WO1994009120A1 - Transfert a mediation retrovirale du gene humain de resistance a de multiples medicaments - Google Patents

Transfert a mediation retrovirale du gene humain de resistance a de multiples medicaments Download PDF

Info

Publication number
WO1994009120A1
WO1994009120A1 PCT/US1993/009988 US9309988W WO9409120A1 WO 1994009120 A1 WO1994009120 A1 WO 1994009120A1 US 9309988 W US9309988 W US 9309988W WO 9409120 A1 WO9409120 A1 WO 9409120A1
Authority
WO
WIPO (PCT)
Prior art keywords
mdr
cells
gene
retroviral
cell
Prior art date
Application number
PCT/US1993/009988
Other languages
English (en)
Inventor
Arthur Bank
Stephen P. Goff
Maureen Ward
Original Assignee
The Trustees Of Columbia University In The City Of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of Columbia University In The City Of New York filed Critical The Trustees Of Columbia University In The City Of New York
Priority to EP93924952A priority Critical patent/EP0672119A4/fr
Priority to AU54445/94A priority patent/AU687765B2/en
Priority to JP6510348A priority patent/JPH08506719A/ja
Publication of WO1994009120A1 publication Critical patent/WO1994009120A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/475—Quinolines; Isoquinolines having an indole ring, e.g. yohimbine, reserpine, strychnine, vinblastine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the multidrug resistance (MDR-1 or MDR) gene is normally expressed at insignificant levels in normal human bone marrow cells.
  • the MDR phenotype is mediated through the expression of a 170,000 Kd plasma transmembrane glycoprotein known as p-glycoprotein that functions as an energy dependent efflux pump for various xenobiotics including colchicine in vitro, and the vinca alkaloids, etoposides, anthracyclines and taxol in vivo (1) (hereinafter referred as MDR-responsive drugs) .
  • MDR-responsive drugs a 170,000 Kd plasma transmembrane glycoprotein known as p-glycoprotein that functions as an energy dependent efflux pump for various xenobiotics including colchicine in vitro, and the vinca alkaloids, etoposides, anthracyclines and taxol in vivo (1).
  • MDR-responsive drugs a 170,000 Kd plasma transmembrane glycoprotein known as p-glycoprotein that
  • Retroviral vectors have been used extensively in gene transfer because of their efficient entry into cells and integration into the host cell's genome (3-5) .
  • Previous studies have indicated that high titer retroviruses, primarily those containing the neomycin-resistance gene (neo R ) can be used to transduce mouse bone marrow cells efficiently, resulting in stable, long-term integration of the transferred gene in the majority of the bone marrow cells (3-11) .
  • Similar experiments using the human ⁇ -globin gene in irradiated mice have been less successful (12, 13).
  • the present invention makes use of a retroviral vector plasmid containing MDR cDNA to transfer MDR resistance into mouse erythroleukemia cells (MELC) in culture.
  • MELC mouse erythroleukemia cells
  • the present invention also makes use of high titer MDR producer cell lines to transduce murine bone marrow cells with the MDR gene. After transduction, there is significant integration and expression of the human MDR gene, both short and long- term, indicating the success of bone marrow stem cell infection in live animals in vivo.
  • the present invention also makes use of high titer amphotropic MDR producer cell lines to transduce human bone marrow cells in culture, and to demonstrate increased MDR protein expression after gene transfer.
  • FIG. 1 Retroviral vector pHaMDR/A containing MDR cDNA.
  • pHaMDR/A is a Harvey based retroviral vector containing full length MDR cDNA (4.1 kb) , as previously described (2, 14).
  • FIG. 2 Southern blots of untransduced and transduced MELC cells grown in 2 ng/ml of colchicine. Each lane contains 5 ⁇ g of purified total MELC DNA digested with Xhol restriction endonuclease. Xhol cuts once inside the proviral genome and gives distinct bands in transduced MELC clones resistant to colchicine. Lane 1: Untransduced sensitive MELC. Lanes 2-8: Transduced colchicine resistant MELC clones showing evidence of clonal integration. Single bands are seen in lanes 3, 4 and 8.
  • FIG. 3 Southern blots of untransduced and transduced MELC clones. 5 ⁇ g of total DNA was loaded in each lane after digestion with Nhel which cuts within the LTRs of the provirus. Nhel digestion allows identification of a single band (arrowA) in the transduced resistant clones corresponding to the full length provirus. Lane 1: untransduced MELC with no band at A and two faint endogenous bands at B. Lanes 2-8: Transduced MELC with bands at A and faint bands at B. Lane 9: MDR producer fibroblast DNA.
  • FIG. 4 Northern blot of untransduced and MDR transduced MELC. 5 ⁇ g of total RNA was loaded in each lane and run in a formamide gel. Lane 1: untransduced MELC. Lane 2: MDR producer cell RNA. Lanes 3-11: Resistant transduced MELC clones selected and maintained in 2 ng/ml colchicine. The arrow to the right shows the expected position of the MDR mRNA. 32 P labelled probes were used. Integrity of RNA was verified with ethidium bromide stains (data not shown) .
  • Figure 5 Southern blot of 3 different MELC clones selected in progressively higher concentrations of colchicine.
  • Lane 1 untrasduced MELC.
  • Lanes 2 MDR producer cell DNA.
  • Lanes 3-5 Clone 1 selected and maintained in 2 ng/ml colchicine (lane 3) 20 ng/ml colchicine (lane 4) and 100 ng/ml colchicine (lane 5).
  • Lanes 6-8 Clone 2 selected and maintained at 2 ng/ml colchicine (lane 6) , 20 ng/ml colchicine (lane 7) and 100 ng/ml colchicine (lane 8) .
  • Lanes 9-11 Clone 3 selected and maintained at 2 ng/ml colchicine (lane 9) , 20 ng/ml colchicine (lane 10) , and 100 ng/ml colchicine (lane 11) .
  • Figure 6 Northern blot analysis of the same clones as shown in Figure 5. Increased MDR mRNA levels are seen as concentrations of colchicine increase.
  • Lane 1 untransduced MELC.
  • Lane 2 MDR viral producer cells.
  • Lanes 3-11 clone 1 (lanes 3-5) , clone 2 (lanes 6-8) , and clone 3 (lanes 9-11) maintained at 2, 20 and 100 ng/ml colchicine respectively for each clone. The faster migrating band in lanes 3 and 4 is not characterized.
  • FIGS 7A, 7B, 7C, 7D, and 7E MDR transduced MELC clones were sequentially grown in media containing increasing concentrations of colchicine over a period of 18 weeks. Samples were labelled with MDR antibody 17F9 (IgG2b isotype) and fluorescein-conjugated IgG2b rat anti-mouse secondary antibody as described below, then analyzed on a FACS Star Plus (Beckton-Dickinson) . Panel A: Untransduced MELC control shows insignificant levels of flurescence.
  • Panels B-E A single representative MDR transduced MELC clone sequentially grown in 5 ng/ml, 20 ng/ml, 300 ng/ml and 600 ng/ml colchicine.
  • Figure 8 Southern blot analysis of GP+E86 MDR producer clones. DNA was digested with EcoRI and probed with a 3.4 kb EcoRI cDNA probe; lanes 1-9: GP+E86 MDR clones; lane 10: GP+E86 negative control; lane 11: pHaMDR/A positive control.
  • Figures 9 A and B FACS analysis of untransfected and transfected cell lines. Cells were stained with the MDR monoclonal antibody 17F9, and then a secondary IgG2b antibody conjugated to FITC, as described below.
  • Figure 10 PCR from peripheral blood with MDR-specific primer. Lanes 1-9 show the signal obtained from 75 ⁇ g of mouse peripheral blood DNA obtained 50 days post-translation with bone marrow exposed to producer cell lines expressing MDR (the arrow at left indicates the expected size band) ; lanes PC and Cl contain the same amount of peripheral blood DNA from untreated mice; G+ is DNA from 8 x 10 5 MDR producer cells. PB is a PBR marker and G is a phix marker.
  • Figures 11A and B FACS analysis of MDR-expressing macrophage- granulocyte population in MDR-transplanted mouse bone marrow cells.
  • Bone marrow cells were obtained by flushing the.femurs and tibias of an MDR-transplanted mouse with ⁇ -MEM media. The red blood cells were lysed, and the remaining cell population stained with the 17F9 MDR monoclonal antibody and a goat anti-mouse, IgG2b, flourescein-conjugated secondary antibody, as described below. The macrophage- granulocyte population was determined by a gate based upon forward and side scatter, and only this population is represented.
  • A Bone marrow from untrnasplanted mouse
  • B bone marrow from transplanted mouse
  • the distinct population to the right of the gate shows (vertical line on the graph) a one log greater MDR fluorsecence, indicating significantly increased expression of MDR over endogenous levels. This population represents over 13% of the gated macrophage- granulocyte cells.
  • Figures 12A and 12B A, B: Lanes 1-12; amphotropic MDR producer clones, lane 13; phi X marker, lanes 14- 22; amphotropic MDR producer clones; lane 23; lxPCR negative control; lane 24; MDR positive control, lane 25; GP+ENV Aml2 packaging cells, lane 26; phi X marker.
  • Figure 13 PCR of spleen DNA from transplanted mouse using amphotropic MDR producers. 1: 11: Phi X size marker; 2-3: negative controls; 4: spleen DNA from mouse transplanted with tissue transduced by retroviral particles produced by the amphotropic MDR producer cell lines, 5: positive control and 6-7: PCR controls.
  • Figure 14 MDR PCR analysis of transduced human bone marrow cells. The arrow at the right identifies the expected band. Lanes 1,2, & 5 are negative controls. Lanes 3 & 4 are positive controls. Lanes 6,7,8, & 9 are MDR-transduced human bone marrow after 1,2,3, & 4 rounds of exposure to MDR retroviral supernatants, respectively.
  • FIGS. 15A and 15B FACS of MDR HMNC
  • HMNC human marrow nucleated cells
  • untransduced HMNC were stained with an MDR monoclonal antibody
  • Untransduced HMNC % of cells to the right of the gate is 3.44%.
  • Figure 16 MDR PCR analysis of transduced CD34 + cells. The arrow at the right identifies the expected band. Lanes l , 4, & 6 are negative controls. Lanes 2 & 3 are positive controls. Lanes 5 & 7 are MDR tranduced CD34 + cells after 9 and 11 days in culture with growth factors, respectively. Summary of the Invention
  • This invention provides a mammalian retroviral producer cell which comprises a retroviral packaging cell and a retroviral vector comprising the human multiple drug resistance gene.
  • the packaging cell may be an ecotropic or amphotropic cell.
  • the vector comprising the multiple drug resistance gene may further comprise a DNA sequence corresponding to a second mammalian gene which may encode a non-selectable phenotype, e.g., an insulin, ⁇ -globin or major histocompatibility gene.
  • Thi ⁇ invention also provides a method of transducing a target mammalian cell, e.g., a bone marrow cell, lymphocyte or tumor cell, with the human multiple drug resistance gene which comprises transducing the target cell with retroviral particles produced by the mammalian retroviral producer cell of this invention.
  • This method may further comprise transducing the target mammalian cell with a non-selectable mammalian gene.
  • This invention further provides a method of introducing the human MDR gene into a mammal which comprises transducing suitable target cells, e.g., bone marrow cells, from the mammal with retroviral particles produced by the producer cell provided herein and then readministering the cells to the mammal.
  • This method may further comprise transducing the mammal with a second mammalian gene.
  • This invention still further provides methods of treating a mammal afflicted with a cancer and of treating a mammal afflicted with a disorder characterized by abnormal expression of a non-selectable gene which involve transducing suitable cells from the mammal with the human MDR gene, contacting the transduced cells with an amount of an MDR-responsive drug cytotoxic to cells not expressing the MDR gene and then readministering the successfully transduced cells to the mammal from which they were isolated.
  • This invention provides a mammalian retroviral producer cell which comprises a retroviral packaging cell and a retroviral vector comprising the human multiple drug resistance gene (hereinafter referred to as the MDR gene) .
  • a "mammalian retroviral producer cell” is constructed by transfecting retroviral packaging cells with a retroviral vector.
  • the retroviral packaging cell comprises a plasmid or plasmid containing some, but not all, of the nucleic acid sequences required for the production of retroviral particles.
  • the retroviral vector is a vector which contains those retroviral nucleic acid sequences necessary for the production of retroviral particles which are not already in the retroviral packaging cell.
  • a "mammalian retroviral producer cell” is a mammalian cell which contains all those retroviral nucleic acid sequences necessary for viral replication and packaging, and is therefore capable of producing retroviral particles.
  • retroviral particles can transduce mammalian cells so that the retroviral genome integrates into the host cells genome and is expressed by the host cell.
  • the retroviral particles produced by the mammalian retroviral producer cell of this invention thus provide a vehicle for introducing the MDR gene into recipient mammalian cells.
  • MDR gene insertion may be a way of providing normal bone marrow cells with MDR expression.
  • MDR-expressing cells This could lead to both resistance of these cells to the toxic effects of subsequent chemotherapy and the generation of an enriched population of MDR-expressing cells, which eventually might be increased by exposure to MDR-responsive chemotherapeutic agents.
  • Amplification of the MDR gene by drug selection of cells may also contribute to increased MDR expression (16, 17).
  • MDR may be used as an in vivo and in vitro selectable marker which could be used to select for bone marrow cells containing a nonselectable gene on the same retroviral vector as the MDR gene.
  • bone marrow cells containing the ⁇ -globin gene could be selected for, in vivo and in vitro, by resistance to chemotherapeutic agents if the MDR and ⁇ -globin genes were on the same retroviral vector. This would result in enrichment of the population of bone marrow cells containing and expressing both of these genes.
  • DHFR dihydroflate reductase
  • the retroviral producer cell may comprise an ecotropic retroviral packaging cell.
  • An e-otropic retroviral packaging cell packages retroviral particles with a limited range of infectivity, i.e., the particles can only infect cells from the same, or closely related, species of animal as the animal from which the packaging cells were derived.
  • the ecotropic retroviral packaging cell is the ecotropic retroviral packaging cell designated GP+E86 (ATCC No. CRL 9642) .
  • the mammalian retroviral producer cell comprises the GP+E-86 ecotropic retroviral packaging cell and the pHaMDR/A retroviral vector (ATCC No. CRL 11164) .
  • the retroviral packaging cell may also be an amphotropic retroviral packaging cell.
  • Amphotropic cells package retroviral particles capable of infecting a broader spectrum of cells than particles produced by an ecotropic retroviral packaging cell, i.e., the retroviral particles produced can infect cells derived from animals other than the animal from which the packaging cell was derived.
  • amphotropic retroviral packaging cell is the amphotropic retroviral packaging cell designated
  • the mammalian retroviral producer cell comprises the GP+EnvAml2 amphotropic retroviral packaging cell and the pHaMDR/A retroviral vector (ATCC No. CRL
  • the GP+E86 retroviral packaging cell, the GP+envAml2 retroviral packaging cell, the retroviral producer cell comprising the GP+E86 packaging cell and the pHaMDR/A retroviral vector (ATCC No. CRL 11164) and the retroviral producer cell comprising the GP+envAml2 packaging cell and the pHaMDR/A vector (ATCC No. CRL 11165) have been deposited on October 16, 1992 with the American Type Culture Collection, 12301 Rockville Pike, Rockville, Maryland, 20852-1776, and are available under the above- identified ATCC Accession numbers.
  • a producer cell as either an ecotropic or an amphotropic producer cell will be determined by the nature of the retrovirus whose sequences were used to construct the producer cell.
  • Both the GP+E86 and the GP+EnvAml2 cells were constructed by transfecting mouse NIH 3T3 with two plasmids containing retroviral sequences. Methods of transfecting mammalian cells with retroviral vector plasmids, e.g., by calcium phosphate transfection or electroporation, are well known to those skilled in the art.
  • Each of the two plasmids contain a retroviral 5' LTR and neither contains a retroviral 3' LTR or a functional retroviral psi packaging sequence, necessary for packaging of retroviral genomes into retroviral particles.
  • One of the plasmids contains the env gene from a retrovirus while the other plasmid contains the gag-pol genes from the same retrovirus.
  • the GP+E86 ecotropic cell was constructed with Moloney Murine Leukemia Virus (MoMuLV) nucleic acid sequences.
  • the GP+EnvAml2 amphotropic cell was constructed using nucleic acid sequences from the 4070A amphotropic murine leukemia virus.
  • the retroviral vector may be a plasmid, cosmid, phage or any other type of vector capable of containing retroviral nucleic acid sequences and suitable for the transfection of mammalian recipient cells.
  • Presently preffered retroviral vectors are plasmid-based retroviral vectors.
  • a retroviral vector useful with either the GP+E86 or GP+EnvAml2 cells, described hereinabove, will contain retroviral 5' and 3' LTRs from the same or a similar retrovirus whose nucleic acid sequences were used to construct the packaging cell, a functional psi packaging sequence from the same retrovirus and the human MDR gene.
  • the retroviral vector is the pHaMDR/A vector (see Figure 1) .
  • pHaMDR/A is a Harvey virus-based vector comprising retroviral 5' and 3' LTRs, a psi packaging sequence, the ampiciliin resistance gene and human MDR cDNA.
  • the retroviral vector may further comprise a DNA sequence corresponding to a second mammalian gene.
  • the second mammalian gene is derived from mammalian cells and encodes a protein normally expressed in mammalian cells.
  • the second mammalian gene may be a cDNA sequence operably linked to a promoter of DNA expression or a genomic DNA sequence.
  • the second mammalian gene is a gene encoding a non-selectable phenotype.
  • a "non-selectable phenotype" means the expression of a gene which cannot be selected for by any of the conventional means, i.e., with drugs, heat or other conventionally used selection pressures.
  • a non-selectable phenotype means that systems containing a mixture of cells, some of which contain cells positive for the non-selectable phenotype and some of which are negative, cannot be manipulated by conventional means such that only cells positive for the non-selectable phenotype survive the manipulation.
  • Genes encoding a non-selectable phenotype useful in accordance with the practice of this invention include insulin, ⁇ -globin and major histocompatibiltiy genes.
  • the practice of this invention is not limited to the insertion of only these genes into the retroviral vector.
  • Other mammalian genes suitable for inclusion in a retroviral vector and insertion into a mammalian cell are also encompassed by the practice of this invention.
  • the second mammalian gene will be packed by the retroviral packaging cell into retroviral particles by virtue of its inclusion in the retroviral vector.
  • Selection of retroviral packaging cells capable of producing a sufficiently high titer of retroviral particles enables the cell to be used in a method of transducing a recipient cell with the gene of interest.
  • These recipient mammalian cells can be exposed to MDR- responsive drugs (e.g., colchicine, anthracyclines, taxol, VP-16, etoposides) . Such exposure will result in the selection of cells sucessfully transduced with the MDR gene and which express the MDR glcyoprotein on their surfaces.
  • the selected cells should also contain the second mammalian gene.
  • this invention provides a cell which produces retroviral particles comprising the human MDR gene. Accordingly, this invention also provides a method of transducing a target mammalian cell with the human multiple drug resistance gene, which comprises culturing the target mammalian cell in the presence of the mammalian retroviral producer cell provided herein under conditions permitting production of retroviral particles by the producer cell and transduction of the target mammalian cell by the retroviral particles; and contacting the target mammalian cells with an MDR- responsive drug in an amount cytotoxic to cells which do not express the multiple drug resistance gene.
  • Suitable target cells are those cells which can be isolated from a mammal, cultured and then transduced with retroviral particles produced by the producer cell provided herein such that they will express genes contained in the transduced nucleic acid.
  • Such cells include bone marrrow, lymphocyte or tumor cells.
  • the practice of this invention is not limited to only these cells, but encompases any mammalian cells with the above-described properties. Methods of obtaining such cells from mammals are well known to those of ordinary skill in the art.
  • bone marrow cells can be withdrawn from a bone, e.g., the femur of a mammal using a syringe and placed in a heparinized flask prior to processing and establishing in culture.
  • Culture conditions permitting production of retroviral particles and their transduction of recipient mammalian cells are also well known to those skilled in the art. Conditions suitable for using the retroviral producer cell provided herein to transduce MELC and mouse bone marrow cells are described below.
  • the method provided by this invention comprises contacting the target mammalian cells with an MDR-responsive drug in an amount cytotoxic to cells which do not express the multiple drug resistance gene.
  • the method provided herein involves the selection of cells based on their expression of the MDR glycoprotein-. This protein functions as an energy- dependent efflux pump for MDR-responsive drugs so that the drugs are not cytotoxic to the cells.
  • an "MDR-responsive drug” is: (1) a drug which is cytotoxic to cells which do not express the MDR glycoprotein in sufficient amounts to serve as an energy- dependent efflux pump for the drug and thereby ward off the cytotxic effects of the drug; and (2) a drug which is not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug.
  • the MDR-responsive drug may be selected from the group of MDR-responsive drugs consisting of colchicine, vinca alkaloids, anthracyclines, etoposides and taxol.
  • other drugs for which the MDR glycoprotein may serve as an energy-dependent efflux pump are also encompassed by the practice of this invention.
  • a "cytotoxic amount" of an MDR-responsive drug is any amount of the drug which, when added to a culture of cells transduced with the human MDR gene, is effective to induce the death of cells not expressing the gene but which is not toxic to cells expressing the MDR gene.
  • the determination of cytotoxic amounts of MDR-responsive drugs will depend upon a number of factors involving the type of recipient cell transduced and the particular MDR-responsive drug used.
  • the retroviral vector used in accordance with the practice of this invention may further comprise a second mammalian gene in addition to the MDR gene.
  • This second mammalian gene will be packaged into retroviral particles along with the MDR gene and therefore, recipient cells transduced with the MDR gene will also be transduced with this second mammalian gene.
  • the method of transducing a target mammalian cell with the human MDR gene may further comprise transducing the target cell with a second mammalian gene.
  • This invention provides a method of introducing the human MDR gene into a mammal which comprises isolating suitable target cells from the mammal; transducing the suitable target mammalian cells with the human multiple drug resistance gene according to the method disclosed hereinabove; and read inistering the transduced target cells to the mammal from which they were isolated.
  • Presently preferred mammals are the mouse and human.
  • the practice of this invention is not limited to these mammals, but includes any mammal from which cells may isolated, transduced and then readministered.
  • target mammalian cells suitable for use in accordance with the practice of this invention include, but are not limited to, bone marrow cells, lymphocytes or tumor cells.
  • the MDR-responsive drug may be selected from the group of MDR-responsive drugs consisting of colchicine, vinca alkaloids, anthracyclines, etoposides and taxol.
  • MDR-responsive drugs consisting of colchicine, vinca alkaloids, anthracyclines, etoposides and taxol.
  • other drugs for which the MDR glycoprotein may serve as an energy-dependent efflux pump are also encompassed by the practice of this invention.
  • the method of this invention provides a reliable way of introducing a non-selectable gene, e.g., an insulin, ⁇ -globin or major histocompatiblity gene, into a mammalian cell.
  • the MDR gene may be amplified in a cell by exposure of the cell to successively higher levels of an MDR-responsive drug.
  • the non-selectable gene may be amplified along with the MDR gene since the two genes were introduced into the cell on the same piece of DNA. Accordingly, the method of this invention may be used to introduce a non-selectable gene into a mammalian cell and to increase the number of copies, by gene amplification, of the gene being expressed in the cell.
  • This invention also provides a safe method of introducing the human MDR gene as compared to other available methods.
  • This invention provides a method of treating a mammal afflicted with a cancer which comprises introducing the human MDR gene into the mammal according to the method provided hereianbove, followed by administering to the mammal an MDR-responsive drug in an amount cytotoxic to cancer cells in the mammal.
  • Mammals which may be treated for cancer according to this practice may be a mouse, human or any other mammal from which cells can be isolated and readministered, where those cells can be transduced with retroviral particles and where the transduced cells will express the human MDR gene in the mammal.
  • the types of cancer contemplated for treatment by the method provided herein are any cancers wherein the tumor cells are susceptible to MDR-responsive drugs and include, but are not limited to, lymphomas, leukemias and sarcomas.
  • an "MDR-responsive drug” is:
  • MDR-responsive drugs useful for treating mammalian cancers in accordance with the practice of this invention include anthracyclines, vinca alkaloids, etoposides and taxol.
  • the practice of this invention is not limited to these drugs, but will include other drugs which can be administered to mammals, are cytotoxic to mammalian tumors, but which are also not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug.
  • an "amount of an MDR-responsive drug cytotoxic to cancer cells in a mammal” is any amount of the the MDR- drug cytotoxic to cancer cells.
  • the specific amount of an MDR-responsive drug which will be cytotxic to cancer cells in a mammal will depend upon a number of factors regarding the drug, the individual and the cancer. Such factors are routinely taken into account when establishing chemotherapeutic protocols for the treatment of cancers and therefore, the specific amounts of MDR- responsive drugs cytoxic to cancer cells in accordance with the practice of this invention are well known to those of ordinary skill in the art or may readily be determined by them without undue experimentation.
  • a problem encountered with the use of these drugs to treat cancers is that the drugs will induce the death of the target tumor cells and also of normal cells, e.g., bone marrow cells, which have properties similar to those possessed by the tumor cells which make them susceptible to the drugs.
  • the method provided herein has the 0
  • This invention provides a method of treating a mammal afflicted with a disorder characterized by abnormal expression of a non-selectable gene, which comprises: isolating suitable target cells from the mammal; culturing the suitable target cells with the mammalian retroviral producer cell provided herein, wherein the retroviral vector comprises the human MDR gene and a second mammalian gene, under conditions permitting production of retroviral particles by the producer cell and transduction of the target cells by the retroviral particles; contacting the transduced target cells with an amount of an MDR-responsive drug cytotoxic to cells which do not express the MDR gene; and readministering the transduced target cells to the animal from which they were isolated.
  • mammals which may be treated in accordance with the practice of this invention are mammals from which cells can be isolated, transduced with retroviral particles and readministered to the mammal from which they were isolated.
  • mammals include, but are not limited to, a mouse or human.
  • Abnormal expression of a gene means expression of the gene either in insufficient amounts of functional gene product to meet the physiological needs of the mammal or in amounts of functional product in excess of the needs of the mammal. MM # n 9120
  • the second mammalian gene introduced into the mammal will be the gene expressed in insufficient amounts.
  • Cells successfully transduced with the MDR gene and expressing sufficient amounts of the MDR protein on their surfaces will be resistant to the effects of MDR-responsive drugs.
  • Cells not transduced with the gene, or expressing insufficient amounts of the MDR protein on their surfaces will not be resistant. Exposure of a population of cells to an MDR-responsive drug will therefore result in the selection of cells transduced with, and expressing, the MDR gene.
  • the second mammalian gene may, but is not required to be, an insulin, ⁇ -globin or major histocompatibility gene.
  • cells from the patient's bone marrow may be isolated and transduced with a functional ⁇ -globin gene.
  • the transduced bone marrow cells are then exposed to an MDR-responsive drug, resulting in the selection of those cells transduced with the MDR gene and expressing the MDR protein on their surfaces.
  • These cells should also have been transduced with the second mammalian gene.
  • the successfully transduced cells are reintroduced into the mammal from which the cells were isolated.
  • the method provided herein thereby results in expression of the transduced ⁇ - globin gene and provision to the mammal of functional hemoglobin.
  • This method may also be practiced with a mammal and an insulin gene to restore functional expression of insulin, and thereby treat the mammal's diabetes.
  • Other disorders characterized by abnormal expression of a gene, where such abnormal expression can be corrected by the expresssion of a transduced gene may also be treated according to the method provided by this invention. Knowledge of disorders which can be treated by supplying a functional gene product in the correct amount are well known to those skilled in the art.
  • abnormal gene expression may also be overexpression of the gene product.
  • the treatment of disorders characterized by overexpression of a gene according to the method provided herein may include the use of a retroviral vector containing the human MDR gene and a second DNA sequence.
  • the second DNA sequence may encode antisense RNA sequence.
  • the antisense RNA sequence will be complementary to an RNA sequence in the messenger RNA synthesized by the gene which is overexpressed. The antisense sequence will therefore be able to block translation of the messenger RNA, thereby lowering the amount of functional product expressed.
  • the DNA sequence encoding the antisense RNA sequence will be operably linked to a promoter of DNA expression. This promoter may be a selectable or otherwise controllable promoter.
  • controllable promoter will be a promoter which is regulated by a drug. Expression of a DNA operably linked to such a promoter may then be controlled in a mammal by controlling the amount of drug administered to the ma mal .
  • the method provided by this invention comprises contacting target mammalian cells transduced with the human MDR gene and a second mammalian gene with an MDR- responsive drug and then read inistering the cells to the mammal from which they were isolated.
  • the method may further comprise determining which of the target cells successfully transduced with the MDR gene express the product of the second gene with which the cells were transduced.
  • the population of cells readministered to the mammal will thereby be enriched for cells expressiong both the MDR gene and the second mammalian gene.
  • This invention provides a method of introducing the human MDR gene into a mammal, e.g., a mouse or human, which comprises isolating suitable target cells from the mammal; culturing the target cells in the presence of the mammalian retroviral producer cell under conditions permitting production of retroviral particles by the retroviral producer cell and transduction of the target cells by the retroviral particles; administering the target cells to the mammal from which they were isolated; and administering to the mammal an MDR-responsive drug in an amount cytotoxic to cells which do not express the human MDR gene at a suitable interval of time after administration of the target cells to the mammal.
  • the target cells may, but are not required to, be bone marrow cells, lymphocytes or tumor cells.
  • the method provided by this invention may further comprise introducing a non- selectable gene into the mammal.
  • an MDR-responsive drug is (1) a drug which is cytotoxic to cells which do not express the MDR glycoprotein in sufficient amounts to serve as an energy-dependent efflux pump for the drug and thereby ward off the cytotxic effects of the drug; and (2) a drug which is not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug.
  • a "cytotoxic amount" of an MDR- responsive drug is any amount of the drug which, when added to a culture of cells transduced with the human MDR gene, is effective to induce the death of cells not expressing the gene but which is not toxic to cells expressing the MDR gene.
  • cytotoxic amounts of MDR-responsive drugs will depend upon a number of factors involving the type of recipient cell transduced and the particular MDR-responsuve drug used. Such factors are well within the lnowledge of one of ordinary skill in the art or may readily be determined by routine experimentation.
  • MDR-responsive drugs useful in accordance with the practice of this invention must be safe for administration to mammals.
  • MDR-responsive drugs include, but are not limited to, anthracyclines, vinca alkaloids, etoposides and taxol.
  • the suitable interval of time will depend upon a number of factor regarding the mammal treated, the target cells isolated and the MDR-responsive drug administered, which are well known to one of ordinary skill in the art or may readily be determined by routine experimentation.
  • Titering was performed as follows: one ml of undiluted viral supernatant was used at sequential dilutions (with media) between 1:1 and 1:10*. The supernatant was layered on 5 x 10* naive 3T3 fibroblasts. Eight ⁇ g/ml of polybrene was added and the cells incubated at 37° and 5% C0 2 for 2 hours; 5 ml of media was added after 2 hours. 48 hours later, the cells were trypsinized and transferred to 100 mm tissue culture dishes and single colonies counted at 14 days. Titers were determined in duplicate using colchicine selection (60 ng/ml) (2, 14) .
  • Genomic DNA was made from the ten clones with the highest titer. DNA was digested with EcoRI, separated on a 1% agarose gel and transferred by the Southern blot method. Blots were probed with a 3.4 kb EcoRI fragment of the human MDR cDNA labelled with 32 P by nick translation.
  • GP+E86 and GP+E86-pHaMDR/A cells were trypsinized and transferred to petri dishes for 18 hours in HXM (hypoxanthine-xanthine myvophenolic acid) media to recover.
  • the cells were analyzed by FACS (fluorescence- activated cell sorting) to quantiate the amount of MDR glycoprotein expressed on the cell surface.
  • the cells were stained with the MDR monoclonal antibody 17F9 (l ⁇ g/10 6 cells) for 20 minutes on ice. 17F9 (Dr. David Ring, Cetus Corporation) recognizes an external epitope of the MDR glycoprotein (19) .
  • the cells were again washed with 1XPBS-3%FCS and resuspended in 300 ⁇ l 1XPBS- 3%FCS. Analysis was performed on a FACS (Becton- Dickson) .
  • CFUs colony forming units
  • MELC were infected with undiluted supernatant from the highest titer producer line (5 x 10* viral particles/ml) (14, 23) .
  • Five x 10 s non-adherent MELC in log phase were plated in 60 mm dishes and exposed to 5 ml of the viral supernatants with the addition of polybrene 8 ug/ml.
  • infected MELC were recovered and placed in selection media containing 2 ng/ml of colchicine in 96 well tissue culture dishes. Half the volume of media was replaced every 3 days. Resistant clones were identified by a change in media color and inspection under an inverted microscope.
  • Southern blotting (25) was performed after extraction of genomic DNA from normal and transduced MELC lines. Guanidine isothiacyanate (GIT) was added to 3 x 10 7 cells and cesium chloride (CsCl) gradient centrifugation was performed at 32,000 rpm x 21° x 19 hr. DNA was precipitated with 95% cold ethanol after addition of NaCl to 0.3 M. Resuspended DNA was digested with proteinase K at 1 mg/ml, then extracted with phenol and choroform- isoamyl alcohol; DNA was quantified by UV absorption at 260 A°. DNA was digested with Xhol which cuts once within the provirus to determine the number of integration sites, and with Nhel which cuts in the LTRs to determine the presence and relative intensity of the inserted retroviral vector.
  • GIT Guanidine isothiacyanate
  • CsCl cesium chloride
  • RNA obtained after GIT and CsCl gradients was resuspended in DEPC treated H 2 0 and analyzed.
  • Gels containing 1.2% agarose, 1% formaldehyde and lx MOPS were prepared; each well was loaded with 5 ⁇ g total RNA in 6% formaldehyde and 50% formamide in a volume of 25 ⁇ l and mixed with 5 ⁇ l running dye. Gels were run at constant voltage, 5V/cm for 3 hours in lOx MOPS running buffer. Overnight transfer to nitrocellulose and subsequent procedures were done as described (22, 23). Ethidium bromide staining was used to determine the integrity of the RNA by inspection of the gels.
  • Radioactive probes for hybridizations were prepared by EcoRI digestion of an MDR plasmid containing 1.2 kb of the MDR cDNA clone (2, 14); this fragment representing the 5' end of the MDR cDNA was isolated and labeled by nick translation with 3 P.
  • the MDR monoclonal IgG2b antibody 17F9 was used to determine the amount of MDR on the surface of parental untransduced MELC and MDR-transduced MELC clones.
  • MELC grown in log phase were washed twice by spinning at 400g x 10 minutes and resuspended in lx PBS. Cells were resuspended in Ab 17F9 (1 ⁇ g/10 6 cells) and incubated for 20 minutes on ice. Suspensions were washed with ice cold lx PBS, 3% FCS, 0.2% NaN 3 , pH 7.4 and centrifuged at 400g for 10 min at 4°C.
  • Marrow was harvested from the hind legs of 12 week old C57BL/6J mice forty eight hours after administration of 5-fluorouracil (500 mg/kg of body weight) .
  • Aliquots of harvested bone marrow (3 x 10 6 cells) were cocultured by layering them onto 100 ml sized plates of semiconfluent GP+E86 producer cells containing the MDR gene (5) .
  • Cocultures were incubated for 24-48 hours in 10 ml of ⁇ MEM media containing 15% fetal calf serum, 15% WEHI conditioned medium, 1% Pen/Strep (Gibco Labs) , polybrene (2 ⁇ g/ml) and 11-6 (200 U/ml) .
  • SCGF stem cell factor
  • Recipient C57BL/6J mice (6-12 weeks old) were irradiated with 975 rad from a gamma source; donor marrow as then infused slowly through the central tail vein of the recipients (5) .
  • Recipient mice were maintained in sterile cages and continued on a regimen with tetracycline started three days prior to irradiation and transplantation. These conditions were maintained for a minimum of two weeks post-transplantation.
  • PCR polymerase chain reaction
  • PCR was carried out with 25 ⁇ l of DNA solution containing one unit of AmpliTaq polymerase and the appropriate reaction kits (Perkin Elmer/Cetus) in a final volume of 50 ⁇ l.
  • Perkin Elmer/Cetus 35 PCR cycles; each cycle included 15 seconds of denaturation at 94°C, 15 seconds of annealing at 55°C and one minute of extension/synthesis at 72°C.
  • MDR-specific sequences were amplified using the sense- strand primer CCCATCATTGCAATAGCAGC (residues 2596-2615; SEQ ID. NO. : 1) and the antisense-strand primer GTTCAAACTTCTGCTCCTGA (residues 2733-2752; SEQ ID. NO.: 2) which yield a 167 bp product (21) .
  • Ten ⁇ l of the PCR product was examined on a 4% agarose-NuSieve gel for the presence of the expected band.
  • Bone marrow cells from sacrificed recipients were obtained by flushing the femurs and tibias of mice with ⁇ MEM media. Red blood cells were lysed for 30 seconds with cold dH 2 0, following which isotonicity was restored with 3.5% NaCl. The remaining population of nucleated cells was stained with the MDR monoclonal antibody 17F9 (1 ⁇ g/10 6 cells) , following the above-described procedure.
  • RNA analysis of these resistant clones by Northern blots show significant levels of MDR mRNA in comparison to untransduced MELC ( Figure 4) .
  • Four of the MELC clones (#1,2,3,5) growing in media containing 2 ng/ml colchicine were analyzed by FACs for their MDR expression (Table 1, see below) .
  • Linear mean fluorescence values of these clones were 7.63 to 19.45 times above the low level fluorescence seen with untransduced MELC grown in nonselective media (Table 1) . These values indicate significant expression of MDR p-glycoprotein on the surface of the cells.
  • FACS analysis indicates a progressive increase in linear fluorescence of clones exposed to greater concentrations of colchicine.
  • Clones 1, 2 and 3 showed 3.0, 2.6 and 3.5 times greater expression of p-glycoprotein on the cell surface as they were subjected to increasing amounts of colchicine from 2 ng/ml to 300 ng/ml.
  • Clone 5 was sequentially subjected to up to 600 ng/ml colchicine and expression of p- glycoprotein on MELC increased with each higher concentration (Table 1, Figure 7) .
  • Transduced MELC were checked periodically for the presence and secretion of wild type MDR-containing retroviruses by exposure of native 3T3 cells for 48 hours to MELC supernatants from clones grown for 4, 8 and 14 weeks.
  • the absence of colchicine resistant 3T3 colonies after 14 days in selection media with 60 ng/ml of colchicine as described (18) indicates the absence of wild type recombinant virus in transduced MELC.
  • the high level producer ecotropic cell line was characterized by Southern blot ( Figure 8) , showing that there was significant integration of the human MDR gene into the genome of these cells.
  • the high level of expression of the MDR P-glycoprotein on the surface of these cells was demonstrated by FACS analysis, conducted as described above (see Figure 9) .
  • Other antibodies, which recognize internal epitopes of the MDR protein and were used to quantitate MDR protein expression, gave high background staining levels with cells that had not been transduced with the human MDR gene.
  • mice transduced with bone marrow containing the human MDR gene were analyzed both for their content of the MDR gene and for expression of the integrated gene over time.
  • Table 2 shows results from all of the mice analyzed. Over 90% of the mice analyzed between 14 and 50 days post translation contained the MDR gene, as demonstrated by MDR PCR analysis of tail vein blood (see Figure 10 and Table 2) . MDR analysis by PCR was continued in some of these animals for up to eight months. In the animals surviving to eight months, approximately 20% contained high MDR levels (Table 2) .
  • FIG. 12 shows the results of the PCR analysis of spleen DNA from mice infected by the producer cell GP+EnvAml2pHaMDR/a. A 167 bp product has been amplified in all the spleen DNA samples from the transplanted mice and not in the control samples, indicating that the mice have been successfully transplanted with MDR transduced marrow.
  • Retrovirally mediated gene transfer is an efficient mechanism to both stably transduce target cells and produce significant expression of the transduced genes.
  • human MDR cDNA is capable of transducing the MDR phenotype into MELC initially sensitive to colchicine.
  • the transduced MELC clones show integration of the full sized retroviral gene construct and expression of intact human MDR mRNA.
  • FACS analysis using an MDR monoclonal antibody (17F9 Ab) is able to clearly distinguish between untransduced and transduced clones.
  • Resistant MELC clones subjected to higher concentrations of colchicine increase their level of MDR genes, mRNA, and protein expression. Because we see greater intensity bands on Southern blots and increased mRNA levels in the same clones, we believe these are due to DNA amplification as demonstrated by others (16, 17) . However, the contribution of other mechanisms such as an increase in the transcription rate, or decreased rates of MRNA or protein degradation cannot be excluded.
  • the use of the 17F9 monoclonal antibody directed against an external epitope of the human MDR glycoprotein allows us to distinguish accurately between resistant and sensitive MELC. This antibody recognizing an external epitope of MDR has a distinct advantage over other antibodies recognizing internal epitopes since the latter require permeabilizing the cells (27) . , « « « « 09120
  • MELC were fluorescently labelled with MDR monoclonal antibody 17F9 and analyzed on a FACS Star Plus (Becton Dickinson) . Linear mean fluorescence was determined and shown above.
  • Two negative control samples of untransduced MELC were analyzed by FACS and the values from both samples are listed above. These untransduced MELC controls are sensitive to media containing 2 ng/ml of colchicine. All other samples were grown in colchicine-containing media, the concentrations being given above.
  • Column 1 samples were not labelled with antibody and the linear means represent low level autofluorescence of the MELC samples.
  • Column 2 samples were labelled only with a fluorescein (FITC) conjugated rat anti-mouse IgG2b secondary antibody.
  • FITC fluorescein
  • Linear mean values indicate a low level of non-specific binding of this secondary antibody to MELC.
  • Column 3 samples were labelled with the MDR 17F9 (IgG2b isotype) and the fluorescein conjugated secondary antibody.
  • Linear mean values indicate significant increases in p-glycoprotein expression on the cell surface of MELC.
  • Column 4 represents ratios of MDR MELC clones linear mean values to untransduced MELC control linear means. These ratios indicate the increase in MDR expression on the MELC clones over those of untransduced MELC, as well as the increase in expression of individual clones subject to increasing concentrations of colchicine.
  • the data presented herein indicate that bone marrow stem cell infection is possible with appropriate retroviral vectors and producer lines containing human genes.
  • the use of 1) long term bone marrow culture to provide repeated infection by retrovirus; 2) isolated stem cells to provide higher virus to cell ratios, and 3) growth factors leading to stem cell proliferation in these population are additional steps that can be used to increase retroviral gene transfer (5, 6) .
  • the presence of growth factors primarily stem cell factor and IL3 and IL6, causes an increase in the number of proliferating stem cells available for retroviral gene transfer (7, 8) .
  • the use of in vitro or in vivo selection of transduced bone marrow cells expressing high levels of MDR is possible by exposure of the cells to MDR responsive chemotherapeutic agents.
  • Resistant Cell Lines Increased MDRl Expression Can Precede Gene Amplification. Science. 232: 643, 1986.
  • Applicants have transduced human bone marrow cells obtained from marrow harvests for future autologous bone marrow transplantation (ABMT) with applicants' highest titer (5 X 10* particles/ml) amphotropic producer line, A12M1 retrovirus ( Figure 14-16) .
  • Supernatants from A12M1 have been used instead of co-culture with MDR producer cells to avoid potential contamination of the bone marrow with the producer cells, an undesirable side-effect in clinical use.
  • NBMC Ficoll-separated nucleated bone marrow cells
  • fibrinectin plates serve as an excellent substrate for the maintenance of CD34+ transduction (Ward, Richardson, Hesdorfer and Bank, Blood, abstract, submitted August, 1993, to be published November, 1993).
  • CD34+ cells are grown on fibrinectin plates Collaborative Research) for 48 hrs in the presence of IL-3, IL-6 and SCF and are transduced with A12M1 supernatants twice over the next 24 hrs.
  • 10 to 50% of BFU-E plated are MDR PCR positive.
  • the transduced cells are then expressed to G-SCF and GM-CSF for and additional 3-7 days.
  • FACS analysis at this time shows 5 and 9% of the expanded cell population have increased levels of MDR; the signal of MDR PCR is also increased at this time.
  • GP+envAM-12 packaging cells have been shown to be safe by their use with the IL-2 gene in human melanoma cells in culture (2) , and ADA gene in monkey marrow transfer experiments (3) , and in applicants' studies with MDR of A12M1 cells (4, 5). Reverse transcriptase assays, Mus dunni co-culture studies, utilization of supernatants on naive 3T3 cells, have been used in these experiments.
  • the GP+envAM12 packaging cells have been approved by the RAC and FDA for use with the IL-2 gene to treat patients with malignant melanoma (2) .
  • the RAC approved the use of A12M1 supernatants in June 1993.
  • A12M1 MDR amphotropic producer cells
  • a 3T3 amplification assay with A12M1 supernatants has consistently been negative by reverse transcriptase.
  • the supernatants of transduced human bone marrow cells is also negative.
  • applicants have grown A12M1 cells in co-culture with Mus dunni cells and assayed the supernatants by the S+L- assay and shown that there is no helper virus by this sensitive assay. The latter assay has also been repeated by Microbiological Associates and shown to be negative (see below) .
  • the mus dunni assay was performed in the following manner. Two hundred thousand mus dunni cells were plated in a tissue culture dish with five ml McCoys' media, ten percent fetal calf solution and five percent penicillin and streptomycin. The following day, two hundred thousand producer cells were irradiated with 3500 rads and plated onto the mus dunni cells.
  • test article SUP-1, defined above, was tested for the presence of murine retroviruses by the feline S + L " focus assay. No foci was observed in any of the plates exposed to the test article indicating that no murine retrovirus was detected using the S + L " assay described in this report.
  • Feline S + L " (PG-4) cells are susceptible to infection with many strains of mammalian retroviruses including such viruses as murine xenotropic viruses, mink cell focus forming viruses and some primate and feline leukemia viruses.
  • the broad range of susceptibility of the feline S + L " cell therefore, provides a sensitive assay for those retroviruses.
  • Test Article SUP-1 was received at Microbiological
  • Source Source: National Cancer Institute Bethesda, Maryland
  • the study objective is to determine whether retroviruses are present in the test article as determined by the development of foci in feline S + L " cells.
  • S*L ⁇ Assay The S + L " cells were maintained and infected for the focus assay according to SOP OPBT0775 as follows: cells were inoculated with 0.2 ml of test or control material following a 30 minute pretreatment with DEAE-dextran. After approximately 2 hours adsorption, inocula were removed and cultures overlaid with culture medium. Plates were refed as necessary and maintained until foci developed in the positive control.
  • the Type C retrovirus used as a positive control was murine amphotropic virus (4070A) propogated in NIH/3T3 cells at Microbiological Associates, Inc.
  • test article was test undiluted (0.2 ml per plate) on S + L " cells. Positive control plates infected with amphotropic virus and unifected negative control plates were run in parallel with the test article.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Emergency Medicine (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cellule productrice rétrovirale de mammifère obtenue par la transfection d'une cellule rétrovirale d'encapsidation avec un vecteur rétroviral renfermant le gène humain de résistance à de multiples médicaments. La cellule productrice rétrovirale de mammifère produit des particules rétrovirales pouvant servir à la transduction de cellules cibles. De ce fait, ladite cellule productrice peut servir à la transduction de cellules mammifères cibles avec ledit gène humain de résistance à de multiples médicaments (gène MDR humain), ainsi qu'avec un second gène, non sélectionnable celui-ci, tel que l'insuline, la β-globine ou l'un des principaux gènes d'histocompatibilité. Cette cellule productrice peut s'utiliser dans les processus de traitement d'un mammifère atteint d'un cancer, et de traitement d'un mammifère atteint d'un trouble caractérisé par l'expression anormale d'un gène non sélectionnable, lesquels processus comprennent la transduction de cellules appropriées depuis le mammifère ayant le gène MDR humain, puis la sélection d'un médicament à sensibilité MDR pour les cellules exprimant le gène MDR. On a mis en évidence que cette lignée productrice est inoffensive et dépourvue de rétrovirus susceptibles de subir une réplication, à la différence des lignées productrices.
PCT/US1993/009988 1992-10-16 1993-10-15 Transfert a mediation retrovirale du gene humain de resistance a de multiples medicaments WO1994009120A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP93924952A EP0672119A4 (fr) 1992-10-16 1993-10-15 Transfert a mediation retrovirale du gene humain de resistance a de multiples medicaments.
AU54445/94A AU687765B2 (en) 1992-10-16 1993-10-15 Retroviral mediated transfer of the human multiple drug resistance gene
JP6510348A JPH08506719A (ja) 1992-10-16 1993-10-15 レトロウイルスに媒介された、ヒト多薬剤耐性遺伝子の導入

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US96247492A 1992-10-16 1992-10-16
US07/962,474 1992-10-16

Publications (1)

Publication Number Publication Date
WO1994009120A1 true WO1994009120A1 (fr) 1994-04-28

Family

ID=25505916

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/009988 WO1994009120A1 (fr) 1992-10-16 1993-10-15 Transfert a mediation retrovirale du gene humain de resistance a de multiples medicaments

Country Status (5)

Country Link
EP (1) EP0672119A4 (fr)
JP (1) JPH08506719A (fr)
AU (1) AU687765B2 (fr)
CA (1) CA2146929A1 (fr)
WO (1) WO1994009120A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0646171A1 (fr) * 1992-05-22 1995-04-05 UNITED STATES GOVERNMENT as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Expression amelioree de genes humains a resistance multimedicaments et selection amelioree de cellules ayant subi une transduction par de tels genes
WO1996007747A1 (fr) * 1994-09-08 1996-03-14 Boehringer Mannheim Gmbh Hybrides vectoriels retroviraux et leur utilisation pour le transfert de genes

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6333612A (ja) * 1986-07-29 1988-02-13 Toshiba Corp 光フアイバジヤイロ
JPS63300906A (ja) * 1987-06-01 1988-12-08 Tokyo Keiki Co Ltd 光ファイバ回転角速度計
JPH0690037B2 (ja) * 1988-06-03 1994-11-14 日本航空電子工業株式会社 光ファイバコイル
JPH0755434Y2 (ja) * 1989-08-30 1995-12-20 カルソニック株式会社 パイプの接続構造
WO1993024613A1 (fr) * 1992-05-22 1993-12-09 The United States Government As Represented By The Secretary Of The Department Of Health And Human Services Expression amelioree de genes humains a resistance multimedicaments et selection amelioree de cellules ayant subi une transduction par de tels genes

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Annals of the New York Academy of Sciences, Volume 612: Sixth Cooley's Anemia Symposium, issued 1990, D. MARKOWITZ et al., "Retroviral Gene Transfer Using Safe and Efficient Packaging Cell Lines", pages 407-414, see entire article. *
Blood, Volume 78, No. 10, supplement No. 1, issued 15 November 1991, S. PODDA et al., "Transfer of the MDR Gene Into Irradiated Mice Using Retroviral Vectors", page 208a, Abstract No. 821, see entire article. *
DNA and Cell Biology, Volume 9, No. 10, issued 1990, C. HESDORFFER et al., "Efficient Gene Transfer in Live Mice Using a Unique Retroviral Packaging Line", pages 717-723, see entire article. *
Mol. Cell. Biol., Volume 9, No. 10, issued October 1989, H. GALSKI et al., "Expression of a Human Multidrug Resistance cDNA (MDR1) in the Bone Marrow of Transgenic Mice: Resistance to Daunomycin-Induced Leukopenia", pages 4357-4363, see entire article. *
Proc. Natl. Acad. Sci. USA, Volume 85, issued June 1988, I. PASTAN et al., "A Retrovirus Carrying an MDR1 cDNA Confers Multidrug Resistance and Polarized Expression of P-Glycoprotein in MDCK Cells", pages 4486-4490, see entire article. *
Progress in Nucleic Acid Research and Molecular Biology, Volume 38, issued 1990, J.R. McLACHLIN et al., "Retroviral-Mediated Gene Transfer", pages 91-136, see entire article. *
See also references of EP0672119A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0646171A1 (fr) * 1992-05-22 1995-04-05 UNITED STATES GOVERNMENT as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Expression amelioree de genes humains a resistance multimedicaments et selection amelioree de cellules ayant subi une transduction par de tels genes
EP0646171A4 (fr) * 1992-05-22 1998-01-07 Us Health Expression amelioree de genes humains a resistance multimedicaments et selection amelioree de cellules ayant subi une transduction par de tels genes.
WO1996007747A1 (fr) * 1994-09-08 1996-03-14 Boehringer Mannheim Gmbh Hybrides vectoriels retroviraux et leur utilisation pour le transfert de genes

Also Published As

Publication number Publication date
EP0672119A1 (fr) 1995-09-20
EP0672119A4 (fr) 1997-06-04
CA2146929A1 (fr) 1994-04-28
JPH08506719A (ja) 1996-07-23
AU687765B2 (en) 1998-03-05
AU5444594A (en) 1994-05-09

Similar Documents

Publication Publication Date Title
Mosca et al. Mesenchymal stem cells as vehicles for gene delivery.
Donahue et al. Helper virus induced T cell lymphoma in nonhuman primates after retroviral mediated gene transfer.
US20170157270A1 (en) Lentiviral vector for stem cell gene therapy of sickle cell disease
JP2001505043A (ja) 遺伝子導入
JP2003501482A (ja) 移植片対宿主疾患の処置のためのｃｄ２０に対する抗体の使用
JPH07505045A (ja) 移植における特異的寛容
JP2001169789A (ja) ウイルス仲介ｄｎａ導入の増強
AU2011377617A1 (en) Improved gene therapy methods
Havenga et al. Retroviral stem cell gene therapy
US20200109416A1 (en) Optimized lentiviral vector for stem cell gene therapy of hemoglobinopathies
WO1995034639A1 (fr) Nouvelle enveloppe retrovirale et long segment terminal a repetitions (ltr) et particules de vecteur retroviral comprenant cette enveloppe et/ou le ltr
WO2012094193A2 (fr) Procédés pour améliorer l'administration de cellules transduites avec un gène
WO1995034639A9 (fr) Nouvelle enveloppe retrovirale et long segment terminal a repetitions (ltr) et particules de vecteur retroviral comprenant cette enveloppe et/ou le ltr
US20220170045A1 (en) Augmentations to lentiviral vectors (cclc-mgata/ank-core lcr-beta-as3-fb) to increase expression
DelaFlor-Weiss et al. Transfer and expression of the human multidrug resistance gene in mouse erythroleukemia cells
NZ300795A (en) Retroviral Plasmid Vectors (enhancer region of LTR replaced, primer binding site replaced or mutated), packaging/transduced cells, use for gene therapy
AU687765B2 (en) Retroviral mediated transfer of the human multiple drug resistance gene
Oh et al. Expression of an anti-sickling β-globin in human erythroblasts derived from retrovirally transduced primitive normal and sickle cell disease hematopoietic cells
US6022738A (en) Vectors for expression of globin genes
Sadelain et al. Issues in the manufacture and transplantation of genetically modified hematopoietic stem cells
JP2001507230A (ja) 核酸構成物及び細胞への直接核酸組み込みのためのその使用
Cohen-Haguenauer et al. Efficient transduction of hemopoietic CD34+ progenitors of human origin using an original retroviral vector derived from Fr-MuLV-FB29: in vitro assessment
Peters et al. Retrovirus mediated gene transfer of the self antigen MBP into the bone marrow of mice alters resistance to experimental autoimmune encephalomyelitis
Bank et al. Transfer of the MDR-1 gene into hematopoietic cells
WO2001066150A2 (fr) Transfert genique a efficacite elevee dans des cellules souches humaines de repopulation a l'aide de particules de vecteur retroviral pseudotype rd114

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2146929

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1993924952

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1995 424251

Country of ref document: US

Date of ref document: 19950616

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 1993924952

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993924952

Country of ref document: EP