AU687765B2 - Retroviral mediated transfer of the human multiple drug resistance gene - Google Patents

Description

RETROVIRAL MEDIATED TRANSFER OF THE HUMAN MULTIPLE DRUG RESISTANCE GENE

This application is a continuation-in-part of United States Application Serial No. 07/962,474, filed October 16, 1992, the contents of which are hereby incorporated by reference.

The invention described herein was made in the course of work supported by Public Health Service Grants DK-25274 and HL-28381 from the National Institutes of Health. The United States government therefore has certain rights in this invention.

Background of the Invention

Throughout this application, various references are referred to within parentheses. Disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains. Full bibliographic citation for these references may be found at the end of each series of experiments in this application.

The multidrug resistance (MDR-1 or MDR) gene is normally expressed at insignificant levels in normal human bone marrow cells. The MDR phenotype is mediated through the expression of a 170,000 Kd plasma transmembrane glycoprotein known as p-glycoprotein that functions as an energy dependent efflux pump for various xenobiotics including colchicine in vitro, and the vinca alkaloids, etoposides, anthracyclines and taxol in vivo (1) (hereinafter referred as MDR-responsive drugs) . Studies of transgenic mice show that insertion of the human MDR gene into the mice, leads to high level expression of this gene in the bone marrow cells (1, 2) . In these mice, the peripheral white blood cell (WBC) count is resistant to the usual marrow suppressive effects of daunomycin chemotherapy.

Gene therapy in animals, including humans, requires safe and efficient gene transfer and high level gene expression. Retroviral vectors have been used extensively in gene transfer because of their efficient entry into cells and integration into the host cell's genome (3-5) . Previous studies have indicated that high titer retroviruses, primarily those containing the neomycin-resistance gene (neo^R) can be used to transduce mouse bone marrow cells efficiently, resulting in stable, long-term integration of the transferred gene in the majority of the bone marrow cells (3-11) . Similar experiments using the human β-globin gene in irradiated mice have been less successful (12, 13). In an attempt to increase the number of transduced cells, and to provide a potential selection, both in vitro and in vivo, for the continued selection of transduced cells, we have used the human multiple drug resistance gene. In studies with transgenic mice, it has been shown that the insertion of a human MDR gene leads to the resistance of mouse bone marrow cells to drugs normally toxic to these cells (MDR-responsive drugs) .

The present invention makes use of a retroviral vector plasmid containing MDR cDNA to transfer MDR resistance into mouse erythroleukemia cells (MELC) in culture. When MELC are exposed to these MDR producer cells, and selected in the presence of colchicine, MELC clones resistant to colchicine can be isolated, and show high levels of MDR expression at the RNA and protein levels. Subsequent exposure of these clones to increasing concentrations of colchicine results in increased levels of MDR mRNA and protein expression. These results indicate that efficient MDR gene transfer and expression is achievable in erythroid cells in culture using retroviral gene transfer. The present invention also makes use of high titer MDR producer cell lines to transduce murine bone marrow cells with the MDR gene. After transduction, there is significant integration and expression of the human MDR gene, both short and long- term, indicating the success of bone marrow stem cell infection in live animals in vivo.

The present invention also makes use of high titer amphotropic MDR producer cell lines to transduce human bone marrow cells in culture, and to demonstrate increased MDR protein expression after gene transfer.

Brief Description of the Drawings

Figure 1: Retroviral vector pHaMDR/A containing MDR cDNA. pHaMDR/A is a Harvey based retroviral vector containing full length MDR cDNA (4.1 kb) , as previously described (2, 14). B = BamHI; E = EcoRI; H = Hindlll; S = Stul; and X = Xhol.

Figure 2: Southern blots of untransduced and transduced MELC cells grown in 2 ng/ml of colchicine. Each lane contains 5 μg of purified total MELC DNA digested with Xhol restriction endonuclease. Xhol cuts once inside the proviral genome and gives distinct bands in transduced MELC clones resistant to colchicine. Lane 1: Untransduced sensitive MELC. Lanes 2-8: Transduced colchicine resistant MELC clones showing evidence of clonal integration. Single bands are seen in lanes 3, 4 and 8.

Figure 3: Southern blots of untransduced and transduced MELC clones. 5 μg of total DNA was loaded in each lane after digestion with Nhel which cuts within the LTRs of the provirus. Nhel digestion allows identification of a single band (arrowA) in the transduced resistant clones corresponding to the full length provirus. Lane 1: untransduced MELC with no band at A and two faint endogenous bands at B. Lanes 2-8: Transduced MELC with bands at A and faint bands at B. Lane 9: MDR producer fibroblast DNA.

Figure 4 Northern blot of untransduced and MDR transduced MELC. 5μg of total RNA was loaded in each lane and run in a formamide gel. Lane 1: untransduced MELC. Lane 2: MDR producer cell RNA. Lanes 3-11: Resistant transduced MELC clones selected and maintained in 2 ng/ml colchicine. The arrow to the right shows the expected position of the MDR mRNA. ³²P labelled probes were used. Integrity of RNA was verified with ethidium bromide stains (data not shown) .

Figure 5: Southern blot of 3 different MELC clones selected in progressively higher concentrations of colchicine. Lane 1: untrasduced MELC. Lanes 2: MDR producer cell DNA. Lanes 3-5: Clone 1 selected and maintained in 2 ng/ml colchicine (lane 3) 20 ng/ml colchicine (lane 4) and 100 ng/ml colchicine (lane 5). Lanes 6-8: Clone 2 selected and maintained at 2 ng/ml colchicine (lane 6) , 20 ng/ml colchicine (lane 7) and 100 ng/ml colchicine (lane 8) . Lanes 9-11: Clone 3 selected and maintained at 2 ng/ml colchicine (lane 9) , 20 ng/ml colchicine (lane 10) , and 100 ng/ml colchicine (lane 11) . Figure 6: Northern blot analysis of the same clones as shown in Figure 5. Increased MDR mRNA levels are seen as concentrations of colchicine increase. Lane 1: untransduced MELC. Lane 2: MDR viral producer cells. Lanes 3-11: clone 1 (lanes 3-5) , clone 2 (lanes 6-8) , and clone 3 (lanes 9-11) maintained at 2, 20 and 100 ng/ml colchicine respectively for each clone. The faster migrating band in lanes 3 and 4 is not characterized.

Figures 7A, 7B, 7C, 7D, and 7E: MDR transduced MELC clones were sequentially grown in media containing increasing concentrations of colchicine over a period of 18 weeks. Samples were labelled with MDR antibody 17F9 (IgG2b isotype) and fluorescein-conjugated IgG2b rat anti-mouse secondary antibody as described below, then analyzed on a FACS Star Plus (Beckton-Dickinson) . Panel A: Untransduced MELC control shows insignificant levels of flurescence.

These cells are sensitive to a colchicine concentration of 2 ng/ml. Panels B-E: A single representative MDR transduced MELC clone sequentially grown in 5 ng/ml, 20 ng/ml, 300 ng/ml and 600 ng/ml colchicine.

Log fluorescence values increase with increasing concentrations of colchicine indicating that p-glycoprotein expression increases as MELC are grown in higher concentrations of colchicine.

Figure 8: Southern blot analysis of GP+E86 MDR producer clones. DNA was digested with EcoRI and probed with a 3.4 kb EcoRI cDNA probe; lanes 1-9: GP+E86 MDR clones; lane 10: GP+E86 negative control; lane 11: pHaMDR/A positive control.

Figures 9 A and B: FACS analysis of untransfected and transfected cell lines. Cells were stained with the MDR monoclonal antibody 17F9, and then a secondary IgG2b antibody conjugated to FITC, as described below.

Figure 10: PCR from peripheral blood with MDR- specific primer. Lanes 1-9 show the signal obtained from 75μg of mouse peripheral blood DNA obtained 50 days post-translation with bone marrow exposed to producer cell lines expressing MDR (the arrow at left indicates the expected size band) ; lanes PC and Cl contain the same amount of peripheral blood DNA from untreated mice; G+ is DNA from 8 x 10⁵ MDR producer cells. PB is a PBR marker and G is a phix marker. Figures 11A and B: FACS analysis of MDR-expressing macrophage- granulocyte population in MDR-transplanted mouse bone marrow cells. Bone marrow cells were obtained by flushing the.femurs and tibias of an MDR-transplanted mouse with α-MEM media. The red blood cells were lysed, and the remaining cell population stained with the 17F9 MDR monoclonal antibody and a goat anti-mouse, IgG2b, flourescein-conjugated secondary antibody, as described below. The macrophage- granulocyte population was determined by a gate based upon forward and side scatter, and only this population is represented. A: Bone marrow from untrnasplanted mouse; B: bone marrow from transplanted mouse; the distinct population to the right of the gate shows (vertical line on the graph) a one log greater MDR fluorsecence, indicating significantly increased expression of MDR over endogenous levels. This population represents over 13% of the gated macrophage- granulocyte cells.

Figures 12A and 12B: A, B: Lanes 1-12; amphotropic MDR producer clones, lane 13; phi X marker, lanes 14- 22; amphotropic MDR producer clones; lane 23; lxPCR negative control; lane 24; MDR positive control, lane 25; GP+ENV Aml2 packaging cells, lane 26; phi X marker.

Figure 13: PCR of spleen DNA from transplanted mouse using amphotropic MDR producers. 1: 11: Phi X size marker; 2-3: negative controls; 4: spleen DNA from mouse transplanted with tissue transduced by retroviral particles produced by the amphotropic MDR producer cell lines, 5: positive control and 6-7: PCR controls.

Figure 14: MDR PCR analysis of transduced human bone marrow cells. The arrow at the right identifies the expected band. Lanes 1,2, & 5 are negative controls. Lanes 3 & 4 are positive controls. Lanes 6,7,8, & 9 are MDR-transduced human bone marrow after 1,2,3, & 4 rounds of exposure to MDR retroviral supernatants, respectively.

Figures 15A and 15B: FACS of MDR HMNC

MDR transduced human marrow nucleated cells (HMNC) and untransduced HMNC were stained with an MDR monoclonal antibody

17F.9 and then an lgG2b-FITC conjugated secondary to look at p-glycoprotein expression.

A. Untransduced HMNC: % of cells to the right of the gate is 3.44%.

B. MDR transduced HMNC: % of cells to the right of the gate is 24.9%.

Figure 16: MDR PCR analysis of transduced CD34⁺ cells. The arrow at the right identifies the expected band. Lanes l , 4, & 6 are negative controls. Lanes 2 & 3 are positive controls. Lanes 5 & 7 are MDR tranduced CD34⁺ cells after 9 and 11 days in culture with growth factors, respectively. Summary of the Invention

This invention provides a mammalian retroviral producer cell which comprises a retroviral packaging cell and a retroviral vector comprising the human multiple drug resistance gene. The packaging cell may be an ecotropic or amphotropic cell. The vector comprising the multiple drug resistance gene may further comprise a DNA sequence corresponding to a second mammalian gene which may encode a non-selectable phenotype, e.g., an insulin, β-globin or major histocompatibility gene.

Thi~ invention also provides a method of transducing a target mammalian cell, e.g., a bone marrow cell, lymphocyte or tumor cell, with the human multiple drug resistance gene which comprises transducing the target cell with retroviral particles produced by the mammalian retroviral producer cell of this invention. This method may further comprise transducing the target mammalian cell with a non-selectable mammalian gene.

This invention further provides a method of introducing the human MDR gene into a mammal which comprises transducing suitable target cells, e.g., bone marrow cells, from the mammal with retroviral particles produced by the producer cell provided herein and then readministering the cells to the mammal. This method may further comprise transducing the mammal with a second mammalian gene.

This invention still further provides methods of treating a mammal afflicted with a cancer and of treating a mammal afflicted with a disorder characterized by abnormal expression of a non-selectable gene which involve transducing suitable cells from the mammal with the human MDR gene, contacting the transduced cells with an amount of an MDR-responsive drug cytotoxic to cells not expressing the MDR gene and then readministering the successfully transduced cells to the mammal from which they were isolated.

Detailed Description of the Invention

This invention provides a mammalian retroviral producer cell which comprises a retroviral packaging cell and a retroviral vector comprising the human multiple drug resistance gene (hereinafter referred to as the MDR gene) . A "mammalian retroviral producer cell" is constructed by transfecting retroviral packaging cells with a retroviral vector. The retroviral packaging cell comprises a plasmid or plasmid containing some, but not all, of the nucleic acid sequences required for the production of retroviral particles. The retroviral vector is a vector which contains those retroviral nucleic acid sequences necessary for the production of retroviral particles which are not already in the retroviral packaging cell. Thus, a "mammalian retroviral producer cell" is a mammalian cell which contains all those retroviral nucleic acid sequences necessary for viral replication and packaging, and is therefore capable of producing retroviral particles.

These retroviral particles can transduce mammalian cells so that the retroviral genome integrates into the host cells genome and is expressed by the host cell. The retroviral particles produced by the mammalian retroviral producer cell of this invention thus provide a vehicle for introducing the MDR gene into recipient mammalian cells.

With safe and efficient transfer of the MDR gene into bone marrow cells, two types of experiments can be performed. First, in patients with cancer not involving the bone marrow, in which routinely high dose chemotherapy is combined with autologous bone marrow transplantation, the insertion of the MDR gene into bone marrow cells will provide resistance to otherwise toxic MDR-responsive chemotherapeutic agents. It has been shown in MDR transgenic mice, that the administration of daunomycin results in no change in their white blood cell counts, while control animals have a marked decrease in white blood cell counts (2, 15). Bone marrow cells usually have low levels of MDR; thus, MDR gene insertion may be a way of providing normal bone marrow cells with MDR expression. This could lead to both resistance of these cells to the toxic effects of subsequent chemotherapy and the generation of an enriched population of MDR-expressing cells, which eventually might be increased by exposure to MDR-responsive chemotherapeutic agents. Amplification of the MDR gene by drug selection of cells may also contribute to increased MDR expression (16, 17).

Second, MDR may be used as an in vivo and in vitro selectable marker which could be used to select for bone marrow cells containing a nonselectable gene on the same retroviral vector as the MDR gene. For example, bone marrow cells containing the β-globin gene could be selected for, in vivo and in vitro, by resistance to chemotherapeutic agents if the MDR and β-globin genes were on the same retroviral vector. This would result in enrichment of the population of bone marrow cells containing and expressing both of these genes. Thus, one could provide a unique in vivo and in vitro selection not available using other markers such as neo^R or dihydroflate reductase (DHFR) due to their toxicity in man. The retroviral producer cell may comprise an ecotropic retroviral packaging cell. An e-otropic retroviral packaging cell packages retroviral particles with a limited range of infectivity, i.e., the particles can only infect cells from the same, or closely related, species of animal as the animal from which the packaging cells were derived. Preferably, the ecotropic retroviral packaging cell is the ecotropic retroviral packaging cell designated GP+E86 (ATCC No. CRL 9642) . In one embodiment of this invention, the mammalian retroviral producer cell comprises the GP+E-86 ecotropic retroviral packaging cell and the pHaMDR/A retroviral vector (ATCC No. CRL 11164) .

The retroviral packaging cell may also be an amphotropic retroviral packaging cell. Amphotropic cells package retroviral particles capable of infecting a broader spectrum of cells than particles produced by an ecotropic retroviral packaging cell, i.e., the retroviral particles produced can infect cells derived from animals other than the animal from which the packaging cell was derived.

Preferably, the amphotropic retroviral packaging cell is the amphotropic retroviral packaging cell designated

GP+EnvAml2 (ATCC No. CRL 9641) . In one embodiment of this invention, the mammalian retroviral producer cell comprises the GP+EnvAml2 amphotropic retroviral packaging cell and the pHaMDR/A retroviral vector (ATCC No. CRL

11165) .

The GP+E86 retroviral packaging cell, the GP+envAml2 retroviral packaging cell, the retroviral producer cell comprising the GP+E86 packaging cell and the pHaMDR/A retroviral vector (ATCC No. CRL 11164) and the retroviral producer cell comprising the GP+envAml2 packaging cell and the pHaMDR/A vector (ATCC No. CRL 11165) have been deposited on October 16, 1992 with the American Type Culture Collection, 12301 Rockville Pike, Rockville, Maryland, 20852-1776, and are available under the above- identified ATCC Accession numbers.

The construction of a producer cell as either an ecotropic or an amphotropic producer cell will be determined by the nature of the retrovirus whose sequences were used to construct the producer cell. Both the GP+E86 and the GP+EnvAml2 cells were constructed by transfecting mouse NIH 3T3 with two plasmids containing retroviral sequences. Methods of transfecting mammalian cells with retroviral vector plasmids, e.g., by calcium phosphate transfection or electroporation, are well known to those skilled in the art. Each of the two plasmids contain a retroviral 5' LTR and neither contains a retroviral 3' LTR or a functional retroviral psi packaging sequence, necessary for packaging of retroviral genomes into retroviral particles. One of the plasmids contains the env gene from a retrovirus while the other plasmid contains the gag-pol genes from the same retrovirus. The GP+E86 ecotropic cell was constructed with Moloney Murine Leukemia Virus (MoMuLV) nucleic acid sequences. The GP+EnvAml2 amphotropic cell was constructed using nucleic acid sequences from the 4070A amphotropic murine leukemia virus.

The retroviral vector may be a plasmid, cosmid, phage or any other type of vector capable of containing retroviral nucleic acid sequences and suitable for the transfection of mammalian recipient cells. Presently preffered retroviral vectors are plasmid-based retroviral vectors. A retroviral vector useful with either the GP+E86 or GP+EnvAml2 cells, described hereinabove, will contain retroviral 5' and 3' LTRs from the same or a similar retrovirus whose nucleic acid sequences were used to construct the packaging cell, a functional psi packaging sequence from the same retrovirus and the human MDR gene. In the presently preferred embodiment of this invention, the retroviral vector is the pHaMDR/A vector (see Figure 1) . pHaMDR/A is a Harvey virus-based vector comprising retroviral 5' and 3' LTRs, a psi packaging sequence, the ampiciliin resistance gene and human MDR cDNA.

The retroviral vector may further comprise a DNA sequence corresponding to a second mammalian gene. The second mammalian gene is derived from mammalian cells and encodes a protein normally expressed in mammalian cells. The second mammalian gene may be a cDNA sequence operably linked to a promoter of DNA expression or a genomic DNA sequence. In one embodiment of this invention, the second mammalian gene is a gene encoding a non-selectable phenotype. As used herein, a "non-selectable phenotype" means the expression of a gene which cannot be selected for by any of the conventional means, i.e., with drugs, heat or other conventionally used selection pressures. A non-selectable phenotype means that systems containing a mixture of cells, some of which contain cells positive for the non-selectable phenotype and some of which are negative, cannot be manipulated by conventional means such that only cells positive for the non-selectable phenotype survive the manipulation. Genes encoding a non-selectable phenotype useful in accordance with the practice of this invention include insulin, β-globin and major histocompatibiltiy genes. However, the practice of this invention is not limited to the insertion of only these genes into the retroviral vector. Other mammalian genes suitable for inclusion in a retroviral vector and insertion into a mammalian cell are also encompassed by the practice of this invention.

The second mammalian gene will be packed by the retroviral packaging cell into retroviral particles by virtue of its inclusion in the retroviral vector. Selection of retroviral packaging cells capable of producing a sufficiently high titer of retroviral particles enables the cell to be used in a method of transducing a recipient cell with the gene of interest. These recipient mammalian cells can be exposed to MDR- responsive drugs (e.g., colchicine, anthracyclines, taxol, VP-16, etoposides) . Such exposure will result in the selection of cells sucessfully transduced with the MDR gene and which express the MDR glcyoprotein on their surfaces. The selected cells should also contain the second mammalian gene.

As discused hereinabove, this invention provides a cell which produces retroviral particles comprising the human MDR gene. Accordingly, this invention also provides a method of transducing a target mammalian cell with the human multiple drug resistance gene, which comprises culturing the target mammalian cell in the presence of the mammalian retroviral producer cell provided herein under conditions permitting production of retroviral particles by the producer cell and transduction of the target mammalian cell by the retroviral particles; and contacting the target mammalian cells with an MDR- responsive drug in an amount cytotoxic to cells which do not express the multiple drug resistance gene.

"Suitable target cells" are those cells which can be isolated from a mammal, cultured and then transduced with retroviral particles produced by the producer cell provided herein such that they will express genes contained in the transduced nucleic acid. Such cells include bone marrrow, lymphocyte or tumor cells. However, the practice of this invention is not limited to only these cells, but encompases any mammalian cells with the above-described properties. Methods of obtaining such cells from mammals are well known to those of ordinary skill in the art. For example, bone marrow cells can be withdrawn from a bone, e.g., the femur of a mammal using a syringe and placed in a heparinized flask prior to processing and establishing in culture. Culture conditions permitting production of retroviral particles and their transduction of recipient mammalian cells are also well known to those skilled in the art. Conditions suitable for using the retroviral producer cell provided herein to transduce MELC and mouse bone marrow cells are described below.

As described hereinabove, the method provided by this invention comprises contacting the target mammalian cells with an MDR-responsive drug in an amount cytotoxic to cells which do not express the multiple drug resistance gene. Thus, the method provided herein involves the selection of cells based on their expression of the MDR glycoprotein-. This protein functions as an energy- dependent efflux pump for MDR-responsive drugs so that the drugs are not cytotoxic to the cells. Accordingly, an "MDR-responsive drug" is: (1) a drug which is cytotoxic to cells which do not express the MDR glycoprotein in sufficient amounts to serve as an energy- dependent efflux pump for the drug and thereby ward off the cytotxic effects of the drug; and (2) a drug which is not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug. The MDR-responsive drug may be selected from the group of MDR-responsive drugs consisting of colchicine, vinca alkaloids, anthracyclines, etoposides and taxol. However, other drugs for which the MDR glycoprotein may serve as an energy-dependent efflux pump are also encompassed by the practice of this invention.

For the purposes of this method, a "cytotoxic amount" of an MDR-responsive drug is any amount of the drug which, when added to a culture of cells transduced with the human MDR gene, is effective to induce the death of cells not expressing the gene but which is not toxic to cells expressing the MDR gene. The determination of cytotoxic amounts of MDR-responsive drugs will depend upon a number of factors involving the type of recipient cell transduced and the particular MDR-responsive drug used.

Such factors are well within the knowledge of one of ordinary skill in the art or may readily be determined by routine experimentation. Amounts of colchicine cytotxic to transduced mouse cells are described below.

The retroviral vector used in accordance with the practice of this invention may further comprise a second mammalian gene in addition to the MDR gene. This second mammalian gene will be packaged into retroviral particles along with the MDR gene and therefore, recipient cells transduced with the MDR gene will also be transduced with this second mammalian gene. Accordingly, the method of transducing a target mammalian cell with the human MDR gene may further comprise transducing the target cell with a second mammalian gene.

This invention provides a method of introducing the human MDR gene into a mammal which comprises isolating suitable target cells from the mammal; transducing the suitable target mammalian cells with the human multiple drug resistance gene according to the method disclosed hereinabove; and read inistering the transduced target cells to the mammal from which they were isolated. Presently preferred mammals are the mouse and human. However, the practice of this invention is not limited to these mammals, but includes any mammal from which cells may isolated, transduced and then readministered. As disclosed hereinabove, target mammalian cells suitable for use in accordance with the practice of this invention include, but are not limited to, bone marrow cells, lymphocytes or tumor cells. The MDR-responsive drug may be selected from the group of MDR-responsive drugs consisting of colchicine, vinca alkaloids, anthracyclines, etoposides and taxol. However, other drugs for which the MDR glycoprotein may serve as an energy-dependent efflux pump are also encompassed by the practice of this invention. Furthermore, the method of this invention provides a reliable way of introducing a non-selectable gene, e.g., an insulin, β-globin or major histocompatiblity gene, into a mammalian cell. In addition, the MDR gene may be amplified in a cell by exposure of the cell to successively higher levels of an MDR-responsive drug. The non-selectable gene may be amplified along with the MDR gene since the two genes were introduced into the cell on the same piece of DNA. Accordingly, the method of this invention may be used to introduce a non-selectable gene into a mammalian cell and to increase the number of copies, by gene amplification, of the gene being expressed in the cell.

This invention also provides a safe method of introducing the human MDR gene as compared to other available methods.

This invention provides a method of treating a mammal afflicted with a cancer which comprises introducing the human MDR gene into the mammal according to the method provided hereianbove, followed by administering to the mammal an MDR-responsive drug in an amount cytotoxic to cancer cells in the mammal. Mammals which may be treated for cancer according to this practice may be a mouse, human or any other mammal from which cells can be isolated and readministered, where those cells can be transduced with retroviral particles and where the transduced cells will express the human MDR gene in the mammal. The types of cancer contemplated for treatment by the method provided herein are any cancers wherein the tumor cells are susceptible to MDR-responsive drugs and include, but are not limited to, lymphomas, leukemias and sarcomas.

As described hereinabove, an "MDR-responsive drug" is:

(1) a drug which is cytotoxic to cells which do not express the -MDR glycoprotein in sufficient amounts to serve as an energy-dependent efflux pump for the drug and thereby ward off the cytotxic effects of the drug; and

(2) a drug which is not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug. MDR-responsive drugs useful for treating mammalian cancers in accordance with the practice of this invention include anthracyclines, vinca alkaloids, etoposides and taxol. However, the practice of this invention is not limited to these drugs, but will include other drugs which can be administered to mammals, are cytotoxic to mammalian tumors, but which are also not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug.

For the purpose of the cancer treatment method provided herein, an "amount of an MDR-responsive drug cytotoxic to cancer cells in a mammal" is any amount of the the MDR- drug cytotoxic to cancer cells. The specific amount of an MDR-responsive drug which will be cytotxic to cancer cells in a mammal will depend upon a number of factors regarding the drug, the individual and the cancer. Such factors are routinely taken into account when establishing chemotherapeutic protocols for the treatment of cancers and therefore, the specific amounts of MDR- responsive drugs cytoxic to cancer cells in accordance with the practice of this invention are well known to those of ordinary skill in the art or may readily be determined by them without undue experimentation.

A problem encountered with the use of these drugs to treat cancers is that the drugs will induce the death of the target tumor cells and also of normal cells, e.g., bone marrow cells, which have properties similar to those possessed by the tumor cells which make them susceptible to the drugs. The method provided herein has the 0

-23-

advantage of protecting the normal cells against the action of MDR-responsive drugs by providing the cells with the MDR glycoprotein prior to their exposure to the drugs.

This invention provides a method of treating a mammal afflicted with a disorder characterized by abnormal expression of a non-selectable gene, which comprises: isolating suitable target cells from the mammal; culturing the suitable target cells with the mammalian retroviral producer cell provided herein, wherein the retroviral vector comprises the human MDR gene and a second mammalian gene, under conditions permitting production of retroviral particles by the producer cell and transduction of the target cells by the retroviral particles; contacting the transduced target cells with an amount of an MDR-responsive drug cytotoxic to cells which do not express the MDR gene; and readministering the transduced target cells to the animal from which they were isolated.

The mammals which may be treated in accordance with the practice of this invention are mammals from which cells can be isolated, transduced with retroviral particles and readministered to the mammal from which they were isolated. Such mammals include, but are not limited to, a mouse or human.

"Abnormal expression" of a gene, as used herein, means expression of the gene either in insufficient amounts of functional gene product to meet the physiological needs of the mammal or in amounts of functional product in excess of the needs of the mammal. _{MM # n} 9120

-24-

Preferably, if the mammal expresses a gene in insufficient amounts, the second mammalian gene introduced into the mammal will be the gene expressed in insufficient amounts. Cells successfully transduced with the MDR gene and expressing sufficient amounts of the MDR protein on their surfaces will be resistant to the effects of MDR-responsive drugs. Cells not transduced with the gene, or expressing insufficient amounts of the MDR protein on their surfaces, will not be resistant. Exposure of a population of cells to an MDR-responsive drug will therefore result in the selection of cells transduced with, and expressing, the MDR gene. The second mammalian gene may, but is not required to be, an insulin, β-globin or major histocompatibility gene. For example, if a patient suffers from a blood disorder, e.g., sickle cell anemia or β-thalassemia, characterized by insufficient expression of functional β-globin due to a defect in the β-globin gene, cells from the patient's bone marrow may be isolated and transduced with a functional β-globin gene. The transduced bone marrow cells are then exposed to an MDR-responsive drug, resulting in the selection of those cells transduced with the MDR gene and expressing the MDR protein on their surfaces. These cells should also have been transduced with the second mammalian gene. The successfully transduced cells are reintroduced into the mammal from which the cells were isolated. The method provided herein thereby results in expression of the transduced β- globin gene and provision to the mammal of functional hemoglobin. . This method may also be practiced with a mammal and an insulin gene to restore functional expression of insulin, and thereby treat the mammal's diabetes. Other disorders characterized by abnormal expression of a gene, where such abnormal expression can be corrected by the expresssion of a transduced gene may also be treated according to the method provided by this invention. Knowledge of disorders which can be treated by supplying a functional gene product in the correct amount are well known to those skilled in the art.

As disclosed hereinabove, "abnormal" gene expression may also be overexpression of the gene product. The treatment of disorders characterized by overexpression of a gene according to the method provided herein may include the use of a retroviral vector containing the human MDR gene and a second DNA sequence. The second DNA sequence may encode antisense RNA sequence. The antisense RNA sequence will be complementary to an RNA sequence in the messenger RNA synthesized by the gene which is overexpressed. The antisense sequence will therefore be able to block translation of the messenger RNA, thereby lowering the amount of functional product expressed. The DNA sequence encoding the antisense RNA sequence will be operably linked to a promoter of DNA expression. This promoter may be a selectable or otherwise controllable promoter. Use of such a promoter will allow for regulation of the syntheis of the antisense RNA sequence such that only the necessary amount is made. The antisense RNA may then be made in amounts sufficient to correct the overexpression of the gene but not to the extent that the gene then synthesizes an insufficient amount of product. One type of controllable promoter will be a promoter which is regulated by a drug. Expression of a DNA operably linked to such a promoter may then be controlled in a mammal by controlling the amount of drug administered to the ma mal .

The method provided by this invention comprises contacting target mammalian cells transduced with the human MDR gene and a second mammalian gene with an MDR- responsive drug and then read inistering the cells to the mammal from which they were isolated. The method may further comprise determining which of the target cells successfully transduced with the MDR gene express the product of the second gene with which the cells were transduced. The population of cells readministered to the mammal will thereby be enriched for cells expressiong both the MDR gene and the second mammalian gene.

This invention provides a method of introducing the human MDR gene into a mammal, e.g., a mouse or human, which comprises isolating suitable target cells from the mammal; culturing the target cells in the presence of the mammalian retroviral producer cell under conditions permitting production of retroviral particles by the retroviral producer cell and transduction of the target cells by the retroviral particles; administering the target cells to the mammal from which they were isolated; and administering to the mammal an MDR-responsive drug in an amount cytotoxic to cells which do not express the human MDR gene at a suitable interval of time after administration of the target cells to the mammal. The target cells may, but are not required to, be bone marrow cells, lymphocytes or tumor cells. The method provided by this invention may further comprise introducing a non- selectable gene into the mammal.

As disclosed hereinabove, methods of isolating and administering suitable target cells to mammals, e.g., by withdrawing or injecting bone marrow cells from the femur, are well known to those of ordinary skill in the art. Culture conditions permitting production of retroviral particles by the retroviral producer cell and transduction of the cultured target cells by the retroviral particles are also well known to those of ordinary skill in the art. Conditions suitable for the culture and transduction of MELC and mouse bone marrow cells are described below.

As disclosed hereinabove, an MDR-responsive drug is (1) a drug which is cytotoxic to cells which do not express the MDR glycoprotein in sufficient amounts to serve as an energy-dependent efflux pump for the drug and thereby ward off the cytotxic effects of the drug; and (2) a drug which is not cytotoxic to cells which express enough of the MDR glycoprotein on their surfaces to be resistant to the drug. For the purposes of the method of the method provided herein, a "cytotoxic amount" of an MDR- responsive drug is any amount of the drug which, when added to a culture of cells transduced with the human MDR gene, is effective to induce the death of cells not expressing the gene but which is not toxic to cells expressing the MDR gene. The determination of cytotoxic amounts of MDR-responsive drugs will depend upon a number of factors involving the type of recipient cell transduced and the particular MDR-responsuve drug used. Such factors are well within the lnowledge of one of ordinary skill in the art or may readily be determined by routine experimentation.

Furthermore, a "suitable interval" of time between -- 0

-28-

readministration of target cells transduced with the human MDR gene and administration of an MDR-responsive drug is any amount of time sufficient to allow for establishment of the cells such that the cells will be resistant to the MDR-responsive drugs. MDR-responsive drugs useful in accordance with the practice of this invention must be safe for administration to mammals. Examples of such MDR-responsive drugs include, but are not limited to, anthracyclines, vinca alkaloids, etoposides and taxol. The suitable interval of time will depend upon a number of factor regarding the mammal treated, the target cells isolated and the MDR-responsive drug administered, which are well known to one of ordinary skill in the art or may readily be determined by routine experimentation.

This invention will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.

Bxperimental Details

First series of experiments

Materials and Methods:

MDR Retroviral Producer Lines

Ecotropic Producer Cells:

Five x 10⁵ GP+E86 packaging cells were transfected using calcium phosphate coprecipitation with 10 μg of the retroviral vector pHaMDR/A plasmid (Figure 1) (14, 18). Transfected cells were selected in Dulbecco Modified Essential Media (DME) with 10% fetal calf serum (FCS) and 1% Penicillin-Streptomycin (Sigma) containing 60 ng of colchicine/ml for 14 days. Forty eight colchicine- resistant clones were isolated in MDR-transfected cells while none were seen in transfected cells. The resistant cells were grown and titered for viral production on NIH 3T3 cells. Titering was performed as follows: one ml of undiluted viral supernatant was used at sequential dilutions (with media) between 1:1 and 1:10*. The supernatant was layered on 5 x 10* naive 3T3 fibroblasts. Eight μg/ml of polybrene was added and the cells incubated at 37° and 5% C0₂ for 2 hours; 5 ml of media was added after 2 hours. 48 hours later, the cells were trypsinized and transferred to 100 mm tissue culture dishes and single colonies counted at 14 days. Titers were determined in duplicate using colchicine selection (60 ng/ml) (2, 14) .

Genomic DNA was made from the ten clones with the highest titer. DNA was digested with EcoRI, separated on a 1% agarose gel and transferred by the Southern blot method. Blots were probed with a 3.4 kb EcoRI fragment of the human MDR cDNA labelled with ³²P by nick translation.

GP+E86 and GP+E86-pHaMDR/A cells were trypsinized and transferred to petri dishes for 18 hours in HXM (hypoxanthine-xanthine myvophenolic acid) media to recover. The cells were analyzed by FACS (fluorescence- activated cell sorting) to quantiate the amount of MDR glycoprotein expressed on the cell surface. The cells were stained with the MDR monoclonal antibody 17F9 (lμg/10⁶ cells) for 20 minutes on ice. 17F9 (Dr. David Ring, Cetus Corporation) recognizes an external epitope of the MDR glycoprotein (19) . The cells were again washed with 1XPBS-3%FCS and resuspended in 300μl 1XPBS- 3%FCS. Analysis was performed on a FACS (Becton- Dickson) .

Amphotropic Producer Cells:

Amphotropic packaging cells were transduced with virus from the highest titer ecotropic MDR producer line. GP+EnvAml2 (17) (titer = 5 x 10*) were seeded in a 6 cm dish. Twenty hours later, the viral supernatant from semi-confluent ecotropic producer cells was harvested, passed through a .45 micron filter and 0.5 ml applied to amphotropic cells. Polybrene (8 μg/ml) was added to supernatants to enhance transduction. After two hours at 37°C, 4.5 ml of media was added to cells. Forty eight hours later, the cells were trypsinized and divided among 96 wells in media containing 60 ng/ml of colchicine. After four weeks, 24 clones were removed and transferred to 6-cm dishes. Clones were analyzed for the presence of the MDR vector by PCR analysis using MDR-specific primers (21) . DNA lysates were prepared from transduced clones (22) . PCR was carried out with 25 μl of lysate, one unit of AmpliTaq polymerase, .2μM dNTPs, 20 micromolar primers and PCR buffer (Perkin Elmer) in a final volume of 50 μl. Reactions were amplified for 35 cycles; each cycle included 30 seconds of denaturation at 94°C, 30 seconds of annealing at 55°C and one minute of extension at 72°C. Ten μl of each reaction was examined on a 4% agarose- NuSieve gel for the presence of the amplified 167 bp product (see Figure 12) .

Titers of colony forming units (CFUs) for each amphotropic producer clone were determined as follows. NIH 3T3 cells (5 x 10*) were seeded in a 6 cm dish. Twenty hours later, the viral supernatants from clones of semi-conlfuent amphotropic MDR producers were passed through 0.45 micron filters and 1 ml of supernatant was applied to the cells. Forty eight hours later, the cells were trypsinized and plated onto a 10 cm dish in media containing 60 ng/ml colchicine. Cells were counted 10-14 days later. Titers ranged from 0 - 1.5 x 10* CFU/ml of viral supernatant.

Infection of MELC Cells:

MELC were infected with undiluted supernatant from the highest titer producer line (5 x 10* viral particles/ml) (14, 23) . Five x 10^s non-adherent MELC in log phase were plated in 60 mm dishes and exposed to 5 ml of the viral supernatants with the addition of polybrene 8 ug/ml. After 48 hours, infected MELC were recovered and placed in selection media containing 2 ng/ml of colchicine in 96 well tissue culture dishes. Half the volume of media was replaced every 3 days. Resistant clones were identified by a change in media color and inspection under an inverted microscope. Individual MELC clones resistant to colchicine were isolated by serial dilutions on 96 well plates (23, 24). These clones were grown, and every 2 weeks the cells were resuspended in media containing 2 to 2.5 times the previous concentration of colchicine, to a maximum of 600 ng/ml of colchicine.

DNA Analysis:

Southern blotting (25) was performed after extraction of genomic DNA from normal and transduced MELC lines. Guanidine isothiacyanate (GIT) was added to 3 x 10⁷ cells and cesium chloride (CsCl) gradient centrifugation was performed at 32,000 rpm x 21° x 19 hr. DNA was precipitated with 95% cold ethanol after addition of NaCl to 0.3 M. Resuspended DNA was digested with proteinase K at 1 mg/ml, then extracted with phenol and choroform- isoamyl alcohol; DNA was quantified by UV absorption at 260 A°. DNA was digested with Xhol which cuts once within the provirus to determine the number of integration sites, and with Nhel which cuts in the LTRs to determine the presence and relative intensity of the inserted retroviral vector.

RNA Analysis:

RNA obtained after GIT and CsCl gradients was resuspended in DEPC treated H₂0 and analyzed. Gels containing 1.2% agarose, 1% formaldehyde and lx MOPS were prepared; each well was loaded with 5 μg total RNA in 6% formaldehyde and 50% formamide in a volume of 25 μl and mixed with 5 μl running dye. Gels were run at constant voltage, 5V/cm for 3 hours in lOx MOPS running buffer. Overnight transfer to nitrocellulose and subsequent procedures were done as described (22, 23). Ethidium bromide staining was used to determine the integrity of the RNA by inspection of the gels. Radioactive probes for hybridizations were prepared by EcoRI digestion of an MDR plasmid containing 1.2 kb of the MDR cDNA clone (2, 14); this fragment representing the 5' end of the MDR cDNA was isolated and labeled by nick translation with ³P.

Fluorescence Cell Sorting (FACS) Analysis:

The MDR monoclonal IgG2b antibody 17F9 was used to determine the amount of MDR on the surface of parental untransduced MELC and MDR-transduced MELC clones. MELC grown in log phase were washed twice by spinning at 400g x 10 minutes and resuspended in lx PBS. Cells were resuspended in Ab 17F9 (1 μg/10⁶ cells) and incubated for 20 minutes on ice. Suspensions were washed with ice cold lx PBS, 3% FCS, 0.2% NaN₃, pH 7.4 and centrifuged at 400g for 10 min at 4°C. Cells were then resuspended and incubated with fluorescein conjugated rat anti-mouse IgG2b (1 μg x 10⁶ cells) for 20 minutes on ice. Suspensions were again washed with lx PBS, 3%FCS, 9.2% NaN³ and the pellet resuspended in 400 μl. Samples were analyzed for linear mean fluorescence on a FACS Star Plus (Beckton-Dickinson) .

Safety Testing: Filtered undiluted supernatants from transduced MELC clones were tested for the presence of intact free recombinant MDR retrovirus after varying times in culture (4-14 weeks) by exposure to naive 3T3 cells. The appearance of colchicine resistance in these 3T3 cells was used to determine whether intact recombinant retrovirus was generated.

Bone Marrow Transplantation:

Marrow was harvested from the hind legs of 12 week old C57BL/6J mice forty eight hours after administration of 5-fluorouracil (500 mg/kg of body weight) . Aliquots of harvested bone marrow (3 x 10⁶ cells) were cocultured by layering them onto 100 ml sized plates of semiconfluent GP+E86 producer cells containing the MDR gene (5) . Cocultures were incubated for 24-48 hours in 10 ml of αMEM media containing 15% fetal calf serum, 15% WEHI conditioned medium, 1% Pen/Strep (Gibco Labs) , polybrene (2 μg/ml) and 11-6 (200 U/ml) . In some experiments, stem cell factor (SCGF; K. Zsebo, Amgen) was used. The unattached bone marrow cells were aspirated and concentrated by centrifugation at 800 g for 10 minutes, then counted in a hematocytometer using acetic acid and trypan blue to determine the number of viable nucleated cells. Finally, aliquots of 1-2 x 10⁶ viable nucleated cells in 0.5 ml or less of αMEM media were collected in 1 cc tuberculin syringes and kept at room temperature, in preparation for injection into irradiated mice (usually less than six hours after removal) . Recipient C57BL/6J mice (6-12 weeks old) were irradiated with 975 rad from a gamma source; donor marrow as then infused slowly through the central tail vein of the recipients (5) . Recipient mice were maintained in sterile cages and continued on a regimen with tetracycline started three days prior to irradiation and transplantation. These conditions were maintained for a minimum of two weeks post-transplantation. GP+EnvAml2pHaMDR/A clone 21, with a titer of 1.5 x 10*, was used to infect mouse bone marrow cells, which were then injected into lethally irradiated mice as described above. Five mice were sacrificed at twelve days post- transplantation and spleen DNA was isolated. The spleen DNA was subjected to PCR analysis, conducted as described above.

Analysis of Transplanted Mice: For the detection of the MDR gene in live recipient mice, polymerase chain reaction (PCR) analysis was used with the appropriate MDR cDNA probes (21) . Seventy five microliters of peripheral blood were obtained from the recipients' tail veins and collected in microhematocrit capillary tubes. The tubes were then spun for about four minutes in a microhematocrit centrifuge to obtain the "buffy coat" containing nucleated white blood cells (WBCs) . These buffy coat cells were treated with a lysis buffer to remove contaminated red blood cells and then incubated with proteinase K (.06 mg/ml) at 55°C for one hour, followed by 95°C for ten minutes (to inactivate the proteinase K) . Both salt/ethanol-precipitated DNA, or DNA lysate directly, were used in the MDR PCR reaction.

PCR was carried out with 25 μl of DNA solution containing one unit of AmpliTaq polymerase and the appropriate reaction kits (Perkin Elmer/Cetus) in a final volume of 50 μl. We used 35 PCR cycles; each cycle included 15 seconds of denaturation at 94°C, 15 seconds of annealing at 55°C and one minute of extension/synthesis at 72°C. MDR-specific sequences were amplified using the sense- strand primer CCCATCATTGCAATAGCAGC (residues 2596-2615; SEQ ID. NO. : 1) and the antisense-strand primer GTTCAAACTTCTGCTCCTGA (residues 2733-2752; SEQ ID. NO.: 2) which yield a 167 bp product (21) . Ten μl of the PCR product was examined on a 4% agarose-NuSieve gel for the presence of the expected band.

Bone marrow cells from sacrificed recipients were obtained by flushing the femurs and tibias of mice with αMEM media. Red blood cells were lysed for 30 seconds with cold dH₂0, following which isotonicity was restored with 3.5% NaCl. The remaining population of nucleated cells was stained with the MDR monoclonal antibody 17F9 (1 μg/10⁶ cells) , following the above-described procedure.

Experimental Results:

Transfer of the MDR gene into MELC:

Uninfected MELC plated on 96 well plates with 2 ng/ml colchicine yielded no resistant clones. By contrast clones were isolated using transduced MELC. In one experiment, 4 wells showed growth at 14 days. Subsequent limiting dilution and growth led to the isolation of a single colchicine resistant clone. Southern blot analysis confirmed clonality by showing a single integration of the MDR gene (Figure 2) . Other clones were subsequently isolated by limiting dilution. Some of the clones show either multiple viral insertions or the presence of multiple resistant clones in the same culture well (Figures 2 and 3) .

Expression of the MDR gene:

RNA analysis of these resistant clones by Northern blots show significant levels of MDR mRNA in comparison to untransduced MELC (Figure 4) . Four of the MELC clones (#1,2,3,5) growing in media containing 2 ng/ml colchicine were analyzed by FACs for their MDR expression (Table 1, see below) . Linear mean fluorescence values of these clones were 7.63 to 19.45 times above the low level fluorescence seen with untransduced MELC grown in nonselective media (Table 1) . These values indicate significant expression of MDR p-glycoprotein on the surface of the cells. TABLE 1

Effects of Increased Concentrations of Colchicine on P-glycoprotein Expression on the Surface of MDR

Transduced MELC

Linear Mean Fluorescence

Fold Increase

Unstained IgG-FITC MDR-FITC in Ex ressio Controls 1.48,2.00 1.59,3.77 1.46,3.12

Clone 1 2ng/ml 1.89 lOng/ml 1.32 300ng/ml 2.41

Clone 2 2ng/ml 1.66 5ng/ml 1.65 300ng/ml 2.14

Clone 3 2ng/ml 1.88 lOng/ml 1.63 300ng/ml 2.02

Clone 5

5ng/ml 1.91

20ng/ml 1.32

300ng/ml 2.60

600ng/ml 2.13

After exposure to progressively higher concentrations of colchicine ranging from 5 to 600 ng/ml, several highly resistant MELC clones were obtained. The high resistance levels of these cell lines as compared to the parental cell lines we show to correlate with 1) amplification of the MDR gene (Figure 5) ; 2) increased MDR mRNA (Figure 6); and 3) increased expression of MDR glycoprotein on the cell surface (Figure 7, Table 1). The increment in the intensity of the DNA bands observed in Southern blots of MELC maintained at greater concentrations of colchicine is due to an increase in the number of copies of the MDR gene since the total amount of DNA in each well is the same (5 μg) an increase in the proportion of MDR mRNA is evidenced by the increased intensity of the bands in Northern blots. FACS analysis indicates a progressive increase in linear fluorescence of clones exposed to greater concentrations of colchicine. Clones 1, 2 and 3 showed 3.0, 2.6 and 3.5 times greater expression of p-glycoprotein on the cell surface as they were subjected to increasing amounts of colchicine from 2 ng/ml to 300 ng/ml. Clone 5 was sequentially subjected to up to 600 ng/ml colchicine and expression of p- glycoprotein on MELC increased with each higher concentration (Table 1, Figure 7) .

Safety testing of MELC Clones:

Transduced MELC were checked periodically for the presence and secretion of wild type MDR-containing retroviruses by exposure of native 3T3 cells for 48 hours to MELC supernatants from clones grown for 4, 8 and 14 weeks. The absence of colchicine resistant 3T3 colonies after 14 days in selection media with 60 ng/ml of colchicine as described (18) indicates the absence of wild type recombinant virus in transduced MELC.

The High Level Producer Cell Line:

The high level producer ecotropic cell line was characterized by Southern blot (Figure 8) , showing that there was significant integration of the human MDR gene into the genome of these cells. The high level of expression of the MDR P-glycoprotein on the surface of these cells was demonstrated by FACS analysis, conducted as described above (see Figure 9) . Other antibodies, which recognize internal epitopes of the MDR protein and were used to quantitate MDR protein expression, gave high background staining levels with cells that had not been transduced with the human MDR gene.

MDR Gene Transfer and Expression In Live Mice:

Several different batches of irradiated mice transduced with bone marrow containing the human MDR gene were analyzed both for their content of the MDR gene and for expression of the integrated gene over time. Table 2 (see below) shows results from all of the mice analyzed. Over 90% of the mice analyzed between 14 and 50 days post translation contained the MDR gene, as demonstrated by MDR PCR analysis of tail vein blood (see Figure 10 and Table 2) . MDR analysis by PCR was continued in some of these animals for up to eight months. In the animals surviving to eight months, approximately 20% contained high MDR levels (Table 2) .

TABLE 2 PCR Analysis of Mice Transduced With the Human MDR Gene

No. of S Cells Hours of c x 10⁶ Cocultur-- F m

1.5 24 + + 1.5 24 + + 1.5 24 + + 1.5 24 + + 1.5 24 + + 1.5 24 + + + 1.5 24 + + + 1.5 24 + 1.5 24 +

.7 48 n.t. + .7 48 n.t. + .7 48 n.t. + .7 48 n.t. + .7 48 n.t. + .7 48 n.t. +

1.5 48 + + 1.5 48 + +

3 48 + +

6 48 - + +

6 48 - + +

3 48 + n.t. +

3 48 + n.t. 1.5 48 + n.t. 1.5 48 + n.t. + +

6 48 + n.t. + + 6 48

27 + n.t. 48 n.t. At eight months some of the animals were sacrificed, and the marrow analyzed for the content and expression of the human MDR gene by PCR, Southern blot and FACS analysis. Southern blot analysis from one of these animals demonstrated significant content of the MDR gene in the bone marrow cells. FACS analysis of the bone marrow cells of this mouse was performed using conditions which excluded long lived lymphocytes from the sort procedure by size and morphology. The cells analyzed were predominantly granulocytes. In this mouse a distinct population representing approximately 14% of the total nonlymphocyte granulocyte pool contained significantly increased levels of MDR protein (Figure 5) . The results indicate that in this animal, bone marrow stem cells were clearly transduced since mature granulocytes containing high levels of MDR protein were present as long as eight months post transplantation. This occurred even without further selection by exposure to MDR-responsive drugs such as taxol and daunomycin which has been shown in transgenic animals to increase MDR expression. Figure 12 shows the results of the PCR analysis of spleen DNA from mice infected by the producer cell GP+EnvAml2pHaMDR/a. A 167 bp product has been amplified in all the spleen DNA samples from the transplanted mice and not in the control samples, indicating that the mice have been successfully transplanted with MDR transduced marrow.

Experimental Discussion:

Retrovirally mediated gene transfer is an efficient mechanism to both stably transduce target cells and produce significant expression of the transduced genes. In these experiments we have shown that human MDR cDNA is capable of transducing the MDR phenotype into MELC initially sensitive to colchicine. The transduced MELC clones show integration of the full sized retroviral gene construct and expression of intact human MDR mRNA. FACS analysis using an MDR monoclonal antibody (17F9 Ab) is able to clearly distinguish between untransduced and transduced clones. There is some variability of baseline mRNA expression and mean fluorescence of FACS among individual clones maintained in 2 ng/ml of colchicine. This may be due to integration of the MDR gene into different sites of chromosomal DNA.

Resistant MELC clones subjected to higher concentrations of colchicine increase their level of MDR genes, mRNA, and protein expression. Because we see greater intensity bands on Southern blots and increased mRNA levels in the same clones, we believe these are due to DNA amplification as demonstrated by others (16, 17) . However, the contribution of other mechanisms such as an increase in the transcription rate, or decreased rates of MRNA or protein degradation cannot be excluded. The use of the 17F9 monoclonal antibody directed against an external epitope of the human MDR glycoprotein allows us to distinguish accurately between resistant and sensitive MELC. This antibody recognizing an external epitope of MDR has a distinct advantage over other antibodies recognizing internal epitopes since the latter require permeabilizing the cells (27) . ,_{««« «} 09120

-44-

The absence of any contaminating intact helper recombinant retrovirus in our experiments show that even with amplification of the transduced MDR gene, the retroviral producer lines used are safe. This reaffirms the results previously obtained using our packaging lines (18, 20). Thus, this system offers the promise of safe and efficient retroviral gene transfer into erythroid cells and high level expression of genes such as MDR.

In two experiments, MELC were fluorescently labelled with MDR monoclonal antibody 17F9 and analyzed on a FACS Star Plus (Becton Dickinson) . Linear mean fluorescence was determined and shown above. Two negative control samples of untransduced MELC were analyzed by FACS and the values from both samples are listed above. These untransduced MELC controls are sensitive to media containing 2 ng/ml of colchicine. All other samples were grown in colchicine-containing media, the concentrations being given above. Column 1 samples were not labelled with antibody and the linear means represent low level autofluorescence of the MELC samples. Column 2 samples were labelled only with a fluorescein (FITC) conjugated rat anti-mouse IgG2b secondary antibody. Linear mean values indicate a low level of non-specific binding of this secondary antibody to MELC. Column 3 samples were labelled with the MDR 17F9 (IgG2b isotype) and the fluorescein conjugated secondary antibody. Linear mean values indicate significant increases in p-glycoprotein expression on the cell surface of MELC. Column 4 represents ratios of MDR MELC clones linear mean values to untransduced MELC control linear means. These ratios indicate the increase in MDR expression on the MELC clones over those of untransduced MELC, as well as the increase in expression of individual clones subject to increasing concentrations of colchicine.

There has been some concern about the efficiency of gene transfer into bone marrow stem cells, especially in experiments involving the human beta globin gene (16, 17) . We have shown that a human gene (MDR) cDNA, contained in retroviral vector, in an appropriately high titer producer cell line clearly leads to relatively efficient and long term transduction of mouse bone marrow cells. These results do not quite match those obtained using a neoR containing retrovirus (14, 18, 19, 23-26). However, this may be due to the relative differences in retroviral titer between MDR producer cells (10⁵) and neoR producer cells (10⁶, 10⁷) .

The data presented herein indicate that bone marrow stem cell infection is possible with appropriate retroviral vectors and producer lines containing human genes. The use of 1) long term bone marrow culture to provide repeated infection by retrovirus; 2) isolated stem cells to provide higher virus to cell ratios, and 3) growth factors leading to stem cell proliferation in these population are additional steps that can be used to increase retroviral gene transfer (5, 6) . In the case of isolated bone marrow populations, containing the majority of hematopoietic stem cells, it has already been shown that the presence of growth factors, primarily stem cell factor and IL3 and IL6, causes an increase in the number of proliferating stem cells available for retroviral gene transfer (7, 8) . The use of in vitro or in vivo selection of transduced bone marrow cells expressing high levels of MDR is possible by exposure of the cells to MDR responsive chemotherapeutic agents.

The use of MDR in patients with advanced cancer undergoing autologous bone marrow transplantation in association with high does chemotherapy appears to be a feasible first clinical trial of this therapeutic modality. Subsequent experiments using the MDR gene as a selectable marker would be done in order to permit the appropriate transfer and expression of a nonselectable gene such as the human beta globin gene into patients with sickle cell anemia or thalassemia. The focus would be curing these patients by enriching their bone marrow population for cells containing and expressing the human beta globin gene. If this strategy was successful, then this methodology could be applied to other genetic diseases in which the gene of interest is not selectable.

References of the preceding sections:

1. Gottesman, M. and Pastan, I.: The Multidrug Transporter, A Double-Edged Sword. J. Biol. Chem. 263: 12163, 1988.

2. Galski, H., Sullivan, M. , Willingham, M.C., Chin, K. , Gottesman, M. and Pastan, I.: Expression of a Human Multidrug Resistance cDNA (MDRl) in the Bone Marrow of Transgenic Mice: Resistance to Daunomycin-Induced Leukopenia. Mol. Cell Biol. 9: 4357, 1989.

3. Mann, R. , Mulligan, R.C. and Baltimore, D. Cell. 33: 153-59, 1983.

4. Cone, R. and Mulligan, R.C. Proc. Natl. Acad. Sci.. 81: 6349-53, 1984.

5. Hesdorffer, C. , Ward M. , Markowitz, D. and Bank, A. DNA & Cell Biol.. 9: 717-23, 1990.

6. Miller, A.D. Blood. 76: 271-78, 1990.

7. Joyner, A., Keller, G. , Phillips, R.A. and Bernstein, A. Nature, 305: 556-58, 1983.

8. Miller, A.D., Jolly, D. , Friedman, T. and Verma, I. Science. 225: 630-32, 1984.

9. Williams, D., et al. Nature. 310: 476-80, 1984

10. Dick, J.E., et al. Cell. 42: 75-9, 1985. 11. Keller, G., Paige, C. , Gilboa, E. and Wagner, E.F. Nature, 318: 149-55, 1985.

12. Dzierzack, A.E., Papayannopoulou, T. and Mulligan, R.C. Nature. 331: 35-41, 1988.

13. Bender, M.A. , Gelinas, R.E. and Miller A.D. Mol. Cell Biol.. 8: 1725-35, 1988.

14. Pastan, I., Gottesman, M. , Ueda, K. , Lovelace, E. , Rutherford, A. and Willingha , M. : A Retrovirus Carrying an MDRl cDNA Confers Multidrug Resistance and Polarized Expression of P-glycoprotein in MDCK Cells. Proc. Natl. Acad. Sci. 85: 4486, 1988.

15. Pastan, I. and Gottesman, M. Ann. Rev. Me .. 42: 277-86, 1991.

16. Shen, D, Fojo, A., Robinson, I.B., Richert, I.V., Pastan, I. and Gottesman, M. : Human Multidrug

Resistant Cell Lines: Increased MDRl Expression Can Precede Gene Amplification. Science. 232: 643, 1986.

17. Germann, A., Gottesman, M. and Pastan, I.: Expression of a Multidrug Resistance-Adenosine Deaminase Fusion Gene. J. Biol. Chem. 264: 7418, 1989.

18. Markowitz, D. , Goff, S. and Bank A.: A Safe Packaging Line for Gene Transfer: Separating Viral Genes on Two Different Plasmids. J. Virol. 62: 1120, 1988. 19. Aihara, M. , Aihara, Y. , Schmidt-Wolf, G. , Schmidt- Wolf, I., Sikic, B.I., Blume, K.G. and Chao, N.J. : A Combined Approach for Purging Multidrug-Resistant Leukemic Cell Lines in Bone Marrow Using a Monoclonal Antibody and Chemotherapy. Blood 77: 2079, 1991.

20. Markowitz, D. , Goff, S. and Bank, A.: Construction and Use of a Safe and Efficient Amphotropic Packaging Cell Line. Virology 167: 400, 1988.

21. Noonan, K.E., et al. Proc. Natl. Acad. Sci.. 87: 7160-64, 1990.

22. Higuchi, R. : Perkin Elmer/Cetus Newsletter. Amplifications 2 : 1, 1989.

23. Lerner, N. , Brigham, S., Goff, S. and Bank, A.: Human β-Globin Gene Expression After Gene Transfer Using Retroviral Vectors. DNA 6: 573, 1987.

24. Rund, D., Dobkin, C. and Bank, A.: Regulated Expression of Amplified Human β-Globin Genes. Blood 70: 733, 1987.

25. Ausbel, F.M. , et al: Current Protocols in Molecular Biology. John Wiley and Sons, 1989.

26. Sanbrook, J. , Fritsch, E.F. and Maniatis, T. : Molecular Clonning. 2nd Ed., Cold Spring Harbor

Laboratory, vol. 1, 1989.

27. Kartner, N. , Evernden-Porelle, D. , Bradley, G. and Ling, V. : Detection of P-glycoprotein in Multidrug- Resistant Cell Lines by Monoclonal Antibodies. Nature 316: 820, 1985.

28. Herzig, G: Autologuous Bone Marrow Transplant in Solid Tumors. Hematol. 9: 1-24, 1981.

29. Peters, W.P., Shall, E.J., Jones, R.B., Olsen, G.A., Bast, R.C, Gocker an, J.P. and Moore, J.O.: High- Dose Combination Alkylating Agents With Bone Marrow Support as Initial Treatment for Metastatic Breast Cancer. J. Clin. Oncol. 6: 1368, 1988.

30. Podda, S., Himelstein, A., de la Flor-Weiss, E. , Richardson, C. , Deloherty, T. , Ward, M. and Bank,

A. : Transfer of the MDR Gene into Irradiated Mice Using Retroviral Vectors. Blood 78: 208A, 1991.

31. Sorrentino, B.P., Brandt, S., Gottesman, M. , Pastan, I., Bodine, D. and Nienhius, A.W. : Positive

Selection In Vivo for Hematopoietic Cells Expressing the Multidrug Resistance Gene Following Retroviral- Mediated Gene Transfer. Blood 78: 19IA, 1991.

32. Markowitz, D., Goff, S. and Bank, A.: A Safe Packaging Line For Gene Transfer. J Virol. 62: 1120-25, 1988.

33. Gros, P., Ben-Neriah, Y., Croop, J. and Housman, D. Nature.^' 323: 728-31, 1986.

34. Bernstein, I.D., Andrews, R.G. and Zsebo, K.M. Blood. 77: 2316-21, 1990. 35. Migliacc.-), G., et al. Proc. Natl. Acad. Sci.. 88: 7420-24, :A91.

36. Bodine, D.M. , Karlsεon, S. and Nienhuis, A.W. Proc. Natl. Acad. Sci.. 86: 8897-8901, 1989.

37. Luskey, B.D., et al. In: Sixth Coolev's Anemia Symposium (A. Bank, ed.). Annals of the New York Academy of Sciences, vol. 612, pp398-406, 1990.

second Series of Experiments

Applicants have transduced human bone marrow cells obtained from marrow harvests for future autologous bone marrow transplantation (ABMT) with applicants' highest titer (5 X 10* particles/ml) amphotropic producer line, A12M1 retrovirus (Figure 14-16) . Supernatants from A12M1 have been used instead of co-culture with MDR producer cells to avoid potential contamination of the bone marrow with the producer cells, an undesirable side-effect in clinical use. In one set of experiments, applicants have cultured Ficoll-separated nucleated bone marrow cells (NBMC) from whole marrow for 24 hours with media containing 10% fetal calf serum, 10 units/ml IL-3, 200 units/ml IL-6, and 50 units/ml human SCF (a gift from AMGEN) (Ward et al. Transfer and expression of the MDR gene in CD34⁺ cells. ASH abstract 1993; 1) . The NBMC were then exposed to A12M1 supernatants for 4-8 hours, 3-4 X, over 48 hours to optimize retroviral transfer by providing an excess virus over cells (usually 2-4 X 10⁷ viral particles/10⁷ cells) . PCR with MDR primers from different exons yields a unique 157 basepair band transduced integrated MDR cDNA; the endogenous human MDR gene containing exons gives either no signal or a band of larger size. A positive MDR PCR signal was obtained after A12M1 supernatants are exposed to human bone marrow (Figure 14) . In addition, applicants have shown that increasing the number of changes the supernatant increases the PCR signal as excess virus is needed (1) (Figure 14) . By analysis of BFU-E from transduced marrows, 10-50% of colonies contain and express MDR as assayed by: 1) MDR PCR of individual colonies; and 2) Resistance of colonies to 50 ng/ml of colchicine- resistant. In other experiments, six of 12 and five of 12 individual BFU-E were MDR PCR-positive after transduction. A .olicants have also demonstrated that 20- 25% of human marrow cells transduced with MDR express the MDR protein at increased levels by FACS analysis (Figure 15) . Applicants have also used CD34⁺ cells and can show MDR transduction in these cells as well (1) (Figure 16) .

In more recent experiments, applicants have shown that fibrinectin plates serve as an excellent substrate for the maintenance of CD34+ transduction (Ward, Richardson, Hesdorfer and Bank, Blood, abstract, submitted August, 1993, to be published November, 1993). In these studies, CD34+ cells are grown on fibrinectin plates Collaborative Research) for 48 hrs in the presence of IL-3, IL-6 and SCF and are transduced with A12M1 supernatants twice over the next 24 hrs. At this time, 10 to 50% of BFU-E plated are MDR PCR positive. The transduced cells are then expressed to G-SCF and GM-CSF for and additional 3-7 days. In two experiments, FACS analysis at this time shows 5 and 9% of the expanded cell population have increased levels of MDR; the signal of MDR PCR is also increased at this time.

GP+envAM-12 packaging cells have been shown to be safe by their use with the IL-2 gene in human melanoma cells in culture (2) , and ADA gene in monkey marrow transfer experiments (3) , and in applicants' studies with MDR of A12M1 cells (4, 5). Reverse transcriptase assays, Mus dunni co-culture studies, utilization of supernatants on naive 3T3 cells, have been used in these experiments. The GP+envAM12 packaging cells have been approved by the RAC and FDA for use with the IL-2 gene to treat patients with malignant melanoma (2) . The RAC approved the use of A12M1 supernatants in June 1993.

Applicants have used several different assays to test for intact retroviruses in supernatants of the applicants' MDR amphotropic producer cells (A12M1) to be used in the proposed protocol. A 3T3 amplification assay with A12M1 supernatants has consistently been negative by reverse transcriptase. The supernatants of transduced human bone marrow cells is also negative. In addition, applicants have grown A12M1 cells in co-culture with Mus dunni cells and assayed the supernatants by the S+L- assay and shown that there is no helper virus by this sensitive assay. The latter assay has also been repeated by Microbiological Associates and shown to be negative (see below) .

Mus dunni assay:

The mus dunni assay was performed in the following manner. Two hundred thousand mus dunni cells were plated in a tissue culture dish with five ml McCoys' media, ten percent fetal calf solution and five percent penicillin and streptomycin. The following day, two hundred thousand producer cells were irradiated with 3500 rads and plated onto the mus dunni cells.

Cells were split one to ten weekly for five weeks. After this period of time, supernatants from the cultures were retrieved and frozen prior to further testing. This supernatant•was called Sup-1. The S+L- assay was also performed by Microbiological Associates (Sup-1) , and similarly using PG4 cells in the experiments shown in the following Table 3. -55-

Table 3

Summary of Safety Data

Supernatant tested

Amphotropic 4070A foci

GP+EnvAml2

GP+EnvAml2 MDR producer

Mus Dunni

Mus Dunni cocultured w/ irradiated MDR producers

Blood plasma from untrans- planted mouse

Blood plasma from ampho¬ tropic MDR mouse trans¬ plant S⁺L^" negative

3T3 RT negative

GP+EnvAml2 RT positive

GP+EnvAml2 MDR producer RT positive Mus Dunni RT negative

Mus Dunni cocultured w/ irridated MDR producers RT negative Blood plasma from untrans- planted mouse RT negative Blood plasma from ampho¬ tropic MDR mouse trans¬ plant RT negative

The data below are derived from a report by the Microbiological Associate Inc.

The test article, SUP-1, defined above, was tested for the presence of murine retroviruses by the feline S⁺L^" focus assay. No foci was observed in any of the plates exposed to the test article indicating that no murine retrovirus was detected using the S⁺L^" assay described in this report.

Feline S⁺L^" (PG-4) cells are susceptible to infection with many strains of mammalian retroviruses including such viruses as murine xenotropic viruses, mink cell focus forming viruses and some primate and feline leukemia viruses. The broad range of susceptibility of the feline S⁺L^" cell, therefore, provides a sensitive assay for those retroviruses.

STUDY INFORMATION

Title: In Vitro Detection of Murine Retroviruses by Feline S⁺L^" Focus Assay

Study Number: ZH431.009200

Test Article: SUP-1 was received at Microbiological

Associates, Inc. on 05/04/93. Determination of the stability, purity and concentration of the test article is the responsibility of the sponsor.

Control Articles:

Positive Control: Murine amphotropic virus (4070A) Lot No. : AL011293

Source: Microbiological Associates, Inc. Negative Control: McCoy's 5A medium

Lot No. : RV041493H

Source : M i c r o b i o l o g i c a l Associates , Inc .

Vehicle Control: None

Test System: Feline S⁺L^" cells Passage No. : 15

Source: Source: National Cancer Institute Bethesda, Maryland

Testing Facility: Biotechnology Dervices Division Microbiological Assocaites, Inc. Life Sciences Center 9900 Blackwell Road Rockville, Maryland 20850

Study Completion See Study Director's Signature Date, in the "Approvals" Section. METHODS Objective:

The study objective is to determine whether retroviruses are present in the test article as determined by the development of foci in feline S⁺L^" cells.

Methods: S*L^~ Assay: The S⁺L^" cells were maintained and infected for the focus assay according to SOP OPBT0775 as follows: cells were inoculated with 0.2 ml of test or control material following a 30 minute pretreatment with DEAE-dextran. After approximately 2 hours adsorption, inocula were removed and cultures overlaid with culture medium. Plates were refed as necessary and maintained until foci developed in the positive control.

Positive control for S⁺L^" Focus Forming Activity:

The Type C retrovirus used as a positive control was murine amphotropic virus (4070A) propogated in NIH/3T3 cells at Microbiological Associates, Inc.

RESULTS

The test article was test undiluted (0.2 ml per plate) on S⁺L^" cells. Positive control plates infected with amphotropic virus and unifected negative control plates were run in parallel with the test article.

Microscopic examination of the plates of feline S⁺L^" cells treated with SUP-1 revealed no foci indicating the absence of murine retorvirus detectible by the S⁺L^" focus assay, see Table 4.

No foci were observed in the negative control and the positive control had a focus count within two standard deviations of the mean titer of the positive control lot.

CONCLUSIONS: The test article, SUP-1, was tested for the presence of murine retrovirus by the feline S⁺L^" focus assay. No foci were observed in any of the plates exposed to the test article indicating that no murine retrovirus was detected using the S⁺L^" assay described in this report. TABLE 4

S⁺L^" Focus Assay on SUP-1 Sample Dilution Foci/ Mean Foci/ FFU/ml* (0.2 ml/plate) Plate Plate

Test Article None 0,0,0,0,0

Positive 2X10 _.-^"5³ 37,65,45 45 1.1x10' Control 40,38

1X10 -5 20,14,20, 18 9.0X10⁶ 19,18

5X10 -6 18,13,15, 14 1.4X10⁷ 12,14

2.5X10^"6 8,6,6,12,4 lxlO⁷

Negative Control None 0,0,0,0,0

* FFU/ml = (Mean #foci/plate) x Volume/Plate x Dilution

TABLE OF MDR-1 TRANSDUCTION OF CDR3 + SEPARTATED CELLS

EXPERIMENTS 1-6 CD34+ Cells exposed to 72 hours incubation with A12M1 viral supernatant.

EXPERIMENTS 7,8 CD34+ cells exposed to 24-96 hours incubation with viral supernatant.

^FU-E colonies obtained

²CFU-GEMM colonies obtained ³MDR-PCR result to indicate transduction of cells by A12M1 viral supernatant. References of the Second Series of Experiments:

1. Ward, M. , Hesdorffer, C. , Smith, L. , de la Flor- Weiss, E. , Podda, S. , Richardson, C. , Gottesman, M. , Pastan, I., Bank, A., Blood Suppl.. 80:239A, 1992, (Abstract)

2. Gansbacher, H. , Zier, K. , Cronin, K. , et al. Blood. 80:2817-2825, 1992.

3. Bodine, D. , Moritz, T. , Luskey, B., et al. Blood Suppl.. 80:72A, 1992 (Abstract)

4. Podda, S., Ward, M. , Himelstein, A., Richardson, C. , de la Flor-Weiss, E. , Smith, L. , Gottesman, M. ,

Pastan, I., Bank, A., Proc. Natl. Acad. Sci.. U.S.A.. 89:9676-9680, 1992.

5. de la Flor-Weiss, E. , Richardson, C. , Ward, M. , Himelstein, A., Smith, L. , Podda, S., Gottesman, M. ,

Pastan, I., Bank, A., Blood. 80:3106-3111, 1992.

0

-62-

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANTS: Arthur Bank, et al.

(ii) TITLE OF INVENTION: RETROVIRAL MEDIATED TRANSFER OF THE HUMAN MULTIPLE DRUG

RESISTANCE GENE

(iii) NUMBER OF SEQUENCES: 2 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Cooper & Dunham

(B) STREET: 30 Rockefeller Plaza

(C) CITY: New York

(D) STATE: New York (E) COUNTRY: USA

(F) ZIP: 10112

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.24

(vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: Not Yet Known

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: White, John P.

(B) REGISTRATION NUMBER: 28,678

(C) REFERENCE/DOCKET NUMBER: 41074-A-PCT/JPW/AKC (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (212) 977-9550

(B) TELEFAX: (212) 977-9809

(C) TELEX: 422523 COOP UI

(2) INFORMATION FOR SEQ ID NO:l;

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: DNA

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: CCCATCATTG CAATAGCAGC 20

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

GTTCAAACTT CTGCTCCTGA 20

Claims (25)

What is claimed is:

1. A mammalian retroviral producer cell which comprises a retroviral packaging cell and a retroviral vector comprising the human multiple drug resistance gene.

2. The mammalian retroviral producer cell of claim 1, wherein the retroviral packaging cell is an ecotropic retroviral packaging cell.

3. The mammalian retroviral producer cell of claim 2, wherein the ecotropic retroviral packaging cell is the GP+E-86 ecotropic retroviral packaging cell (ATCC No. CRL 9642) .

4. The mammalian retroviral producer cell of claim 3 comprising the pHaMDR/A retroviral vector (ATCC No. CRL 11164) .

5. The mammalian retroviral producer cell of claim 1, wherein the retroviral packaging cell is an amphotropic packaging cell.

6. The mammalian retroviral producer cell of claim 5, wherein the amphotropic retroviral packaging cell is the GP+EnvAml2 amphotropic retroviral packaging cell (ATCC No. CRL 9641) .

7. The mammalian retroviral producer cell of claim 6 comprising the pHaMDR/A retroviral vector (ATCC No. CRL 11165) . 0

-65-

8. The mammalian cell of claim 1, wherein the retroviral vector further comprises a DNA sequence corresponding to a second mammalian gene.

9. The mammalian cell of claim 8, wherein the second mammalian gene encodes a non-selectable phenotype.

10. The mammalian cell of claim 9, wherein the second mammalian gene is selected from the group consisting of an insulin gene, a β-globin gene or a major histocompatibility gene.

11. A method of transducing a target mammalian cell with the human multiple drug resistance gene which comprises:

(i) culturing the target mammalian cell in the presence of the mammalian retroviral producer cell of claim 1 under conditions permitting production of retroviral particles by the producer cell and transduction of the target mammalian cell by the retroviral particles; and

(ii) contacting the target mammalian cells with an

MDR- responsive drug in an amount cytotoxic to cells which do not express the multiple drug resistance gene.

12. The method of claim 11, wherein the target mammalian cell is selected from the group consisting of a bone marrrow cell, a lymphocyte or a tumor cell.

13. The method of claim 11, wherein the MDR-responsive drug is selected from the group consisting of colchicine, vinca alkaloids, anthracyclines and taxol .

14. The method of claim 11, further comprising transducing the target mammalian cell with a non- selectable mammalian gene.

15. A method of introducing the human MDR gene into a mammal which comprises:

(i) isolating suitable target cells from the mammal;

(ii) transducing the suitable target mammalian cells with the human multiple drug resistance gene according to the method of claim 11; and (iϋ) readministering the transduced target cells to the mammal from which they were isolated.

16. A safe method of introducing the human MDR gene into a mammal which comprises:

(i) isolating suitable target cells from the mammal; (ii) transducing the suitable target mammalian cells with the human multiple drug resistance gene according to the method of claim 11; and (iii) readministering the transduced target cells to the mammal from which they were isolated.

17. The method of claim 15 or 16, wherein the mammal is a mouse or a human. 0

-67-

18. The method of claim 15 or 16, further comprising introducing a non-selectable gene into the mammal.

19. A method of treating a mammal afflicted with a cancer which comprises introducing the human MDR gene into the mammal according to the method of claim 15 or 16 followed by administering to the mammal an MDR-responsive drug in an amount cytotoxic to cancer cells in the mammal.

20. The method of claim 19, wherein the mammal is a mouse or a human.

21. The method of claim 19, wherein the cancer is selected from the group consisting of lymphomas, leukemias or sarcomas.

22. The method of claim 19, wherein the MDR-responsive drug is selected from the group consisting of anthracyclines, vinca alkaloids, etoposides and taxol.

23. A method of treating a mammal afflicted with a disorder characterized by abnormal expression of a non-selectable gene, which comprises:

(i) isolating suitable target cells from the mammal; (ii) culturing the suitable target cells with the mammalian retroviral producer cell of claim 1, wherein the retroviral vector comprises the human MDR gene and a second mammalian gene, under conditions permitting production of retroviral particles by the producer cell and transduction of the target cells by the retroviral particles; (iii) contacting the transduced target cells with an amount of an MDR-responsive drug cytotxic to cells which do not express the

MDR gene; and (iv) readministering the transduced target cells to the animal from which they were isolated.

24. The method of claim 23, wherein the mammal is a mouse or a human.

25. The method of claim 24, wherein the disorder is anemia, β-thallesemia or diabetes.