WO1994004673A1 - Promoteurs fongiques actifs en presence du glucose - Google Patents

Promoteurs fongiques actifs en presence du glucose Download PDF

Info

Publication number
WO1994004673A1
WO1994004673A1 PCT/FI1993/000330 FI9300330W WO9404673A1 WO 1994004673 A1 WO1994004673 A1 WO 1994004673A1 FI 9300330 W FI9300330 W FI 9300330W WO 9404673 A1 WO9404673 A1 WO 9404673A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
sequence
seq
host
glucose
Prior art date
Application number
PCT/FI1993/000330
Other languages
English (en)
Inventor
Tiina Hannele Nakari
Maija-Leena Onnela
Marja Hannele ILMÉN
Kaisu Milja Helena Nevalainen
Merja Elisa PENTTILÄ
Original Assignee
Alko Group Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alko Group Ltd. filed Critical Alko Group Ltd.
Priority to EP93917824A priority Critical patent/EP0656943A1/fr
Priority to AU47121/93A priority patent/AU4712193A/en
Priority to JP6505947A priority patent/JPH08500733A/ja
Publication of WO1994004673A1 publication Critical patent/WO1994004673A1/fr
Priority to FI950779A priority patent/FI950779A/fi

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2468—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on beta-galactose-glycoside bonds, e.g. carrageenases (3.2.1.83; 3.2.1.157); beta-agarase (3.2.1.81)
    • C12N9/2471—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01023—Beta-galactosidase (3.2.1.23), i.e. exo-(1-->4)-beta-D-galactanase

Definitions

  • Promoter probe vectors have been designed for cloning of promoters in E. coli (An, G. et al, J. Bad. 740:400- 407 (1979)) and other bacterial hosts (Band, L. et al , Gene 26:313-315 (1983); Achen, M.G., Gene 45:45-49 (1986)), yeast (Goodey, A.R. et al , Mol. Gen. Genet. 204:505-511 (1986)) and mammalian cells (Pater, M.M. et al, J. Mol. App. Gen. 2:363-371 (1984)). Because it is well known in the art that Trichoderma promoters fail to work in E.
  • Trichoderma coli and yeast e.g. Penttila, M. ⁇ . et al, Mol. Gen. Genet. 794:494-499 (1984)
  • these organisms cannot be used as hosts to isolate Trichoderma promoters. Due to the fact that, during the transformation of Trichoderma, the transforming DNA integrates into the fungal genome in varying copies in random locations, application of this method by using Trichoderma itself as a cloning host is also unlikely to succeed and would not be practical for efficient isolation of Trichoderma promoters with the desired properties.
  • genes can be isolated from either a cDNA or chromosomal gene bank (library) using hybridization as a detection method.
  • hybridization may be with a corresponding, homologous gene from another organism (e.g., Vanhanen et al , Curr. Genet. 75:181-186 (1989)) or with a probe designed on the basis of expected similarities in amino acid sequence.
  • an oligonucleotide can also be designed which can be used in hybridization for isolation of the gene.
  • the gene is cloned into an expression bank, the expression product of gene can be also detected from such expression bank by using specific antibodies or an activity test.
  • Specific genes can be isolated by using complementation of mutations in E. coli or yeast (e.g., Keesey, J.K. et al , J. Bad. 752:954-958 (1982); Kaslow, D.C., J. Biol. Chem. 265:12337-12341 (1990); Kronstad, J.W., Gene 79:97-106 (1989)), or complementation of corresponding mutants of filamentous fungi for instance by using SIB selection (Akins et al. , Mol Cell. Biol. 5:2272-2278 (1985)).
  • Differential hybridization has been used for cloning of genes expressed under certain conditions.
  • the method relies on the screening of a bank separately with an induced and noninduced cDNA probe.
  • Trichoderma reesei genes strongly expressed during production of cellulolytic enzymes have been isolated (Teeri, T. et al, Bio/Technology 7:696-699 (1983)).
  • the differential hybridization methods used are based on the idea that the genes searched for are expressed in certain conditions (like cellulases on cellulose) but not in some other conditions (like cellulases on glucose) which enables picking up clones hybridizing with only one of the cDNA probes used.
  • Another option for obtaining a promoter with desired properties is to modify the already existing ones. This is based on the fact that the function of a promoter is dependent on the interplay of regulatory proteins which bind to specific, discrete nucleotide sequences in the promoter, termed motifs. Such interplay subsequently affects the general transcription machinery and regulates transcription efficiency. These proteins are positive regulators or negative regulators (repressors), and one protein can have a dual role depending on the context (Johnson, P.F. and McKnight, S.L. Annu. Rev. Biochem. 58:799-839 (1989)).
  • TEFs Translation Elongation Factors
  • TEFs are universally conserved proteins that promote the GTP-dependent binding of an aminoacyl-tRNA to ribosomal A-site in protein synthesis. Especially conserved is the N-terminus of the protein containing the GTP binding domain. TEFs are known as very abundant proteins in cells comprising about 4-6% of total soluble proteins (Miyajima, I. et al , J. Biochem. 53:453-462 (1978); Thiele, D. et al, J. Biol. Chem. 260:3084-3089 (1985)). tef genes have been isolated from several organisms. In some of them they constitute a multigene family. Also a number of pseudogenes have been isolated from some organisms.
  • the promoter of the human tef gene can direct transcription in vitro at least 2-fold more effectively than the adenovirus major late promoter, which indicates that the tef promoter is a strong promoter in mammalian expression systems (Uetsuki et al. , J. Biol. Chem. 264:5191-519 (1989)). Both the human and the A. thaliana tefl promoter (for translation elongation factor EF-l ⁇ ) has been used in an expression system with high efficiency of gene expression (Kim et al , Gene 97:217-223 (1990); Curie et al , Nucl Acid Res. 79: 1305-1310 (1991)).
  • Trichoderma reesei The filamentous fungus Trichoderma reesei is an efficient producer of hydrolases, especially of different cellulose degrading enzymes. Due to its excellent capacity for protein secretion and developed methods for industrial cultivations, Trichoderma is a powerful host for production of heterologous, recombinant proteins in large scale. The efficient production of both homologous and heterologous proteins in fungi relies on fungal promoters.
  • the promoter of the main cellulase gene of Trichoderma, cellobiohydrolase 1 has been used for production of heterologous proteins in Trichoderma grown on media containing cellulose or its derivatives (Harkki et al , Bio/Technology 7:596-603 (1989); Saloheimo etal , Bio/Technology 9:987-990 (1991)).
  • the cbhl promoter cannot be used when the Trichoderma are grown on glucose containing media due to glucose repression of cbhl promoter activity. This regulation occurs at the transcriptional level and thus glucose repression could be mediated through the promoter sequences.
  • Glucose repression in the yeast Saccharomyces cerevisiae has been studied for many years. These studies have however failed, until recently, to identify binding sequences in promoters or regulatory proteins binding to promoters which would mediate glucose repression.
  • the first ever published glucose repressor protein and the binding sequence in eukaryotic cells was published by Nehlin and Ronne (Nehlin, J.O. and Ronne, H. EMBO J. 9:2891-2899 (1990)).
  • This MIG1 protein seems to be responsible of one fifth of the glucose repression of GAL genes in Saccharomyces cerevisiae, other factors still being required to obtain full glucose repression effect (Nehlin, J.O.
  • Trichoderma et al, EMBO J. 70:3373-3377 (1991)).
  • Trichoderma produces less protease activity when grown on glucose.
  • cellulase production is repressed when Trichoderma is grown on glucose, thus allowing for the easier purification of the desired product from the Trichoderma medium.
  • no identification or characterization of any promoter that is highly functional in Trichoderma grown on glucose In addition, no modifications of the normally glucose repressed promoter, the cbhl promoter, have been identified which would allow the use of this strong promoter for expression of heterologous genes in Trichoderma grown on glucose.
  • This invention is first directed to the identification of the motif, the DNA element, that imparts glucose repression onto the Trichoderma cbhl promoter.
  • the invention is further directed to a modified Trichoderma cbhl promoter, such modified promoter lacking such glucose repression element and such modified promoter being useful for the production of proteins, including cellulases, when the host is grown on glucose medium.
  • the invention is further directed to a method for the isolation of genes that are highly expressed on glucose, especially from filamentous fungal hosts such as Trichoderma.
  • the invention is further directed to five such previously undescribed genes and their promoters from Trichoderma reesei.
  • the invention is further directed to specific cloning vectors for
  • Trichoderma containing the above mentioned sequences.
  • the invention is further directed to filamentous fungal strains transformed with said vectors, which strains thus are able to produce proteins such as cellulases on glucose.
  • the invention is further directed to a process for producing cellulases or other useful enzymes on glucose.
  • Figure 1 shows the plasmid pTHNl which carries the tefl promoter and 5' part of the coding region and shows the relevant features of the te 7 gene and the sequenced areas.
  • Figure IA is the nucleotide sequence of the tefl promoter and coding sequence [TEF001; SEQ ID 1]. The promoter sequence stops at base number 1234. The methionine codon of the start site of translation is located at base numbers 1235-1237 and is underlined. The total number of bases shown is 3461.
  • the DNA sequence composition is 850A, 1044C, 860G, 697T, and 10 other.
  • Figure 2 shows the plasmid pEA33 which carries the tefl promoter and the coding region with relevant features.
  • Figure 3 shows the plasmid pTHN3 which carries the promoter and coding region of the clone cDNAl and shows the relevant features.
  • Figure 3 A is the nucleotide sequence of the cDNAl promoter and coding sequence [SEQ ID 2]. The promoter sequence stops at base number 1157. The methionine codon of the start site of translation is located at base numbers 1158-1160 as numbered in Figure 3A and is underlined.
  • Figure 4 shows the plasmid pEAlO which carries the promoter and coding region of the clone cDNAlO and the relevant regions and sequenced areas.
  • Figure 4A is the nucleotide sequence of the cDNAlO promoter and coding sequence [CDNAIOSEQ; SEQ ID 3]. The promoter sequence stops at base number 1522. The methionine codon of the start site of translation is located at base numbers 1523-1525 and is underlined. The total number of bases shown is 2868. The DNA sequence composition is 760A, 765C, 675G and 668T.
  • Figure 5 shows the plasmid pEA12 which carries the clone cDNA12 and relevant features and sequenced areas.
  • Figure 5 A is the nucleotide sequence of the cDNA12 promoter and coding sequence [A12DNA; SEQ ID 4]. The promoter sequence stops at base number 1101. The methionine codon of the start site of translation is located at base numbers 1102-1104 and is underlined. The total number of bases is 2175.
  • the DNA sequence composition is 569A, 602C, 480G, 519T and 5 other.
  • Figure 6A is the nucleotide sequence of the cDNA15 promoter and coding sequence [S ⁇ Q ID 5]. The total number of bases is 2737. The DNA composition is 647A, 695C, 742G, 649T and 4 other.
  • Figure 7 shows plasmid pPL ⁇ 3 which carries the eg/7 cDNA.
  • the sequence of the adaptor molecule [SEQ ID 25] that was constructed to remove the small Sacll and Asp718 fragment from the plasmid so as to construct an exact joint [SEQ ID 26, SEQ ID 27] between the cbhl promoter and the egll signal sequences [SEQ IDs 18 and 16].
  • Figure 7A shows the 1588 bp sequence of the egll cDNA (369A, 527C, 418G and 274T) [SEQ ID 16].
  • Figure 7B shows the sequence of the 745 bp cbhl terminator of pPLE131 (198A, 191C, 177G, and 179T) [SEQ ID 23].
  • Figure 8 shows construction of plasmid pEM-3A and SEQ ID 28.
  • the "A” on the plasmid maps denotes the EGI tail sequence and the "B” denotes the EGI hinge sequence.
  • Figure 9 shows the plasmid pTHNlOOB for expression of the EGIcore under the tefl promoter and SEQ ID 28.
  • Figure 10 shows production of EGIcore from the plasmid pTHNlOOB into the culture medium of the host strain QM9414 analyzed by EGI specific antibodies from a slot blot.
  • Lane 1 pTHN100B-16b, 200 ⁇ l glucose supernatant; lane 2: QM9414, 200 ⁇ l glucose supernatant; lane 3: TBS; lane 4: QM9414, 200 ⁇ l solka floe 1 :500 diluted supernatant; lane 5: QM9414, 200 ⁇ l solka floe 1:5,000 diluted supernatant; lane 6: QM9414, 200 ⁇ l solka floe 1:10,000 diluted supernatant; lane 7: pTHN100B-16b, 200 ⁇ l glucose 1:5 diluted supernatant; lane 8: QM9414, 200 ⁇ l glucose 1:5 diluted supernatant; lane 9: 200 ng EGI protein; lane 10: 100 ng EGI protein; lane 11: 50 ng EGI protein; and lane 12: 25 ng EGI protein.
  • Figure 11 shows Western blotting with EGI specific antibodies of culture medium of the strain pTHN100B-16c grown in whey-spent grain or glucose medium, and of EGIcore purified from the glucose medium.
  • Lane 1 pTNH100B-16c, 10 ⁇ l whey spent grain supernatant
  • lane 2 pTNH100B-16c, 5 ⁇ l whey spent grain supernatant
  • lanes 3-5 EGIcore purified from pTHN100B-16c glucose fermentation
  • lane 6 pTHN100B-16c, 15 ⁇ l glucose fermenter supernatant, concentrated lOOx
  • lane 7 pTHN100B-16c, 7.5 ⁇ l glucose fermenter supernatant, concentrated lOOx
  • lane 8 low molecular weight markers at 94kDa, 67 kDa, 43 kDa, 30 kDa and 20.1 kDa (bands 1-5 starting from lane 8, top of gel).
  • Figure 12 shows Western blotting of culture medium of the strain pTHN100B-16c grown on glucose medium.
  • Lane 1 EGI protein, about 540 ng; lane 2, EGI protein, about 220 ng; lane 3, EGI protein, about 110 ng;
  • lane 4 pTHN100B-16c, 30 ⁇ l glucose fermenter supernatant;
  • lane 5 pTHN100B-16c, 30 ⁇ l glucose fermenter supernatant, concentrated 4.2x;
  • lane 6 low molecular weight markers at 94kDa, 67 kDa, 43 kDa, 30 kDa and 20.1 kDa (bands 1-5 starting from lane 6, top of gel).
  • Figure 13 diagrams the elements of the plasmid pMLO16.
  • Figure 13A is the sequence of the cbhl promoter of plasmid pML016 [SEQ ID18].
  • Figure 13B is the sequence of the T. reesei cbhl terminator on plasmid pML016 and plasmids derived from it [SEQ ID24].
  • Figure 14 shows the expression of -galactosidase on glucose medium in pMLO16del5(l l)-transformants of Trichoderma reesei QM 9414 (A2-F5).
  • Figure 15 shows the restriction map of the plasmid pMLO16del5(l l), which carries the shortened form of the cbhl promoter fused to the lacZ gene and the cbhl terminator.
  • Figure 15A is the sequence of the truncated cbhl promoter [(pMLO16del5(l l)); SEQ ID19]. The polylinker is underlined. The arrow denotes the deletion site.
  • Figure 16 shows the restriction map of the plasmid pMLO17, which carries the shortened form of the cbhl promoter fused to the cbhl chromosomal gene.
  • the restriction sites marked with a superscripted cross " + " are not single sites. There are two additional Ec ⁇ RI sites in the cbhl gene that are not shown.
  • Figure 16A shows the sequence of the Kspl-Xmal fragment (the underlined portion) that contains the chromosomal cbhl gene [SEQ ID 17].
  • Figure 17 shows the expression of CBHI on glucose medium in pMLO17 transformants of Trichoderma reesei QM 9414. A collection of single spore cultures (number and a letter-code) and different control samples are shown.
  • Figure 18 shows specific mutations of mig-like sequences (M) in cbhl promoters of pMI-24, pMI-25, pMI-26, pMI-27 and pMI-28.
  • the promoters shown here were fused to lacZ gene and cbhl terminator as described for pMLO16 (see Figure 13) or pMLO16del0(2) (see Figure 19).
  • the genomic sequence is 5'-CTGGGG and the altered sequence is 5'-TCTAAA.
  • the genomic sequence is 5'-CTGGGG and the altered sequence is 5'-TCTAAA.
  • the genomic sequence is 5 ' -GTGGGG and the altered sequence is 5 ' -TCTAGA.
  • pMLO16delO(2) was used as a starting vector for pMI-25, pMI-26, pMI-27 and pMI-28, pMLO16 for pMI-24.
  • v the polylinker.
  • Figure 18A is the sequence of the altered cbhl promoter of pMI-24 (PMI27PROM) ([SEQ ID20]). The total number of bases is 1776.
  • the sequence composition is 487A, 399C, 434G, and 456T.
  • the polylinker is underlined and the sequence alteration is boxed.
  • Figure 18B is the sequence of the altered cbhl promoter of pMI-27 ([SEQ ID21]).
  • the polylinker is underlined, the arrow denotes the deletion point and the sequence alterations are boxed.
  • Figure 18C is the sequence of the altered cbhl promoter of pMI-28 (PMI28PROM) ([SEQ ID22]).
  • the polylinker is underlined, the arrow denotes the deletion point and the sequence alterations are boxed.
  • the total number of bases is 1776.
  • the sequence composition if 490A, 399C, 430G and 457T.
  • Figure 19 shows the restriction map of the plasmid pMLO16delO(2), which carries the shortened form of the cbhl promoter fused to lacZ gene and the cbhl terminator.
  • Figure 20 shows the expression of ⁇ -galactosidase on indicated medium in Trichoderma reesei QM9414 transformed with pMLO16del0(2), pMI-25, pMI-27, pMI-28, pMLOl ⁇ and pMI-24.
  • Trichoderma especially when Trichoderma are grown on glucose, a method has been developed for the isolation of previously unknown Trichoderma genes which are highly expressed on glucose, and their promoters.
  • the method of the invention requires the use of only one cDNA population of probes.
  • the method of the invention would be useful for the identification of promoter sequences that are active under any desired environmental condition to which a cell could be exposed, and not just to the exemplified isolation of promoters that are capable of expression in glucose medium.
  • environmental condition is meant the presence of a physical or chemical agent, such agent being present in the cellular environment, either extracellularly or intracellularly.
  • Physical agent would include, for example, certain growth temperatures, especially a high or low temperature.
  • Chemical agents would include any compound or mixtures including carbon growth substrates, drugs, atmospheric gases, etc.
  • the organism is first grown under the desired growth condition, such as the use of glucose as a carbon source.
  • Total mRNA is then extracted from the organism and preferably purified through at least a polyA+ enrichment of the mRNA from the total RNA population.
  • a cDNA bank is made from this total mRNA population using reverse transcriptase and the cDNA population cloned into any appropriate vector, such as the commercially available lambda-ZAP vector system (Stratagene).
  • the cDNA is packaged such that it is suitable for infection of any E. coli strain susceptable to lambda bacteriophage infection.
  • the cDNA bank is transferred by standard colony hybridization techniques onto nitrocellulose filters for screening.
  • the bank is plated and plaque lifts are taken onto nitrocellulose.
  • the bank is screened with a population of labelled cDNAs that had been synthesized against the same RNA population from which the cloned cDNA bank was constructed, using stringent hybridization conditions. It should be noted that the genes are not expressed in any way during this selection process. This results in clones hybridizing with varying intensity and the ones showing the strongest signals are picked. Genes that are most strongly expressed in the original population comprise the majority of the total mRNA pool and thus give a strong signal in this selection.
  • the inserts in clones with the strongest signals are sequenced from the 3 'end of the insert using any standard DNA sequencing technique as known in the art. This provides a first identification of each clone and allows the exclusion of identical clones.
  • the frequency with which each desired clone is represented in the cDNA lambda-bank is determined by hybridizing the bank against a clone-specific PCR probe.
  • the desired clones are those which, in addition to having the strongest signals as above, are also represented at the highest frequencies in the cDNA bank, since this implies that the abundancy of the mRNA in the population was relatively high and thus that the promoter for that gene was highly active under the growth conditions.
  • the intensity of the hybridization signal of a specific clone should correlate positively with the frequency with which that clone is found in the cDNA bank.
  • the inserts of the clones selected in this manner may be used as probes to isolate the corresponding genes and their promoters from a chromosomal bank, such as one cloned into lambda as above.
  • the method of the invention is not limited to Trichoderma, but would be using for cloning genes from any host, or from a specific tissue with such host, from which a cDNA bank may be constructed, including, prokaryote (bacterial) hosts, and any eukaryotic host plants, mammals, insects, yeast, and any cultured cell populations.
  • prokaryote bacterial
  • any eukaryotic host plants mammals, insects, yeast, and any cultured cell populations.
  • five genes that express relatively high levels of mRNA in Trichoderma reesei when such Trichoderma are grown on glucose were identified. These genes were sequenced and identified as clone cDNA33, cDNAl, cDNAlO, cDNA12, and cDNA15.
  • genes and their promoters were identified. Such genes and promoters (or portions thereof) may then be subcloned into any desired vector, such as the pSP73 vector (Promega, Madison, WI, USA).
  • the clones containing the genes and their promoters (or parts of them) highly expressed in Trichoderma grown on glucose are represented as follows:
  • Trichoderma translation elongation factor l ⁇ (tefl).
  • four other, new genes have been identified for the first time that are highly expressed on glucose in Trichoderma.
  • tef7 shows a relevant degree of homology to any known protein sequences. All of the genes isolated are also expressed on other carbon sources and would not have been found with the classical method of differential cloning. This shows the importance of the method used in this invention in isolation of the most suitable genes for a specific purpose, such as for isolation of strong promoters for expression on glucose containing medium.
  • the promoter of any of these genes may be operably linked to a sequence heterologous to such promoter, and especially heterologous to the host Trichoderma, for expression of such gene from a Trichoderma host that is grown on glucose.
  • the coding sequence provides a secretion signal for secretion of the recombinant protein into the medium.
  • promoters of the invention allow for the expression of genes from Trichoderma under conditions in which there are no cellulases and relatively few proteases.
  • recombinant genes can be highly expressed on Trichoderma using a glucose-based growth medium.
  • the promoters of the invention while being strongly expressed on glucose (that is, when the filamentous fungal host is grown on medium providing glucose as a carbon and energy source), are not repressed in the absence of glucose. In addition, they are active when the Trichoderma host is grown on carbon sources other than glucose.
  • the glucose promoters of the invention can be used to produce enzymes native to Trichoderma itself, especially of those capable of hydrolysing different kinds of plant material.
  • the fungus does not naturally produce these enzymes and consequently one or more specific hydrolytic enzymes could be produced on glucose medium free from other plant material hydrolyzing enzymes. This would result in an enzyme preparate or enzyme mixtures for specific applications.
  • This invention also describes a method for the modification of the cellobiohydrolase 1 promoter (cbhl) such that the activity of the promoter is retained but the promoter no longer is repressed when cells are grown on glucose-containing medium.
  • cbhl cellobiohydrolase 1 promoter
  • the DNA motif that imparted glucose repression has been identified and removed from this promoter, allowing production of desired proteins whose coding sequences are operably linked to the promoter in suitable hosts, such as Trichoderma.
  • a modified cbhl promoter is termed a derepressed cbhl promoter.
  • any protein, including a cellulase may be produced without production of other plant material hydrolysing enzymes, especially of native cellulases.
  • Isolated glucose promoters or derepressed cbhl promoter can be used for instance to produce separate individual cellulases in hosts grown on glucose without any simultaneous production of other hydrolases such as other cellulases, hemicellulases, xylanases etc. or to produce heterologous proteins in varying growth media.
  • genetic sequences is intended to refer to a nucleic acid molecule (preferably DNA). Genetic sequences that are capable of encoding a protein are derived from a variety of sources. These sources include genomic DNA, cDNA, synthetic DNA, and combinations thereof. The preferred source of genomic DNA is a fungal genomic bank.
  • the preferred source of the cDNA is a cDNA bank prepared from fungal mRNA grown in conditions known to induce expression of the desired gene to produce mRNA or protein.
  • a coding sequence from any host including prokaryotic (bacterial) hosts, and any eukaryotic host plants, mammals, insects, yeasts, and any cultured cell populations would be expected to function (encode the desired protein).
  • Genomic DNA may or may not include naturally occurring introns.
  • genomic DNA may be obtained in association with the 5' promoter region of the gene sequences and/or with the 3' transcriptional termination region. According to the invention however, the native promoter region would be replaced with a promoter of the invention. Such genomic DNA may also be obtained in association with the genetic sequences which encode the 5' non-translated region of the mRNA and/or with the genetic sequences which encode the 3' non-translated region. To the extent that a host cell can recognize the transcriptional and/or translational regulatory signals associated with the expression of the mRNA and protein, then the 5' and/or 3' non-transcribed regions of the native gene, and/or, the 5' and/or 3' non-translated regions of the mRNA may be retained and employed for transcriptional and translational regulation.
  • Genomic DNA can be extracted and purified from any host cell, especially a fungal host cell, which naturally expresses the desired protein by means well known in the art.
  • a genomic DNA sequence may be shortened by means known in the art to isolate a desired gene from a chromosomal region that otherwise would contain more information than necessary for the utilization of this gene in the hosts of the invention.
  • restriction digestion may be utilized to cleave the full-length sequence at a desired location.
  • nucleases that cleave from the 3'-end of a DNA molecule may be used to digest a certain sequence to a shortened form, the desired length then being identified and purified by gel electrophoresis and DNA sequencing.
  • Such nucleases include, for example, Exonuclease III and fi ⁇ /31. Other nucleases are well known in the art.
  • DNA preparations either genomic DNA or cDNA
  • suitable DNA preparations are randomly sheared or enzymatically cleaved, respectively, and ligated into appropriate vectors to form a recombinant gene (either genomic or cDNA) bank.
  • a DNA sequence encoding a desired protein or its functional derivatives may be inserted into a DNA vector in accordance with conventional techniques, including blunt-ending or staggered-ending termini for ligation, restriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Techniques for such manipulations are disclosed by Maniatis, T., (Maniatis, T. et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition, 1988) and are well known in the art.
  • Libraries containing sequences coding for the desired gene may be screened and the desired gene sequence identified by any means which specifically selects for a sequence coding for such gene or protein such as, for example, a) by hybridization with an appropriate nucleic acid probe(s) containing a sequence specific for the DNA of this protein, or b) by hybridization-selected translational analysis in which native mRNA which hybridizes to the clone in question is translated in vitro and the translation products are further characterized, or, c) if the cloned genetic sequences are themselves capable of expressing mRNA, by immunoprecipitation of a translated protein product produced by the host containing the clone.
  • any means which specifically selects for a sequence coding for such gene or protein such as, for example, a) by hybridization with an appropriate nucleic acid probe(s) containing a sequence specific for the DNA of this protein, or b) by hybridization-selected translational analysis in which native mRNA which hybridizes to the clone
  • Oligonucleotide probes specific for a certain protein which can be used to identify clones to this protein can be designed from the knowledge of the amino acid sequence of the protein or from the knowledge of the nucleic acid sequence of the DNA encoding such protein or a related protein.
  • antibodies may be raised against purified forms of the protein and used to identify the presence of unique protein determinants in transformants that express the desired cloned protein.
  • amino acid sequence is listed horizontally, unless otherwise stated, the amino terminus is intended to be on the left end and the carboxy terminus is intended to be at the right end.
  • a nucleic acid sequence is presented with the 5' end on the left.
  • Peptide fragments may be analyzed to identify sequences of amino acids that may be encoded by oligonucleotides having the lowest degree of degeneracy. This is preferably accomplished by identifying sequences that contain amino acids which are encoded by only a single codon.
  • amino acid sequence may be encoded by only a single oligonucleotide sequence
  • amino acid sequence may be encoded by any of a set of similar oligonucleotides.
  • all of the members of this set contain oligonucleotide sequences which are capable of encoding the same peptide fragment and, thus, potentially contain the same oligonucleotide sequence as the gene which encodes the peptide fragment
  • only one member of the set contains the nucleotide sequence that is identical to the exon coding sequence of the gene.
  • this member is present within the set, and is capable of hybridizing to DNA even in the presence of the other members of the set, it is possible to employ the unfractionated set of oligonucleotides in the same manner in which one would employ a single oligonucleotide to clone the gene that encodes the peptide.
  • the genetic code one or more different oligonucleotides can be identified from the amino acid sequence, each of which would be capable of encoding the desired protein.
  • the probability that a particular oligonucleotide will, in fact, constitute the actual protein encoding sequence can be estimated by considering abnormal base pairing relationships and the frequency with which a particular codon is actually used (to encode a particular amino acid) in eukaryotic cells.
  • the suitable oligonucleotide, or set of oligonucleotides, which is capable of encoding a fragment of a certain gene (or which is complementary to such an oligonucleotide, or set of oligonucleotides) may be synthesized by means well known in the art (see, for example, Oligonucleotides and Analogues, A Practical Approach, F. Eckstein, ed., 1992, IRL Press, New York) and employed as a probe to identify and isolate a clone to such gene by techniques known in the art.
  • the above-described DNA probe is labeled with a detectable group.
  • detectable group can be any material having a detectable physical or chemical property. Such materials have been well-developed in the field of nucleic acid hybridization and in general most any label useful in such methods can be applied to the present invention. Particularly useful are radioactive labels, such as 32 P, 3 H, M C, 3S S, ,2S I, or the like. Any radioactive label may be employed which provides for an adequate signal and has a sufficient half-life. If single stranded, the oligonucleotide may be radioactively labelled using kinase reactions.
  • polynucleotides are also useful as nucleic acid hybridization probes when labeled with a non-radioactive marker such as biotin, an enzyme or a fluorescent group.
  • a non-radioactive marker such as biotin, an enzyme or a fluorescent group.
  • oligonucleotide complementary to this theoretical sequence or by constructing a set of oligonucleotides complementary to the set of "most probable" oligonucleotides, one obtains a DNA molecule (or set of DNA molecules), capable of functioning as a probe(s) for the identification and isolation of clones containing a gene.
  • a bank is prepared using an expression vector, by cloning DNA or, more preferably cDNA prepared from a cell capable of expressing the protein into an expression vector. The bank is then screened for members which express the desired protein, for example, by screening the bank with antibodies to the protein.
  • the above discussed methods are, therefore, capable of identifying genetic sequences that are capable of encoding a protein or biologically active or antigenic fragments of this protein.
  • the desired coding sequence may be further characterized by demonstrating its ability to encode a protein having the ability to bind antibody in a specific manner, the ability to elicit the production of antibody which are capable of binding to the native, non- recombinant protein, the ability to provide a enzymatic activity to a cell that is a property of the protein, and the ability to provide a non-enzymatic (but specific) function to a recipient cell, among others.
  • coding sequences In order to produce the recombinant protein in the vectors of the invention, it is desirable to operably link such coding sequences to the glucose regulatable promoters of the invention.
  • a recipient eukaryotic cell preferably a fungal host cell
  • a non-replicating DNA or
  • RNA non-integrating molecule
  • the expression of the encoded protein may occur through the transient (nonstable) expression of the introduced sequence.
  • the coding sequence is introduced on a DNA molecule, such as a closed circular or linear molecule that is incapable of autonomous replica- tion,
  • a linear molecule that integrates into the host chromosome Preferably, a linear molecule that integrates into the host chromosome.
  • Genetically stable transformants may be constructed with vector systems, or transformation systems, whereby a desired DNA is integrated into the host chromosome. Such integration may occur de novo within the cell or, be assisted by transformation with a vector which functionally inserts itself into the host chromosome.
  • the gene encoding the desired protein operably linked to the promoter of the invention may be placed with a transformation marker gene in one plasmid construction and introduced into the host cells by transformation, or, the marker gene may be on a separate construct for co-transformation with the coding sequence construct into the host cell.
  • the nature of the vector will depend on the host organism. In the practical realization of the invention the filamentous fungus Trichoderma has been employed as a model. Thus, for Trichoderma and especially for T. reesei, vectors incorporating DNA that provides for integration of the expression cassette (the coding sequence operably linked to its transcriptional and translational regulatory elements) into the host's chromosome are preferred. It is not necessary to target the chromosomal insertion to a specific site.
  • targeting the integration to a specific locus may be achieved by providing specific coding or flanking sequences on the recombinant construct, in an amount sufficient to direct integration to this locus at a relevant frequency.
  • Cells that have stably integrated the introduced DNA into their chromosomes are selected by also introducing one or more markers which allow for selection of host cells which contain the expression vector in the chromosome, for example the marker may provide biocide resistance, e.g., resistance to antibiotics, or heavy metals, such as copper, or the like.
  • the selectable marker gene can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co- transformation.
  • a genetic marker especially for the transformation of the hosts of the invention is amdS, encoding acetamidase and thus enabling Trichoderma to grow on acetamide as the only nitrogen source.
  • Selectable markers for use in transforming filamentous fungi include, for example, acetamidase (the amdS gene), benomyl resistance, oligomycin resistance, hygromycin resistance, aminoglycoside resistance, bleomycin resistance; and, with auxotrophic mutants, ornithine carbamoyltransferase (OCTase or the argB gene).
  • OCTase or the argB gene auxotrophic mutants
  • the use of such markers is also reviewed in Finkelstein, D.B. in: Biotechnology of Filamentous Fungi: Technology and Products, Chapter 6, Finkelstein, D.B. et al, eds., Butterworth-Heinemann, publishers, Stoneham, MA, (1992), pp. 113-156).
  • the cloned coding sequences obtained through the methods described above, and preferably in a double-stranded form, may be operably linked to sequences controlling transcriptional expression in an expression vector, and introduced into a host cell, either prokaryote or eukaryote, to produce recombinant protein or a functional derivative thereof.
  • a host cell either prokaryote or eukaryote
  • antisense RNA or a functional derivative thereof it is also possible to express antisense RNA or a functional derivative thereof.
  • the present invention encompasses the expression of the protein or a functional derivative thereof, in eukaryotic cells, and especially in fungus.
  • a nucleic acid molecule such as DNA, is said to be "capable of expressing" a polypeptide if it contains expression control sequences which contain transcriptional regulatory information and such sequences are
  • operably linked to the nucleotide sequence which encodes the polypeptide.
  • An operable linkage is a linkage in which a sequence is connected to a regulatory sequence (or sequences) in such a way as to place expression of the sequence under the influence or control of the regulatory sequence.
  • Two DNA sequences are said to be operably linked if induction of promoter function results in the transcription of mRNA encoding the desired protein and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the expression regulatory sequences to direct the expression of the protein, antisense RNA, or (3) interfere with the ability of the DNA template to be transcribed.
  • a promoter region would be operably linked to a DNA sequence if the promoter was capable of effecting transcription of that DNA sequence.
  • regulatory regions needed for gene expression may vary between species or cell types, but shall in general include, as necessary, 5' non-transcribing and 5' non-translating (non-coding) sequences involved with initiation of transcription and translation respectively, such as the TATA box, capping sequence, CAAT sequence, and the like, with those elements necessary for the promoter sequence being provided by the promoters of the invention.
  • Such transcriptional control sequences may also include enhancer sequences or upstream activator sequences, as desired.
  • Expression of a protein in eukaryotic hosts such as fungus requires the use of regulatory regions functional in such hosts, and preferably fungal regulatory systems.
  • a wide variety of transcriptional and translational regu ⁇ latory sequences can be employed, depending upon the nature of the host.
  • these regulatory signals are associated in their native state with a particular gene which is capable of a high level of expression in the host cell.
  • control regions may or may not provide an initiator methionine (AUG) codon, depending on whether the cloned sequence contains such a methionine.
  • AUG initiator methionine
  • Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis in the host cell. Promoters from filamentous fungal genes which encode a mRNA product capable of translation are preferred, and especially, strong promoters can be employed provided they also function as promoters in the host cell.
  • a fusion product that contains a partial coding sequence (usually at the amino terminal end) of a protein and a second coding sequence (partial or complete) of a second protein.
  • the first coding sequence may or may not function as a signal sequence for secretion of the protein from the host cell.
  • the sequence coding for desired protein may be linked to a signal sequence which will allow secretion of the protein from, or the compartmentalization of the protein in, a particular host.
  • Such fusion protein sequences may be designed with or without specific protease sites such that a desired peptide sequence is amenable to subsequent removal.
  • the native signal sequence of a fungal protein is used, or a functional derivative of that sequence that retains the ability to direct the secretion of the peptide that is operably linked to it.
  • Aspergillus leader/secretion signal elements also function in Trichoderma.
  • the non-transcribed and/or non-translated regions 3' to the sequence coding for a desired protein can be obtained by the above-described cloning methods.
  • the 3 '-non-transcribed region may be retained for its transcriptional termination regulatory sequence elements, or for those elements which direct polyadenylation in eukaryotic cells. Where the native expression control sequences signals do not function satisfactorily in a host cell, then sequences functional in the host cell may be substituted.
  • the vectors of the invention may further comprise other operably linked regulatory elements such as DNA elements which confer antibiotic resistance, or origins of replication for maintenance of the vector in one or more host cells.
  • Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species.
  • the DNA construct(s) is introduced into an appropriate host cell by any of a variety of suitable means, including transformation.
  • recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. If this medium includes glucose, expression of the cloned gene sequence(s) results in the production of the desired protein, or in the production of a fragment of this protein as desired. This expression can take place in a continuous manner in the transformed cells, or in a controlled manner, for example, by induction of expression.
  • Fungal transformation is carried out also accordingly to techniques known in the art, for example, using, for example, homologous recombination to stably insert a gene into the fungal host and/or to destroy the ability of the host cell to express a certain protein.
  • Fungi- useful as recombinant hosts for the purpose of the invention include, e.g., Trichoderma, Aspergillus, Claviceps purpurea, Penicillium chrysogenum, Magnaporthe grisea, Neurospora, Mycosphaerella spp. , Collectotrichum trifolii, the dimorphic fungus Histoplasmia capsulatum, Nectia haematococca (anamorph:F « ⁇ ri#rn solani f. sp. phaseoli and f. sp.
  • Ustilago violacea Ustilago maydis, Cephalosporium acremonium, Schizophyllum commune, Podospora anserina, Sordaria macrospora, Mucor circinelloides, and Collectotrichum capsici. Transformation and selection techniques for each of these fungi have been described (reviewed in Finkelstein, D.B. in: Biotechnology of Filamentous Fungi: Technology and Products, Chapter 6, Finkelstein, D.B. et al, eds., Butterworth-Heinemann, publishers, Stoneham, MA, (1992), pp. 113-156). Especially preferred are Trichoderma reesei, T. harzianum, T.
  • the hosts of the invention are meant to include all Trichoderma.
  • Trichoderma are classified on the basis of morphological evidence of similarity. T. reesei was formerly known as T. viride Pers. or T. koningii Oudem; sometimes it was classified as a distinct species of the T. longibrachiatum group.
  • the entire genus Trichoderma in general, is characterized by rapidly growing colonies bearing tufted or pustulate, repeatedly branched conidiophores with lageniform phialides and hyaline or green conidia borne in slimy heads (Bissett, J., Can. J. Bot. 62:924-931 (1984)).
  • T. reesei The fungus called T. reesei is clearly defined as a genetic family originating from the strain QM6a, that is, a family of strains possessing a common genetic background originating from a single nucleus of the particular isolate QM6a. Only those strains are called T. reesei.
  • Trichoderma harzianum acts as a biocontrol agent against plant pathogens.
  • a transformation system has also been developed for this Trichoderma species (Herrera-Estrella, A. et al, Molec. Microbiol. 4:839-843 (1990) that is essentially the same as that taught in the application.
  • Trichoderma harzianum is not assigned to the section Longibrachiatum
  • the method used by Herrera-Estrella in the preparation of spheroplasts before transformation is the same.
  • the teachings of Herrera-Estrella show that there is not a significant diversity of Trichoderma spp. such that the transformation system of the invention would not be expected to function in all Trichoderma.
  • glucose regulated promoters identified herein would be also regulatable by glucose in other fungi. Except for cbhl, it is understood that the glucose regulated promoters of the invention may not be directly regulated by glucose, but rather that they function regardless of its presence. Many species of fungi, and especially Trichoderma, are available from a wide variety of resource centers that contain fungal culture collections.
  • Trichoderma species are catalogued in various databases. These resources and databases are summarized by O'Donnell, K. et al, in Biochemistry of Filamentous Fungi: Technology and Products, D.B. Fingelstein et al, eds., Butterworth-Heinemann, Stoneham, MA, USA, 1992, pp. 3-39.
  • recipient cells After the introduction of the vector and selection of the transformant, recipient cells are grown in a selective medium, which selects for the growth of vector-containing cells. Expression of the cloned gene sequence(s) results in the synthesis and secretion of the desired heterologous or homologous protein, or in the production of a fragment of this protein, into the medium of the host cell.
  • the coding sequence is the sequence of an enzyme that is capable of hydrolysing lignocellulose.
  • examples of such sequences include a DNA sequence encoding cellobiohydrolase I (CBHI), cellobiohydrolase II (CBHII), endoglucanase I (EGI), endoglucanase II (EGII), endoglucanase III (EGIII), /3-glucosidases, xylanases (including endoxylanases and 3-xylosidase), side-group cleaving activities, (for example, a- arabinosidase, ⁇ -D-glucuronidase, and acetyl esterase) , mannanases, pectinases (for example, endo-polygalacturonase, exo-polygalacturonase, pectinesterase, or, pectin and pectin acid lyase), and enzymes of lig
  • the gene for the major endoglucanase (EGI) has also been cloned and characterized (Penttila, M., et al , Gene 45:253-263 (1986); Patent Application EP 137,280; Van Arstel, J.N.V., et al , Bio/Technology 5:60-64).
  • Other isolated cellulase genes include cbhl (Patent Application WO 85/04672; Chen, CM., et al, Bio /Technology 5:274-278 (1987)) and egl3 (Saloheimo, M., et al, Gene 65: 11-21 (1988)).
  • the expressed protein may be isolated and purified from the medium of the host in accordance with conventional conditions, such as extraction, precipitation, chromatography, affinity chromatography, electrophoresis, or the like.
  • the cells may be collected by centrifugation, or with suitable buffers, lysed, and the protein isolated by column chromatography, for example, on DEAE-cellulose, phosphocellulose, polyribocytidylic acid- agarose, hydroxyapatite or by electrophoresis or immunoprecipitation.
  • Trichoderma reesei strain QM9414 (Mandels, M. et al. , Appl. Microbiol. 27: 152-154 (1971)) was grown in a 10 liter fermenter in glucose medium (glucose 60 g/1, Bacto-Peptone 5 g/1, Yeast extract 1 g/1, KH 2 PO 4 4 g/1, (NH 4 ) 2 SO 4 4 g/1, MgSO 4 0.5 g/1, CaCl 2 0.5 g/1 and trace elements FeSO 4 *7H 2 O 5 mg/1, MnSO 4 « H 2 O 1.6 mg/1, ZnSO 4 »7H 2 O 1.4 mg/1, and CoCl 2 « 6H 2 O 3.7 mg/1, pH 5.0-4.0).
  • Glucose feeding (465g/20h) was started after 30 hours of growth. Mycelium was harvested at 45 hours of growth and RNA was isolated according to Chirgwin, J.M. et al , Biochem. J. 78:5294-5299 (1979)). Poly A+ RNA was isolated from the total RNA by oligo(dT)-cellulose chromatography (Maniatis, T. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982)) and cDNA synthesis and cloning of the cDNAs was carried out according to manufacturer's instructions into lambda-ZAP vector (ZAP-cDNA synthesis kit, Stratagene).
  • the cDNA bank was transferred onto nitrocellulose filters and screened with 32 P-labelled single- stranded cDNA synthesized (Teeri, T.T. et al, Anal. Biochem. 764:60-67 (1987)) from the same poly A+ RNA from which the bank was constructed.
  • the labelled cDNA was relabelled with 32 P-dCTP (Random Primed DNA Labeling kit, Boehringer-Mannheim).
  • the hybridization conditions were as described in Maniatis, T. et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982). Fifty clones giving the strongest positive reaction were isolated and the cDNAs were subcloned in vivo into Bluescript SK(-) plasmid according to manufacturer's instructions (ZAP-cDNA synthesis kit, Stratagene).
  • the frequency of each specific clone in the cDNA lambda-bank was determined by hybridizing the bank with a clone specific PCR probe.
  • the clones cDNA33, cDNAl , cDNAlO, cDNA12, cDNA15, showing the five highest frequencies corresponded to 1-3% of the total mRNA pool.
  • cDNAs of the clones cDNA33, cDNAl, cDNAlO, cDNA12, and cDNA15 were used as probes to isolate the corresponding genes and promoters from a Trichoderma chromosomal lambda-bank prepared earlier (Vanhanen, S. et al, Curr. Genet. 75: 181-186 (1989)).
  • Sequences were obtained from the 5' ends of the genes and from the promoters using primers designed from previously obtained sequences.
  • the sequences of the isolated promoters and genes or parts of them are shown in SEQ ID1 for cDNA33, SEQ ID2 for cDNAl, SEQ ID3 for cDNAlO, SEQ ID4 for cDNA12, and SEQ ID5 for cDNA15.
  • SEQ ID1 for cDNA33 SEQ ID2 for cDNAl
  • SEQ ID3 for cDNAlO SEQ ID4 for cDNA12
  • SEQ ID5 for cDNA15
  • the pPEG131 insert sequence is egll cDNA in which a STOP codon is constructed just before the hinge region of the egll gene.
  • the cbhl terminator sequence is Figure 7B [SEQ ID 23].
  • SEQ ID 23 is a shortened cbhl terminator sequence, similar to SEQ ID 24 (the "long" cbhl terminator but lacking 30 nucleotides at the 5' end).
  • pPLE3 contains a pUC18 backbone, and carries the cbhl promoter inserted at the EcoRl site.
  • the cbhl promoter is operably linked to the full length egll cDNA coding sequence and to the cbhl transcriptional terminator.
  • the ori and amp genes are from the bacterial plasmid.
  • the resulting plasmid pEM-3 ( Figure 8) now carries a copy of egll cDNA with a translational stop codon after the egll core region (EGI amino acids 1-22 are the EGI signal sequence; EGI amino acids 23-393, terminating at a Thr, are considered the 'core' sequence).
  • pEM-3 was then digested with Ec ⁇ RI and Sphl and the released Bluescribe M13+ moiety (Vector Cloning Systems, San Diego, USA) of the plasmid was replaced by Ec ⁇ RI and Sphl digested pAMD ( Figure 8) containing a 3.4 kb amdS fragment from plasmid p3SR2 (Hynes, M.J. et al, Mol. Cell. Biol. 3: 1430-1439 (1983); Tilburn, J. et al, Gene 26:205-221 (1983).
  • This resulting plasmid p ⁇ M-3A ( Figure 8) was digested with Ec ⁇ RI and partially with Kspl to release the 2.3 kb fragment carrying the cM7-promotor and the 8.6 kb fragment carrying the rest of the plasmid was purified from agarose gel.
  • SEQ ID1 bases 1-1234 two primers were designed (SEQ ID6 and SEQ 1D7) and used in a PCR reaction to isolate a 1.2 kb promoter fragment adjacent to the translational start site of the tefl gene.
  • the 5' primer was ACCGGAATTCATATCTAGAGGAGCCCGCGAGTTTGGATACGCC (SEQ ID6) and the 3' primer was
  • Trichoderma reesei strain QM9414 was transformed essentially as described (Penttila, M. et al, Gene 67: 155-164 (1987) using 6-10 ⁇ g of the plasmid pTHNlOOB.
  • the Amd + transformants obtained were streaked twice onto slants containing acetamide (Penttila, M. et al. Gene 67: 155-164 (1987)). Thereafter spore suspensions were made from transformants grown on Potato Dextrose agar (Difco).
  • EGI-core production was tested by slot blotting with EGI specific antibody from 50 ml shake flask cultures carried out in minimal medium (Penttila, M. et al.
  • EGI-core producing strain pTHN100B-16c was grown in a 10 liter fermenter in glucose medium as described earlier in Example 1 except that yeast extract was left out and glucose feeding was 555g/22h. The culture supernatant was separated from the mycelium by centrifugation. The secretion of EGI-core by Trichoderma was verified by Western blotting by conventional methods running concentrated culture supematants on SDS-PAGE and treating the blotted filter with monoclonal EGI-core specific antibodies ( Figure 11 and Figure 12).
  • the enzyme activity was shown semiquantitatively in a microtiter plate assay by using the concentrated culture supematants and 3 mM chloronitrophenyl lactocide as a substrate and measuring the absorbance at 405 nm (Clayessens, M. et al., Biochem. J. 267:819-825 (1989).
  • the vector pMLO16 ( Figure 13) contains a 2.3 kb cbhl promoter fragment ([SEQ ID18, Figure 13A) starting at 5' end from the Ec ⁇ RI site, isolated from chromosomal gene bank of Trichoderma reesei (Teeri, T. et al., J.
  • a short 5c7I linker shown in Figure 13 was cloned into the joint between the pBR322 and cbhl promoter fragments so that the expression cassette can be released from the vector by restriction digestion with Sail and Sphl.
  • Progressive unidirectional deletions were introduced to the cM7 promoter by cutting the vector with Kpnl and Xhol and using the ⁇ rase-A-Base System (Promega, Madison, USA) according to manufacturer's instructions. Plasmids obtained from different deletion time points were transformed into the E. coli strain DH5 ⁇ (BRL) by the method described in (Hanahan D., J. Mol. Biol. 766:557-580 (1983)) and the deletion end points were sequenced by using standard methods.
  • Trichoderma reesei strain QM9414 was transformed with expression vectors for ⁇ -galactosidase containing either the intact 2.3 kb cbhl promoter or truncated versions of it, generated as explained in Example 6. Twenty ⁇ g of the plasmids were digested with Sail and Sphl to release the expression cassettes from the vectors and these mixtures were cotransformed to Trichoderma together with 3 ⁇ g of plasmid p3SR2 (Hynes, M.J. et al , Mol. Cell. Biol 3: 1430-1439 (1983)) containing the acetamidase gene. The transformation method was that described in (Penttila, M. et al.
  • the vector part containing the shortened cbhl promoter, the cbhl terminator and the pBR322 sequence was ligated to the chromosomal cbhl gene isolated as a £spI-Xm ⁇ I-fragment from the chromosomal gene bank of Trichoderma reesei (Teeri, T. et al , Bio/Technology 7:696-699 (1983)).
  • the sequence of this fragment is provided as the underlined portion of Figure 16A ([SEQ ID17]).
  • the plasmid pMLO17 was transformed to the Trichoderma reesei strain QM 9414 and the Amd + transformants were screened as described earlier in example 7.
  • CBHI production was tested from 40 transformants in microtiter plate cultures (200 ⁇ l; 3 days) carried out in minimal medium (Penttila, M. et al. Gene 67: 155- 164 (1987) supplemented with 3 % glucose and using additional glucose feeding (total amount of fed glucose was 6 mg/200 ⁇ l culture).
  • the culture supematants were slot blotted on nitrocellulose filters and CBHI was detected with specific antibody.
  • the spore suspensions of the 10 best CBHI producing transformants were purified to single spore cultures on plates containing acetamide and Triton X-100 (Penttila, M. et al, Gene 67: 155-164 (1987)).
  • GAC c SEQID 11
  • GGG AAT TCG
  • GTC ACC TCT AAA
  • TGT GTA ATT TGC CTG
  • pMLOl ⁇ ( Figure 13) was used as a PCR template with the appropriate primers to yield a 770 bp fragment A (primers TAG CGA ATT CTA GGT CAC CTC TAA AGG TAC ccT GCA GCT CGA GCT AG (SEQ ID 14) and GGG AAT TCT CTA GAA ACG CGT TGG CAA ATT ACG GTA CG (SEQ ID 10), beginning at the polylinker at -1500 and ending at -720 upstream of ATG, and a 720 bp fragment B (primers GGG AAT TCT TCT AGA TTG CAG AAG CAC GGC AAA GCC CAC TTA ccc (SEQ ID 13) and GGG AAT TCA TGA TGC GCA GTC CGC GG (SEQ ID 15)), beginning at -720 and ending at Kspl at -16.
  • Fragments A and B were purified from agarose gel and digested with BstEll-Xbal and Xbal-Kspl respectively, ligated to the 7.8 kb fragment of pMLOl ⁇ to produce pMI-24.
  • the resulting cbhl promoter carries a sequence alteration (genomic sequence 5' GTGGGG, altered sequence: 5' TCTAGA) at position -720 to -715 upstream of the translation initiation codon of intact cbhl promoter ( Figure 18).
  • the sequence of the altered cbhl promoter in pMI-24 is provided in Figure 18A and SEQ ID20.
  • Fragment C was purified from agarose gel, digested with SaR-Xbal and ligated to the 7.6 kb SalJ-Xbal fragment of pMLO16delO(2) to produce pMI-25.
  • the cbhl promoter of pMI-25 has a sequence alteration (genomic sequence: 5'GTGGGG, altered sequence: 5TCTAAA) at position -1505-1500 upstream of the translation initiation codon of intact cbhl promoter ( Figure 18).
  • pMLO16delO(2) was used as a PCR template to yield a 750 bp fragment D (primers GGG AAT TCG GTC ACC TCT AAA TGT GTA ATT TGC CTG
  • Fragment D was purified from agarose gel, digested with BstEll-Kspl and ligated to the 7.8 kb BstEll-Kspl fragment of pMI-25 to produce pMI-26.
  • the cbhl promoter of pMI-26 has sequence alterations at positions -1505-1500 (genomic sequence: 5'GTGGGG, altered sequence: 5TCTAAA) and -1001-996 (genomic sequence: 5'CTGGGG, altered sequence: 5TCTAAA) upstream of the translation initiation codon of intact cbhl promoter ( Figure 18).
  • pMLO16delO(2) was used as a PCR template to yield a 280 bp fragment E (primers GGG AAT TCT CTA GAA ACG CGT TGG CAA ATT ACG GTA CG (SEQ ID 10) and GGG AAT TCG GTC ACC TCT AAA TGT GTA ATT TGC CTG CTT GAC C (SEQ ID 11)), beginning from the promoter intemal polylinker and ending at -720 and a 720 bp fragment F (primers GGG AAT TCT TCT AGA
  • the cbhl promoter of pMI-27 has sequence alterations at positions -1505-1500 (genomic sequence: 5'GTGGGG, altered sequence: 5TCTAAA) and -720-715 (genomic sequence: 5'GTGGGG, altered sequence: 5TCTAGA) upstream of the translation initiation codon of intact cbhl promoter ( Figure 18).
  • the sequence of the altered cbhl promoter of pMI-27 is shown in Figure 18C and SEQ ID21.
  • pMLO16delO(2) was used as a PCR template to yield a 280 bp fragment G (primers GGG AAT TCT CTA GAA ACG CGT TGG CAA ATT ACG GTA CG (SEQ ID 10) and GGG AAT TCG GTC ACC TCT AAA TGT GTA ATT TGC CTG CTT GAC CGA TCT AAA CTG TTC GAA GCC CGA ATG TAG G (SEQ ID 12)), beginning from the promoter intemal polylinker and ending at -720 and a 720 bp fragment H (primers GGG AAT TCT TCT AGA TTG CAG AAG CAC GGC AAA GCC CAC TTA ccc (SEQ ID 13) and GGG AAT TCA TGA TGC GCA GTC CGC GG (SEQ ID 15)), beginning at -720 and ending at Kspl at -16.
  • Fragments G and H were purified from agarose gel, digested with BstEII-Xbal and Xbal -Kspl respectively and ligated to the 7.8 kb BstEII-KspI fragment of pMI-25 to produce pMI-28.
  • the cbhl promoter of pMI-28 has sequence alterations at positions -1505-1500 (genomic sequence: 5'GTGGGG, altered sequence: 5TCTAAA), -1001-996 (genomic sequence: 5'CTGGGG, altered sequence: 5TCTAAA), and -720-715 (genomic sequence: 5'GTGGGG, altered sequence: 5TCTAGA) upstream of the translation initiation codon of intact cbhl promoter ( Figure 18).
  • the sequence of the altered cbhl promoter of pMI-28 is shown in Figure 18C and SEQ ID22.
  • CTCCTCCNNN GCATGGGCTG GAACGGGGAA GCCCGCGGCC CGCCGGTCAA GCAGGTCAAG 420 AGGCGGCAGA ACAGGCTCGG CCTCGGCGCC AAGGAGCTCA AGGAGGAAGA GGACCTCGGC 480
  • ACGCCCCTCC TCGACTCTTG GGACATCGTA CGGCAGAGAA TCAACGGATT CACACCTTTG 900
  • GAGAAAGCCC ACAAAGTGTT GATGAGGACC ATTTCCGGTA CTGGGAAAGT TGGCTCCACG 2040
  • AAATCTATTA CCCACAGACG AACGGGAATC GGTGATGAGT GGTTTCTTGT AAGTCAACAT 180
  • CTTCTCCTAC CTCTGGCTCA CCTCTTTCAT CTTCTCCGCG CAGGACTGGA GCAGCGACAA 1500
  • GACBBBBBCC GCGCTCGCAT GGTTCATCTG CTACAACAAC ACAATGACAA TCCGAACCAG 1920
  • AAGTTCGGAC CCATTGGCAG CACCGGCAAC CCTAGCGGCG GCAACCCTCC CGGCGGAAAC 3240
  • ACATTCAAGG AGTATTTAGC CAGGGATGCT TGAGTGTATC GTGTAAGGAG GTTTGTCTGC 1740
  • AGTATTTAGC CAGGGATGCT TGAGTGTATC GTGTAAGGAG GTTTGTCTGC CGATACGACG 1800
  • CTAGTAGCAA CCTGTAAAGC CGCAATGCAG CATCACTGGA AAATACAAAC CAATGGCTAA 960
  • CTAGTAGCAA CCTGTAAAGC CGCAATGCAG CATCACTGGA AAATACAAAC CAATGGCTAA 960
  • CAATGTTGAT ATTGTTCCGC CAGTATGGCT CCACCCCCAT CTCCGCGAAT CTCCTCTTCT 540
  • Ala lie Leu Ala lie Ala Arg Leu Val Ala Ala Gin Gin Pro Gly 15 20 25

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

L'invention se rapporte à un procédé pour l'identification et le clonage de promoteurs qui produisent une expression dans des conditions ambiantes définies, telles que la croissance dans un milieu à base de glucose. Grâce à ce procédé, on peut identifier cinq promoteurs de Trichodermal ayant un fort pouvoir d'expression des séquences de codage fonctionnellement liées, l'un de ces promoteurs étant constitué par le promoteur de T. reesei tef1. L'invention décrit également des promoteurs de cbh1 modifiés, qui sont modifiés pour que le glucose ne réprime plus l'expression à partir de tels promoteurs. L'invention décrit également des vecteurs et des hôtes qui utilisent de tels promoteurs, ainsi que des compositions d'enzymes fongiques uniques provenant de tels hôtes.
PCT/FI1993/000330 1992-08-19 1993-08-19 Promoteurs fongiques actifs en presence du glucose WO1994004673A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP93917824A EP0656943A1 (fr) 1992-08-19 1993-08-19 Promoteurs fongiques actifs en presence du glucose
AU47121/93A AU4712193A (en) 1992-08-19 1993-08-19 Fungal promoters active in the presence of glucose
JP6505947A JPH08500733A (ja) 1992-08-19 1993-08-19 グルコースの存在下で活性的な真菌プロモーター
FI950779A FI950779A (fi) 1992-08-19 1995-02-20 Homepromoottorit, jotka ovat aktiivisia glukoosin läsnäollessa

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US93248592A 1992-08-19 1992-08-19
US932,485 1992-08-19

Publications (1)

Publication Number Publication Date
WO1994004673A1 true WO1994004673A1 (fr) 1994-03-03

Family

ID=25462396

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI1993/000330 WO1994004673A1 (fr) 1992-08-19 1993-08-19 Promoteurs fongiques actifs en presence du glucose

Country Status (5)

Country Link
EP (1) EP0656943A1 (fr)
JP (1) JPH08500733A (fr)
AU (1) AU4712193A (fr)
CA (1) CA2142602A1 (fr)
WO (1) WO1994004673A1 (fr)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5674707A (en) * 1992-12-10 1997-10-07 Gist-Brocades N.V. Production of heterologous proteins in filamentous fungi
WO1998023764A1 (fr) * 1996-11-29 1998-06-04 Röhm Enzyme Finland OY Promoteur de cbh i, tronque et obtenu a partir de trichoderma reesei, et utilisation de celui-ci
EP0952223A1 (fr) * 1996-09-13 1999-10-27 Meiji Seika Kabushiki Kaisha Sequence de regulation des genes de la cellulase cbh1 provenant de trichoderma viride et systeme de production en serie de proteines ou de peptides utilisant une telle sequence
US6001595A (en) * 1996-11-29 1999-12-14 Rohm Enzyme GmbH Promoters and uses thereof
WO2000058342A1 (fr) * 1999-03-25 2000-10-05 Valtion Teknillinen Tutkimuskeskus Procede de separation de proteines
WO2002053758A2 (fr) * 2000-12-29 2002-07-11 Rhein Biotech Gesellschaft für neue Biotechnologische Prozesse und Produkte mbH Procede de fabrication de proteines heterologues dans un champignon homothallique de la famille sordariaceae
WO2002064624A3 (fr) * 2001-02-13 2002-11-21 Valtion Teknillinen Tutkimuskeskus Procede ameliore de production de proteines secretees dans les champignons
ES2200705A1 (es) * 2002-08-14 2004-03-01 Newbiotechnic Sa Elemento regulador que activa la expresion genica en condiciones de baja tension de oxigeno y represion por glucosa.
EP1458867A2 (fr) * 2001-12-13 2004-09-22 Macquarie University Promoteurs de gene
US7375197B2 (en) * 2002-01-14 2008-05-20 Midwest Research Institute Cellobiohydrolase I gene and improved variants
EP2345727A2 (fr) 2004-04-16 2011-07-20 DSM IP Assets B.V. Promoteurs de champignon pour l'expression d'un gène dans une cellule de champignon.
US8268585B2 (en) 1998-10-06 2012-09-18 Dyadic International (Usa), Inc. Transformation system in the field of filamentous fungal hosts
EP2631295A2 (fr) 2007-02-15 2013-08-28 DSM IP Assets B.V. Cellule hôte recombinée pour production de composé dýintérêt
US8551751B2 (en) 2007-09-07 2013-10-08 Dyadic International, Inc. BX11 enzymes having xylosidase activity
WO2013160762A2 (fr) 2012-04-26 2013-10-31 Adisseo France S.A.S. Procédé de production d'acide 2,4-dihydroxybutyrique
WO2013189878A1 (fr) 2012-06-19 2013-12-27 Dsm Ip Assets B.V. Promoteurs permettant d'exprimer un gène dans une cellule
WO2014009432A2 (fr) 2012-07-11 2014-01-16 Institut National Des Sciences Appliquées Micro-organisme modifié pour la production de propane-1,3-diol (pdo)
WO2014009435A1 (fr) 2012-07-11 2014-01-16 Adisseo France S.A.S. Procédé de préparation de 2,4-dihydroxybutyrate
US8637293B2 (en) 1999-07-13 2014-01-28 Alliance For Sustainable Energy, Llc Cellobiohydrolase I enzymes
US8673618B2 (en) 1996-10-10 2014-03-18 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
US8680252B2 (en) 2006-12-10 2014-03-25 Dyadic International (Usa), Inc. Expression and high-throughput screening of complex expressed DNA libraries in filamentous fungi
US9516879B2 (en) 2010-08-26 2016-12-13 Agrosavfe N.V. Chitinous polysaccharide antigen-binding proteins
EP4431609A1 (fr) 2023-03-14 2024-09-18 Adisseo France S.A.S. Procédé d'amélioration de la production et du rendement d'acide 2,4-dihydroxybutyrique

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0137280A1 (fr) * 1983-08-31 1985-04-17 Cetus Oncology Corporation Cellobiohydrolases recombinantes fongueuses
US5108918A (en) * 1988-08-11 1992-04-28 Gist-Brocades Method for identifying and using biosynthetic genes for enhanced production of secondary metabolites

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0137280A1 (fr) * 1983-08-31 1985-04-17 Cetus Oncology Corporation Cellobiohydrolases recombinantes fongueuses
US5108918A (en) * 1988-08-11 1992-04-28 Gist-Brocades Method for identifying and using biosynthetic genes for enhanced production of secondary metabolites

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Biotechnology, Volume 7, June 1989, A. HARKKI et al., "A Novel Fungal Expression System: Secretion of Active Calf Chymosin from the Filamentous Fungsu Trichoderma Reesei", page 596 - page 603, see page 596, column 1, line 22 - column 2, line 31, page 599, column 1, lines 44-49 and the whole document. *
Dialog Information Services, file 357, Dialog Acc. No. 016146, DBA Acc. No. 83-10126, TEERI T. et al.: "The Molecular Cloning of the Major Cellulase Gene from Trichoderma Reesei - Cellobiohydrolase I Gene Isolation Cloning and Characterization", Bio/Technology (1, 8, 696-99) 1983. *

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5674707A (en) * 1992-12-10 1997-10-07 Gist-Brocades N.V. Production of heterologous proteins in filamentous fungi
US5710021A (en) * 1992-12-10 1998-01-20 Royal Gist-Brocades N.V. Production of heterologous proteins in filamentous fungi
EP0952223A1 (fr) * 1996-09-13 1999-10-27 Meiji Seika Kabushiki Kaisha Sequence de regulation des genes de la cellulase cbh1 provenant de trichoderma viride et systeme de production en serie de proteines ou de peptides utilisant une telle sequence
EP0952223A4 (fr) * 1996-09-13 2004-05-12 Meiji Seika Co Sequence de regulation des genes de la cellulase cbh1 provenant de trichoderma viride et systeme de production en serie de proteines ou de peptides utilisant une telle sequence
US8916363B2 (en) 1996-10-10 2014-12-23 Dyadic International (Usa), Inc. Construction of Highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
US8673618B2 (en) 1996-10-10 2014-03-18 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
WO1998023764A1 (fr) * 1996-11-29 1998-06-04 Röhm Enzyme Finland OY Promoteur de cbh i, tronque et obtenu a partir de trichoderma reesei, et utilisation de celui-ci
US6001595A (en) * 1996-11-29 1999-12-14 Rohm Enzyme GmbH Promoters and uses thereof
US8268585B2 (en) 1998-10-06 2012-09-18 Dyadic International (Usa), Inc. Transformation system in the field of filamentous fungal hosts
WO2000058342A1 (fr) * 1999-03-25 2000-10-05 Valtion Teknillinen Tutkimuskeskus Procede de separation de proteines
US7335492B2 (en) 1999-03-25 2008-02-26 Valtion Teknillinen Tutkimuskeskus Process for partitioning of proteins
US7060669B1 (en) 1999-03-25 2006-06-13 Valtion Teknillinen Tutkimuskeskus Process for partitioning of proteins
US8637293B2 (en) 1999-07-13 2014-01-28 Alliance For Sustainable Energy, Llc Cellobiohydrolase I enzymes
WO2002053758A3 (fr) * 2000-12-29 2002-12-05 Rhein Biotech Proz & Prod Gmbh Procede de fabrication de proteines heterologues dans un champignon homothallique de la famille sordariaceae
WO2002053758A2 (fr) * 2000-12-29 2002-07-11 Rhein Biotech Gesellschaft für neue Biotechnologische Prozesse und Produkte mbH Procede de fabrication de proteines heterologues dans un champignon homothallique de la famille sordariaceae
WO2002064624A3 (fr) * 2001-02-13 2002-11-21 Valtion Teknillinen Tutkimuskeskus Procede ameliore de production de proteines secretees dans les champignons
US7517685B2 (en) 2001-12-13 2009-04-14 Macquarie University Gene promoters
EP1458867A4 (fr) * 2001-12-13 2005-08-10 Univ Macquarie Promoteurs de gene
EP1458867A2 (fr) * 2001-12-13 2004-09-22 Macquarie University Promoteurs de gene
US7375197B2 (en) * 2002-01-14 2008-05-20 Midwest Research Institute Cellobiohydrolase I gene and improved variants
ES2200705A1 (es) * 2002-08-14 2004-03-01 Newbiotechnic Sa Elemento regulador que activa la expresion genica en condiciones de baja tension de oxigeno y represion por glucosa.
EP2345727A2 (fr) 2004-04-16 2011-07-20 DSM IP Assets B.V. Promoteurs de champignon pour l'expression d'un gène dans une cellule de champignon.
US8680252B2 (en) 2006-12-10 2014-03-25 Dyadic International (Usa), Inc. Expression and high-throughput screening of complex expressed DNA libraries in filamentous fungi
EP2631295A2 (fr) 2007-02-15 2013-08-28 DSM IP Assets B.V. Cellule hôte recombinée pour production de composé dýintérêt
US8551751B2 (en) 2007-09-07 2013-10-08 Dyadic International, Inc. BX11 enzymes having xylosidase activity
US9516879B2 (en) 2010-08-26 2016-12-13 Agrosavfe N.V. Chitinous polysaccharide antigen-binding proteins
WO2013160762A2 (fr) 2012-04-26 2013-10-31 Adisseo France S.A.S. Procédé de production d'acide 2,4-dihydroxybutyrique
WO2013189878A1 (fr) 2012-06-19 2013-12-27 Dsm Ip Assets B.V. Promoteurs permettant d'exprimer un gène dans une cellule
WO2014009435A1 (fr) 2012-07-11 2014-01-16 Adisseo France S.A.S. Procédé de préparation de 2,4-dihydroxybutyrate
WO2014009432A2 (fr) 2012-07-11 2014-01-16 Institut National Des Sciences Appliquées Micro-organisme modifié pour la production de propane-1,3-diol (pdo)
EP4431609A1 (fr) 2023-03-14 2024-09-18 Adisseo France S.A.S. Procédé d'amélioration de la production et du rendement d'acide 2,4-dihydroxybutyrique
WO2024189069A1 (fr) 2023-03-14 2024-09-19 Adisseo France S.A.S. Procédé pour améliorer la production et le rendement en acide 2, 4 dihydroxybutyrique

Also Published As

Publication number Publication date
JPH08500733A (ja) 1996-01-30
EP0656943A1 (fr) 1995-06-14
AU4712193A (en) 1994-03-15
CA2142602A1 (fr) 1994-03-03

Similar Documents

Publication Publication Date Title
US5989870A (en) Method for cloning active promoters
WO1994004673A1 (fr) Promoteurs fongiques actifs en presence du glucose
Ilmén et al. The glucose repressor gene cre1 of Trichoderma: isolation and expression of a full-length and a truncated mutant form
Ilmén et al. Functional analysis of the cellobiohydrolase I promoter of the filamentous fungus Trichoderma reesei
EP0532533B1 (fr) Procedes de production des preparations d'enzymes par cultivation de trichoderma transformes
JP4922524B2 (ja) 糸状菌の分野における新規発現調節配列および発現産物
SK280670B6 (sk) Vyčistená a izolovaná sekvencia dna, konštrukt, ve
BRPI0716219A2 (pt) Composições e métodos para produção aperfeiçoada de proteína.
JP4563585B2 (ja) ポリペプチドの生成方法において有用な菌類転写活性化因子
EP2576793B1 (fr) Procédé de production améliorée de protéines à partir de champignons filamenteux
US8710205B2 (en) Transcription factor
US20130078674A1 (en) Method for protein production in filamentous fungi
Hauser et al. Purification of the inducible α-agglutinin of S. cerevisiae and molecular cloning of the gene
CN1341149A (zh) 草酰乙酸水解酶缺陷型真菌宿主细胞
JP2002515252A (ja) 糸状菌変異体細胞においてポリペプチドを生産するための方法
US9701970B2 (en) Promoters for expressing genes in a fungal cell
US6326477B1 (en) Process for modifying glucose repression
WO1998023764A1 (fr) Promoteur de cbh i, tronque et obtenu a partir de trichoderma reesei, et utilisation de celui-ci
CN113755509A (zh) 溶血磷脂酶变体及其构建方法和在黑曲霉菌株中的表达
US6001595A (en) Promoters and uses thereof
AU734541B2 (en) Increased production of secreted proteins by recombinant yeast cells
CN113699176A (zh) 高产溶血磷脂酶黑曲霉重组表达菌株的构建及应用
US6534286B1 (en) Protein production in Aureobasidium pullulans
JP2000513223A (ja) 真菌中で発現される異種遺伝子中の陰性スプライス部位の変更
Ma Construction and characterization of Aspergillus niger expression vectors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU MG MN MW NL NO NZ PL PT RO RU SD SE SK UA VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2142602

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 950779

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 1993917824

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1993917824

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993917824

Country of ref document: EP