WO1994002500A1 - Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique - Google Patents

Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique Download PDF

Info

Publication number
WO1994002500A1
WO1994002500A1 PCT/US1993/006674 US9306674W WO9402500A1 WO 1994002500 A1 WO1994002500 A1 WO 1994002500A1 US 9306674 W US9306674 W US 9306674W WO 9402500 A1 WO9402500 A1 WO 9402500A1
Authority
WO
WIPO (PCT)
Prior art keywords
population
molecules
molecule
nucleic acid
nucleotides
Prior art date
Application number
PCT/US1993/006674
Other languages
English (en)
Inventor
Nagindra Prashad
Christopher Lewis Reading
Mark Blick
William Dugald Weber
Michael Lee Cubbage
Shyh Chen Ju
Morteza Asgari
Joel Bresser
Original Assignee
Aprogenex, Inc.
Board Of Regents, The University Of Texas System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aprogenex, Inc., Board Of Regents, The University Of Texas System filed Critical Aprogenex, Inc.
Priority to AU47742/93A priority Critical patent/AU4774293A/en
Publication of WO1994002500A1 publication Critical patent/WO1994002500A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This inventions described herein concern the detection of nucleic acids through the use of nucleic acid probes.
  • RNA or DNA probes By the use of sp cific nucleic acid (RNA or DNA) probes, nucleic acid molecules that signify infection and other disease states may be detected. Certain genetic diseases are characterized by the presence of genes which are not present in normal tissue. Other diseased conditions are characterized by the expression of RNAs or RNA translation products (i.e. peptides or proteins) which are not expressed in normal cells. Some disease states are characterized by the absence of certain genes or gene portions, or the absence or alteration of expression of gene products or proteins.
  • One type of cell of particular interest is a normal cell that has become an aberrant cell, possibly cancerous, as a result of chromosomal translocation either interchromosomal or intrachromosomal. It is therefore desirable to be able to detect a cell with a chromosomal translocation.
  • Standard karyotyping techniques are capable of identifying cells that have undergone chromosomal translocation. Nevertheless, it would be advantageous to achieve the identification by in situ hybridization methods, as this allows a large number of cells to be analyzed relatively quickly by flow cytometry.
  • Such hybridization techniques require probes, amplification primers, or primer sets, specific for nucleic acids that only exist when a cell has undergone translocation.
  • nucleic acid technology has been used to detect nucleic acids created by chromosomal translocations ( M. J. Embleton, et al, cited above; Fritsch et al, U.S. patent 4,725,536; Stephenson et al, U.S. patent 4,681,840.)
  • the probe target is DNA
  • the target is generally a two-stranded target: an "anti-sense" strand from which RNA such as mRNA is transcribed and a "sense strand” that is complementary in base sequence to the anti-sense strand.
  • an "anti-sense" strand from which RNA such as mRNA is transcribed
  • a sense strand that is complementary in base sequence to the anti-sense strand.
  • Some of the principles applicable in designing a probe population that will hybridize against both strands of a target are also applicable to designing a probe molecule or primer molecule that will hybridize only to RNA or DNA molecules found in cells that have undergone chromosomal translocation.
  • Such probes take advantage of the new base sequences that exist as a result of the creation of the translocation junction point, the point at which two segments of normal chromosomes have joined to form a translocation chromosome.
  • the inventions relate to nucleic acid probe or primers that hybridize specifically to RNA or DNA spanning a nucleic acid translocation junction in a cell that has undergone chromosomal translocation.
  • a nucleic acid probe population is created so that although some of the probe molecules are capable of hybridizing to one strand of a double-stranded target and other probe molecules are capable of hybridizing to the other strand of that target, the probe molecules cannot hybridize to each other.
  • one has a series of probes that can, on each strand of the target, hybridize in end-to-end fashion. Self-hybridization of the probe population is avoided, by limiting the size of the probe molecules and by limiting the length of the regions that are complementary between any two probe molecules.
  • Fig. 1 Nucleotides 101 to 400 of Gen Bank sequence HUMREPA84 are marked and are shown such that nucleotide 101 is at the 5' end of the sequence and nucleotide
  • nucleotides in the sequence complementary to that between nucleotides 101 and 400 are shown below those latter nucleotides.
  • the nucleotide sequences of five probes, H18-100L, H18-100R, H18-110R, H18-10, and H18-11, are indicated.
  • Fig. 2 Diagram showing relationships among probes used in Example 3.
  • an “analyte molecule” is a molecule that the assay is designed to detect.
  • An “amplification molecule” is a nucleic acid molecule that is generated by using an amplification process (e.g., PCR, 3SR, LCR, LAR, LAS, Q ⁇ , TAS). It will either have a base sequence complementary to all or part of an RNA analyte molecule or have a base sequence the same as all or part of an analyte RNA molecule.
  • a "probe” is a molecule that comprises an oligonucleotide and usually also a reporter moiety, the reporter being detectable, the oligonucleotide hybridizable to an amplification RNA molecule.
  • Reporter moieties can be radioactive, fluorescent, chemiluminescent, enzymes (e.g., alkaline phosphatase, horseradish peroxidase, or other enzymes that catalyze colorimetric reactions), or ligands (such as biotin or haptenated digoxigenin reactable with an antibody) that can react specifically to ligand-specific binding molecules (such as streptavidin) linked to directly detectable moieties that are, for example, radioactive, fluorescent, chemiluminescent, or enzymes.
  • a first nucleotide sequence is "complementary" to a second nucleotide sequence if "Watson-Crick" base-pairing rules define the relationship between the two sequences: wherever there is a guanine (G) in one sequence, there is a cytosine (C) in the other sequence and wherever there is an adenine (A) in one sequence there is either a thymine
  • hybrid is a double-stranded (or partially double-stranded) molecule formed by two nucleic acid molecules wherein one molecule has a nucleotide sequence complementary to a sequence in the other molecule.
  • nucleotide sequence is a term intended to cover a sequence where there is
  • a "translocation junction-spanning cellular RNA molecule” is a cellular RNA molecule (such as an hnRNA or mRNA molecule) comprising two nucleotide sequences contiguous and joined at an RNA translocation junction of that molecule, one nucleotide sequence transcribed from a portion of a chromosome on one side of a chromosomal translocation junction and the second nucleotide sequence transcribed from a portion of that chromosome on the other side of that chromosomal junction.
  • a translocation junction-spanning mRNA molecule can, for example, be created in a cell by cellular processing of a translocation junction-spanning hnRNA molecule.
  • a "translocation junction-spanning cellular RNA segment” is a segment of a cellular RNA molecule (such as an hnRNA or mRNA molecule) comprising two nucleotide sequences contiguous and joined at an RNA translocation junction of that molecule, one nucleotide sequence transcribed from a portion of a chromosome on one side of a chromosomal translocation junction and the second nucleotide sequence transcribed from a portion of that chromosome on the other side of that chromosomal junction.
  • a cellular RNA molecule such as an hnRNA or mRNA molecule
  • a "translocation junction-spanning cellular DNA molecule” is a cellular DNA molecule comprising two nucleotide sequences, the two sequences contiguous as regards each other so as to form a sequence of length equal to the sum of their respective lengths, one nucleotide located on a portion of a chromosome on one side of its translocation junction and the second nucleotide sequence located on a portion of that chromosome on the other side of that junction.
  • a “translocation junction-spanning cellular DNA segment” is a segment of a cellular DNA molecule, which segment comprises two nucleotide sequences, the two sequences contiguous as regards each other so as to form a sequence of length equal to the sum of their respective lengths, one nucleotide located on a portion of a chromosome on one side of its translocation junction and the second nucleotide sequence located on a portion of that chromosome on the other side of that junction.
  • SUBSTITUTE SHEET an amplified version thereof would include segments that have a base sequence identical to that of said nucleic acid segment (considering U for RNA the same as T for DNA) or complementary thereto.
  • a "translocation junction-spanning amplification nucleic acid molecule” is an amplification nucleic acid molecule that comprises a nucleotide sequence complementary to a junction-spanning cellular nucleic acid molecule or segment.
  • a “translocation junction-spanning cellular nucleic acid molecule” is a molecule that is either a “translocation junction-spanning cellular RNA molecule” or a “junction- spanning cellular DNA molecule”.
  • a “translocation junction-spanning cellular nucleic acid segment” is a molecular segment that is either a “translocation junction-spanning cellular RNA segment” or a “junction-spanning cellular DNA segment”.
  • a “primer” is an oligonucleotide which is extended into a longer molecule by an enzyme such as a DNA polymerase (e.g., in the polymerase chain reaction, "PCR") or reverse transcriptase (e.g., in the 3SR process, Guatelli et al, Proc. Natl. Acad. Sci.
  • PCR polymerase chain reaction
  • reverse transcriptase e.g., in the 3SR process, Guatelli et al, Proc. Natl. Acad. Sci.
  • a "translocation junction-spanning primer” is a primer that has a nucleotide sequence complementary to, or the same as, a junction-spanning RNA segment.
  • In situ is a term used to describe processes (e.g., hybridization or amplification, such as PCR, LCR, LAR, LAS, Q ⁇ , TAS, or 3SR) that take place inside a cell or virus that is essentially intact; the cell or virus is frequently one that has been treated with a cross-linking or precipitating fixative, many but not all of which are named herein.
  • processes e.g., hybridization or amplification, such as PCR, LCR, LAR, LAS, Q ⁇ , TAS, or 3SR
  • Intrachromosomal chromosomal translocation is a translocation that arises when one or more alterations within a single chromosome creates two adjacent chromosome segments from two segments that are not adjacent in normal cells. Alterations that can cause interchromosomal chromosomal translocations include deletions of a chromosome segment, duplication of such a segment, and rearrangement or transposition of such a segment.
  • Interchromosomal chromosomal translocation is a translocation that arises when a segment of one chromosome combines with one or more segments of another chromosome.
  • PCR refers to the polymerase chain reaction, an amplification process that uses oligonucleotide primers and a Taq polymerase (see, for example, PCR Protocols: A guide to Methods and Applications, M. A. Innis et al, Eds., Academic Press, San Diego, California, 1990).
  • 3SR is an amplification system that uses oligonucleotide primers, a reverse transcriptase, DNA-dependent RNA polymerase, and RNase H (J. C. Guatelli et al, Proc. Natl Sci. USA. 87, 1874 (1990).
  • TAS is a transcription-based amplification system that uses oligonucleotide primers, a reverse transcriptase, and DNA-dependent RNA polymerase (D. Y. Kwoh et al, Proc. Natl. Acad. Sci. USA. 86, 1173, 1989).
  • LCR LCR
  • LAR LAR
  • LAS ligation chain reaction
  • ligation amplification reaction ligation-based amplification system
  • Q ⁇ replicase uses that RNA bacteriophage enzyme to effect amplification. (P. M. Lizardi et al, Bio/Technologv 6, 1197 (1988)).
  • a translocation junction-spanning probe is a probe that has a nucleotide sequence complementary to or the same as a junction-spanning RNA segment.
  • a "biological entity” as used herein is either a cell or a virus.
  • a "population of molecules” indicates a plurality of molecules. Often the number is large because probe and primer molecules can be as small as 15 to 50 nucleotides in length and be added to reaction mixtures at concentrations in the range 100 ng to 10 ug or even higher if necessary. "A homogenous population of molecules” means that each of the molecules is the same as every other molecule in the population.
  • a molecule comprising a nucleotide sequence complementary to a nucleotide sequence 15 to 50 nucleotides, but not more than 15 to 50 nucleotides, of either a translocation junction-spanning cellular nucleic acid segment or an amplified version thereof indicates that sequences other than those that are part of a junction spanning sequence may be part of the molecule.
  • junction-spanning primer or probe when a junction-spanning primer or probe is hybridized to a junction-spanning RNA molecule in the cell, then the hybridization is done under conditions (temperature, time, ionic strength, etc.) wherein the probe will not hybridize to a molecule that is not a junction-spanning molecule.
  • This selectivity of hybridization is accomplished by appropriate choice of the length of the primer or probe, as well as appropriate choice of the hybridization conditions according to the following principles: For any pair of single-stranded molecules, if one has within itself a nucleotide sequence that is complementary to a nucleotide sequence in the second molecule, and both of those sequences are N nucleotides long (the total length of either molecule can be greater than N) then the molecules will form a hybrid only if N is larger than some critical value. The critical value will depend partly on the hybridization conditions (temperature, choice of solvent, etc.) and partly on the nucleotide composition of the complementary sequences.
  • the critical value of N By varying the hybridization conditions and/or the base sequences of the probe molecules, one can vary the critical value of N. By routine experimentation, one can determine the critical value for any set of hybridization conditions and target sequence and thereby perform the processes of this invention.
  • N must exceed a critical value provides a basis for detecting nucleic acid sequences that include a junction point.
  • the nucleic acid of normal cells will have both parts of such a sequence but the two parts will not be joined. Therefore if the probe is complementary to a sequence of no more than N-l nucleotides (or a sequence of no more then N-3 nucleotides, which is preferred) on one side of the junction point and complementary to a sequence of no more than N-l nucleotides (or a sequence of no more than N-3 nucleotides, which is preferred) on the other side of the junction point, it will not hybridize to normal cell nucleic acids.
  • translocation junction spanning probe or primer have a nucleotide sequence complementary to that of a translocation junction-spanning segment
  • one half of the junction-spanning segment to which the probe or primer is complementary should be on one side of the translocation junction containing that segment (implying that the other half will be on the other side of that junction).
  • the critical value in the experiments exemplified in the Examples below will be seen to be between 12 an 23.
  • the length of the probe molecules be about 24 nucleotides, and by not letting N exceed 12 for any pair of probe molecules, one has an effective probe population for hybridizing to a two-stranded target.
  • the population is effective because one obtains about twice as much as signal as one would obtain with probes to just one strand.
  • the invention is a process for detecting a two-stranded nucleic acid target, which process comprises the steps of:
  • SUBSTITUTE SHEET (1) separating the strands of the target sufficiently to allow them each to hybridize to a nucleic acid probe of complementary nucleotide sequence;
  • step (2) detecting the nucleic acid probe molecules that are hybridized to target molecules; such that step (2) is performed under conditions that allow each strand of the target to form a hybrid with a nucleic acid probe molecule complementary in nucleotide sequence to that strand; such that, as to the nucleotide sequence of each nucleic acid probe molecule, there is a totally complementary sequence in the target; such that each nucleic acid probe molecule is partially complementary in nucleotide sequence to at least one other nucleic acid probe molecule; such that no two nucleic acid probe molecules are completely complementary in nucleotide sequence to each other; such that, where a portion of one nucleic acid probe molecule is complementary in nucleotide sequence to another nucleic acid probe molecule, that portion has a length which is too short to allow it to hybridize to the other nucleic acid probe molecule under the conditions of step (2).
  • nucleotide sequence is intended to cover a sequence where there is some atom (e.g., sulfur) other than phosphorus at some of the positions where internucleoside phosphorus normally occur. In such a situation, one could alternatively two molecules complementary as to nucleotide sequence as being complementary as to nucleoside sequence or complementary as to nucleotide sequence.
  • atom e.g., sulfur
  • the probe molecule will normally be labelled with a detectable label, e.g., radioactively (e.g. with 32 P), a dye molecule such as fluorescein, or a moiety that can enter into a chemiluminescence reaction.
  • a detectable label e.g., radioactively (e.g. with 32 P)
  • a dye molecule such as fluorescein
  • a moiety that can enter into a chemiluminescence reaction.
  • the two target strands are located in
  • SUBSTITUTE SHEET a biological entity that is either a cell or a virus.
  • the cell or virus may be suspended in solution and not immobilized on a solid support.
  • the cell or virus may be immobilized on a solid support.
  • the cell or virus may be part of a tissue section (histologic section).
  • the cells containing the target nucleic acid molecules may be eukaryotic cells
  • prokaryotic cells e.g., bacteria
  • plant cells or any other type of cell.
  • prokaryotic cells e.g., bacteria
  • plant cells or any other type of cell.
  • They can be simple eukaryotes such as yeast or derived from complex eukaryotes such as humans.
  • the target strands of nucleic acid may be in a non-enveloped virus or an enveloped virus (having a non-enveloped membrane such as a lipid protein membrane).
  • a plurality of molecules in the probe population are each covalently attached to a fluorescent dye molecule either directly or via a cross-linker molecule.
  • the two target strands may be purified nucleic acids. They may have been extracted from a virus, cell or multi-cellular organism.
  • the two target strands may be immobilized on a solid support (such as on nitrocellulose paper or a nylon sheet) during Step (2) of the process. Alternatively, they may be in solution and not immobilized on a solid support.
  • the target strands may be DNA.
  • the target strands may be RNA, as in the case of a virus (e.g., human immunodeficiency virus) where complementary
  • RNA strands can exist simultaneously in a single cell.
  • a viral nucleic acid target can be part of a virus, in which case the virus may or may not be inside a cell. Alternatively, a viral nucleic acid target may not be part of a virus, but may be inside a cell.
  • the probe molecules have nucleotide sequences such that, if one strand of the target strand is saturated with probe molecules, then there will be no unhybridized target strand sequences forming gaps between the probe molecules.
  • each probe molecule is complementary to a sequence, present in at least one other probe molecule, not less than about 12 nucleotides but not more
  • SUBSTITUTE SHEET than about 100 nucleotides in length.
  • each probe molecule is complementary to a sequence, present in at least one other probe molecule, not less than about 12 nucleotides but not more than about 20 nucleotides in length. In one preferred embodiment, each probe molecule that is complementary to a sequence, present in at least one other probe molecule, that is about 12 nucleotides in length.
  • each probe is between about 15 nucleotides and 100 nucleotides. It is more preferred that the length of each probe is between about 15 nucleotides and 40 nucleotides.
  • the portion of a probe molecule that is complementary to another probe molecule is not less than about 12 nucleotides but not more than about 100 nucleotides in length. It is more preferred that the portion of a probe molecule that is complementary to another probe molecule is not less than about 12 nucleotides but not more than about 20 nucleotides in length. In one highly preferred embodiment of the process, the portion of a probe molecule that is complementary to another probe molecule is about 12 nucleotides in length.
  • the two-stranded target has a first target strand and a second target strand and wherein the probe molecules that are complementary in nucleotide sequence to the first target strand have a detectable label with a structure different from the detectable label on the probe molecules that complementary to the second target strand.
  • the detectable label on the probe molecules that are complementary in nucleotide sequence to the first target strand may be a fluorescent dye and the detectable label on the probe molecules that are complementary to the second strand may also be a fluorescent dye.
  • the probe molecules that are complementary in nucleotide sequence to the first target strand are also complementary in nucleotide sequence to cellular RNA molecules.
  • RNA molecules an example of where the latter particular embodiment is useful is where there may be a double-stranded DNA viral genome (or the reverse transcriptase DNA copy of an RNA viral genome) in the
  • SUBSTITUTE SHEET target cell of interest and, if indeed there is such a genome present, then there may or may not be RNA transcribed from such a genome. Not only is it of interest, from a clinical point of view, to know whether the DNA genome is present, it is of clinical interest to know whether that genome is being expressed into mRNA or other RNA copies of the genome. If there is no viral mRNA (or other RNA) present, then the amount of nucleic acid detected by the probe against the anti-sense strand will equal the amount of nucleic acid detected by the probe against the sense strand.
  • the amount of nucleic acid detected by the probe against the sense strand of DNA will exceed the amount of nucleic acid detected by the probe against the anti-sense strand of DNA. The excess will be due to the mRNA present.
  • the two-stranded target may be cellular DNA, cellular RNA, viral DNA, or viral RNA.
  • the inventions here are also the nucleic acid probe populations, including all specific and preferred embodiments, disclosed here for use in those processes.
  • probe populations used in the above-noted process of the invention.
  • An example is a nucleic acid probe population wherein 1) the length of each probe molecule is between about 15 nucleotides and about
  • each probe molecule is at least partially complementary in nucleotide sequence to at least one other probe molecule.
  • Table A is illustrative of the types of diseases that can be detected by using the present inventions. It is not intended to place a limit on the types of diseases or translocations that can be detected by the present inventions.
  • junction-spanning nucleotide sequences for the translocations are either already published or can be determined by using techniques used for the published sequences.
  • proximal dell5q Prader-Willi syndrome t(l;15)(p36.2;pll.2) generalized muscular hypotonia (X;5)(pll.2;q35.2) Incontinentia pigmenti
  • ALL congenital acute lymphoblastic leukemia
  • FAB M4 acute myelomonocytic leukemia
  • FAB M3 childhood ALL 46,XY,t(3q;llq),t(7q;19p),t(15;17)(q26;q22) ANLL
  • the nucleic acid probe may be DNA, RNA, or oligonucleotides or polynucleotides comprised of DNA or RNA.
  • the DNA or RNA may be composed of the bases adenosine, uridine, thymidine, guanine, cytosine, or any natural or artificial chemical derivatives thereof.
  • the probe is capable of binding to a complementary or mirror image target cellular genetic sequence through one or more types of chemical
  • Nucleic acid probes may be detectably labeled prior to addition to the hybridization solution.
  • a detectable label may be selected which binds to the hybridization product.
  • Probes may be labeled with any detectable group for use in practicing the invention.
  • Such detectable group can be any material having a detectable physical or chemical property.
  • detectable labels have been well-developed in the field of immunoassays and in general most any label useful in such methods can be applied to the present invention.
  • Particularly useful are enzymatically active groups, such as enzymes (see Clin. Chem.. 22:1243 (1976)), enzyme substrates (see British Pat. Spec. 1,548,741), coenzymes (see U.S. Patents Nos.
  • nucleic acid probe is considered to include nucleic acids that have been labeled in any manner, including the foregoing manners.
  • Biotin labeled nucleotides can be incorporated into DNA or RNA by nick translation, enzymatic, or chemical means. The biotinylated probes are detected after hybridization using avidin/strepavidin, fluorescent, enzymatic or colloidal gold conjugates. Nucleic acids may also be labeled with other fluorescent compounds, with immunodetectable fluorescent derivatives or with biotin analogues. Nucleic acids may also be labeled by means of attaching a protein. Nucleic acids cross-linked to radioactive or fluorescent histone HI, enzymes (alkaline phosphatase and peroxidases), or single-stranded binding (ssB) protein may also be used. To increase the sensitivity of detecting the colloidal gold or peroxidase products, a number of enhancement or amplification procedures using silver solutions may be used.
  • SUBSTITUTE SHEET were detected by incubation with the antibody to RNA-DNA hybrids.
  • PhotobiotinTM labeling of probes is preferable to biotin labeling.
  • Nucleic acid probes can be used against a variety of nucleic acid targets, viral, prokaryotic, and eukaryotic.
  • the target for probe populations of these inventions will usually be a DNA target such as a gene (e.g., oncogene), control element (e.g., promoter, repressor, or enhancer), chromosomal translocation junction, or sequence coding for ribosomal RNA, transfer RNA, or RNase P.
  • the target may be any nucleic acid target, either RNA or DNA that comprises one of the two complementary target nucleotide sequences; that will be the situation, for example, where the desire is to detect any DNA or mRNA molecule with a specific sequence or its complement.
  • the target may be RNA, as in the case of a translocation junction-spanning molecule, or a viral RNA sequence and its RNA complement present in the same cell.
  • probes of any desired sequence can be made.
  • a purified nucleic acid is considered here to be one that has been extracted from a cell or has been synthesized in vitro in a cell-free system. Many procedures have been published for hybridizing probes to such purified nucleic acids. Generally, if the target is a DNA molecule, its strands are separated by heat or other means before the hybridization step takes place. The hybridization can take place with the target immobilized on a solid support (e.g., nitrocellulose paper for DNA, nylon for RNA) by well-established procedures.
  • the probes may be labeled in the same way as probes are labeled for in situ experiments as described below; or they may be labeled in other detectable ways. The manner of labeling is not critical for implementation of this experiment. If a labeling procedure is known to work for probes against purified nucleic acid targets, it would be expected to work for probe populations where both strands are targeted. Targets in cells, tissue, and fluids
  • the hybridization assay can be done for targets in biological entities in liquid suspension, in cells on slides or other solid supports, in tissue culture cells, and in tissue sections.
  • the biological entity can come from solid tissue (e.g., bone marrow, nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes, testes, cervix, and brain) or cells present in membranes lining various tracts, conduits and cavities (such as the gastrointestinal tract, urinary tract, vas deferens, uterine cavity, uterine tube, vagina, respiratory tract, nasal cavity, oral cavity, pharynx, larynx, trachea, bronchi and lungs) or cells in an organism's fluids (e.g., urine, stomach fluid, sputum, blood and lymph fluid) or stool.
  • solid tissue e.g., bone marrow, nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes
  • In situ hybridization allows the detection of RNA or DNA sequences within individual cells. With sufficiently large targets, it can detect as few as 1-5 target molecules per cell in as little as 2-4 hours. (PCT Applications 90/02173 and Wo 90/02204) It also allows for the simultaneous detection of more than one different polynucleotide sequence in an individual cell. It also allows detection of proteins and polynucleotides in the same cell.
  • a chaotropic agent such as 50% formamide
  • a buffer such as 0.1M sodium phosphate (pH 7.4), about 100 micrograms (ug)/milliliter
  • SUBSTITUTE SHEET low molecular weight DNA to diminish non-specific binding, 0.1% Triton X-100 to facilitate probe entry into the cells and about 10-20 mM vanadyl ribonucleoside complexes.
  • the hybridization solution is added a probe population, to hybridize with the target nucleic acids. If the cells are to be ultimately viewed on glass slides (or other solid supports), the cells as either single cell suspensions or as tissue slices are deposited on the slides. The cells are fixed by choosing a fixative which provides the best spatial resolution of the cells and the optimal hybridization efficiency. After fixation, the support bound cells may be dehydrated and stored at room temperature or the hybridization procedure may be carried out immediately.
  • the hybridization solution containing the probe is added in an amount sufficient to cover the cells.
  • the cells are then incubated at an appropriate temperature.
  • Temperatures used in the Examples below will be seen to be in the range 42°-46°C. Conditions where preferred temperatures are in the range 50°-55°C have been disclosed in PCT applications WO 90/02173 and WO 90/02204. However, temperatures ranging from 15°C. to 80°C. may be used.
  • the hybridization solution may include a chaotropic denaturing agent, a buffer, a pore forming agent, a hybrid stabilizing agent, and the target-specific probe molecule.
  • the chaotropic denaturing agents Robotson, D. W. and Grant, M. E. (1966) J.
  • Biol Chem. 241: 4030; Hamaguchi, K. and Geiduscheck, E. P. (1962) J. Am. Chem. Soc. 84: 1329) include formamide, urea, thiocyanate, guanidine, trichloroacetate, trifluoroacetate, tetramethylamine, perchlorate, and sodium iodide. Any buffer which maintains pH at least between 7.0 and 8.0 is preferred.
  • the pore forming agent is for instance, a detergent such as Brij 35, Brij 58, sodium dodecyl sulfate, CHAPSTM Triton X-100.
  • the pore-forming agent is chosen to facilitate probe entry through plasma, or nuclear membranes or cellular compartmental structures. For instance, 0.05% Brij 35 or 0.1% Triton X-100 will permit probe entry through the plasma membrane but not the nuclear membrane. Alternatively, sodium desoxycholate will allow probes to traverse the
  • a biopolymer probe may also be selected such that its size is sufficiently small to traverse the plasma membrane of a cell but is too large to pass through the nuclear membrane.
  • Hybrid stabilizing agents such as salts of mono- and di-valent cations are included in the hybridization solution to promote formation of hydrogen bonds between complementary nucleotide sequences of the probe and its target biopolymer.
  • nucleic acids unrelated to the target biopolymers are added to the hybridization solution at a concentration of about 100 fold the concentration of the probe.
  • Specimens are removed after each of the above steps and analyzed by observation of cellular morphology as compared to fresh, untreated cells using a phase contrast microscope.
  • the condition determined to maintain the cellular morphology and the spatial resolution of the various subcellular structures as close as possible to the fresh untreated cells is chosen as optimal for each step.
  • the cells Prior to nucleic acid hybridization, the cells may be reacted with antibodies in phosphate buffered saline. After hybridization one may analyze the cells for both bound antibodies and bound hybridization probes.
  • Supports which may be utilized include, but are not limited to, glass, Scotch tape (3M), nylon, Gene Screen Plus (New England Nuclear) and nitrocellulose. Most preferably glass microscope slides are used. The use of these supports and the procedures for depositing specimens thereon will be obvious to those of skill in the art. The choice of support
  • SUBSTITUTE SHEET material will depend upon the procedure for visualization of cells and the quantitation procedure used. Some filter materials are not uniformly thick and, thus, shrinking and swelling during in situ hybridization procedures is not uniform. In addition, some supports which autofluoresce will interfere with the determination of low level fluorescence. Glass microscope slides are most preferable as a solid support since they have high signal-to-noise ratios and can be treated to better retain tissue.
  • a fixative may be selected from the group consisting of any precipitating agent or cross-linking agent used alone or in combination, and may be aqueous or non-aqueous.
  • the fixative may be selected from the group consisting of formaldehyde solutions, alcohols, salt solutions, mercuric chloride sodium chloride, sodium sulfate, potassium dichromate, potassium phosphate, ammonium bromide, calcium chloride, sodium acetate, lithium chloride, cesium acetate, calcium or magnesium acetate, potassium nitrate, potassium dichromate, sodium chromate, potassium iodide, sodium iodate, sodium thiosulfate, picric acid, acetic acid, paraformaldehyde, sodium hydroxide, acetones, chloroform, glycerin, thymol, etc.
  • the fixative will comprise an agent which fixes the cellular constituents through a precipitating action and has the following characteristics: the effect is reversible, the cellular (or viral) morphology is maintained, the antigenicity of desired cellular constituents is maintained, the nucleic acids are retained in the appropriate location in the cell, the nucleic acids are not modified in such a way that they become unable to form double or triple stranded hybrids, and cellular constituents are not affected in such a way so as to inhibit the process of nucleic acid hybridization to all resident target sequences.
  • Choice of fixatives and fixation procedures can affect cellular constituents and cellular morphology; such effects can be tissue specific.
  • fixatives for use in the invention are selected from the group consisting of ethanol, ethanol-acetic acid, methanol, and methanol-acetone which fixatives afford the highest hybridization efficiency with good preservation of cellular morphology.
  • Fixatives for practicing the present invention include 95% ethanol/5% acetic acid for HL-60 and normal bone marrow cells, 75% ethanol/20% acetic acid for K562 and normal peripheral blood cells, 50% methanol/50% acetone for fibroblast cells and normal bone marrow cells, and 10% formaldehyde/90% methanol for cardiac muscle tissue. These fixatives provide good preservation of cellular morphology and preservation and accessibility of antigens, and high hybridization efficiency. Simultaneously, the fixative may contain a compound which fixes the cellular components by cross-linking these materials together, for example, glutaraldehyde or formaldehyde.
  • cross-linking agent While this cross-linking agent must meet all of the requirements above for the precipitating agent, it is generally more "sticky" and causes the cells and membrane components to be secured or sealed, thus, maintaining the characteristics described above.
  • the cross linking agents when used are preferably less than 10% (v/v).
  • Cross-linking agents while preserving ultrastructure, often reduce hybridization efficiency; they form networks trapping nucleic acids and antigens and rendering them inaccessible to probes and antibodies. Some also c ⁇ valently modify nucleic acids preventing later hybrid formation.
  • microscope slides containing cells may be stored air dried at room temperature for up to three weeks, in cold (4°C) 70% ethanol in water for 6-12 months, or in paraplast for up to two years. If specimens are handled under RNase free conditions, they can be dehydrated in graded alcohols and stored for at least 5 months at room temperature.
  • Reagents can be purchased from any of a variety of sources including Aldrich Chemical Co., Milwaukee, Wisconsin, Sigma Chemical Co., St. Louis, Missouri, Molecular Probes, Inc., Eugene, Oregon, Clontech, Palo Alto, California, Kodak, Rochester, NY, and SPectrum Chemical Manufacturing Corp., Gardenea, California.
  • SUBSTITUTE SHEET to lyse the red blood cells.
  • the white blood cells are centrifuged at 3,000 rpm for 10 minutes in a clinical centrifuge. The cell pellet is subsequently washed with 10 ml. PBS and the pellet is resuspended in PBS. Cells are deposited by cytocentrifugation onto precleaned glass slides and air dried for 5 min. The cells are then fixed in 75% ethanol/ 20% acetic acid for 20 min. at room temperature. Hybridization procedures using oncogene-specific probes are then followed.
  • cells either as single cell suspensions or as tissue slices may be deposited on solid supports such as glass slides.
  • cells are placed into a single cell suspension of about 10 5 -10 6 cells per ml.
  • the cells are fixed by choosing a fixative which provides the best spatial resolution of the cells and the optimal hybridization efficiency.
  • the hybridization is then carried out in the same solution which effects fixation.
  • This solution contains both a fixative and a chaotropic agent such as formamide. Also included in this solution is a hybrid stabilizing agent such as concentrated lithium chloride or ammonium acetate solution, a buffer, low molecular weight DNA and/or ribosomal RNA (sized to 50 bases) to diminish non-specific binding, and a pore forming agent to facilitate probe entry into the cells. Nuclease inhibitors such as vanadyl ribonucleoside complexes may also be included. To the hybridization solution is added a probe (or probes), to hybridize with a target polynucleotide.
  • a hybrid stabilizing agent such as concentrated lithium chloride or ammonium acetate solution, a buffer, low molecular weight DNA and/or ribosomal RNA (sized to 50 bases) to diminish non-specific binding, and a pore forming agent to facilitate probe entry into the cells.
  • Nuclease inhibitors such as vanadyl ribonucleoside complexes
  • the one-step procedure is a means of carrying out the fixation, prehybridization, hybridization and detection steps normally associated with in situ hybridization procedures all in one step.
  • SUBSTITUTE SHEET convenient temperature may be used to carry out the hybridization reaction. Furthermore, this provides a hybridization assay which can be accomplished with viable or non-viable cells in solution. In either case, the assay is rapid and sensitive.
  • the hybridization procedure is carried out utilizing a single hybridization solution which also fixes the cells. This fixation is accomplished in the same solution and along with the hybridization reaction.
  • the fixative may be selected from the group consisting of any precipitating agent or cross-linking agent used alone or in combination, and may be aqueous or non-aqueous.
  • Tissue samples are broken apart by physical, chemical or enzymatic means into single cell suspension.
  • Cells are placed into a PBS solution (maintained to cellular osmolality with bovine serum albumin (BSA) at a concentration of 10 5 to 10 6 cells per ml.
  • BSA bovine serum albumin
  • Cells in suspension may be fixed and processed at a later time, fixed and processed immediately, or not fixed and processed in the in situ hybridization system of the present invention.
  • a single solution is added to the cells/tissues (hereafter referred to as the specimen).
  • This solution contains the following: a mild fixative, a chaotrope, a nucleic acid probe (RNA or DNA probe which is prelabeled) and/or antibody probe, salts, detergents, buffers, and blocking agents.
  • the incubation in this solution can be carried out at 55 °C for 20 minutes as well as other conditions such as those in the Examples below.
  • the fixative is one which has been found to be optimal for the particular cell type being assayed (eg., there is one optimal fixative for bone marrow and peripheral blood even though this "tissue" contains numerous distinct cell types).
  • the fixative is usually a combination of precipitating fixatives (such as alcohols) and cross-linking fixatives (such as aldehydes), with the concentration of the cross-linking fixatives kept very low (less than
  • the hybridization cocktail contains a denaturing agent, usually formamide at about 30% (v/v), but other chaotropic agents such as Nal, urea, etc. may also be used. Furthermore, several precipitating and/or cross-linking fixatives also have mild denaturing properties; these properties can be used in conjunction with the primary denaturant in either an additive or synergistic fashion.
  • the hybridization cocktail may be constructed to preferentially allow only the formation of RNA-RNA or RNA-DNA hybrids. This is accomplished by adjusting the concentration of the denaturing agents along with the concentration of salts (primarily monovalent cations of the Group I series of metals along with the ammonium ion) and along with the temperature of hybridization which is used.
  • the present invention may be provided in the form of a kit adapted for a one- step process.
  • kits for detecting a nucleic acid molecule in a biological entity comprising a probe population described herein and one more reagents for use in a solution for reacting said probe population with said biological entity so that a hybrid molecule can form between a molecule of the probe population and a nucleic acid molecule in the biological entity.
  • the biological entity is a cell and the one or more reagents comprise a reagent selected from the group, a fixative and a chaotropic agent. (Preferred are the fixatives and chaotropic reagents identified in this application.)
  • a kit could include a solution containing a fixation/hybridization cocktail and one or more labeled probes.
  • This solution could, for example, contain 15-40% ethanol, 25-40% formamide, 0-10% formaldehyde, 0.1-1.5 M LiCl, 0.05-0.5 M Tris-acetate (pH 7-8), 0.05%-0.15% Triton X-100, 20 ug/ml-200 ug ml of a non-specific nucleic acid which does not react with the probe(s), and 0.1 ug/ml to 10 ug/ml of single stranded probes directly labeled with a reporter molecule. More specifically, for example, this solution could contain 30% ethanol, 30% formamide, 5% formaldehyde,
  • kit may also include:
  • a second detectable reporter system which would react with the probe or the probe-target hybrid.
  • Any mechanical components which may be necessary or useful to practice the present invention such as a solid support (e.g. a microscope slide), an apparatus to affix cells to said support, or a device to assist with any incubations or washings of the specimens. 4. A photographic film or emulsion with which to record results of assays carried out with the present invention.
  • the H9 cell line was used in the following experiment. Cultured cells were washed with nuclease-free Phosphate Buffered Saline (PBS) and placed in a single cell suspension at a concentration that resulted in clearly separated cells. The cells were spun down to a pellet and the supernatant, drained off. The cells were resuspend in 40% ethanol, 50% PBS, and 10% glacial acetic acid and left for 12-16 hours at 4°C. After fixation, the cells were spun to remove the fixative and then washed once in IX PBS and resuspend in 2X SSC. The cells should be used immediately.
  • PBS nuclease-free Phosphate Buffered Saline
  • NR 25-AL was derived from the nitrogen reductase gene found in bacteria and was known to not hybridize to nucleic acid within eukaryotic cells.
  • the DNA sequences for these two probes used are shown in Table 1 below. Twelve base, ten base, eight base, and six base oligomers, derived from these 25-base oligomers were also prepared with the sequences shown in the Table 1 below. All sequences displayed in the Examples have the 5' end as the left end of the sequence.
  • Hybridization For the hybridization procedure, to pelleted cells was added 50 ⁇ l of an hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4, 1 ⁇ g/ ⁇ l sheared DNA, 3% (v/v) Triton X-100 (alcohol derivative of polyoxylene ether, see Aldrich Chemical Co. catalogue for 1990-91), 5% PEG 4000 (polyethylene glycol), 25 mM DTT (dithiothreitol), 0.4 M guanidinium isothiocyanate, 15X Ficoll/PVP, and the probe added at a concentration of 2.5 ⁇ g/ml. Hybridizations were carried out at 42°C for
  • 500X Ficoll/PVP is 5g of Ficoll type 400 (polysucrose 400,000 mol wt) plus 5 g of PVP (polyvinylpyrollidone) dissolved in water to a total volume of 100 ml; 15X FIcoll/PVP is 500X Ficoll/PVP diluted with water by a factor of 15/500.
  • the cells were spun at 250 X g for 5 minutes. The supernatant was removed and the cell pellet resuspended in 0.2 ml counterstain solution consisting of 0.0025% Evans Blue in IX PBS. Flow Cytometer Use and Interpretation
  • the cells were analyzed on a Profile IITM made by Coulter Instruments.
  • the Instrument uses a 488nm argon laser, a 525nm band pass filter for FLl and a 635nm band pass filter for the counterstain.
  • the sample containing the negative probe was analyzed first and the quad-stats were set so that less than 0.01% of the cells fell in the upper-right quadrant.
  • the sample analyzed with the positive probe was analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats were set correctly and the two samples had been handled identically, any number of cells (above 0.01%) that were recorded in the upper right quadrant were scored as positive.
  • H9 cells Approximately 500,000 H9 cells were equally divided into two tubes and fixed as described above. For one of these sample aliquots was added a hybridization solution containing a positive probe (28S) and to the other a negative probe (NR), corresponding to the same size as the positive probe as in the list in Table 1 above. Following hybridization and washing, flow cytometry was performed.
  • 28S positive probe
  • NR negative probe
  • a cell line with an additional chromosome 18 (XX+18) was grown as a monolayer to confluency and then trypsinized and approximately 5,000 cell were deposited onto a clean glass slide by the cytospining method.
  • sequences for the 25-base synthetic oligonucleotide probes listed below in Table 3 and in Figure 1 were obtained from the published sequences for the alpha centromeric repetitive DNA sequence on chromosome 18.
  • the 5'-aminohexyl ohgodeoxynucleotides were then coupled to a rhodamine dye from Clontech and purified by Waters HPLC using a baseline 810 chromatography work station.
  • Hybridization For the hybridization procedure, to the cells deposited onto the slides was added 20 to 25 ⁇ l of a hybridization cocktail consisting of 30% formamide, 5X SSC, O.l M sodium phosphate buffer, pH 7.4, 100 ⁇ g/ml low molecular weight, denatured, salmon or herring sperm DNA, 5% (v/v) Triton X-100, 15X Ficoll/PVP, 0.4 M guanidinium isothiocaynate, 10 mM DTT, and 0.025 M EDTA and the probe, added at a concentration of 2.5 ⁇ g/ml. Denaturation and hybridization was carried out simultaneously by placing the slides in
  • 1,4 phenylenediamine antifade in 50% glycerol and 1 ug/ml Hoechst (33258) was used.
  • Photomicrographs were taken on an Olympus BH10 microscope with fluorescence capabilities, using Kodak Ektachrome EES-135 (PS 800/1600) film, exposed, and push processed at 1600 ASA. A 20-second exposure time was consistently used, so that direct comparisons could be made between all photomicrographs taken.
  • HTB 31 "C-33A” is a human cervical carcinoma derived cell line from cervical cancer biopsies (J. National Cancer Institute 32:135-148, 1964) and contains no human papilloma virus was used as the negative control.
  • CCL 1550 "CAski” is a human cervical carcinoma cell line containing 400-500 copies of HPV16 integrated into its genome.(Science 196:1456-1458, 1977), and was used as the positive control.
  • HPV 16-426-436 and HPV 16-501-512 was obtained from the published sequence for HPV type 16 and was accessed via the Genetic Sequence Data Bank, GenBank, version 69.0.
  • the ohgodeoxynucleotides were synthesized (Applied Biosystems DNA Synthesizer Model 380 B using the recommended A.B.I. reagents), and in the last stage an aminohexyl linker was attached to the 5' end phosphate.
  • the 5'-aminohexyl ohgodeoxynucleotides were then coupled to a rhodamine dye from Clontech and purified by Waters HPLC using a baseline 810 chromatography work station.
  • hybridization procedure 20 ⁇ l of an hybridization cocktail consisting of PEG 21%, formamide 25%, 5X SSC, salmon sperm DNA 1 mg/ml, Ficoll/PVP 15X, 0.4 M guanidinium isothiocyanate, 50 mM DTT, 5% Triton X-100, 50 mM EDTA, 50 mM Na 2 P0 4 and probe at a concentration of 0.06 ug/ul is added to the slide. A coverslip was applied and the slide was heated to 95°C for 5 minutes, allowed to cool to 42°C and incubated for 25 minutes at that temperature.
  • Photomicrographs were taken on an Olympus BH10 microscope with fluorescence capabilities, using Kodak Ektachrome EES-135 (PS 800/1600) film, exposed, and push processed at 1600 ASA A 20-second exposure time was consistently used, so that direct comparisons could be made between all photomicrographs taken.
  • the cell lines C-33A and Caski were used to determine the intensity difference between the signal obtained using probes directed at one strand of the DNA vs probes directed at both strands ("staggered overlap" probes).
  • the sequences for the 25-base synthetic oligonucleotide probes listed below and designated HYR 7 were obtained from the published sequences for the alpha centromeric repetitive DNA sequence on the Y chromosome. Twelve base, ten base, eight base, and six base oligomers, derived from these 25-base oligomers were also prepared as shown in the Table 5 below.
  • hybridization procedure to the cells deposited onto the slides was added 20 to 25 ⁇ l of a hybridization cocktail consisting of 30% formamide, 5X SSC, O.IM sodium phosphate buffer, pH 7.4, 100 ⁇ g/ml low molecular weight, denatured, salmon or herring sperm DNA, 5% (v/v) Triton X-100, 15X Ficoll/ PVP, 0.4 M guanidinium isothiocaynate, 10 mM DTT, and 0.025 M EDTA and the probe, added at a concentration of 2.5 ⁇ g/ml Denaturation and hybridization was carried out simultaneously by placing the slides in an incubator for 15 minutes at 85°C.
  • a hybridization cocktail consisting of 30% formamide, 5X SSC, O.IM sodium phosphate buffer, pH 7.4, 100 ⁇ g/ml low molecular weight, denatured, salmon or herring sperm DNA, 5% (v/v) Triton X-100, 15X Ficoll/ PVP,
  • Photomicrographs were taken on an Olympus BH10 microscope with fluorescence capabilities, using Kodak Ektachrome EES-135 (PS 800/1600) film, exposed, and push processed at 1600 ASA. A 20-second exposure time was consistently used, so that direct comparisons could be made between all photomicrographs taken.
  • the cell line (GM 02504G, Coriell Inst. of Med. Research, Camden NJ), grown as a monolayer and were trypinsized. DNA isolated essentially by the method of Maniatis et al f Molecular Cloning. T. Maniatis, E.F. Fritsch and J. Sambrook, eds., Cold
  • the sequences for the 25-base synthetic oligonucleotide probes listed below and designated HYR 7 were obtained from the published sequences for the alpha centromeric repetitive DNA sequence on the Y chromosome. Twelve base, ten base, eight base, and six base ohgomers, derived from these 25-base oligomers were also prepared as shown in the Table 6 below.
  • the probes were then end labeled with digoxigenin at the 3' end using an end labeling kit from Boehringer Mannheim Biochemicals (BMB) and using the BMB recommended procedure.
  • BMB Boehringer Mannheim Biochemicals
  • the filters were cut to a size of about 10 cm x 2 cm and were incubated for 3 hrs at 65° C in a pre-hybridization solution followed by incubation at 56° C overnight in a hybridization solution containing end-labeled oligonucleotide probes.
  • the hybridization cocktail consisted of 30% formamide, 5X SSC, 0.1M sodium phosphate buffer, pH 7.4, 100 ug/ml low molecular weight denatured salmon or herring sperm DNA, 5% (v/v) Triton X-100, 15X Ficoll/PVP, 0.4 M guanidinium isothiocyanate, 10 mM DTT, and 0.025 M EDTA and the probe, added at a concentration of 2.4 ug/ml
  • the filters were washed, blocked, equilibrated and reacted with anti-anti-digoxigenin/alkaline phosphatase conjugate according to BMB protocol and soaked in the substrate (lumipos 530, BMB). The filters were then exposed to x-ray film and the films were developed.
  • This Example demonstrates that oligomers prepared to both strands of a DNA target and that the results can be monitored by flow cytometry. It also demonstrates the ability to hybridize to both DNA strands allows one to quantitate simultaneously the amount of DNA and RNA within individual cells.
  • the H9 cell line is used in the following experiment. Cultured cells are washed with nuclease-free Phosphate Buffered Saline (PBS) and placed in a single cell suspension at a concentration that results in clearly separated cells. The cells are spun down to a pellet and the supernatent drained off. The cells are resuspended in 40% ethanol, 50% PBS, and 10% glacial acetic acid and left for 12-16 hours at 4°C. After fixation, the cells are spun to remove the fixative and then washed once in IX PBS and resuspended in 2X SSC. The cells should be used immediately.
  • PBS nuclease-free Phosphate Buffered Saline
  • HIV sequences used as probes are accessed via GenBank, version 69.0, prepared as probe by cutting them into 30-mers as described in figure 2, for HPV sequences. This design results in an "overlap" region of 15 bases.
  • sequences are cut into 30-base oligonucleotides and synthesized as phosphorothioate ohgonucleotides using DNA synthesizers (Applied Biosystem DNA Synthesizer, Model 380B) and using the recommended ABI reagents.
  • the polysulfurized oligonucleotides are then coupled to a fluorescent dye and purified by column chromatography and HPLC.
  • 30-base NR ohgonucleotides (30-mers) serve as the negative control probes.
  • Probes are made as phosphorothioate ohgonucleotides, each 30-mer having four sulfur atoms, using an Applied Biosystem (ABI) DNA Synthesizer, Model 380B and the recommended ABI reagents.
  • the sulfur atoms are located as follows: one is at the extreme 5' end of the probe, a second is between the 7th and 8th nucleosides (counting from the 5' end), the third is between the 22nd and 23rd nucleosides, and the fourth is between the 29th and 30th nucleosides.
  • the sulfur atoms of the polysulfurized oligonucleotides are then coupled to a fluorescent dye, iodoacetamido-fluorescein, as follows (smaller amounts can be synthesized by adjusting the volumes): 200 ⁇ g of dried oligonucleotide is dissolved in 100 ⁇ l of 250 mM Tris buffer, pH 7.4 to form a first solution. Then one mg of iodoacetamido-fluorescein is combined with 100 ⁇ l of dry dimethylformamide (i.e., 100 percent DMF) in a second solution. The two solutions are mixed together and shaken overnight.
  • a fluorescent dye iodoacetamido-fluorescein
  • the labeled oligonucleotide is precipitated with ethanol and 3M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye. The desired fractions are then collected. The liquid phase is then removed under vacuum. The crude material is then purified with HPLC (high performance liquid chromatography).
  • hybridization procedure to pelleted cells is added 50 ⁇ l of a hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4,
  • the cells are placed in a 15 ml conical tube to which is added 10 ml of a wash solution, consisting of .IX SSC, .4M guanidinium isothiocyanate, and .1% Triton at a temperature of 42°C.
  • a wash solution consisting of .IX SSC, .4M guanidinium isothiocyanate, and .1% Triton at a temperature of 42°C.
  • the solution is agitated until the cells are a single cell suspension and then spun at 250 X g for 5 minutes.
  • the supernatant is removed and to the pellet is added 10 ml of a wash solution, consisting of .IX SSC, .1% Triton at a temperature of 42°C.
  • the solution is agitated until the cells are a single cell suspension.
  • the cells are spun at 250 X g for 5 minutes.
  • the supernatant is removed and the cell pellet resuspended in 0.2
  • the cells are analyzed on a FACSTARTM made by Beckon Dickinson.
  • the Instrument uses a 5 watt argon laser coupled to a dye head, a 525nm band pass filter for FLl and a 584nm band pass filter for the Rhodamine.
  • the sample containing the negative probe is analyzed first and the quad-stats are set so that less than 0.01% of the cells fall in the upper-right quadrant or lower-right quandant.
  • the sample analyzed with the HIV probes is analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats are set correctly and the two samples have been handled identically, any number of cells (about
  • 0.01% that are recorded in the upper right quadrant are scored as positive for both strands and/or mRNA. Any number of cells (above 0.01%) that are recorded in the lower right quadrant are scored positive for DNA only.
  • the Histogram is constructed so that FL-3 is the Y axis and FL-1 is the X axis.
  • Example 4or 6 The protocol of Example 4or 6 can be followed with one or more of the following changes:
  • the hybridization cocktail additionally contains 10% DMSO (v/v) and 5% (v/v) vitamin E;
  • junction-spanning probe is one that is referred to here as an L6- 40 probe and that has a base sequence (in the 5' to 3' direction, left to right),:
  • One shortened L6-40 probe is the L6-26 probe that has a base sequence:
  • junction-spanning probe is the K28-40 probe, which has the base sequence: TA(__ GGCCGCTGAAGGGCTTTTGAACTCTGCTTAAATCCA
  • K28-26 probe One shortened K28-40 probe is the K28-26 probe, which has the following base sequence: CGCTGAAGGGCTTTTGAACTCTGCTT
  • Fluorochrome-labeled L6-26 and K28-26 probes were made using an Applied Biosystems, Inc. DNA Synthesizer Model 380 B using the recommended AB.I. reagents) and in the last stage attaching an aminohexyl linker to the 5' phosphate.
  • the 5'- aminohexyl ohgodeoxynucleotides were purified and coupled to a fluorescein derivative (fluorescein isothiocyanate) from Molecular Probes and purified by Waters HPLC using a baseline 810 chromatography work station. The result was an essentially homogeneous population of probe molecules. Quantities in excess of 10 ng were made.
  • the L6-26, L6-40, K28-26, and K28-40 probes will hybridize to mRNA molecules from K-562 cells (ATCC No.CCL 243), which was derived from a patient with chronic myelogenous leukemia.
  • MOLECULE TYPE cDNA to rRNA
  • HYPOTHETICAL N
  • MOLECULE TYPE cDNA to rRNA
  • HYPOTHETICAL N
  • MOLECULE TYPE cDNA to rRNA
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:22: GAGTCGATTT 10 (2) INFORMATION FOR SEQ ID NO:23
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:33: TAAAGTTGTA GACCCTGCTT TTGTA 25
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:34: ACCACTCCCA CTAAACTTAT TACAT 25
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:40: TTAACCTCTA GGCGTACTGG CATTA 25
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:41: GGTACAGTAG AATTGGTAAT AAACA 25
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:42 ⁇ AACACTACG (2) INFORMATION FOR SEQ ID NO:43
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • SEQUENCE DESCRIPTION SEQ ID NO:47: AGTGGGAGTG GTTACAAAAG CAGGG 25 (2) INFORMATION FOR SEQ ID NO:48
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL N
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Sondes ou amorces d'acide nucléique s'hybridant à l'ARN ou à l'ADN réalisant une jonction de translocation d'acide nucléique dans une cellule ayant subi une translocation chromosomique.
PCT/US1993/006674 1992-07-17 1993-07-16 Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique WO1994002500A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU47742/93A AU4774293A (en) 1992-07-17 1993-07-16 Oligonucleotide probes and primers for detecting chromosomal translocation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US91590092A 1992-07-17 1992-07-17
US07/915,900 1992-07-17

Publications (1)

Publication Number Publication Date
WO1994002500A1 true WO1994002500A1 (fr) 1994-02-03

Family

ID=25436402

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US1993/006715 WO1994002643A1 (fr) 1992-07-17 1993-07-16 Sondes d'acide nucleique et leur utilisation dans la detection d'acides nucleiques bicatenaires
PCT/US1993/006674 WO1994002500A1 (fr) 1992-07-17 1993-07-16 Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US1993/006715 WO1994002643A1 (fr) 1992-07-17 1993-07-16 Sondes d'acide nucleique et leur utilisation dans la detection d'acides nucleiques bicatenaires

Country Status (5)

Country Link
EP (1) EP0672185A4 (fr)
CN (1) CN1088260A (fr)
AU (2) AU4681693A (fr)
IL (1) IL106379A0 (fr)
WO (2) WO1994002643A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000234A1 (fr) * 1994-06-23 1996-01-04 Aprogenex, Inc. Sondes d'hybridation centromeres
GB2311132A (en) * 1996-03-15 1997-09-17 Univ Heidelberg Labelled nucleic acid sequences which are specific for translocation breaking points
FR2770539A1 (fr) * 1997-10-30 1999-05-07 Jean Gabert Methode de diagnostic in vitro de pathololgies associees a des remaniements geniques et trousses de diagnostic
WO2010058189A1 (fr) * 2008-11-24 2010-05-27 Trillion Genomics Limited Oligonucléotides capables de distinguer des séquences d’acide nucléique qui comprennent une séquence conservée

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6941568B2 (ja) * 2015-06-24 2021-09-29 デイナ ファーバー キャンサー インスティチュート，インコーポレイテッド ヌクレアーゼを使用する野生型ｄｎａの選択的分解および突然変異体対立遺伝子の濃縮

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4999290A (en) * 1988-03-31 1991-03-12 The Board Of Regents, The University Of Texas System Detection of genomic abnormalities with unique aberrant gene transcripts
US5024934A (en) * 1988-03-14 1991-06-18 The Board Of Regents, The University Of Texas System Detection of minimal numbers of neoplastic cells carrying DNA translocations by DNA sequence amplification
US5198338A (en) * 1989-05-31 1993-03-30 Temple University Molecular probing for human t-cell leukemia and lymphoma

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4868105A (en) * 1985-12-11 1989-09-19 Chiron Corporation Solution phase nucleic acid sandwich assay
US4925785A (en) * 1986-03-07 1990-05-15 Biotechnica Diagnostics, Inc. Nucleic acid hybridization assays
US5030557A (en) * 1987-11-24 1991-07-09 Ml Technology Venture Means and method for enhancing nucleic acid hybridization
EP0385410B1 (fr) * 1989-02-28 1996-10-02 Canon Kabushiki Kaisha Oligonucléotide à double brin partiel et son procédé de formation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5024934A (en) * 1988-03-14 1991-06-18 The Board Of Regents, The University Of Texas System Detection of minimal numbers of neoplastic cells carrying DNA translocations by DNA sequence amplification
US4999290A (en) * 1988-03-31 1991-03-12 The Board Of Regents, The University Of Texas System Detection of genomic abnormalities with unique aberrant gene transcripts
US5198338A (en) * 1989-05-31 1993-03-30 Temple University Molecular probing for human t-cell leukemia and lymphoma

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
EMBO J., Vol. 6, Number 7, issued 1987, MENGLE-GAW et al., "A Human Chromosome 8 Region with Abnormalities in B Cell, HTLV-1+ T Cell and C-Myc Amplified Tumors", pages 1959-1965. *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000234A1 (fr) * 1994-06-23 1996-01-04 Aprogenex, Inc. Sondes d'hybridation centromeres
GB2311132A (en) * 1996-03-15 1997-09-17 Univ Heidelberg Labelled nucleic acid sequences which are specific for translocation breaking points
DE19610255A1 (de) * 1996-03-15 1997-09-18 Univ Heidelberg Nukleinsäuresequenzen und Verfahren zum Nachweis von Translokationen zwischen Chromosomen
GB2311132B (en) * 1996-03-15 2000-05-24 Univ Heidelberg Nucleic acid sequences and methods of demonstrating translocations between chromosomes
DE19610255B4 (de) * 1996-03-15 2004-11-04 Universität Heidelberg Verfahren zur Herstellung von Nukleinsäuresequenzen und Verfahren zum Nachweis von Translokationen zwischen Chromosomen
FR2770539A1 (fr) * 1997-10-30 1999-05-07 Jean Gabert Methode de diagnostic in vitro de pathololgies associees a des remaniements geniques et trousses de diagnostic
WO1999023251A1 (fr) * 1997-10-30 1999-05-14 Jean Gabert Methode de diagnostic in vitro de pathologies associees a des remaniements geniques et trousses de diagnostic
WO2010058189A1 (fr) * 2008-11-24 2010-05-27 Trillion Genomics Limited Oligonucléotides capables de distinguer des séquences d’acide nucléique qui comprennent une séquence conservée
US20110319283A1 (en) * 2008-11-24 2011-12-29 Trillion Genomics Limited Oligonucleotides capable of discriminating between nucleic acid sequences that comprise a conserved sequence

Also Published As

Publication number Publication date
IL106379A0 (en) 1993-11-15
CN1088260A (zh) 1994-06-22
WO1994002643A1 (fr) 1994-02-03
EP0672185A1 (fr) 1995-09-20
AU4681693A (en) 1994-02-14
EP0672185A4 (fr) 1997-04-23
AU4774293A (en) 1994-02-14

Similar Documents

Publication Publication Date Title
EP2636757B1 (fr) Compositions et procédés pour la détection d'aberrations chromosomiques avec de nouveaux tampons d'hybridation
US5521061A (en) Enhancement of probe signal in nucleic acid-mediated in-situ hybridization studies
US7368245B2 (en) Method and probes for the detection of chromosome aberrations
GB2293238A (en) Primers for replication and/or amplification reactions
Bauman et al. Cytochemical hybridization with fluorochrome-labeled RNA. II. Applications.
EP1721991B1 (fr) Methode de detection d acide nucleique et son utilisation
EP0662151A1 (fr) Composes reducteurs de fond pour essais fluorimetriques in-situ a mediation par sonde
WO1994002645A1 (fr) Detection rapide de biopolymeres dans des echantillons traites par un colorant
EP0357436A2 (fr) Essai d'hybridation "in situ" en une seule étape
US20050191632A1 (en) Cytogenetic abnormalities that are predictive of response to therapy for chronic lymphocytic leukemia
EP0662153A1 (fr) Piegeurs de radicaux libres servant a reduire l'autofluorescence dans des cellules fixes
EP0862650B1 (fr) Hybridation in situ pour detecter des sequences d'acides nucleiques specifiques dans des echantillons eucaryotes
WO1994002500A1 (fr) Sondes et amorces d'oligonucleotides servant a detecter la translocation chromosomique
WO1996000234A1 (fr) Sondes d'hybridation centromeres
WO1995019449A1 (fr) Populations de sondes d'hybridation non adjacentes
WO1994002644A1 (fr) Detection in situ d'acides nucleiques utilisant l'amplification 3sr
WO1997008339A1 (fr) Dosage diagnostic pour leucemie myelogene chronique

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR BY CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU MG MN MW NL NO NZ PL PT RO RU SD SE SK UA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA