue e.g., nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph
  • In situ hybridization allows the detection of RNA or DNA sequences within individual cells. It can detect as few as 1-5 target molecules per cell in as little as 2-4 hours. (PCT Applications WO 90/02173 and WO 90/02204) It also allows for the simultaneous detection of more than one different polynucleotide sequence in an individual cell. It also allows detection of proteins and polynucleotides in the same cell.
  • a chaotropic agent such as 50% formamidc
  • a buffer such as 0.1M sodium phosphate (pH 7.4)
  • a probe population-designed to hybridize with the target nucleic acids is added to the hybridization solution. If the cells are to be ultimately viewed on glass slides (or other solid supports), the cells as either single cell suspensions or as tissue slices are deposited on the slides. The cells are fixed by choosing a fixative which provides the best spatial resolution of the cells and the optimal hybridization efficiency. After fixation, the support bound cells may be dehydrated and stored at room temperature or the hybridization procedure may be carried out immediately. The hybridization solution containing the probe is added in an amount sufficient to cover the cells. The cells are then incubated at an appropriate temperature.
  • the hybridization solution may include a chaotropic denaturing agent, a buffer, a pore forming agent, a hybrid stabilizing agent, and the target-specific probe molecule.
  • the chaotropic denaturing agents Robotson, D. W. and Grant, M. E. (1966) J. Biol. Chem. 241 : 4030; Hamaguchi. K. and Geiduscheck, E. P. (1962) J. Am. Chem. Soc.
  • 84: 1329) include formamide, urea, thiocyanate, guanidine, trichloroacetate, tetramethylamine, perchlorate, and sodium iodide. Any buffer which maintains pH at least between 7.0 and 8.0 is preferred.
  • the pore forming agent is for instance, a detergent such as Brij 35 (23 lauryl ether), Brij 58 (20 cetyl ether), sodium dodecyl sulfate, CHAPSTM ((3-[3- cholamidopropyl)-dimethylammonio]-l -propane sulfonate), Triton X-100 (a polyoxyethylene ether sold by Sigma Chemical Company, St. Louis, MO) or Tween
  • the pore-forming agent is chosen to facilitate probe entry through plasma, or nuclear membranes or cellular compartmental structures. For instance, 0.05% Brij 35 or 0.1% Triton X-100 will permit probe entry through the plasma membrane but not the nuclear membrane. Alternatively, sodium desoxycholate will allow probes to traverse the nuclear membrane.
  • Hybrid stabilizing agents such as salts of mono- and di-valent cations are included in the hybridization solution to promote formation of hydrogen bonds between complementary nucleotide sequences of the probe and its target biopolymer.
  • fixative agents may also serve as hybrid stabilizing agents and vice versa.
  • nucleic acids unrelated to the target biopolymers are added to the hybridization solution at a concentration of about 100-fold the concentration of the probe.
  • Specimens are removed after each of the above steps and analyzed by observation of cellular morphology as compared to fresh, untreated cells using a phase contrast microscope.
  • the condition determined to maintain the cellular morphology and the spatial resolution of the various subcellular structures as close as possible to the fresh untreated cells is chosen as optimal for each step.
  • the cells Prior to, during, or following, nucleic acid hybridization, the cells may be reacted with antibodies in phosphate buffered saline. A ter hybridization one may analyze the cells for both bound antibodies and bound hybridization probes.
  • Supports which may be utilized include, but are not limited to, glass, Scotch tape (3M), nylon, Gene
  • a fixative may be a precipitating agent or a cross-linking agent used alone or in combination, and may be aqueous or non-aqueous.
  • the fixative may, for example, be selected from the group consisting of formaldehyde solutions, neutral buffered formalin, alcohols, salt solutions, mercuric chloride sodium chloride, sodium sulfate, potassium dichromate, potassium phosphate, ammonium bromide, calcium chloride, sodium acetate, lithium chloride, cesium acetate, calcium or magnesium acetate, potassium nitrate, potassium dichromate, sodium chromate, potassium iodide, sodium iodate, sodium thiosulfate, picric acid, acetic acid, paraformaldehyde, sodium hydroxide, acetones, chloroform, glycerin, thymol, etc.
  • the fixative will comprise an agent which fixes the cellular constituents through a precipitating action and has the following characteristics: the effect is reversible, the cellular (or viral) morphology of interest is maintained, the antigenicity of desired cellular constituents is maintained, the nucleic acids arc retained in the appropriate location in the cell, the nucleic acids are not modified in such a way that they become unable to form double or triple stranded hybrids, and cellular constituents are not affected in such a way so as to inhibit the process of nucleic acid hybridization to all resident target sequences.
  • Choice of fixatives and fixation procedures can affect cellular constituents and cellular morphology; such effects can be tissue specific.
  • fixatives for use in the invention are selected from the group consisting of ethanol, ethanol-acetic acid, methanol, and methanol-acetone which fixatives afford the highest hybridization efficiency with good preservation of cellular morphology.
  • Fixatives for practicing the present invention include 95% ethanol/5% acetic acid for IIL-60 and normal bone marrow cells, 75% ethanol/20% acetic acid for K562 and normal peripheral blood cells, 50% methanol/50% acetone for fibroblast cells and normal bone marrow cells, and 10% formaldehyde/90% methanol for cardiac muscle tissue. These fixatives provide good preservation of cellular morphology and preservation and accessibility of antigens, and high hybridization efficiency.
  • the fixative may contain a compound which fixes the cellular components by cross-linking these materials together, for example, glutaraldehyde or formaldehyde. While this cross-linking agent must meet all of the requirements above for the precipitating agent, it is generally more "sticky" and causes the cells and membrane components to be secured or sealed, thus, maintaining the characteristics described above.
  • the cross linking agents when used are preferably less than 10% (v/v). Cross-linking agents, while preserving ultrastructure, often reduce hybridization efficiency; they form networks trapping nucleic acids and antigens and rendering them inaccessible to probes and antibodies. Some also covalently modify nucleic acids preventing later hybrid formation.
  • microscope slides containing cells may be stored air dried at room temperature for up to 18 months, in cold (4°C) 70% ethanol in water for 6-12 months, or in paraplast for up to two years. If specimens are handled under RNase-free conditions, they can be dehydrated in graded alcohols and stored for at least 18 months at room temperature.
  • Reagents can be purchased from any of a variety of sources including Aldrich Chemical Co., Milwaukee, Wisconsin, Sigma Chemical Co., St. Louis, Missouri, Molecular Probes, Inc., Eugene, Oregon, Clontech, Palo Alto, California, Kodak, Rochester, NY, and Spectrum Chemical Manufacturing Corp., Gardenea, California.
  • cells either as single cell suspensions or as tissue slices may be deposited on solid supports such as glass slides.
  • cells are placed into a single cell suspension of about l ⁇ ⁇ 6 cells per ml. The cells are fixed by choosing a fixative which provides the best spatial resolution of the cells and the optimal hybridization efficiency.
  • the hybridization may be carried out in the same solution which effects fixation.
  • This solution may contain both a fixative and a chaotropic agent such as formamide.
  • a hybrid stabilizing agent such as concentrated sodium or lithium chloride or ammonium acetate solution, a buffer, low molecular weight DNA and/or ribosomal RNA (sized to about 50 bases) to diminish non-specific binding, and a pore forming agent to facilitate probe entry into the cells.
  • Nuclease inhibitors such as vanadyl ribonucleosidc complexes may also be included.
  • a probe or probes
  • the one-step procedure is a means of carrying out the fixation, prehybridization, hybridization and detection steps normally associated with in situ hybridization procedures all in one step.
  • a convenient temperature may be used to carry out the hybridization reaction.
  • this provides a hybridization assay which can be accomplished with viable or non-viable cells in solution. In either case, the assay is rapid and sensitive.
  • the one-step hybridization procedure is carried out utilizing a single hybridization solution which may also fix the cells. This fixation may be accomplished in the same solution and along with the hybridization reaction.
  • the fixative may be selected from the group consisting of any precipitating agent or cross-linking agent used alone or in combination, and may be aqueous or non-aqueous.
  • Tissue samples are broken apart by physical, chemical or enzymatic means into single cell suspension.
  • Cells may be placed into a PBS solution (maintained to cellular osmolality with bovine serum albumin (BSA) at a concentration of 10 5 to 10 6 cells per ml.
  • BSA bovine serum albumin
  • Cells in suspension may be fixed and processed at a later time, fixed and processed immediately, or not fixed and processed in the i situ hybridization system of the present invention.
  • a single solution is added to the cells/tissues (hereafter referred to as the specimen).
  • This solution may contain the following: a mild fixative, a chaotrope, a nucleic acid probe (RNA or DNA probe which is prelabeled) and/or antibody probe, salts, detergents, buffers, and blocking agents.
  • the incubation in this solution can be carried out at 55°C for 20 minutes as well as other conditions such as those in the Example below.
  • the fixative is one which has been found to be optimal for the particular cell type being assayed (eg., there may be one optimal fixative for bone marrow and peripheral blood even though this "tissue" contains numerous distinct cell types).
  • the fixative is usually a combination of precipitating fixatives (such as alcohols) and cross-linking fixatives (such as aldehydes), with the concentration of the cross-linking fixatives kept very low (less than 10%). Frequently, the solution contains 10-40% ethanol, and 5% formalin.
  • concentration and type of precipitating agent and crosslinking agent may be varied depending upon the probe and the stringency requirements of the probe, as well as the desired temperature of hybridization.
  • the hybridization cocktail contains a denaturing agent, usually formamide at about 30% (v/v), but other chaotropic agents such as Nal, urea, etc. may also be used. Furthermore, several precipitating and/or cross-linking fixatives also have mild denaturing properties; these properties can be used in conjunction with the primary denaturant in either an additive or synergistic fashion.
  • the hybridization cocktail may be constructed to preferentially allow only the formation of RNA-RNA or RNA-DNA hybrids.
  • kits may comprise one more reagents for use in a solution for reacting said probe population with said biological entity so that a hybrid molecule can form between a molecule of the probe population and a nucleic acid molecule in the biological entity.
  • a kit could include a solution containing a fixation/hybridization cocktail and one or more labeled probes.
  • This solution could, for example, contain 0-40% ethanol/methanol, 25-40% formamide, 0-10% formaldehyde, 0.1-1.5 M LiCl, 0.05-0.5 M Tris-acetate (pH 7-8), 0.05%-0.15% Triton X-100, 20 ug/ml-200 ug/ml of a non-specific nucleic acid which does not react with the probe(s), and 0.1 ug/ml to 10 ug/ml of single stranded probes directly labeled with a reporter molecule.
  • the kit could include concentrated stock solution(s) to be diluted sufficiently to form the solutions needed for hybridization.
  • it could include any mechanical components which may be necessary or useful to practice the present invention such as a solid support (e.g. a microscope slide), an apparatus to affix cells to said support, or a device to assist with any incubations or washings of the specimens, a photographic film or emulsion with which to record results of assays carried out with the present invention.
  • Fluorescent measurements can be made using a fluorescent microscope such as an
  • Fluorescent measurements can also be made on a flow cytometer, such as a FACSTAR 1M made by Becton Dickinson.
  • a "tight dot” is one that is essentially symmetrical (circular perimeter) and small compared to the total size of the cell. In a perfect assay system, all dots observed with control cells (e.g., normal cells) are tight, there is one dot for each target region, and there is no other signal other than that created by the tight dots.
  • a "split dot” is one that appears as two tight dots that are either slightly overlapping or just touching each other. Split dots are the result of a probe hybridizing to two regions, one normally the desired target region. Split dots, if they appear in normal or control cells are not a desirable aspect of an assay. They limit the ability of the assay to detect chromosomal aberrations. Split dots, when seen, will not necessarily be seen in all cells: In some cell orientations, one dot may be hidden behind the other along the viewer's line of sight.
  • a "diffuse signal” is one that is symmetrical and shows a bright region bordering one or more less bright regions. Diffuse dots are caused by the probe binding to nontarget regions of a cell's chromosomes at a lesser intensity than it its binding to its target region. As with split dots, the appearance of the diffuse signal can vary from cell to cell depending on the cell's orientation with respect to the viewer's line of sight. Diffuse dots are not a desirable feature of an assay.
  • each X chromosome oligonucleotide probe can be determined by hybridizing it to human female cells (XX) and human male cells (XY). An oligonucleotide is then considered specific if it gave two tight dots in the female cells (or chromosome spreads from them), one tight dot in the male cells (or chromosome spreads from them), and no other signal.
  • each Y chromosome oligonucleotide probe can be determined by hybridizing it to human female cells (XX) and human male cells (XY). An oligonucleotide is then considered specific if it gave no tight dots in the female cells (or chromosome spreads), one tight dot in the male cells (or chromosome spreads), and no other signal.
  • each chromosome 18 oligonucleotide probe can be determined by hybridizing it to normal human female cells (or chromosome spreads from them) and those with a trisomy for chromosome 18. An oligonucleotide is then considered specific if it gave two tight dots in the normal cells (or chromosome spreads), three tight dots in the trisomic cells or spreads, and no other signal.
  • each chromosome 1 oligonucleotide probe can be determined by hybridizing it to normal human female cells, chromosome spreads, or metaphase spreads. An oligonucleotide is considered specific if it gave two tight dots in the normal cells or their chromosome spreads, and no other signal.
  • each chromosome 13/21 oligonucleotide probe (a probe that will hybridize to either the centromere of chromosome 13 or the centromere of chromosome 21) can be determined by hybridizing it to normal or trisomic human cells, chromosome spreads, or metaphase chromosome spreads. An oligonucleotide is then considered specific if the only signal it generated was four tight dots in normal cells or spreads, or five tight dots in cells or chromosome spreads trisomic for either chromosome 13 or 21.
  • Useful reagents and solutions for performing hybridization include 0.0025% Evans Blue and or 10% dodecyl alcohol in the solution analyzed cytofluorimetrically; 5% (v/v) vitamin E in the hybridization cocktail used when the target is a biological entity; about 8% DMSO (v/v) with about 5% or 10% squalane and about 5% or 10% pyrrolidinone in the hybridization cocktail when the target is in a biological entity; if a probe with a promoter region is used, it may be advantageous to add a compound selected from the group, dimethyl sulfoxide, an alcohol, an aliphatic alkane, an alkene, a cyclodextrin, a fatty acid ester, an amide or lactam, and an organic saline, to the solution containing the amplifying polymerase when it is added to the cells containing the hybridized probe; 5 ul of 1 M ( 1 molar) dithiothreitol and 5 ul of Proteinase
  • probes are labelled at both ends, such as with tetramethylrhodamine via a linker generated by Aminolink 2 linker (Applied Biosystems, Inc. Foster City, U.S.
  • Aminolink 2 ⁇ 6-trifluoroacetylamino)hexyl-(2-cyanoethyl)-(N,N diisopropyl)- phosphoramidite ⁇ was added to the 5' end of each oligonucleotide by standard phosphoroamidite chemistry using an Applied Biosystems Inc. DNA Synthesizer except that after the oligonucleotide was synthesized, Aminolink 2 was reacted with the oligonucleotide's 5' hydroxyl group in the same manner as a protected phosphoramidile nucleoside would react with that hydroxyl during normal oligonucleotide synthesis by the DNA synthesizer.
  • PROCEDURES FOLLOWED IN THE EXAMPLES PREPARATION OF CELLS FOR HYBRIDIZATION AND HYBRIDIZATION CONDITIONS:
  • cells were prepared for hybridization and hybridized with probes essentially as follows, or with minor variations: Cells were grown to confluence in 5% CO 2 , then rinsed in IX PBS. To the cells were added 0.25% trypsin in 0.02 M EDTA. They were incubated at 37°C for 5 min, then gently tapped to dislodge cells. They were then washed in media and then spun by cytospin for about 7 min at 700 rpm onto clean glass slides and left to air dry. To the dried cells was added 20 ul of ethanol: methanol (3: 1). They were then allowed to dry. Hybridization was done by incubating the cells on slides in 20 ul of a hybridization cocktail al 85°C for 15 min after which the cells were washed once with wash solution A and five times with wash solution B before being mounted in mounting solution.
  • the hybridization solution was made according to the following formula:
  • DTT Dithriothreitol
  • Enzymatically digested/Sheared Herring Sperm DNA 0.2 ml
  • wash solution A had the following composition: 0.4 M guanidium isothiocyanate, 0.1 % Triton X-100, 0.1 x SSC in deionized water.
  • Wash solution B had the following composition: 0.1 % Triton X-100, 0.1 x SSC in deionized water.
  • Mounting solution was 0.1% 1 ,4 diphenylamine (antifade) in 50% glycerol (v/v) and nuclear stain Hoechst (#33258; 1 ug/ml).
  • PEG polyethylene glycol
  • SSC 0.15 sodium citrate, 0.015 M sodium citrate.
  • Ficoll/PVP is 5 g of Ficoll type 400 (polysucrose 400,000 molecular weight) plus 5 g of PVP (polyvinylpyrrolidone) diluted to a total volume of 100 ml with water.
  • Sodium phosphate buffer is pll 6.8.
  • the fluorescent signal was measured by a fluorescent microscope and compared to each other by intensity.
  • An Olympus BH-2 microscope was used.
  • White blood cells were stimulated with mitogen (phytohemagglutinin at 1 ug/ml) to divide; while dividing, the cells were arrested in metaphase with colchicine (0.01 ug/ml) which disrupts microtubules.
  • Cells were suspended in hypotonic solution (0.075 M KC1 for 15 to 30 min then resuspended in methanol :acetic acid (3: 1) and dropped onto glass slides where they lysed.
  • mitogen phytohemagglutinin at 1 ug/ml
  • TTCCATTCCA TTCCAATCCA TTCCTTTCCT TTCGCTTGCA TTCCATTCTA 50
  • TTCCAGTATA TTCCATTGTA TTCGATCCCA TTCCTTTCAA TTCCATTTCA 600
  • TCAATTCCAT TCGACTCTAT TCCGTTCCAT TCAATTCCAT TCCATTCGAT 2950 TCCATTTTTT TCGAGAACCT TCCATTACAC TCCCTTCCAT TCCAGTGCAT 3000
  • TCAATTCTAT TCCATTCGAT TTAGTTCGAT
  • TCTATTCACT TCCATTCCAT 3450
  • TCGATTCCAG TCCATTGGAG
  • TCAATTCCTT TCGACACCCA GCCTTTCCAG 3500
  • AATTCATTTG AAGACAATTC CATTCAATAC CAATTGATGA TGGTTATTTT 50 TGATTCCATT TGATGATGAT TACATTCCAT TTCATCATAA TTCCATTCGA 100 TTCCACTCGA GATTCCATTC GATTCCATTC AA 132
  • the map used is that for the "Human chromosome X-linked alpha satellite repetitive DNA 2.0 kb repeat”.
  • the map used is that for the "Human Y-Chromosome specific repetitive DNA Family (DYZl) Sequence"
  • map positions of the nucleotides at the 5' end of various nonpreferred chromosome 1 probes each 25 nucleotides in length.
  • the map used is that for the "Human satellite III DNA fragment, 5' end", unless the map position is marked with an asterisk (*). If the map position is marked with an asterisk, that position denotes the 3' position of a sequence complementary to the probe. For example, for probe T1A-2, the 3' end of its sequence is a "T" complementary to the "A" at position 46 on the map, the 5' end of its sequence is an "A" complementary to the "T” at position 71 on the map.
  • Probe # map position (5' if not marked with *)
  • map positions of the nucleotides at the 5' end of various nonpreferred chromosome 18 probes each 25 nucleotides in length.
  • the map used is that for the "Human alphoid repetitive DNA LI.84 mapping to chromosome 18", unless the map position is marked with an asterisk (*). If the map position is marked with an asterisk, that position denotes the 3' position of a sequence complementary to the probe.
  • the map used is that for "Human alphoid repetitive DNA L1.26 mapping to chromosome 13 and 21".
  • Oligonucleotides 25-nucleotides long, were made with sequences found in the "human chromosome X-linked alpha satellite repetitive DNA 2.0 kb repeat".
  • the dye on the 5' end of the Aminolink 2 linker of each oligonucleotide was tetramethylrhodamine.
  • the cells were female white blood cells (WBC).
  • oligonucleotide pools were made: Pool 1 had equal amounts of oligonucleotides 1, 8, 15, and 16. Pool 2 had equal amounts of oligonucleotides 18, 19, 33 and 62.
  • each pool the concentration of each oligonucleotide was 10 ug/ml.
  • Hybridization was carried out for 15 min at 85 °C. When pools 1 and 2 were both present in the hybridization cocktail, there were some cells ( about 70 % of the cells) with both one tight dot and one split dot. There were also cells (about 30 % of the cells) with a diffuse signal.
  • Oligonucleotides 25-nucleotides long, were made with sequences found in the "human chromosome X-linked alpha satellite repetitive DNA 2.0 kb repeat".
  • the dye on the 5' end of the Aminolink 2 linker of each oligonucleotide was tetramethylrhodamine.
  • the concentration of individual probes in the hybridization assay was 50 ug/ml.
  • the cells were SiHA Cells (Female, polyploid cells with 4 to 8 X-chromosomes). A good result ("specific") was one in which 4-8 tight dots were observed.
  • probes that either gave no signal or were nonspecific could be excluded from further consideration as high quality, preferred probes.
  • probe 44 specific results were obtained in another experiment, but the lack of consistent specific results caused it to be less than preferred. Those characterized as “specific” or “result uncertain” were still considered to be preferred probes, unless shown to be otherwise by the results of other experiments.
  • the pool contained equal concentrations of probe numbers 6, 7, 9, 1 1, 16, 25, 43, 54 each at a concentration of 5 ug/ml.
  • the probes were each 25 nucleotides long and had a nucleotide sequence contained in the Y
  • Chromosome Centromere the "Human Y-Chromosome specific repetitive DNA Family
  • the dye at the 5' end of each probe was tetramethylrhodamine.
  • Hybridizations were done to "XX + 18" cells (female cells with chromosome 18 trisomy; cells and instructions for maintaining them in culture were obtained from Coriell Institute for Medical Research, Camden, NJ, its catalogue No. GM 03538) and "XY + 21 " cells
  • the cells used were "XX + 18" cells.
  • the dye at the 5' end of each probe was tetramethylrhodamine.
  • the criterion for a good result was: No signal.
  • the results were:
  • Oligonucleotides 10 and 1 1 were each 25-nucleotides long had each had a nucleotide sequence present in the centromeric DNA strand complementary to that specified herein as "Human alphoid repetitive DNA L1.84 mapping lo chromosome 18".
  • Oligonucleotides 10-OL and 10-OR base sequences were partially complementary to that of oligonucleotide 10, and were targeted for the centromere strand specified herein as "Human alphoid repetitive DNA LI.84 mapping to chromosome 18.
  • Oligonucleotide 1 1-OR was partially complementary to probe 1 1 and was targeted for the centromere strand specified herein as "Human alphoid repetitive DNA LI.84 mapping to chromosome 18.
  • each probe was tetramethylrhodamine.
  • Cells were "XX + 18" cells.
  • the concentration of each probe in the hybridization cocktail was 80 ug/ml.
  • the criterion for a good result was: three tight dots. The results were as follows:
  • Probe 10 The amount of signal other than three tight dots, ranged from none to very little.
  • Probe 10-OL In addition to three tight dots, nonspecific signal was observed.
  • Probe 10-OR Three tight dots, no non-specific signal.
  • Probe 11 In addition to three tight dots, there was strong non-specific signal.
  • Probe 11-OR In addition to .three tight dots, there was a very strong non-specific signal.
  • probes 10 and 10-OR are high quality, preferred probes.
  • oligonucleotides were tested individually (not as part of a pool), the oligonucleotides were numbers 1, 3, 10, 11, 12, and 14. The oligonucleotides, each 25- nuclcotidcs long, each had a nucleotide sequence complementary to one shown herein for "Human alphoid repetitive DNA LI.84 mapping to chromosome 18". The dye attached at the 5' end of each probe was tetramethylrhodamine.
  • Example 7 Probes for Chromosome number 1
  • the cells used were human white blood cells (WBC) with two "number 1 " chromosomes.
  • the target for hybridization was either WBC or a chromosome spread from WBC.
  • T1A-1 WBC 2 dots very bright T1A-1 spread 2 dots, very bright
  • centromere sequences from chromosomes 13 and 21 are identical. Therefore, the probes should hybridize equally to chromosome 13 and chromosome 21.
  • the cells used were human cell line with trisomy for chromosome 21 (GM 02419, XX+21) obtained from Coriell Institute for Medical Research.
  • the criterion for a good result was: 5 dots, 3 for chromosome 21 (trisomy 21) and 2 for chromosome 13.
  • probe combination 1 , 8 and 13 gave the specific 5 dots without any non-specific dots or signal. Therefore, probes 1, 8 and 13 are highly specific probes.
  • Example 9 Analysis of Probes by Southern Blot Hybridization
  • Southern Blot hybridization was performed to identify probes that were non-specific. A probe was considered nonspecific if it hybridized to more than one band on a
  • Cellular DNA was purified and digested to completion with restriction enzyme Eco-Rl. It was then fractionated by electrophoresis and transferred in denatured form to, and immobilized on, nitrocellulose paper. Probes labelled with 32 P were hybridized against the immobilized restriction enzyme DNA fragments in sodium phosphate buffer + 0.1% SDS at 50 °C for 12 hours. The filter paper was then washed in and analyzed for bound probe by.

Abstract

L'invention concerne des sondes et des ensembles de sondes permettant de détecter des centromères des chromosomes humains X et Y et des chromosomes humains 1, 13, 18 et 21. L'invention concerne également l'utilisation de ces ensembles de sondes pour l'identification de chromosomes, ainsi que des coffrets permettant de mettre en oeuvre de tels procédés.
PCT/US1995/007995 1994-06-23 1995-06-23 Sondes d'hybridation centromeres WO1996000234A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU28716/95A AU2871695A (en) 1994-06-23 1995-06-23 Centromere hybridization probes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US26456794A 1994-06-23 1994-06-23
US08/264,567 1994-06-23

Publications (1)

Publication Number Publication Date
WO1996000234A1 true WO1996000234A1 (fr) 1996-01-04

Family

ID=23006637

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/007995 WO1996000234A1 (fr) 1994-06-23 1995-06-23 Sondes d'hybridation centromeres

Country Status (2)

Country Link
AU (1) AU2871695A (fr)
WO (1) WO1996000234A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6194146B1 (en) 1997-06-13 2001-02-27 Bioseparations, Inc. Situ and in vitro hybridization method and buffer
FR2812641A1 (fr) * 2000-08-03 2002-02-08 Dosagene R & D Moyens pour cibler des regions repetees d'acides nucleiques
EP2185573A2 (fr) * 2007-07-26 2010-05-19 Cellay, Inc. Sondes spécifiques des chromosomes hautement visibles et procédés associés
WO2011012280A1 (fr) 2009-07-30 2011-02-03 Roche Diagnostics Gmbh Ensemble de sondes oligonucléotidiques, procédés et utilisation dudit ensemble
CN102337338A (zh) * 2011-09-28 2012-02-01 广东省妇幼保健院 同时快速检测五种染色体数目的方法及试剂盒与应用
ITPD20110081A1 (it) * 2011-03-16 2012-09-17 Univ Cagliari Metodo di visualizzazione e caratterizzazione del sistema nervoso mediante colorazione combinata per impregnazione metallica ed immunoistochimica
WO2017119930A1 (fr) * 2016-01-08 2017-07-13 Abbott Molecular Inc. Tampons d'hybridation comprenant du thiocyanate de guanidinium
US9944975B2 (en) 2015-09-03 2018-04-17 Abbott Molecular Inc. Hybridization buffers

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994002643A1 (fr) * 1992-07-17 1994-02-03 Aprogenex, Inc. Sondes d'acide nucleique et leur utilisation dans la detection d'acides nucleiques bicatenaires

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994002643A1 (fr) * 1992-07-17 1994-02-03 Aprogenex, Inc. Sondes d'acide nucleique et leur utilisation dans la detection d'acides nucleiques bicatenaires
WO1994002500A1 (fr) * 1992-07-17 1994-02-03 Aprogenex, Inc. Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NUCLEIC ACIDS RESEARCH, Volume 13, Number 8, issued 1985, WAYE et al., "Chromosome-Specific Alpha Satellite DNA: Nucleotide Sequence Analysis of the 2.0 Kilobase Pair Repeat from the Human X Chromosome", pages 2731-2743. *
NUCLEIC ACIDS RESEARCH, Volume 14, Number 19, issued 1986, NAKAHORI et al., "A Human Y-Chromosome Specific Repeated DNA Family (DYZ1) Consists of a Tandem Array of Pentanucleotides", pages 7569-7580. *
NUCLEIC ACIDS RESEARCH, Volume 14, Number 5, issued 1986, DEVILEE et al., "Sequence Heterogeneity Within the Human Alphoid Repetitive DNA Family", pages 2059-2073. *

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6194146B1 (en) 1997-06-13 2001-02-27 Bioseparations, Inc. Situ and in vitro hybridization method and buffer
FR2812641A1 (fr) * 2000-08-03 2002-02-08 Dosagene R & D Moyens pour cibler des regions repetees d'acides nucleiques
WO2002012555A2 (fr) * 2000-08-03 2002-02-14 Dosagene - R & D Moyens pour cibler des regions repetees d'acides nucleiques
WO2002012555A3 (fr) * 2000-08-03 2003-10-30 Dosagene R & D Moyens pour cibler des regions repetees d'acides nucleiques
EP2185573A2 (fr) * 2007-07-26 2010-05-19 Cellay, Inc. Sondes spécifiques des chromosomes hautement visibles et procédés associés
EP2944647A1 (fr) * 2007-07-26 2015-11-18 Cellay, Inc. Sondes spécifiques des chromosomes hautement visibles et procédés associés
EP2185573A4 (fr) * 2007-07-26 2011-12-07 Cellay Inc Sondes spécifiques des chromosomes hautement visibles et procédés associés
US8445206B2 (en) 2009-07-30 2013-05-21 Roche Diagnostics Operations, Inc. Set of oligonucleotide probes as well as methods and uses thereto
US10640815B2 (en) 2009-07-30 2020-05-05 Roche Molecular Systems, Inc. Set of oligonucleotide probes as well as methods and uses thereto
WO2011012280A1 (fr) 2009-07-30 2011-02-03 Roche Diagnostics Gmbh Ensemble de sondes oligonucléotidiques, procédés et utilisation dudit ensemble
US9347091B2 (en) 2009-07-30 2016-05-24 Roche Molecular Systems, Inc. Set of oligonucleotide probes as well as methods and uses thereto
US11421266B2 (en) 2009-07-30 2022-08-23 Roche Molecular Systems, Inc. Set of oligonucleotide probes as well as methods and uses thereto
WO2012123492A1 (fr) * 2011-03-16 2012-09-20 Universita' Degli Studi Di Cagliari Procédé, composition et trousse de visualisation et de caractérisation du système nerveux par combinaison de la coloration pour une imprégnation métallique et une immunohistochimie
CN103534571A (zh) * 2011-03-16 2014-01-22 卡利亚里大学 通过组合金属浸渍染色和免疫组化染色显现和表征神经系统的方法、组合物和试剂盒
ITPD20110081A1 (it) * 2011-03-16 2012-09-17 Univ Cagliari Metodo di visualizzazione e caratterizzazione del sistema nervoso mediante colorazione combinata per impregnazione metallica ed immunoistochimica
CN102337338A (zh) * 2011-09-28 2012-02-01 广东省妇幼保健院 同时快速检测五种染色体数目的方法及试剂盒与应用
US9944975B2 (en) 2015-09-03 2018-04-17 Abbott Molecular Inc. Hybridization buffers
WO2017119930A1 (fr) * 2016-01-08 2017-07-13 Abbott Molecular Inc. Tampons d'hybridation comprenant du thiocyanate de guanidinium
US10457981B2 (en) 2016-01-08 2019-10-29 Abbott Molecular Inc. Hybridization buffers
JP2019502386A (ja) * 2016-01-08 2019-01-31 アボツト・モレキユラー・インコーポレイテツド グアニジウムチオシアネートを含むハイブリダイゼーション緩衝液
CN108779490A (zh) * 2016-01-08 2018-11-09 雅培分子公司 包含硫氰酸胍的杂交缓冲液

Also Published As

Publication number Publication date
AU2871695A (en) 1996-01-19

Similar Documents

Publication Publication Date Title
EP0614492B1 (fr) Procede d'hybridation in situ
US5985549A (en) Non-isotopic in-situ hybridization method for detection of nucleic acids
CA2196898C (fr) Methodes pour mesurer la longueur d'un telomere
JP4517152B2 (ja) 染色体−特異的染色の方法および組成物
US6607877B1 (en) Methods and compositions for chromosome-specific staining
JP5592357B2 (ja) 新規なハイブリダイゼーションバッファーを用いた染色体異常の検出のための組成物及び方法
US5962332A (en) Detection of trinucleotide repeats by in situ hybridization
US7368245B2 (en) Method and probes for the detection of chromosome aberrations
JPH03244400A (ja) 癌評価方法
US20090215643A1 (en) Highly Visible Chromosome-Specific Probes and Related Methods
EP0673436A4 (fr) Amplification du signal de sondes dans des etudes d'hybridation in-situ a mediation par acide nucleique
EP1012330A1 (fr) Coloration de chromosomes heterospecifiques
WO1996000234A1 (fr) Sondes d'hybridation centromeres
EP0862650B1 (fr) Hybridation in situ pour detecter des sequences d'acides nucleiques specifiques dans des echantillons eucaryotes
US20050272032A1 (en) Internal control for in situ hybridization
WO1993006245A1 (fr) Composition de sondage destinee a l'identification de genomes, et procedes associes
EP0672185A1 (fr) Sondes d'acide nucleique et leur utilisation dans la detection d'acides nucleiques bicatenaires
WO1995019449A1 (fr) Populations de sondes d'hybridation non adjacentes
JP3401722B2 (ja) 核酸ハイブリッド形成アッセイにおける、またはそれに関する改良
Zitzelsberger et al. Multicolor FISH techniques for the detection of inter-and intrachromosomal rearrangements
Cannizzaro et al. Fluorescent in situ hybridization (FISH) for DNA probes in the interphase and metaphase stages of the cell cycle
Weier et al. Differential staining of human and murine chromatin in situ by hybridization with species-specific satellite DNA probes
EP0519070A1 (fr) Procede d'estimation d'un type d'antigene de leucocytes humains
van de Corput et al. Oestradiol, a new hapten for detecting nucleic acid sequences by FISH
Schwanitz et al. Fluorescence in situ hybridization

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LT LU LV MD MG MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TT UA UG UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA