WO1990008823A1 - Somatotropin analogs - Google Patents

Somatotropin analogs Download PDF

Info

Publication number
WO1990008823A1
WO1990008823A1 PCT/US1989/005445 US8905445W WO9008823A1 WO 1990008823 A1 WO1990008823 A1 WO 1990008823A1 US 8905445 W US8905445 W US 8905445W WO 9008823 A1 WO9008823 A1 WO 9008823A1
Authority
WO
WIPO (PCT)
Prior art keywords
bst
somatotropin
serine
mammalian
vector
Prior art date
Application number
PCT/US1989/005445
Other languages
English (en)
French (fr)
Inventor
Alan J. Parcells
John E. Mott
Che-Shen C. Tomich
Original Assignee
The Upjohn Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Upjohn Company filed Critical The Upjohn Company
Publication of WO1990008823A1 publication Critical patent/WO1990008823A1/en
Priority to DK140491A priority Critical patent/DK140491A/da

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/61—Growth hormone [GH], i.e. somatotropin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to analogs of animal somatotro ins. More specifically, the invention relates to bovine somatotropin analogs. BACKGROUND OF THE INVENTION
  • Somatotropins were originally discovered in pituitary gland extracts from various animal species. In general, somatotropins are conserved molecules and similarities in a ino acid sequences and structure are found between different species of animals. Bovine somatotropin (or growth hormone) has been well studied. The litera ⁇ ture was reviewed by Paladini, A.C. et al., CRC Crit. Rev. Biochem. 15:25-56 (1983).
  • Somatotropins including bovine somatotropin, are globular proteins comprising a single chain of approximately 200 amino acids, having two intramolecular disulfide bonds.
  • bovine somatotropin bSt
  • the most common form of natural bovine somatotropin (bSt) has a single 190-191 amino acid chain, a globular structure with two intramolecular disulfide bonds and a molecular weight of about 22,000 daltons.
  • Natural bSt extracted from pituitary glands is, however, - a heterogeneous mixture of proteins. At least six major forms of the protein have been described. The longest form has 191 amino acid residues and an ala-phe amino terminus. The second form has 190 amino acid residues and a phe amino terminus. The third form has 187 amino acid residues and a met amino terminus. The remaining three forms of bSt substitute valine for leucine at position 127. In addition to this heterogeneity, undefined heterogeneity of bSt has also been described (Hart, I.C. et al., Biochem. J. 218:573-581 (1984); Wallace, M. and Dickson, H.B.F. , Biochem.
  • bSt has two such disulfide bridges in the native state.
  • bSt contains four cysteine residues located at amino acid positions 53, 164, 181 and 189 of mature bSt. The first two form a disulfide bond which generates the so-called large loop while the latter two form the small loop of bSt.
  • the recombinant bovine somatotropin (rbSt) protein produced in E. coli is in a reduced form and requires in the isolation protocol an oxidation step to form the disulfide bridges. It has been observed that reducible dimeric and polymeric forms of the protein are formed.
  • Dimer has been shown to have reduced biopotency in the rat bioassay and reduced milk production in dairy cows.
  • the dimeric rbSt may also be antigenic.
  • the present invention overcomes these problems by eliminating the disulfide bridges, in particular, between cysteines 181 and 189.
  • M. Schleyer, et al, Hoppe-Seyler's Z. Physiol. Chem. , 364, p. 291 (1983) described studies in which the disulfide bridges of porcine growth hormone were cleaved by a variety of techniques with retention of biological activity.
  • M. Schleyer, et al, Hoppe-Seyler's Z. Physiol. Chem., 363, p. 1111 (1982) refer to cleavage of the disulfide bridges of human growth hormone without completely abolishing biological activity.
  • U.S. patent 3,264,186 describes the limited cleavage of bovine growth hormone at ethionine to produce an active protein.
  • This invention relates to the enhancement of bioactivity, processability, and product uniformity of animal somatotropins having a cysteine to serine change in amino acids in at least one of positions 53, 164, 181 and 189 as exemplified in bSt (cys -» ser) and similar changes in somatotropins from other species including porcine and ovine.
  • the invention relates to mammalian somato ⁇ tropins in which at least one of the cysteine residues corresponding to residues 53, 164, 181 and 189 is replaced with serine. More specifically disclosed are mammalian somatotropins in which both cysteine residues corresponding to residues 181 and 189 are replaced with serine.
  • animal somatotropins in which the cysteine residue corresponding to residue 181 is replaced with serine or in which the cysteine residue corresponding to residue 189 is replaced with serine. More specifically, the animals are mammals, even more specifically bovines.
  • animal somatotropins wherein at least one cysteine residue at position 53 or 164 is replaced with serine, more specifically, wherein the cysteine residue 53 is replaced with serine, and more specifically wherein the cysteine residue 164 is replaced with serine. More specifically, the animals are mammals, even more specifically bovines.
  • Also provided are methods for enhancing the growth of animals that comprises treatment of the animals with an effective amount of one of the disclosed animal somatotropins, specifically wherein the animal is a mammal, more specifically, wherein the mammal is a bovine.
  • Also provided are methods for increasing milk production in a female ruminant comprising the administration of an effective amount of a animal somatotropin of this invention, more specifically, wherein the ruminant is a dairy cow and wherein the somatotropin is bSt.
  • vectors comprising DNA coding for an animal somatotropin having at least one of the cysteine residues correspond- ing to residues 53, 164, 181 and 189 changed to serine, specifically which are capable of directing the expression of the somatotropin- like protein.
  • microorganisms hosting said vectors specifi ⁇ cally from the bacterial genus, Escherichia. Both chemical and genetic modifications of these amino acid residues are embraced by this invention.
  • Chart 1 illustrates one species of bSt and the amino acid numbering that corresponds to the modification sites of this invention. The numbering for other somatotropins may differ. However, using the cysteines numbered 53, 164, 181 and 189 of the bSt in Chart 1, those of ordinary skill in the art can readily locate corresponding amino acid sequences in other native animal somatotropins, or their analogs, to achieve the desired enhanced bioactivity, processability and product uniformity.
  • closest-related native somatotropin refers to the naturall -occurring form of animal somatotropin which when compared to a specific somatatropin analog of the instant invention is more closely identical in amino acid sequence than any other naturally- occurring form of animal somatotropin.
  • the bSt of Chart 1 is the "closest-related native somatotropin” to an analog wherein the cysteine at position 53 is replaced with serine.
  • somatotropin-like protein refers to both native forms of somato ⁇ tropins and to analogs of native somatotropins provided that the analogs have sufficient protein identity with their parent compounds to have bioactivity as either a growth promoter or as a stimulant for milk production.
  • animal somatotropin refers to somatotropins originating from animals and includes somatotropins derived from either natural sources, e.g., pituitary gland tissue or from microor ⁇ ganisms transformed by recombinant DNA techniques to produce a naturally-occurring form of somatotropin.
  • natural sources e.g., pituitary gland tissue or from microor ⁇ ganisms transformed by recombinant DNA techniques to produce a naturally-occurring form of somatotropin.
  • a specific mammalian source such as a bovine somatotropin
  • the somatotropin includes those derived from either natural sources or from transformed microorganisms.
  • microorganism refers to both single cellular prokaryotic and eukaryotic organisms such as bacteria, yeast, actinomycetes and single cells from higher plants and animals grown in cell culture. Transgenic animals are also known to those skilled in the art for production of heterologous polypeptides.
  • native refers to naturally-occurring forms of somatotropins which may have been derived from either natural sources, e.g., pituitary gland tissue or from microorganisms trans ⁇ formed by recombinant DNA techniques to produce a naturally-occurring form of somatotropin.
  • vector includes both cloning plasmids and plasmids for directing the expression of a somatotropin by virtue of the DNA encoding the somatotropin being operatively linked to a promoter capable of functioning in a microorganism.
  • vector can also include chromosomal insertion of the DNA encoding the heterologous polypeptide.
  • Somatotropins are very similar in amino acid sequence and physical structure. Although the processes described in the Examples are directed toward bSt, the processes are equally applicable to any animal somatotropin, particularly other mammalian somatotropins, having the requisite cysteine residues available for conversion to serine.
  • rbSt analogs have been con ⁇ structed. These analogs include those having the DNA sequence corresponding to the codons for cysteine at positions 181 and 189 changed to the codon for serine, two other analogs having the codon at either 181 or 189 changed to a serine codon, and one encoding a truncated rbSt protein which contains a translational stop codon at position 179. These four analogs were made as gene fusions and were expressed using expression vector pCFM414 and the E. coli strain AM343c.
  • the vectors have been designated pRA-bSt/hyb-Serl81/9, pRA- bSt/hyb-Serl ⁇ l, pRA-bSt/hyb-Serl89, and pRA-bSt/hyb-179T.
  • a vector containing the DNA which encodes an unmodified rbSt product, pRA- bSt/hyb was also constructed to serve as a control. All five of these vectors were found to express rbSt at high levels in the AM343c strain.
  • cys -> ser bSt into dairy cattle is done according to known methods using any route effective to deliver the required dosage to the animal's circulatory system.
  • Modes of administration include oral, intramuscular injections, subcutaneous injections and the use of timed-release implants.
  • the preferred mode of administration is by subcutaneous injection using a timed-release implant.
  • Appropriate vehicles for injections include physiologically compatible buffers such as sodium bicarbonate, sodium phosphate, or ammonium phosphate solutions.
  • Timed-release implants are known in the art, e.g., U. S. Pat. 4,333,919.
  • the effective dosage range is from 1.0 to 200 milligrams per animal per day.
  • the bSt analogs of the present invention can be used to produce increased growth in the species in which native bSt has been shown to have growth-related bioactivity such as bovines, sheep, rats, salmon and chickens.
  • the preferred animals are bovines used for beef such as bulls, heifers or steers.
  • Cys - ser bSt can be used to produce increased growth rates in beef cattle by administration any time between weaning until slaughter. Cys - * • ser bSt is administered to beef cattle for a minimum of 30 days and for a maximum of 450 days depending upon desired time of slaughter. Animals used for veal are typically slaughtered at approximately 6 months of age and 10 to 30 mg/day of cys -> ser bSt is administered up until the age of slaughter to effectuate desired increases in growth rate.
  • cys ⁇ ser bSt is administered between 30 and 90 days post-partum and continued for up to 300 days. Cys ⁇ * ser bSt will also increase lactation in other commercial milk-producing animals such as goats and sheep.
  • the MC1000 (F “ , araD j g, del(araABC-leu) 7 6 7 9, galU, t pa jjj , malB flm , rspL, relA, thi) (available in the Experiments with Gene Fusion Strain Kit, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York ) and JM83 (ara, del(lac-pro) , rspL, phi80 lacZ delM15) (avaiable from American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852) strains are used as competent cells for vector construction.
  • the AM343c (F " , sup° tonA) strain is used for inductions.
  • strain AM343C It was derived from expression strain AM343C by curing the strain of the endogenous expression plasmid pCFM414-bGH.
  • Strain AM343C also designated UC*9801
  • An alternative strain for expression is BST-1C (see PCT/US 88/00328, which is incorporated herein by reference). Plasmids: The pUC9 (J. Vieira and J. Messing, Gene 19, pp.
  • the pCFM414-bGH vector (deposited with strain AM343C, above) was constructed from pCFM414 (U.S. Patent 4,710,473) by inserting n EcoRI/BamHI fragment that contains the trp promoter, and the trpL ribosome binding site from E. coli, and a synthetic bSt gene.
  • the pTrp-BStml and the pTrp-BStmlb vectors are described in PCT/US 88/00328.
  • Both of these vectors were constructed using a bSt cDNA gene (PCT/US88/00328, incorporated herein by reference). Both vectors have been modified in the DNA sequence encoding the bSt carboxyl-terminus.
  • the pTrp-BStml vector has a BamHI restriction site immediately after the translational stop codon for bSt and contains a serine codon at position 189.
  • the pTrp-BStmlb vector is similar to pTrp-BStml except that it contains a cysteine codon corresponding to position 189 of bSt.
  • DNA Preparation and Cloning protocols Most DNA preperation and general techniques are done by techniques well known to those skilled in the art (see, T. Maniatis, et al, Molecular Cloning: A Laboratory
  • DNA is prepared as previously described (J.E. Mott, et al, EMBO J., 4, pp. 1887-1891 (1985)). Restriction digestions and ligations are performed according to the manufacturers' recommendations. Restric ⁇ tion enzymes and ligase are purchased from New England Biolabs. DNA fragments are isolated from agarose gels by one of two techniques. For fragments smaller than 800 bps, the bands are cut from the gel, crushed and frozen on dry ice in the presence of phenol. The aqueous phase is separated by centrifugation and ethanol precipitated. For fragments greater than 800 bp the band is cut from the gel and electro-eluted (T. Maniatis, et al, supra).
  • Plasmid Transformations Cells to be transformed are grown over night and subcultured 1/100. These cells are grown to mid-log phase, 5 ml is centrifuged and resuspended in 10 ml of cold 50 mM CaCl2, and incubated on ice or at 4° C for at least one hour. The cells are again centrifuged and taken up in 0.5 ml 50 nM C C ⁇ - Approximately 100 ⁇ l of cells is incubated on ice with plasmid DNA for one hour. Cells are heat shocked for 7 in. at 37° C, and are plated on LB plates containing 100 ⁇ g/ml ampicillin. Selections for runaway vectors are done at 27° C. Selections for non-runaway vectors are done at 37° C.
  • Oligomers are synthesized and purified as previously described (PCT/US88/00328) .
  • the synthetic DNA fragments for the introduction of the termination codon at position 179 are formed by heating oligonucleotides JM-1 and JM-2 (Chart 2) in the presence of ligation buffer to 100° C and allowing the mixture to cool to room temperature.
  • oligomers JM-4 and 5 are first kinased with high specificity P ** - 1 2-labeled gamma-ATP and then hybridized to JM-3 and JM-6 (Chart 3).
  • the four oligonucleotide structure is ligated and isolated from a non-denaturing polyacryl- amide gel.
  • SDS PAGE The SDS PAGE protocol has been previously described (J.E. Mott, et al, Proc. Natl. Acad. Sci. USA, 82, pp. 88-92 (1985)).
  • the sequencing kit SequenaseTM is purchased from United States Biochemical. Sequencing is performed according to the manufacturers' recommendations. DNA for double-stranded sequencing is prepared by the method of L. B. Agellon and T. T. Chen, Gene Anal. Techn. 3 pp.86-89 (1986).
  • the annealing protocol is modified as follows: 3 ⁇ l of 2M NaOH, 2mM EDTA is added to 12 ⁇ l double-stranded plasmid DNA and incubated for 5 minutes at room temperature, 3 ⁇ l of lOOng/ ⁇ l primer is added and the mix is incubated for 10 minutes followed by the addition of 6 ⁇ l of 3M sodium acetate. After an additional 5 minute incubation, lOO ⁇ l of ice-cold 95% ethanol is added and the DNA is precipitated for 20 minutes on dry ice. " The DNA is pelleted, rinsed with 70% ethanol and vacuum dried. After resuspension in 8 ⁇ l water and 2 ⁇ l sequencing buffer, the sequencing is continued according to the manufacturer's directions.
  • 2.5 ⁇ l of the dGTP termination mixes A, C, G and T are pipetted into individual wells of a microtiter plate and pre-warmed at 37°C.
  • the Sequenase enzyme is diluted 1:8 in ice cold TE buffer.
  • l ⁇ l of 0.1M DTT, 2 ⁇ l of the diluted label mix, 2 ⁇ l of -"S-dATP and 2 ⁇ l of diluted Sequenase are added to the annealed DNA and the reactions incubated for 2 minutes at room temperature.
  • 3.5 ⁇ l of the labeling reaction is added to each termination well (A, C, G and T) and incubated for an additional 5 minutes. The reactions are stopped with 4 ⁇ l of stop mix.
  • the temperature sensitive runaway vector pC_?M414-bGH expresses high levels of rbSt.
  • the vector contains a synthetic rbSt gene which is expressed from the trp promoter and uses the trpL ribosomal binding site for initiation of translation.
  • This synthetic rbSt gene and the cDNA bSt gene both have a unique Pstl restriction site at the sequence which corresponds to amino acids 90 and 91.
  • hybrid bSt genes can be made using this common in-frame site.
  • a hybrid gene, bSt/hyb, containing the sequence encoding the N-terminal region of the synthetic gene and the carboxyl terminus of -li ⁇ the cDNA gene is expressed to produce rbSt protein at high levels when cloned into the pCFM414 vector.
  • the distal portion of the bSt gene can be altered using the unique restriction sites located in the cDNA segment.
  • the cDNA for example, contains a Mstll restriction site at the sequences which encode amino acids 175, 176 and 177. These can be used to replace the sequence for the carboxyl terminus with synthetic DNA fragments which alter the cysteine codon at positions 181 and 189 or prematurely terminate translation.
  • the hybrid genes must be placed in a vector in which these sites remain unique.
  • the pUC-9 vector (J. Vieira and J. Messing, Gene, 19, pp.259-268 (1982), available from Bethesda Reasearch Laboratories, Gaitherburg, Maryland 20877) is a constitutive high copy number vector derived from pBR322. It contains the gene for ampicillin resistance and the lac promoter expressing the lacZ' beta-galactosidase gene.
  • the lacZ' gene encodes a small N-terminal peptide fragment which is capable of functionally complementing a peptide fragment produced by the lacZdelM15 beta-galactosidase gene (Vieira and Messing, supra). This complementation can be visualized by using the chromogenic substrate X-Gal (Bethesda Research Laboratories, Gaithersburg, MD) which turns blue in cells with functioning beta-galactosidase.
  • pUC9 has been modified to contain unique restriction sites within the sequence for lacZ' which are referred to as the polyclonal sites.
  • DNA fragments which are inserted into these sites destroy the ability of the lacZ' peptide to be produced and to complement the lacZdelM15 beta-galac- tosidase protein. Such cells do not turn blue in the presence of the X-Gal indicator.
  • the pUC-9 vector does not contain a Mstll restriction site but does contain unique sites in lacZ' polylinker for EcoRI, BamHI, Pstl, and Hindlll.
  • the pUC-9 vector is modified to eliminate the Pstl and the Hindlll sites which would interfere with the hybrid gene con ⁇ struction and subsequent modification. This is accomplished by digesting the vector with Hindlll and Hinll. A Hinll site is also present in the polyclonal site. The Hindlll site is filled with PolA klenow, the vector is ligated and transformed into competent JM83 cells. Resultant plasmids are screened and a candidate selected which has lost the Hindlll and Pstl restriction sites but retained the BamHI and EcoRI sites.
  • the resultant vector is designated pDH23.
  • the unique EcoRI and BamHI restriction sites permit the cloning of the synthetic bSt gene.
  • the synthetic bSt gene is isolated from plasmid pCFM414-bGH as an EcoRI/BamHI fragment and is cloned into the pDH23 vector which is previously digested with BamHI and EcoRI.
  • the EcoRI/BamHI fragment also contains the trp promoter and the trpL ribosome binding site.
  • the resultant vector is designated pDH-bSt. In this vector the Pstl and BamHI restriction sites in the bSt gene are unique.
  • a Pstl/BamHI fragment is isolated from the pTrp-BStml vector.
  • This vector contains the bSt cDNA which is expressed from the trp promoter and uses the trpL riboso al binding site.
  • the bSt gene in pTrp-BStml is modified to encode a serine at position 189.
  • the pTrp- BStml vector is digested with Pstl and BamHI and a fragment of about 315 bp is isolated which contains the DNA sequence for the carboxyl terminus of bSt.
  • the pDH-bSt/hyb-189S vector is digested with Pstll and BamHI and the large vector fragment is isolated.
  • a Pstl/BamHI fragment is isolated from pTrp-BStmlb (PCT/US88/00328) .
  • pTrp-BStmlb is similar to pTrp-BStml except that it contains a syn- thetically derived oligonucleotide fragment cloned between the Mstll and BamHI restriction sites. This fragment is identical to the fragment described in Chart 3 except that it contains the cysteine codon TGC at the positions corresponding to amino acids 181 and 189.
  • the codon usage is optimized and a Hindlll restriction site is engineered into the sequence between codons 181 and 189.
  • the Pstl/BamHI fragment is isolated from pTrp-BStmlb and ligated into the large fragment of the pDH-bSt/hyb-189S vector to generate pDH- bSt/hyb.
  • the bSt gene of pDH-bSt/hyb encodes the natural bSt.
  • the pDH-bST/hyb-189S is digested with Mstll and BamHI and the large vector fragment from the digestions is isolated.
  • a synthetic fragment derived from four oligonucleotides is shown in Chart 3. This synthetic fragment is designed to be inserted into the Mstll/BamHI restriction sites. The insertion of this fragment generates a gene encoding a bSt protein with serine at amino acid positions 181 and 189.
  • This fragment is ligated to the large Mstll/BamHI fragment of pDH-bSt/hyb-189S to create the second vector pDH-bSt/hyb-Serl81/9. In this vector the restriction sites Pstl, Mstll, Hindlll, and BamHI are unique.
  • the third vector derived from pDH-bSt/hyb-189S is made by inserting the synthetic fragment shown in Chart 2. This fragment encodes a translational stop codon corresponding to position 179 of the bSt. The fragment is ligated to the Mstll/BamHI fragment of pDH- bSt/hyb-189S to generate a bSt gene that encodes a truncated bSt lacking the small loop. This vector is called pDH-bSt/hyb-179T.
  • This example sets forth the cloning strategy for constructing genes with individual serine codons at position 181 or 189.
  • Two starting vectors are used, pDH-bSt/hyb and pDH-bSt/hyb-Serl81/9 (Example 1) .
  • pDH-bSt/hyb encodes the natural bSt gene and pDH- bSt/hyb-Serl81/9 has serine codons for amino acids 181 and 189.
  • Both vectors have a unique Hindlll restriction site located between the sequence for these two codons. Digestion of these vectors with EcoRI and Hindlll generates two fragments from each vector.
  • the 850 bp fragment contains the trp promoter and about 95% of the bSt gene inclusive of the 181 codon.
  • the 850 bp fragments are exchanged between the starting vectors in the cloning so that the fragment from pDH-bSt/hyb containing a cysteine codon at 181 is introduced into the pDH-bSt/hyb-Serl81/9 vector which has the serine codon at 189, and conversely the 850 bp fragment containing the serine 181 codon from pDH-bSt/hyb-Ser181/9 is cloned into the pDH-bSt/hyb vector containing the 189 cysteine codon.
  • the modified genes are cloned into the expression vector pCFM414-bGH.
  • pCFM414-bGH is digested with EcoRI and BamHI and the large vector fragment is purified, thus removing the endogenous bSt gene.
  • the vectors pDH-bSt/hyb, pDH-bSt/hyb- Serl81/9, pDH-bSt/hyb-Serl81, pDH-bSt/hyb-Serl89 and pDH-bSt/hyb-179T are digested with EcoRI and BamHI, and an 870 bp fragment containing the trp promoter, trpL ribosome binding site and the entire bSt gene is isolated from each.
  • the fragments are individually ligated to the pCFM414 vector fragment and transformed into competent cells of E. coli strain MC1000. Plasmid DNA for the individual constructions is prepared.
  • the resultant vectors are designated pRA-bSt/hyb, pRA- bSt/hyb-Serl81/9, pRA-bSt/hyb-Serl81, pRA-bSt/hyb-Serl89 and pRA- bSt/hyb-179T.
  • the vectors pRA-bSt/hyb, pRA-bSt/hyb-Serl81/9, pRA-bSt/hyb- Serl ⁇ l, pRA-bSt/hyb-Serl89 and pRA-bSt/hyb-179T are transformed into competent cells of E. coli AM343c.
  • the cultures are induced as described above, and a six hour post-induction sample from each culture is analyzed by SDS PAGE. All constructs show high level expression of their respective rbSt proteins.
  • E. coll strain BST-1C is vised for expression (PCT/US88/00328) .
  • Vector pDH-bSt/hyb-Serl81/9 as described above contains between its EcoRI and Pstl sites the trp promoter, trpL ribosome binding site, and the synthetic bSt DNA sequence encoding amino acids 1 to 90 of bSt, from the Pstl site to the Mstll site it contains a sequence derived from the cDNA gene corresponding to amino acid positions 91 to 176 (Example 1) , and from the Mstll to BamHI restriction sites contains sequences derived from the synthetic oligonucleotide block (Example 1).
  • the portion of the gene derived from the synthetic bSt gene can be deleted by digesting pDH-bSt/hyb-Serl81/9 with EcoRI and Pstl and isolating the large vector fragment.
  • the deleted segment can be replaced with an EcoRI, Pstl restriction fragment from pTrp- BStm4 (PCT/US88/00328) , which contains the trp promoter, and the trpL ribosome binding site and the DNA sequence from the cDNA encoding amino acids 1 to 90 of bSt.
  • This DNA also contains a GCC to GCT codon change at the codon corresponding to the second alanine of bSt which results in improved expression (PCT/US88/0328) .
  • the resultant vector is called pDH-bStm4-Serl81/9.
  • both the pDH-bStm4-Serl81/9 and pURA-1 vectors are digested with EcoRI and BamHI restriction enzymes.
  • the large vector fragment from pURA-1 and the smaller bSt gene fragment from pDH-bStm4-Serl81/9 are isolated and ligated together with a BamHI transcriptional termination fragment of rpoC (PCT/US88/00328) .
  • the ligated DNA is used to transform competent cells of MC1000.
  • the resultant vector, pURA-bStm4-Serl81/9 is identical to pURA-4 (PCT/US- 88/00328) except that it contains the 181 and 189 cys -> ser modifica- tions.
  • the vector is transformed into the BST-1C strain (PCT/US88/00328) and induced as previously described (PCT/US88/- 00328).
  • Ser-53 or ser-164 is made from DNA encoding bSt having serine at those positions by oligonucleotide-directed mutagenesis on a double- stranded DNA plasmid, using the following procedure:
  • the oligonucleotide primer is phosphorylated by incubating 4 ⁇ l of oligonucleotide (4 ⁇ g) with 54 ⁇ l of water, 7 ⁇ l of buffer (0.5 M Tris-HCl, pH 7.4, 0.1 M MgCl 2 , 0.1 M dithiothreitol), 2 ⁇ l of 50 mM ATP, and 3 ⁇ l of 10 units/ ⁇ l T4 polynucleotide kinase to a final volume of 70 ⁇ l at 37" C for 60 minutes.
  • the reaction mixture is extracted with phenol and ether, evaporated to dryness, and dissolved in 3 ⁇ l of H2O.
  • Two ⁇ l of this phosphorylated oligonucleotide is mixed with 15 ⁇ l of denatured plasmid DNA (denatured by incubating 2 ⁇ g of DNA in 12 ⁇ l with 3 ⁇ l of 2 N NaOH and 2 mM EDTA for 15-20 minutes at room temperature) , followed by the addition of 6 ⁇ l of 3 M sodium acetate, and 100 ⁇ l of ethanol.
  • the mixture is kept in dry ice for 15-30 minutes and the precipitate is collected by centrifuga- tion, washed with 70% ethanol, dried, and dissolved in 25 ⁇ l of 10 mM Tris-HCl, pH 7.4 and 1 mM EDTA.
  • This solution is added with 1 ⁇ l of the phosphorylated oligonucleotide, 20 ⁇ l of water, 7.5 ⁇ l of 1 M Tris-HCl, pH 8.3, 10 ⁇ l of 0.2 M NaCl, 25 ⁇ l of 0.1 M MgCl 2 , 20 ⁇ l of 10 mM dNTP, 17.5 ⁇ l of 5 mM ATP, 20 ⁇ l of 0.4 M 0-mercaptoethanol, 16 ⁇ l of Klenow enzyme (80 units), 20 ⁇ l of T4 DNA ligase (8,000 units), and 18 ⁇ l of T4 gene 32 protein (32 ⁇ g).
  • the reaction mixture in a total volume of 200 ⁇ l, is incubated at 37° C for 1 hour, mixed with NaCl to final 0.2 M, extracted with phenol and ether, and precipi ⁇ tated with ethanol.
  • the precipitate is dissolved in 100 ⁇ l of 10 mM Tris-HCl, pH 7.4 and 1 mM EDTA and used for transformation of E. coll DH1, MC1000 or other appropriate strains.
  • 2-20 ⁇ l of the mutagenized plasmid are used for transformation.
  • the transformants carrying the plasmid with the mutation are screened for by colony hybridization, using the ⁇ utagenesis oligonu ⁇ cleotide as the probe and selecting washing conditions to detect the mutation over the wild-type background.
  • the procedures for hybridi ⁇ zation are as described in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning.
  • oligonucleotide probe is phosphorylated with 100-200 MCi of (7- 32 P)ATP and 10-20 units of T4 polynucleotide kinase in 50 mM Tris-HCl, pH 7.8, 10 mM MgCl2, and 10 mM dithiothreotol, in a total volume of 20 ⁇ l.
  • Hybridization is carried out in 5x Denhardt's, 5x SSC and 0.1% SDS at 42° C.
  • the filters are washed in 5x SSC and 0.1% SDS at a temperature which allows the oligonucleotide probe to remain annealed to the changed sequence and dissociated from the wild- ype sequence.
  • Transformants that hybridize strongly with the oligonucleotide probe are selected and DNA sequencing is carried out to confirm the altered sequence.
  • oligonucleotide-directed mutagenesis to generate DNA encoding bSt with serine at position 53 or 164 is carried out with plasmid pURA-m4 (PCT/US88/00328).
  • plasmid pURA-m4 PCT/US88/00328.
  • an oligonucleotide with the sequence GTTGCCTTCTCTTTCTCTGA- AAC is used for mutagenesis and as a probe for colony hybridization with washing temperature for the filters at 51* C.
  • the plasmid with the change is called pURA-m4-53ser.
  • the serine substitution at position 164 is generated with the oligonucleotide CTGCTCTCCTCTTTCCG- GAAGG using 51" C for washing of filters and the resulting plasmid is called pURA-m4-164ser.
  • This strategy uses the Pstl site located at codon 90 of the bSt gene to splice together the bSt sequences with single serine sub ⁇ stitutions at position 53 or 164.
  • the bSt sequence with serine at position 164 is subcloned into pDH23 by isolating the EcoRI/BamHI small fragment containing the trp promoter and the bSt gene from pURA-m4-164ser and ligating it to the EcoRI/BamHI large vector fragment isolated from pDH23.
  • the resulting plasmid pDH-m4-164ser has a single Pstl site at codon 90 of the bSt gene.
  • the EcoRI/Pstl large vector fragment containing the 3' half of the bSt sequence with serine at position 164 is isolated from pDH-m4-164. This fragment is ligated to the small EcoRI/Pstl fragment containing the trp promoter and the 5' half of the bSt encoding sequence with serine at position 53 isolated from pURA-m4-53ser. The resulting plasmid is named pDH- m4-53/164ser.
  • the EcoRI/Hindlll small fragment containing the trp promoter and the bSt sequence is isolated from pDH23-m4-53/164ser. This fragment is ligated to the EcoRI/Hindlll large vector fragment isolated from pURA-m4. The resulting plasmid is named pURA-__4-53/164ser.
  • Example 8 Construction of a bSt Gene with Serine at Positions 54, 164, 181, and 189.
  • the EcoRI/Mstll small fragment carrying the trp promoter and most of the bSt coding sequence with serine at positions 53 and 164 is isolated from pDH- m4-53/164ser. This fragment is ligated to the EcoRI/Mstll large vector fragment containing the 3' bSt coding sequence with serine at positions 181 and 189 isolated from pDH-bSt/hyb-serl81/9.
  • the resulting plasmid is named pDH-m4-53/164/181/189ser.
  • the EcoRI/BamHI small fragment containing the trp promoter and the bSt coding sequence with serine at positions 53, 164, 181 and 189 is isolated from pDH-m4-53/164/181/189ser (Fragment I).
  • the EcoRI/BamHI large vector fragment (Fragment II) and the 350 bp BamHI fragment carrying the transcription terminator for the E. coll genes rpoBC (Fragment III) are isolated from pURA-m4.
  • Fragments I, II and III are ligated and a plasmid with the terminator in the correct orienta ⁇ tion is selected and named pURA-m4-53/164/181/189ser.
  • Example 9 Expression of bSt with Serine at One or More of the Positions 53, 164, 181 and 189.
  • the vector pURA-m4-53ser, pURA-m4-164ser, pURA-m4-53/164ser or pURA-m4-53/164/181/189ser is transformed into E. coll BSt-lC and induced as described in patent application PCT/US88/00328.
  • Example 10 Biological Activity of Cys ⁇ * Ser bSt Analogs
  • AM343c cells transformed with pRA-bSt/hyb-Serl81/9 were grown in 200 L of beer using a modified Luria Broth. Initially the cells were grown at 27 ⁇ C, pH 7 until an A550 of 1 was obtained. Induction was caused by a temperature shift to 37", a pH shift to 6 and the addition of yeast extract (PCT/US 88/00328). rbSt is harvested from the cells collected by centrifugation as follows:
  • rbSt mixture is chromatographed over DEAE-Sepharose and the rbSt fractions are recovered and lyophilized.
  • hypophysectomized, female, Sprague-Dawley rats are purchased from Charles River Laboratories, Inc. The rats are divided into test groups of 7 rats per group.
  • a standard pituitary-derived bSt for control is dissolved in 0.15 M NaCl/0.03 M sodium bicarbonate buffer, pH 10.8. The pH of the solution is adjusted to 9.5 and the solution is diluted to a protein concentra- tion of 2 mg/ml with a similar buffer at pH 9.5.
  • the test rbSts are prepared as lyophilized powders containing Tween 80 and mannitol in sodium bicarbonate buffer.
  • rbSt reconstituted to a 10 mg/ml solution which is then diluted 1:5 to make stock solutions.
  • a preparation of recombinantly produced natural rbSt is used as a control.
  • Each animal in the test groups is injected twice daily (100 ⁇ l/injection) for a total dosage of 7.5, 15, 30 or 60 mg protein/day for a total of nine days.
  • the rats are weighed daily throuout the treatment period, except week ⁇ ends.
  • cow bioassay lactating Holstein cows were used. These cows were free of metabolic disorders, mastitis, disease and medica ⁇ tion before assingment to the study. The cows were blocked in four replicates of five cows each based on the average milk yield on days 3 and 2 before the first injection of test compound. Cows between 122 and 289 days postpartum were used for the study. The five cows of each block were assingned randomly to one of three experimental groups: 5 mg and 15 mg each daily of cys ⁇ ser rbSt, rbSt process control and non-injected control group. Cows were injected at about 0745 to 0815 hours daily; i.e., 2 to 3 hours after milking.
  • the rbSt was harvested from the collected cells as in Expample 10 except that it was necessary to repeat Steps 4 (sodium lauroyl sarcosine removal by Dowex-lx4 treatment) and 5 (chromatography on DEAE-Sepharose). This was done for two preparations from the fermentation. In vitro analytical data are given in Table 4. Table 4
  • JM-3 3' CTTTGCTGCCCTAAAGTATTGGGAGT JM-4 3' GGATAATCTTTCGCCTCCTTCGAAGTGG JM-5 3' CCCAATACTTTAGGGCAGCAAAGCCACTT JM-6 3' CGAAGGAGGCGAAAGATTATCCCTAG

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Endocrinology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Cosmetics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US1989/005445 1989-01-31 1989-12-11 Somatotropin analogs WO1990008823A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DK140491A DK140491A (da) 1989-01-31 1991-07-29 Pattedyrs-somatotropin, dets anvendelse til foroegelse af dyrs vaekst og af droevtyggeres maelkeproduktion samt vektor indeholdende dna, der koder for et pattedyrs-somatropin, og en mikroorganisme, der er vaert for en saadan vektor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US30473389A 1989-01-31 1989-01-31
US304,733 1994-09-12

Publications (1)

Publication Number Publication Date
WO1990008823A1 true WO1990008823A1 (en) 1990-08-09

Family

ID=23177749

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1989/005445 WO1990008823A1 (en) 1989-01-31 1989-12-11 Somatotropin analogs

Country Status (6)

Country Link
EP (1) EP0456642A1 (ja)
JP (1) JP3207416B2 (ja)
AU (1) AU620673B2 (ja)
CA (1) CA2005502C (ja)
DK (1) DK140491A (ja)
WO (1) WO1990008823A1 (ja)

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001789A1 (en) * 1990-07-16 1992-02-06 Pitman-Moore, Inc. Stable and bioactive modified somatotropins
US5534617A (en) * 1988-10-28 1996-07-09 Genentech, Inc. Human growth hormone variants having greater affinity for human growth hormone receptor at site 1
US5688666A (en) * 1988-10-28 1997-11-18 Genentech, Inc. Growth hormone variants with altered binding properties
US5849535A (en) * 1995-09-21 1998-12-15 Genentech, Inc. Human growth hormone variants
EP1624847A2 (en) * 2003-05-09 2006-02-15 Neose Technologies, Inc. Compositions and methods for the preparation of human growth hormone glycosylation mutants
US7696163B2 (en) 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7795210B2 (en) 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US7803777B2 (en) 2003-03-14 2010-09-28 Biogenerix Ag Branched water-soluble polymers and their conjugates
US7842661B2 (en) 2003-11-24 2010-11-30 Novo Nordisk A/S Glycopegylated erythropoietin formulations
US7956032B2 (en) 2003-12-03 2011-06-07 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US8008252B2 (en) 2001-10-10 2011-08-30 Novo Nordisk A/S Factor VII: remodeling and glycoconjugation of Factor VII
US8063015B2 (en) 2003-04-09 2011-11-22 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
US8207112B2 (en) 2007-08-29 2012-06-26 Biogenerix Ag Liquid formulation of G-CSF conjugate
US8268967B2 (en) 2004-09-10 2012-09-18 Novo Nordisk A/S Glycopegylated interferon α
US8361961B2 (en) 2004-01-08 2013-01-29 Biogenerix Ag O-linked glycosylation of peptides
US8633157B2 (en) 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
US8716239B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF
US8716240B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US8791066B2 (en) 2004-07-13 2014-07-29 Novo Nordisk A/S Branched PEG remodeling and glycosylation of glucagon-like peptide-1 [GLP-1]
US8841439B2 (en) 2005-11-03 2014-09-23 Novo Nordisk A/S Nucleotide sugar purification using membranes
US8911967B2 (en) 2005-08-19 2014-12-16 Novo Nordisk A/S One pot desialylation and glycopegylation of therapeutic peptides
US8916360B2 (en) 2003-11-24 2014-12-23 Novo Nordisk A/S Glycopegylated erythropoietin
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
US9005625B2 (en) 2003-07-25 2015-04-14 Novo Nordisk A/S Antibody toxin conjugates
US9029331B2 (en) 2005-01-10 2015-05-12 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9150848B2 (en) 2008-02-27 2015-10-06 Novo Nordisk A/S Conjugated factor VIII molecules
US9187532B2 (en) 2006-07-21 2015-11-17 Novo Nordisk A/S Glycosylation of peptides via O-linked glycosylation sequences
US9187546B2 (en) 2005-04-08 2015-11-17 Novo Nordisk A/S Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0355460B1 (en) * 1988-08-24 2000-12-27 American Cyanamid Company Stabilization of somatotropins by modification of cysteine residues utilizing site directed mutagenesis or chemical derivatization

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0109748A1 (en) * 1982-10-19 1984-05-30 Cetus Corporation Pharmaceutical and veterinary preparations of cystein-125-depleted muteins of Interleukin-2 and their production

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0109748A1 (en) * 1982-10-19 1984-05-30 Cetus Corporation Pharmaceutical and veterinary preparations of cystein-125-depleted muteins of Interleukin-2 and their production

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHEMICAL ABSTACTS, Vol. 110, No. 11, 13 March 1989, (Columbus, Ohio, US), page 212* Abstact No. 89909P, & JP-A-62255500 (Kyowa Hakko Kogyo Co., Ltd), 7 November 1987* *
Eur. J. Biochem., Vol. 153, No. 3, 1985, Febs, T. TOKUNAGA et al.: "Synthesis and Expression of a Human Growth Hormone (Somatotropin) Gene Mutated to Change Cysteine-165 to Alanine", pages 445-449 *

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6022711A (en) * 1988-10-28 2000-02-08 Genentech, Inc. Human growth hormone variants having enhanced affinity for human growth hormone receptor at site 1
US5534617A (en) * 1988-10-28 1996-07-09 Genentech, Inc. Human growth hormone variants having greater affinity for human growth hormone receptor at site 1
US5688666A (en) * 1988-10-28 1997-11-18 Genentech, Inc. Growth hormone variants with altered binding properties
US5854026A (en) * 1988-10-28 1998-12-29 Genentech, Inc. Human growth hormone variant having enhanced affinity for human growth hormone receptor at site 1
US6143523A (en) * 1988-10-28 2000-11-07 Genentech, Inc. Human growth hormone variants
WO1992001789A1 (en) * 1990-07-16 1992-02-06 Pitman-Moore, Inc. Stable and bioactive modified somatotropins
US6136563A (en) * 1993-05-25 2000-10-24 Genentech, Inc. Human growth hormone variants comprising amino acid substitutions
US6004931A (en) * 1993-05-25 1999-12-21 Genentech, Inc. Method for inhibiting growth hormone action
US6057292A (en) * 1995-09-21 2000-05-02 Genentech, Inc. Method for inhibiting growth hormone action
US5849535A (en) * 1995-09-21 1998-12-15 Genentech, Inc. Human growth hormone variants
US7696163B2 (en) 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7795210B2 (en) 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US8716240B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US8716239B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF
US8008252B2 (en) 2001-10-10 2011-08-30 Novo Nordisk A/S Factor VII: remodeling and glycoconjugation of Factor VII
US7803777B2 (en) 2003-03-14 2010-09-28 Biogenerix Ag Branched water-soluble polymers and their conjugates
US8247381B2 (en) 2003-03-14 2012-08-21 Biogenerix Ag Branched water-soluble polymers and their conjugates
US8063015B2 (en) 2003-04-09 2011-11-22 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
US8853161B2 (en) 2003-04-09 2014-10-07 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
US7932364B2 (en) 2003-05-09 2011-04-26 Novo Nordisk A/S Compositions and methods for the preparation of human growth hormone glycosylation mutants
EP1624847A4 (en) * 2003-05-09 2008-06-18 Neose Technologies Inc COMPOSITIONS AND METHODS FOR PREPARING GLYCOSYLATION MUTANTS OF HUMAN GROWTH HORMONE
EP1624847A2 (en) * 2003-05-09 2006-02-15 Neose Technologies, Inc. Compositions and methods for the preparation of human growth hormone glycosylation mutants
US9005625B2 (en) 2003-07-25 2015-04-14 Novo Nordisk A/S Antibody toxin conjugates
US7842661B2 (en) 2003-11-24 2010-11-30 Novo Nordisk A/S Glycopegylated erythropoietin formulations
US8633157B2 (en) 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
US8916360B2 (en) 2003-11-24 2014-12-23 Novo Nordisk A/S Glycopegylated erythropoietin
US7956032B2 (en) 2003-12-03 2011-06-07 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US8361961B2 (en) 2004-01-08 2013-01-29 Biogenerix Ag O-linked glycosylation of peptides
US8791066B2 (en) 2004-07-13 2014-07-29 Novo Nordisk A/S Branched PEG remodeling and glycosylation of glucagon-like peptide-1 [GLP-1]
US8268967B2 (en) 2004-09-10 2012-09-18 Novo Nordisk A/S Glycopegylated interferon α
US10874714B2 (en) 2004-10-29 2020-12-29 89Bio Ltd. Method of treating fibroblast growth factor 21 (FGF-21) deficiency
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US9029331B2 (en) 2005-01-10 2015-05-12 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US9187546B2 (en) 2005-04-08 2015-11-17 Novo Nordisk A/S Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
US8911967B2 (en) 2005-08-19 2014-12-16 Novo Nordisk A/S One pot desialylation and glycopegylation of therapeutic peptides
US8841439B2 (en) 2005-11-03 2014-09-23 Novo Nordisk A/S Nucleotide sugar purification using membranes
US9187532B2 (en) 2006-07-21 2015-11-17 Novo Nordisk A/S Glycosylation of peptides via O-linked glycosylation sequences
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography
US8207112B2 (en) 2007-08-29 2012-06-26 Biogenerix Ag Liquid formulation of G-CSF conjugate
US9150848B2 (en) 2008-02-27 2015-10-06 Novo Nordisk A/S Conjugated factor VIII molecules

Also Published As

Publication number Publication date
EP0456642A1 (en) 1991-11-21
DK140491D0 (da) 1991-07-29
AU620673B2 (en) 1992-02-20
JP3207416B2 (ja) 2001-09-10
AU4663189A (en) 1990-08-24
CA2005502C (en) 2001-06-05
JPH04503001A (ja) 1992-06-04
CA2005502A1 (en) 1990-07-31
DK140491A (da) 1991-07-29

Similar Documents

Publication Publication Date Title
AU620673B2 (en) Somatotropin analogs
JP2583214B2 (ja) 牛ソマトトロピン含有組成物およびこれを用いる牛の乳汁分秘促進法
AU634517B2 (en) Somatotropin analogs
CZ636081A3 (en) Process for preparing a vector for dna transfer
US4861868A (en) Production of proteins in procaryotes
US5605815A (en) Nucleic acids encoding and expression of parathyroid hormone-like peptide
US5141922A (en) Biologically active proteins and a method for their use
RU2034457C1 (ru) Способ повышения продуктивности сельскохозяйственных животных и препарат для его осуществления
US5631227A (en) Somatotropin analogs
EP0236452B1 (en) Enhanced bioactivity of mammalian somatotropin through selective deamidation
JP2619036B2 (ja) ブタ成長ホルモンアナログ
AU633278B2 (en) Isolation and cloning of complementary dna for gene coding of bovine trophoblast protein-1
EP0263206B1 (en) Enhanced bioactivity of mammalian somatotropin through selective deamidation
EP0363063A2 (en) Sheep growth hormone
AU647374B2 (en) Sheep growth hormone
JP2666069B2 (ja) 組換え型鳥類プロラクチン又は組換え型鳥類プレプロラクチン，組換え型ニワトリプロラクチン，組換え型ニワトリプロラクチン構造遺伝子，組換え型ニワトリプレプロラクチン，組換え型ニワトリプレプロラクチン構造遺伝子，組換えプラスミド，組換えプラスミドを含む微生物
JPH02219576A (ja) 魚類成長ホルモン遺伝子
PL174955B1 (pl) Sposób wytwarzania wektora do biosyntezy polipeptydu oraz nowy wektor do biosyntezy polipypteku

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 1990901301

Country of ref document: EP

AK Designated states

Kind code of ref document: A1

Designated state(s): AU DK FI HU JP KR NO SU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE ES FR GB IT LU NL SE

WWP Wipo information: published in national office

Ref document number: 1990901301

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990901301

Country of ref document: EP