WO1991019004A1 - Detection specifique du mycobacterium tuberculosis - Google Patents
Detection specifique du mycobacterium tuberculosis Download PDFInfo
- Publication number
- WO1991019004A1 WO1991019004A1 PCT/FR1991/000457 FR9100457W WO9119004A1 WO 1991019004 A1 WO1991019004 A1 WO 1991019004A1 FR 9100457 W FR9100457 W FR 9100457W WO 9119004 A1 WO9119004 A1 WO 9119004A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- sequences
- dna
- primers
- mycobacterium tuberculosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Definitions
- the invention relates to a nucleic acid sequence specific for Mycobacterium tuberculosis, as well as to specific fragments of this sequence capable of playing the role of nucleic primers in the amplification of DNA originating from Mycobacterium in a biological sample.
- the invention also relates to a method for detecting Mycobacterium tuberculosis in a biological sample, this method using said nucleic primers.
- Mycobacteria correspond to the genus Mycobacterium which includes at least 54 different species.
- M. tuberculosis is the agent of tuberculosis.
- tuberculosis For example, an epidemiological study carried out in Florida has shown that 10% of AIDS patients have tuberculosis when they are diagnosed with AIDS or 18 months before it is diagnosed. In these patients, tuberculosis appears in 60% of cases in a disseminated form therefore not identifiable by conventional diagnostic criteria such as chest radiography or sputum analysis.
- tuberculosis and other related mycobacteriosis is difficult to make for various reasons: pulmonary diseases caused by different mycobacteria cannot be distinguished clinically, radiologically or histologically; mycobacteria are often present in small quantities and when they are in a quantity detectable by the conventionally used methods, the disease is already in progress and the patients are contagious to those around them; moreover, because of the very long generation time of these bacteria (24 h for M. tuberculosis compared to 20 min for E. coli), the culture of these organisms is difficult. Thus it takes 6 to 8 weeks to identify the germs and more to obtain an antibiogram usable for the adequate treatment of the patients. The need for a detection test which does not require a culture of the germs and which can be directly used with pathological samples, even when the germs are present at low concentrations therein, is therefore essential.
- Serological techniques may prove useful under certain conditions, but their use is limited by their low sensitivity and / or specificity (DANIEL T.M. et al., Am. Rev. Respir. Dis., 1987, 135, 1137-1151).
- the presence or absence of mycobacteria can also be determined by hybridization with DNA or RNA using probes specific for DNA sequences (KIEHN TE et al., J. Clin. MIcrobiol., 1987, 25, 1551-1552; ROBERTS MC et al., J. Clin. Microbiol., 1987, 25, 1239-1243; DRAKE TA et al., J. Clin. Microbiol., 1987, 25, 1442-1445).
- these methods are based on the polymorphism of the nucleotide sequences of the fragments used or on the polymorphism of the surrounding regions and also require the culture of the microorganisms.
- THIERRY et al. (Nucl. Acid Res., Vol. 18 no. 1, p 188) have described a specific sequence of the Mycobacterium tuberculosis complex and named IS 6110. The authors propose to use this sequence as a nucleic probe in the detection of Mycobacterium tuberculosis.
- PATEL et al. J. Clin., Microbiol., Mar. 1990, 513-518
- PATEL et al. J. Clin., Microbiol., Mar. 1990, 513-518
- the length of the fragments obtained using these primers was different from the expected theoretical length, and several fragments of variable size were obtained.
- the authors observed the absence of hybridization of the amplified products with the plasmid used to determine the primers. These results indicate that these primers would not be suitable for detecting the presence of M. tuberculosis in a biological sample and confirm the critical nature of the choice of primers.
- the object of the present invention is to provide a method of detecting M. tuberculosis which is specific, sensitive and reliable, and which does not require a prior culture of mycobacteria.
- the invention relates to a nucleic acid fragment derived from the genome of Mycobacterium tuberculosis, characterized in that it comprises one of the sequences I, II, III and IV, defined as follows:
- sequence II a sequence comprising at least 10 consecutive bases of one of the sequences A to H and having a total length of approximately 20 to 40 bases;
- sequence III a sequence having a length of 20 to 40 bases which hybridizes with sequence I or with sequence II, and which preferably has at least 80% homology with these;
- the invention also relates to a pair of nucleic acid fragments derived from the genome of Mycobacterium tuberculosis and capable of playing the role of nucleic primers in the amplification of DNA from said Mycobacterium in a biological sample, characterized in that it consists of two sequences selected from sequences I to IV according to claim 1.
- the inventors have identified this series of nucleic acid fragments capable of playing the role of primers from the sequence IS 6110 (Nucl. Acid. Res. Vol 18 no 1, 1990) and sequences which adjoin the sequence IS 6110 in the genome of M. tuberculosis. The latter have been identified in the context of this invention by the inventors.
- the sequence IS 6110 described in Nucl. Acid., Res., Vol. 18 No. 1, 1990, is part of the sequence shown in Figure 6. More specifically, the sequence IS 6110 extends from bases 327 to 1687 of the sequence of Figure 6.
- the primers of the invention have essential characteristics to allow their use in the selective amplification of M. tuberculosis DNA, namely the absence of homology with the human genome and the absence of amplification of related sequences. and likely to be present in the biological sample (for example the sequence of E. coli IS 3411).
- the inventors have found that the results obtained using the primers of the invention are very reliable insofar as the length of the fragments obtained corresponds to the theoretical length expected and are of a constant length and not variable. This is true even for the pairs of primers which lead to the amplification of very long fragments (of the order of 1000 to 1500 bases) where the risk of interruption of the polymerization is very high due to the effects of the structure. secondary of the sequence.
- FIG. 6 illustrates the positions of the primers A to H with respect to the entire sequence.
- Figure 7 shows the sequence restriction map of Figure 6.
- the pair of primers is chosen, from sequences I to IV, so that the amplification product has a length between approximately 100 and 300 nucleotides, for example between 100 and 200 or so. Couples in which the positive primer consists of the sequence A and the negative primer consists of one of the sequences B, C and D, are particularly preferred. Another particularly preferred pair of primers is that of which the positive primer consists of the sequence H and the negative primer consists of the sequence complementary to the sequence G.
- the primers of the invention can also consist of a sequence II which has a length of 20 to 40 bases and which comprises at least 10 consecutive bases of one of the sequences A to H.
- a sequence II which has a length of 20 to 40 bases and which comprises at least 10 consecutive bases of one of the sequences A to H.
- fragments of one of the sequences A to H having between 20 and 30 bases, or alternatively, one of the sequences A to H to which linkers have been added, for example an EcoRI linker, GAAT. It is particularly preferred to use primers whose first 5 nucleotides on the 3 ′ side are 100% homologous to those present in the corresponding part of the sequence to be amplified.
- sequence III having a length of 20 to 40 bases which hybridizes under stringent conditions with the sequence I or II.
- This type of sequence generally has at least 80% homology with the sequence to which it hybridizes. In this way, it is possible to substitute certain bases of the sequences A to H with other bases or to add bases to the ends of the sequences A to H.
- the stringent conditions are those normally used in the art.
- sequences IV which are sequences complementary to one of the sequences I, II or III, for example complementary to one of the sequences A to H.
- the invention also relates to a method for detecting the presence of Mycobacterium tuberculosis in a biological sample, characterized by the following steps:
- primers nucleic acid fragments
- the biological sample can be any sample that may contain M. tuberculosis, for example sputum, urine, blood. Normally the samples undergo a processing in order to extract the DNA and make it accessible for hybridization. These treatments are known in the art.
- the conditions applied during amplification can be as follows:
- the demonstration of the amplification can be carried out by gel electrophoresis, for example on agarose gel colored with ethidium bromide.
- a nucleic probe said probe comprising at least part of the sequence.
- Such probes are plasmids pMT01, containing bases 1 to 1152 of the sequence of Figure 6 and plasmid pMT02, containing bases 309 to 1219 of said sequence.
- Other suitable probes would be any probe having a length of at least 20 bases, capable of hybridizing under stringent conditions with a part of the sequence IS 6110 lying between the two primers chosen.
- Particularly preferred probes are the following sequences J, K, L, M:
- 1 x SSC corresponds to 0.15 M NaCl and 0.05 M Na citrate and a solution 1 x Denhardt's corresponds to 0.02% Ficoll, 0.02% polyvinylpyrrolidone and 0.02% bovine serum albumin.
- the amplification according to the invention is specific to the DNA of the Mycobacterium tuberculosis complex (see for example Figures 1A and B).
- the amplification observed with the DNA of M. bovis-BCG, M. bovis and M. microti does not diminish the advantage of the method since these mycobacteria are not likely to be present in the sample d human origin.
- Mr. Bovis is responsible for tuberculosis in cattle and Mr. Microti is the causative agent of tuberculosis in rodents.
- the primers of the invention does not lead to any amplification of DNA from other types of Mycobacteria such as M. fortiutum, M. gordonae, M. avium, etc ...
- the primers of the invention do not amplify DNA of human or bacterial origin (for example E. Coli). This is illustrated in figure 2.
- the invention also relates to a kit or kit for detecting the presence of Mycobacterium tuberculosis in a biological sample, characterized in that it comprises the following elements:
- the invention also relates to the entire sequence illustrated in FIG. 6.
- the inventors have found that this sequence contains two open reading frames, one of which resembles a gene coding for a transposase.
- pair of primers # 1 positive primer 5 '- CCCGCGGCAAAGCCCGCAGGACCACGATCG - 3' negative primer: 5 '- CGACCCGCCAGCCCAGGATCCIGCGAGCGT - 3' length of the amplified fragment excluding primers: 141
- primers no2 positive anterior 5 '- CCCGCGGCAAAGCCCGCAGGACCACGATCG - 3' negative primer: 5 '- GGCGGGTCCAGATGGCTTGCTCGATCGCGT - 3' length of the amplified fragment excluding primers: 201
- primers no3 positive primer 5 '- CCCGCGGCAAAGCCCGCAGGACCACGATCG - 3' negative primer: 5 '- GTTGGCGGGTCCAGAT GGCTTGCTCGATCG - 3 length of the amplified fragment excluding primers: 204 probes of couple n ° 3
- Example 2 verification of the specificity of the primers compared to other types of Mycobacteria.
- the specificity of the primers was verified using DNA from different bacterial species belonging to the genus Mycobacterium.
- the total DNA from samples of different types of Mycobacteria is subjected to an amplification by the "Polymerase Chain Reaction” technique (P.C.R.) using the pair of primers No. 1 indicated in Example 1.
- P.C.R. Polymerase Chain Reaction
- the amplification products are analyzed by agarose gel electrophoresis and staining with ethidium bromide.
- FIG. 1A shows the results.
- the channels indicated in FIG. 1A correspond to the following samples:
- FIG. 1B shows the results obtained when the plasmid pMT02 (labeled with AAF according to Kourilsky et al, French patent application 8124131) was used as a probe on the amplification products obtained in this example.
- the construction of the plasmid pMT02 is described in Example 6.
- Human DNA can contaminate the samples to be analyzed.
- the amplification technique described in Example 2 is applied to samples of total DNA in the presence of the primer couple No. 1.
- the amplification is carried out by the polymerase chain reaction (PCR) technique according to Saiki et al (Science, 1988, 239, 487-491) using 12.5 pmol of the oligonucleotides (primer couple n ° 1) and d DNA biological samples with 2 U of Taq polymerase in a 50mM KCl buffer, 10mM Tris-HCl pH8.3, 2.4mM MgCl 2 , 300 ⁇ M deoxyribonucleotides and 100 ⁇ g / ml of gelatin. The final volume of the reaction is 100 ⁇ l.
- the parameters of the PCR steps were chosen as follows: 1 min at 94oC, 1 min at 50oC, 1 min at 72oC for 40 cycles.
- Figure 3 shows the results of the agarose gel analysis after P.C.R. of these samples. Lanes 1 to 11 correspond to biological samples from 11 different people. These results were verified by direct reading under a microscope and confirmed the results obtained by amplification.
- the amplified bands are visualized under UV.
- Example 5 Analysis on agarose gel of M. tuberculosis DNA amplified with different pairs of oligonucleotides.
- the amplified bands are visualized under UV.
- the plasmid pMT02 was constructed by cloning into the vector pUC18 of a fragment of 900 base pairs Hind III / Bam HI originating from the sequence IS 6110 (fragment which corresponds to bases 309 to 1219 of the sequence illustrated in FIG. 6) .
- the plasmid pMT02 can be used as a probe when verifying the amplified sequences.
- the specificity of pMT02 was determined by Southern blot after complete digestion of different mycobacterial DNAs with Bam HI.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP91510731A JPH05507617A (ja) | 1990-06-08 | 1991-06-07 | 結核菌の特異的検出 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR90/07192 | 1990-06-08 | ||
| FR9007192A FR2663033B1 (fr) | 1990-06-08 | 1990-06-08 | Detection specifique du mycobacterium tuberculosis. |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1991019004A1 true WO1991019004A1 (fr) | 1991-12-12 |
Family
ID=9397443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR1991/000457 Ceased WO1991019004A1 (fr) | 1990-06-08 | 1991-06-07 | Detection specifique du mycobacterium tuberculosis |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP0461045B1 (https=) |
| JP (1) | JPH05507617A (https=) |
| AT (1) | ATE142702T1 (https=) |
| CA (1) | CA2084894A1 (https=) |
| DE (1) | DE69121975T2 (https=) |
| DK (1) | DK0461045T3 (https=) |
| ES (1) | ES2093688T3 (https=) |
| FR (1) | FR2663033B1 (https=) |
| GR (1) | GR3021781T3 (https=) |
| WO (1) | WO1991019004A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5776693A (en) * | 1990-06-08 | 1998-07-07 | Institut Pasteur | Specific detection of the mycobacterium tuberculosis |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7009041B1 (en) | 1989-07-11 | 2006-03-07 | Gen-Probe Incorporated | Oligonucleotides for nucleic acid amplification and for the detection of Mycobacterium tuberculosis |
| CA2020958C (en) * | 1989-07-11 | 2005-01-11 | Daniel L. Kacian | Nucleic acid sequence amplification methods |
| US5766849A (en) * | 1989-07-11 | 1998-06-16 | Gen-Probe Incorporated | Methods of amplifying nucleic acids using promoter-containing primer sequence |
| WO1993022330A1 (en) * | 1992-04-28 | 1993-11-11 | Gen-Probe Incorporated | NUCLEIC ACID PROCESS PROBES TO $i(MYCOBACTERIUM TUBERCULOSIS) |
| JP4137996B2 (ja) * | 1992-05-06 | 2008-08-20 | ジェン−プローブ・インコーポレイテッド | 核酸配列増幅方法,組成物及びキット |
| GB9301776D0 (en) * | 1993-01-29 | 1993-03-17 | Univ Alberta | Method for detecting genomic variation |
| CA2163393C (en) * | 1994-11-30 | 2003-04-22 | Colleen Marie Nycz | Amplification and detection of mycobacteria nucleic acids |
| US5925518A (en) * | 1995-05-19 | 1999-07-20 | Akzo Nobel N.V. | Nucleic acid primers for amplification of a mycobacteria RNA template |
| US5731150A (en) * | 1995-11-01 | 1998-03-24 | Chiron Diagnostic Corporation | IS6110 based molecular detection of mycobacterium tuberculosis |
| FR2767337B1 (fr) | 1997-08-14 | 2002-07-05 | Pasteur Institut | Sequences nucleiques de polypeptides exportes de mycobacteri es, vecteurs les comprenant et applications au diagnostic et a la prevention de la tuberculose |
| FR2791067B1 (fr) * | 1999-03-16 | 2003-01-31 | Pasteur Institut | Sequence deletees chez m.bovis bcg/m.ou m.tuberculosis, procede de detection des mycobacteries utilisant ces sequences et vaccins |
| CN1491285A (zh) * | 2000-12-26 | 2004-04-21 | �����﹤����ʽ���� | 致病微生物的检测方法 |
| US8044184B2 (en) | 2004-04-26 | 2011-10-25 | Wako Pure Chemical Industries, Ltd. | Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith |
| US20080206776A1 (en) | 2005-09-05 | 2008-08-28 | Bio-Rad Pasteur | Use of Both Rd9 and Is6110 as Nucleic Acid Targets for the Diagnosis of Tuberculosis, and Provision of Multiplex-Compliant Is6110 and Rd9 Targets |
| SG10201403780WA (en) * | 2009-07-03 | 2014-10-30 | Agency Science Tech & Res | Method and/or primers for the detection of mycobacterium tuberculosis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990010085A1 (en) * | 1989-02-22 | 1990-09-07 | Cogent Limited | Probes, kits and methods for the detection and differentiation of mycobacteria |
| FR2651505A1 (fr) * | 1989-09-06 | 1991-03-08 | Pasteur Institut | Fragments d'acides nucleiques derives d'un genome de mycobacterie appropriee, leurs applications dans le diagnostic des infections a mycobacteries et plasmides contenant lesdits fragments. |
-
1990
- 1990-06-08 FR FR9007192A patent/FR2663033B1/fr not_active Expired - Lifetime
-
1991
- 1991-06-07 CA CA002084894A patent/CA2084894A1/fr not_active Abandoned
- 1991-06-07 EP EP91401501A patent/EP0461045B1/fr not_active Expired - Lifetime
- 1991-06-07 WO PCT/FR1991/000457 patent/WO1991019004A1/fr not_active Ceased
- 1991-06-07 JP JP91510731A patent/JPH05507617A/ja active Pending
- 1991-06-07 DK DK91401501.1T patent/DK0461045T3/da active
- 1991-06-07 ES ES91401501T patent/ES2093688T3/es not_active Expired - Lifetime
- 1991-06-07 AT AT91401501T patent/ATE142702T1/de not_active IP Right Cessation
- 1991-06-07 DE DE69121975T patent/DE69121975T2/de not_active Expired - Lifetime
-
1996
- 1996-11-27 GR GR960403179T patent/GR3021781T3/el unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990010085A1 (en) * | 1989-02-22 | 1990-09-07 | Cogent Limited | Probes, kits and methods for the detection and differentiation of mycobacteria |
| FR2651505A1 (fr) * | 1989-09-06 | 1991-03-08 | Pasteur Institut | Fragments d'acides nucleiques derives d'un genome de mycobacterie appropriee, leurs applications dans le diagnostic des infections a mycobacteries et plasmides contenant lesdits fragments. |
Non-Patent Citations (4)
| Title |
|---|
| International Journal of Leprosy, volume 56, no. 4, décembre 1988 (US) P.P. Reddi et al.: "Repetitive DNA sequence of Mycobacterium tuberculosis: analysis of differential hybridization pattern with other mycobacteria", pages 592-598, voir l'article en entier * |
| Journal of Clinical Microbiology, volume 28, no. 3, mars 1990, American Society for Microbiology; R.J. Patel et al.: "Sequence analysis and amplification by polymerase chain reaction of a cloned DNA fragment for identification of Mycobacterium tuberculosis", pages 513-518 (cité dans la demande) * |
| Nucleic Acids Research, volume 18, no. 1, 11 janvier 1990, Oxford University Press, D. Thierry et al.: "IS6110, an IS-like element of Mycobacterium tuberculosis complex", page 188, voir l'article en entier (cité dans la demande) * |
| The Journal of General Microbiology, volume 135, no. 9, septembre 1989, SGM, Z.F. Zainuddin et al.: "Polymorphic repetitive DNA sequences in Mycobacterium tuberculosis detected with a gene probe from a Mycobacterium fortuitum plasmid", pages 2347-2355, voir l'article en entier particulièrement la discussion * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5776693A (en) * | 1990-06-08 | 1998-07-07 | Institut Pasteur | Specific detection of the mycobacterium tuberculosis |
Also Published As
| Publication number | Publication date |
|---|---|
| EP0461045B1 (fr) | 1996-09-11 |
| FR2663033B1 (fr) | 1992-09-04 |
| HK1000072A1 (en) | 1997-11-14 |
| ATE142702T1 (de) | 1996-09-15 |
| DK0461045T3 (https=) | 1997-02-17 |
| JPH05507617A (ja) | 1993-11-04 |
| GR3021781T3 (en) | 1997-02-28 |
| ES2093688T3 (es) | 1997-01-01 |
| DE69121975T2 (de) | 1997-03-27 |
| FR2663033A1 (fr) | 1991-12-13 |
| DE69121975D1 (de) | 1996-10-17 |
| EP0461045A1 (fr) | 1991-12-11 |
| CA2084894A1 (fr) | 1991-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0461045B1 (fr) | Détection spécifique du mycobacterium tuberculosis | |
| FR2694754A1 (fr) | Fragments d'ADN de mycobactéries, amorces d'amplification, sondes d'hybridation, réactifs et procédé de détection de détection de mycobactéries. | |
| EP0490951B1 (fr) | Fragments d'acides nucleiques derives d'un genome de mycobacterie appropriee, leurs applications dans le diagnostic des infections a mycobacteries et plasmides contenant lesdits fragments | |
| WO1995003412A2 (fr) | Fragment nucleotidique de l'arn ribosomique 23s de mycobacteries, sondes et amorces derivees, reactif et procede de detection | |
| FR2701028A1 (fr) | Séquences oligonucléotidiques hybridant spécifiquement avec une séquence génonique de campylobacter jejuni. Applications comme sondes et amorces oligonucléotidiques. | |
| EP0943010B1 (fr) | Procede de mise en evidence de contaminants microbiologiques vivants dans un echantillon de produit a usage alimentaire | |
| FR2694768A1 (fr) | Séquences d'oligonucléotides pour la détection spécifique de mollicutes par amplication de gènes conservés. | |
| EP0612356B1 (fr) | Sequences nucleotidiques hybridant specifiquement avec les souches bacteriennes du complexe mycobacterium avium-intracellulare | |
| EP0577523B1 (fr) | Fragment de l'ADN génomique de Streptococcus pneumoniae, sonde d'hybridation, amorce d'amplification, réactif et procédé de détection de Streptococcus pneumoniae | |
| FR2651505A1 (fr) | Fragments d'acides nucleiques derives d'un genome de mycobacterie appropriee, leurs applications dans le diagnostic des infections a mycobacteries et plasmides contenant lesdits fragments. | |
| EP0918854B1 (fr) | Fragments d'acides nucleiques specifiques de mycobacteries membres du complexe m. tuberculosis) et leurs applications pour la detection et le diagnostic differentiel des membres du complexe m. tuberculosis | |
| JPH10500011A (ja) | 直列変異反復配列オリゴタイピングによる結核菌群細菌の検出および鑑別 | |
| US5776693A (en) | Specific detection of the mycobacterium tuberculosis | |
| EP0643776B1 (fr) | Sequences nucleotidiques issues de genes codant des pectate-lyases, et leurs utilisations notamment pour la detection de bacteries du genre erwinia | |
| EP1430148A2 (fr) | Procede de determination de l'existence de melanges d'origines animales ou vegetales dans des substrats organiques | |
| FR2659086A1 (fr) | Fragments nucleotidiques caracteristiques de fragments d'adn de mycobacteries. leur utilisation comme amorce pour la detection d'une infection due a des mycobacteries. | |
| CA3166316A1 (fr) | Procede de pcr multiplexe pour la detection de microorganismes et son utilisation | |
| FR2857375A1 (fr) | Procede de detection et/ou d'identification de bacteries de genre staphylococcus | |
| WO1996000299A1 (fr) | Fragments d'acides nucleiques, derives du genome de mycobacterium xenopi et leurs applications | |
| FR2616804A1 (fr) | Sonde d'adn destinee a la detection de listeria monocytogenes, kit analytique et methode permettant d'effectuer cette detection | |
| FR2648476A1 (fr) | Acide nucleique et oligonucleotide en derivant, constituant des sondes nucleotidiques specifiques de plasmodium falciparum, et leur application pour la detection par hybridation de l'adn de plasmodium falciparum | |
| Lukey | Investigation of DNA sequences unique to mycobacterium bovis | |
| WO1997016563A1 (fr) | Sequences nucleotidiques pour la detection des erwinia carotovora subsp. atroseptica | |
| HK1000072B (en) | Specific detection of mycobacterium tuberculosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2084894 Country of ref document: CA |