WO1988002005A1 - Precurseurs d'insuline - Google Patents

Precurseurs d'insuline Download PDF

Info

Publication number
WO1988002005A1
WO1988002005A1 PCT/DK1987/000111 DK8700111W WO8802005A1 WO 1988002005 A1 WO1988002005 A1 WO 1988002005A1 DK 8700111 W DK8700111 W DK 8700111W WO 8802005 A1 WO8802005 A1 WO 8802005A1
Authority
WO
WIPO (PCT)
Prior art keywords
insulin
amino acid
cys
leu
gln
Prior art date
Application number
PCT/DK1987/000111
Other languages
English (en)
Inventor
Per Balschmidt
Finn Benned Hansen
Kim Ry Hejnaes
Ib Groth Clausen
Original Assignee
Nordisk Gentofte A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nordisk Gentofte A/S filed Critical Nordisk Gentofte A/S
Publication of WO1988002005A1 publication Critical patent/WO1988002005A1/fr
Priority to DK258688A priority Critical patent/DK258688A/da

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0089—Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/62—Insulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones

Definitions

  • Insulin precursors Insulin precursors .
  • the present invention relates to novel insulin precursors. More specifically, the invention relates to novel proinsu- lin-like insulin precursors which can be used in the pre ⁇ paration of insulins showing an inherent protracted action, or which may be used per se in the treatment of Diabetes. Moreover, the invention relates to DNA sequences coding for such proinsulin-like insulin precursors as well as pharma- ceutical preparations comprising the insulin precursors of the invention.
  • Soluble insulin preparations are usually fast acting, but in return the action ceases after few hours. Therefore, in ⁇ jections must be administered frequently, normally several times a day.
  • insulin preparations with protracted action have been formulated so that the ac ⁇ tion is maintained for several hours or even up to 24 hours or longer.
  • some diabetic patients only have to receive a small number of injections, e.g. a single or two injections during 24 hours.
  • Such a protracted action can be achieved by converting the insulin to a slightly soluble salt, such as zinc insulin or protamin insulin.
  • the slightly soluble insulin salts are used in the form of suspensions from which the insulin is gradually released, e.g. after subcutaneous injection. Recently other methods have also been invoked to achieve a protracted action.
  • An Example hereof is the encapsula ⁇ tion of insulin crystals in polymerized serum albumin.
  • An ⁇ other example is continuously acting infusion devices, so-called insulin pumps.
  • Insulins which are normally used in the treatment of Dia ⁇ betes, such as porcine, bovine, ovine, or human insulin, contain six carboxylic acid groups, viz. in the A4, A17, A21, B13, B21, and " B30 positions. The numbering is refer ⁇ ring to the positions in the A and B chain, respectively, of the insulin, starting from the N-termini.
  • the biological activity o-f insulin will usually decrease by an increasing degree of derivatization. However, the biological activity is influenced surprisingly little even at high degrees of derivatization of the free carboxylic acid groups. However, when all six free carboxylic acid groups are derivatized the biological activity is complete ⁇ ly abolished, vide D. Levy: Biochem. Biophys. Acta, 310 (1973), pages 406-415.
  • insulin derivatives wherein one or more of the four amino acid residues of positions A4, A17, B13 and B21 contain an uncharged side chain
  • the insu ⁇ lin activity can be maintained, and at the same time a surprisingly protracted action is achieved.
  • This protrac ⁇ ted effect is dependent on the properties of the specific derivative, e.g. the number of substituted amino acid re- sidues and the chemical composition of the uncharged side chains of said residues.
  • the protracted action is relatively insensitive to tryptic activity, inde ⁇ pendent of the origin of said tryptic activity.
  • ⁇ n a At. ileast one of * groups rR.B13, ⁇ RB21, ⁇ RA4, and, R A17 is a neutral amino acid residue and the others, if any others, are Glu, the positions A6 and All, A7 and B7, and A20 and B19, respectively, are connected by sulphur bridges, and X is a peptide bond or is a peptide chain of up to 40 members, the ultimate member being adjacent to Gly Al being Lys or Arg.
  • X has the amino acid sequence, which connects B29-lysine and Al-glycine in human proinsulin, in which optionally one or more of the acidic amino acids in the positions X., X,-, X_, X 14/ or X-,- may be converted into a neutral amino acid, such an insulin precursor will per se be applicable in pharmaceu ⁇ tical preparations for the treatment of Diabetes.
  • human proinsulin has acquired an increasing in ⁇ terest due to its use in the treatment of Diabetes, in spite of the relatively low specific biological strength of human proinsulin. This is not only due to the simpler bio echnological production, but' also to the appearance of some therapeutical advantages, over human insulin: -
  • the duration of the hypoglycemic effect observed after subcutaneous injection is distinctly longer than after the injection of a dissolved insulin preparation of the same potency, however shorter than the effect of an insulin suspension preparation ("Insulatard" ⁇ J , "Monotard” ⁇ ) (R.O.C. Adeniyi-Jones et al. : Diabetes Research and Clin ⁇ ical Practice, Suppl. 1 (1985) vide p. 3) , moreover, it suggests, however, that a better glycemic control can be achieved, as, apparently, proinsulin suppresses the hepa ⁇ tic glucose production rather than stimulates the periph ⁇ eral glucose conversion (R.R. Revers et al.: Diabetes _3_3 (1984) p. 762-770) .
  • the above-mentioned therapeutically suitable insulin pre ⁇ cursors of the invention possess the same therapeutical activities as human proinsulin. Moreover, they offer the advantage that the protracted hypoglycemic activity may be extended substantially by choosing a suitable degree of derivatization. Of course, it is also possible to use the insulin precursors of the invention in admixture with ordi ⁇ nary insulin in preparations achieving combined effects.
  • the preferred process for the production of the insulin precursors of the invention is by biosynthesis, as, e.g. by changing only a single base in the codon in the DNA strand coding for glutamic acid, this codon can be made code for glutamine.
  • this codon can be made code for glutamine.
  • the pro- duct is produced as a fusion protein with another protein separated by a cleaving site.
  • This may be a protease cleav ⁇ ing site or a site which can be cleaved chemically, e.g. methionine.
  • the gene for proinsulin is e.g. cloned as a genefusion with another protein by means of recombinant DNA techniques. After isolation of the chimeric protein said protein is cleaved by using a suitable enzyme or CNBr, whereupon the denatured proinsulin is isolated in a sul- phitated form.
  • This product is renatured under reducing conditions using 2-mercaptoethanol at a pH of 10.5 as de- scribed in U.S. Patent specification No. 4,430,266, fol ⁇ lowed by a trypsin/CpB cleavage as described by Kemmler, J. Biol. Che . 246, p. 6786 (1971) .
  • the resulting insulin is isolated in a manner known per se.
  • Proinsulin can be prepared biosynthetically by using the method disclosed in the specification of European Patent No. 116,201. In this method proteins are secreted into the culture medium by using the oL-factor system from Saccharo- myces cerevisiae. By inserting the gene coding for proinsu- lin into this system, proinsulin can be isolated from the culture medium by using the system described in the speci ⁇ fication of Danish Patent application No. 3091/84. Here ⁇ after, proinsulin can be converted into insulin by the known methods described above.
  • the product is either pro- insulin or proinsulin-like insulin precursors. Furthermore, these products are either produced together with a signal sequence the purpose of which is to carry the product to the cell surface where it is split off, or as a fusion with a protein for stabilizing the product. Moreover, it is possible to prepare modified proinsulins biosynthetically.
  • European Patent application No. 82303071.3 discloses proinsulins wherein the C-chain is modified by means of recombinant DNA techniques.
  • the insulin modifications described above can be produced by expressing the modified DNA sequence as a fusion with the gene encoding human SOD (superoxide dismutase) in the yeast Saccharomyces cerevisiae.
  • SOD superoxide dismutase
  • yeast Saccharomyces cerevisiae The insulin modifications described above can be produced by expressing the modified DNA sequence as a fusion with the gene encoding human SOD (superoxide dismutase) in the yeast Saccharomyces cerevisiae.
  • SOD is expressed in high yields in yeast (Jabusch, Biochemistry, 1_9, 2310-2316, 1980) and is furthermore capable of stabilizing the expres ⁇ sion of proinsulin and variants of proinsulin which are unstable when expressed in microorganisms.
  • the GAPDH-promotor As promotor for the transcription of the SOD-insulin gene is used the GAPDH-promotor (glyceraldehyde-3-phosphate de- hydrogenase) from Saccharomyces cerevisiae.
  • the promotor is made regulatable by fusing to the GAPDH-proiribtor the regulatory region from the ADH2- 1 -promotor, also from Saccharomyces cerevisiae.
  • the promotor When grown in a medium containing glucose, the promotor is inactive whereas it is active in absence of glucose.
  • the modifications in the DNA sequence can be made using in vitro mutagenesis on the insulin gene.
  • the procedure is de ⁇ scribed by T.A. Kunkel, Proc. Natl. Acad. Sci., USA, 82, 448-492 (1985) .
  • a sequence ⁇ on- taining the insulin gene is cloned into the single-strand ⁇ ed DNA bacteriophage M13.
  • DNA (the template) from this hybrid phage is purified and a primer, typically a 15- to 25-mer, which contains the desired mutation and a homolo ⁇ gous region on each side of the mutation, is annealed to the template.
  • Next step is to extend the primer along the whole phage genome using DNA polymerase I and in this way a double-stranded molecule is created, one strand contain ⁇ ing the mutation, the other strand being the wild- ype in ⁇ sulin gene.
  • the primer will show complete homology to the mutated strand, but will differ by one single nucleotide from the wild- type.
  • double-stranded DNA can be iso- lated from the E. coli cells in which the phage has multi ⁇ plied, and from this DNA the modified insulin gene is re ⁇ covered. The gene is then re-inserted into the original expression system.
  • JPlasmid which expresses the SOD-Met-PI fusion protein:
  • the expression plasmid which when present in the yeast Saccharomyces cerevisiae produces a fusion protein of the form SOD-Met-PI (superoxide dismutase-methionin-proinsulin) is shown in Figure 1.
  • This plasmid is the basic plasmid for expression of modified insulin molecules because in vitro mutagenesis can be used to create expression plasmids which encode the modifications.
  • 2 ⁇ 2-micron. A DNA sequence isolated from Saccharo- myces cerevisiae. Responsible for replication of the plasmid in S. cerevisiae.
  • LEU2d Selectable marker. Encodes an enzyme in the biosyn ⁇ thesis of leucin.
  • ADH2r The regulatory part of the ADH2 promotor (alcohol dehydrogenase) (Shuster et al., Mol. Cell. Biol., 6_, 1894-1902 ( 1986 ) ) .
  • GAPDHp The glyceraldehyde-3-phosphate dehydrogenase pro ⁇ motor (Travis et al., J. Biol. Che . , 258, 4384-4389 (1985) ) .
  • GAPDHt The glyceraldehyde-3-phosphate dehydrogenase ter ⁇ minator (references as above) .
  • pBR322 Bacterial sequence. Responsible for replication when propagating the plasmid in E. coli.
  • N Restriction endonuclease recognition site. Ncol.
  • SOD The superoxide dismutase gene.
  • PI The proinsulin gene.
  • the plasmid pYSIl an intermediate to the final expression plasmid pYASIl, encodes a SOD-Met-PI fusion.
  • the SOD gene fragment was isolated as the big partial Sau3A restriction fragment from pSODNco5 (Hallewell et al., Nucleic Acids Res., 1_3_, 2017-2034, 1985) .
  • Plasmid pins5 was used for the isolation of a Hindlll-Sall restriction fragment, which contains a synthetic proinsulin gene with preferred yeast codons with the exception " of the 13 aminoterminal amino acids.
  • a synthetic 51 basepair Sau3A-HindIII linker encod ⁇ ing the 3 C-terminal amino acids of SOD, methionin and the 13 N-terminal amino acids of proinsulin were combined with the two purified fragments and an NcoI-Sall-cut pPGAP vec ⁇ tor (Travis et al., reference above) .
  • a fragment containing the regulatory sequence of ADH2 was isolated from plasmid pADR2 (Beier and Young, Nature 300, 724-728, 1982) , which contains a BamHI-SphI fragment encoding ADH2 and its upstream regulatory region. Plasmid pADR2 was cut with EcoRV, which cuts in the position +66 from the ATG start-codon. The DNA was furthermore treated with Bal31 nuclease and synthetic Xhol-linkers were ligated to the ends. After digestion with Xhol and religation, the result ⁇ ing plasmid was transformed into E. coli.
  • a plasmid which contained an Xhol-linker in the position -232 from the ADH2 ATG initiation codon was digested with Xhol, treated with SI nuclease and digested with EcoRI creating a linear mole ⁇ cule with a blunt end at the Xhol-site in the ADH2 regula ⁇ tory region and an EcoRI-site originating from pBR322.
  • a fragment containing the GAPDH promotor-region was isola-- ted by digestion with the restriction enzymes Alul and EcoRI of pPGAP (Travis et al.) and isolation of a 400 base- pair fragment.
  • the hybrid promotor was now constructed by ligating the GAPDH promotor fragment with the linearized plasmid containing the ADH2 sequences. The fusion between the two fragments was verified by sequence analysis.
  • the final expression plasmid was now constructed by liga ⁇ ting the BamHI/NcoI-fragment isolated from pJS104 and the NcoI/BamHI-fragment from pSIl, digesting the ligation pro ⁇ duct with BamHI and ligating the fragment to the yeast replicating vector pCl/1 (Brake et al., Proc. Natl. Acad. Sci. , J31., 4642-4646, 1984) treated with calf intestine phosphatase.
  • Cloning of the insulin gene in the M13 phage The 3034 basepair BamHI-fragment isolated from the ex- pression plasmid pYASIl was cloned into the replicative form of the M13 phage Ml3mpl8 digested with BamHI. After transformation of the E. coli strain JM101, the presence and orientation of the insert was verified by sequence analysis on DNA isolated as described by Messing and Viei- ra, Gene 1_9, 269-276, 1982.
  • the mutagenisation primer used was synthesized as described by Sanchez-Pescador and Urdea, DNA, _3 / 339-343, 1982. The sequence was: d (ACAACATTGTTGAACAATACC) .
  • the 21-mer was kinased at the 5 '-end in a 10 plitre volume containing 70 mM Hepes, pH 7.0, 10 mM MgCl 2 , 5 mM DTT, 1 itiM ATP, 50 pmol oligonucleotide and 3.6 units T4 polynucleo- tide kinase from Amersham.
  • the incubation was carried out for 2 x 30 min. with addition of 1 plitre 10 mM ATP be ⁇ tween the two incubations.
  • the 21-mer was labelled at the 5'-end in a 50 ⁇ litre vol ⁇ ume containing 70 mM Hepes, pH 7.0, 10 mM MgCl ⁇ , 5 mM DTT, 40 pmol oligonucleotide, 2.5 mM ( ⁇ - 32P) -ATP and 7 units of
  • T4 polynucleotide kinase The incubation was 30 min. at
  • Template-DNA in which a number of thymidin molecules have been replaced by uracil, can be isolated from the strain E. coli RZ1032 (T.A. Kunkel, reference given earlier) .
  • the strain was infected with M13-phages containing the insulin g sequence in the following way: 10 M13-phages are mixed with 100 ml 2 x YT medium (yeast extract 5 g/litre, tryp- tone 8 g/litre, NaCl 5 g/litre) supplemented with 0.25 ug/ml uridine and 10 ml E. coli RZ1032-cells in mid-loga- rithmic phase.
  • the culture was incubated with shaking at 37°C for 16 hours. From this culture single-stranded uracil- -containing DNA was purified according to Messing and Viei- ra (reference given earlier) scaled up to the greater vol- ume.
  • Oligonucleotide-primer second-strand synthesis Single-stranded Ml3mpl8 (0.13 pmol) containing the insulin sequence and isolated from the uracil-incorporating strain RZ1032 was incubated with the 5 '-kinased mutagenisation primer (5 pmol) in 20 mM Hepes, pH 7.3, 10 mM MgCl.,, 50 mM NaCl and 1 mM DTT. The mixture was heated to 85°C and then cooled to room temperature.
  • the filters were bathed in 0.5 M NaOH, 1.5 M NaCl for 1 minute, in 0.5 M Tris-HCl, pH 8.0, 1.5 M NaCl for 1 minute and finally in 0.3 M NaCl, 0.03 M sodium citrate (2 x SSC) for 5 minutes.
  • the filters were then baked in a vacuum-oven at 80 C for 2 hours and pre- -hybridized in 20 ml 0.9 M NaCl, 0.09 M sodium citrate, 0.2% serumalbumin, 0.2% Ficoll, 0.2% polyvinylpyrrolidone,
  • the positive phages were used for infecting the E.coli strain JM101. About 10 phages and 5 colonies of JM101 were grown in 5 ml 2 x YT for 6 hours at 37 C and the double- -stranded, circular DNA was purified according to the meth ⁇ od described by Birnboim and Doly, Nucleic Acids Res., 7, ' 1513 (1979) .
  • Ligation to the yeast replication vector pCl/1 The BamHI-fragment isolated above was ligated to the vector pCl/1 in the following reaction mixture: 0.6 ug fragment, 0.1 ⁇ g vector treated with BamHI and phosphatase, 50 mM Tris-HCl, pH 7.4, 10 mM MgCl 2 , 10 mM DTT and 1 mM ATP in a final volume of 20 ⁇ litres. 5 ⁇ litres of the ligation mix were transformed into the E.coli strain MC1061 in which the modified expression plasmid was propagated and identified.
  • the yeast Saccharomyces cerevisiae P017 (a., Ieu2) was trans ⁇ formed according to a procedure described by Hinnen et al., Proc. Natl. Acad. Sci., USA, 75, 1929, 1978.
  • Example 2 The yeast Saccharomyces cerevisiae P017 (a., Ieu2) was trans ⁇ formed according to a procedure described by Hinnen et al., Proc. Natl. Acad. Sci., USA, 75, 1929, 1978.
  • a transformant was used to inoculate YPD medium (Sherman et al., Methods in yeast genetics, Cold Spring Harbor La- boratory, 1981) . Following growth at 30 C to stationary phase, the culture was diluted 20 times into YP-medium containing 1% ethanol and again grown to saturation at 30 C,
  • the hybrid-protein containing fractions (detected by SDS- -PAGE) was diluted with 3 volumes of water, and the pro ⁇ tein was precipitated by addition of 390 g of ammonium sulphate per litre. The precipitation was isolated by cen- trifugation and after resuspension in water it was dia- lyzed against water and lyophilized.
  • Preparation of sulphitated precursor The lyophilized residue from the CNBr-cleavage was dis ⁇ solved at 37 C in 50 ml of 0.2 M disodium hydrogen phos ⁇ phate, 8 M urea, adjusted to pH 7.4 with 5 M acetic acid and 12.5 ml of 0.5 M sodium sulphite, 0.2 M EDTA, 8 M urea, adjusted to pH 7.4 with glacial acetic acid was added and the solution was left at 37 C. After 10 min. 6 ml of 0.5 M sodium tetrathionate, 8 M urea, adjusted to pH 7.4 with glacial acetic acid was added. After 30 min. 12.5 ml of the said sulphite solution and after 40 min. 7 ml of the said tetrathionate solution were added, and the reaction mixture was left for further 60 min. at 37 C.
  • Trisacryl ( ⁇ R)GF-05 By gelfiltration on a column of Trisacryl ( ⁇ R)GF-05 the pro ⁇ tein was transferred to a buffer containing 0.05 M acetic acid, 0.01 M sodium chloride, 7 M urea and adjusted to pH 4.7 with sodium hydroxide, and the solution was applied on a 5 x 15 cm column of SP-Trisacryl ⁇ M, equilibrated at 4°C with the said buffer. The protein was then eluted by the same buffer at a flow rate of 100 ml per hour, and the precursor containing fractions were pooled, desalted on a column of Trisacryl ( ⁇ R- / )GF-05 in 0.05 M ammonium bicarb ⁇ onate and lyophilized.
  • insulin precursors were prepared by the meth ⁇ ods described above:
  • the protein powder was dissolved in a mixture containing 200 mg of threonine methyl ester, 1.0 ml of ethanol and 0.4 ml of distilled water.
  • the pH value was adjusted to 6.3 with acetic acid, and 2 ml of Trypsin-Sepharose ⁇ were ad ⁇ ded.
  • the trypsin-matrix was removed by filtration, and the protein was precipitated by adding 10 volumes of 2-propanol.
  • the air-dried precipitate was redissolved in 0.02 M TRIS/hydrochloride, 60% (by volume) ethanol, pH 8.25, applied to a 1.6 x 20 cm Q-Sepharose ⁇ - ⁇ - CL-6B Fast Flow column, equilibrated with said buffer, and eluted with a linear sodium chloride gradient in the same buffer in- creasing from 0 to 0.1 M over 15 hours at a flow rate of 50 ml per hour.
  • the ethanol was removed in vacuo from the fraction containing (A4-gln) -human insulin, B30-methyl ester, and the protein was precipitated by adjusting the pH value to 6.8. After centrifugation and lyophilization the B30-methyl ester was hydrolyzed for 10 minutes in cold 0.1 M sodium hydroxide at a protein concentration of 10 mg/ml followed by adjustment of the pH value to 8.5.
  • the solution was diluted with 2 volumes of 0.02 M TRIS/- hydrochloride, pH 8.5, and was then applied to a 1.6 x 20 cm Q-Sepharose ⁇ CL-6B Fast Flow column and eluted as described above.
  • the protein was precipitated at a pH value of 6.3 after removal of the ethanol. 30 mg of (A4-gln) - -human insulin was obtained after lyophilization.
  • the purity of the product was ascertained by reverse phase high pressure liquid chromatography, and the identity of the product was confirmed by amino acid analysis and multi- step Edman degradation.
  • the hereby precipitated protein was iso ⁇ lated by centrifugation and lyophilization.
  • the protein powder was redissolved in a mixture of 400 mg of threonine methyl ester, 2.0 ml of ethanol and 0.80 ml of distilled water.
  • the pH value was adjusted to 6.3 with acetic acid, and 3.2 ml of Trypsin-Sepharose was added.
  • the trypsin- -matrix was removed by filtration, and the protein was pre ⁇ cipitated by adding 10 volumes of 2-propanol.
  • the air-dried precipitate was redissolved in 0.02 M TRIS/hydrochloride, 60% (by volume) ethanol, pH 8.25, applied to a 1.6 x 20 cm Q-Sepharose ⁇ CL-6B Fast Flow column, equilibrated with said buffer, and eluted with a linear sodium chloride gra ⁇ host in the same buffer increasing from 0 to 0.1 M over 15 hours at a flow rate of 50 ml per hour.
  • the ethanol was removed in vacuo from the_ contain ⁇ ing (A4-g ⁇ n) -human insulin, B30-methyl ester, and the pro ⁇ tein was precipitated by adjusting the pH value to 6.8.
  • the purity of the product was ascertained by reverse phase high pressure liquid chromatography, and the identity of the product was confirmed by amino acid analysis and multi- step Edman degradation.
  • the resin was then removed by filtra ⁇ tion, and the resulting solution mainly containing _/(A4,B21) -gln/-des-B30-insulin was adjusted to pH 6.5.
  • the precipitated protein was isolated by centrifugation and lyophilization.
  • the protein powder was redissolved in a mixture of 400 mg of threonine methyl ester, 2.0 ml of ethanol and 0.80 ml of 20
  • the ethanol was removed in vacuo from the fraction containing _/(A4,B21)-gin/-human insulin, B30-methyl ester, ⁇ n ⁇ the pro ⁇ tein was precipitated by adjusting the pH value to 7. After centrifugation and lyophilization the B30-methyl ester was hydrolyzed for 10 minutes in cold 0.1 M sodium hydroxide at a protein concentration of 10. mg/ml followed by adjust ⁇ ment o'f the pH value to 9.
  • the solution was diluted with 2 volumes of 0.02 M TRIS/- hydrochloride, pH 9, and was then applied to a 1.6 x 20 cm Q-Sepharose ⁇ - ⁇ - CL-6 Fast Flow column and eluted as de ⁇ scribed above.
  • the protein was precipitated at a pH value of 6.5 after removal of the ethanol. 28 mg of _ (A4,B21)-gin/-human insulin were obtained after lyophili- zation.
  • the purity of the product was ascertained by reverse phase high pressure liquid chroma ography, and the' identity of the product was confirmed by amino acid analysis and multi- step Ed an degradation.
  • the protein powder was dissolved in a mixture containing 250 mg of threonine methyl ester, 1.25 ml of ethanol and 0.5 ml of distilled water.
  • the pH value was adjusted to 6.3 with acetic acid, and 2 ml 10 ded.
  • the ethanol was removed in vacuo from the fraction contain ⁇ ing _/(A4,B21)-gln/-human insulin, B30-methyl ester, and the protein was precipitated by adjusting the pH value to 7.
  • the B30 methyl ester was hydrolyzed for 10 minutes in cold 0.1 M sodium 25 hydroxide at a protein concentration of 10 mg/ml followed by adjustment of the pH value to 9.
  • the solution was di ⁇ luted with 2 volumes of 0.02 M TRIS/-hydrochloride, pH 9, and was then applied to a 1.6 x 20 cm Q-Sepharose ⁇ CL-6B Fast Flow column and eluted as described above.
  • the protein 0 was precipitated at a pH value of 6.5 after removal of the ethanol. 25 mg of _/ (A4,B21) -gin/-human insulin were ob ⁇ tained after lyophilization.
  • the purity of the product was ascertained by reverse phase high pressure liquid chromatography, and the identity of 5 the product was confirmed by amino acid analysis and multi- step Edman degradation.
  • Preparation for injection containing (A4-gln)-human pro ⁇ insulin 25 mg of (A4-gln)-human proinsulin were dissolved in 3 ml of 0.0225 M phosphoric acid containing 0.5% of m-cresol and 2.6% of glycerol, and the pH value was adjusted to 7.4 with sodium hydroxide solution. The volume was adjusted to 5.0 ml with water, and the solution was sterilized by fil- tration.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Emergency Medicine (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

On prépare selon un procédé connu des précurseurs d'insuline représentés par la séquence d'acides amines suivante: (I), dans laquelle au moins l'un des groupes RB13, RB21, RA4 et RA17 représente un résidu d'acide aminé neutre, et les autres, s'il y a lieu, représentent Glu; les positions A6 et A11, A7 et B7, et A20 et B19, respectivement, sont reliées par des ponts de soufre, et Xn représente une liaison de peptides ou une chaîne de peptides ne dépassant pas 40 éléments, le dernier élément adjacent à GlyA1 étant Lys ou Arg. Lesdits précurseurs peuvent être convertis en dérivés d'insuline ou être utilisés dans des préparations pharmaceutiques selon un procédé connu.
PCT/DK1987/000111 1986-09-12 1987-09-11 Precurseurs d'insuline WO1988002005A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DK258688A DK258688A (da) 1986-09-12 1988-05-11 Insulinprecursorer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DK437786A DK437786D0 (da) 1986-09-12 1986-09-12 Insulinprecursorer
DK4377/86 1986-09-12

Publications (1)

Publication Number Publication Date
WO1988002005A1 true WO1988002005A1 (fr) 1988-03-24

Family

ID=8132996

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK1987/000111 WO1988002005A1 (fr) 1986-09-12 1987-09-11 Precurseurs d'insuline

Country Status (6)

Country Link
EP (1) EP0282550A1 (fr)
JP (1) JPH01501150A (fr)
AU (1) AU8028387A (fr)
DK (1) DK437786D0 (fr)
ES (1) ES2007110A6 (fr)
WO (1) WO1988002005A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989012647A1 (fr) * 1988-06-20 1989-12-28 Novo-Nordisk A/S Precurseurs d'insuline
WO1990001038A1 (fr) * 1988-07-20 1990-02-08 Nordisk Gentofte A/S Analogues d'insuline humaine et preparations les contenant
EP0367163A2 (fr) * 1988-11-03 1990-05-09 Hoechst Aktiengesellschaft Procédé de préparation d'un précurseur d'insuline chez les streptomyces
WO1990011299A1 (fr) * 1989-03-20 1990-10-04 Novo Nordisk A/S Nouveaux composes d'insuline
US5426036A (en) * 1987-05-05 1995-06-20 Hoechst Aktiengesellschaft Processes for the preparation of foreign proteins in streptomycetes
US5506202A (en) * 1988-12-29 1996-04-09 Hoechst Aktiengesellschaft Insulin derivatives, a process for the preparation thereof, the use thereof, and a pharmaceutical formulation containing them

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE58906966D1 (de) * 1988-06-23 1994-03-24 Hoechst Ag Mini-Proinsulin, seine Herstellung und Verwendung.

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0055945A2 (fr) * 1981-01-02 1982-07-14 Genentech, Inc. Proinsuline humaine, ses analogues, méthode de préparation par expression polypeptidique microbienne et sa conversion en insuline humaine
EP0068701A2 (fr) * 1981-06-19 1983-01-05 Canadian Patents and Development Limited Gènes pour proinsuline à chaîne-C modifiée
EP0163529A1 (fr) * 1984-05-30 1985-12-04 Novo Nordisk A/S Précurseurs d'insuline, procédé pour leur production et procédé pour la production d'insuline humaine à partir de tels précurseurs d'insuline
EP0194864A2 (fr) * 1985-03-12 1986-09-17 Novo Nordisk A/S Peptides
EP0195691A1 (fr) * 1985-03-22 1986-09-24 Novo Nordisk A/S Procédé pour la préparation de précurseurs d'insuline et procédé de préparation d'insuline humaine
WO1986005497A1 (fr) * 1985-03-15 1986-09-25 Nordisk Gentofte A/S Derives d'insuline et preparations pharmaceutiques contenant ces derives
EP0214826A2 (fr) * 1985-08-30 1987-03-18 Novo Nordisk A/S Analogues d'insuline et leur méthode de préparation

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0055945A2 (fr) * 1981-01-02 1982-07-14 Genentech, Inc. Proinsuline humaine, ses analogues, méthode de préparation par expression polypeptidique microbienne et sa conversion en insuline humaine
EP0068701A2 (fr) * 1981-06-19 1983-01-05 Canadian Patents and Development Limited Gènes pour proinsuline à chaîne-C modifiée
EP0163529A1 (fr) * 1984-05-30 1985-12-04 Novo Nordisk A/S Précurseurs d'insuline, procédé pour leur production et procédé pour la production d'insuline humaine à partir de tels précurseurs d'insuline
EP0194864A2 (fr) * 1985-03-12 1986-09-17 Novo Nordisk A/S Peptides
WO1986005497A1 (fr) * 1985-03-15 1986-09-25 Nordisk Gentofte A/S Derives d'insuline et preparations pharmaceutiques contenant ces derives
EP0195691A1 (fr) * 1985-03-22 1986-09-24 Novo Nordisk A/S Procédé pour la préparation de précurseurs d'insuline et procédé de préparation d'insuline humaine
EP0214826A2 (fr) * 1985-08-30 1987-03-18 Novo Nordisk A/S Analogues d'insuline et leur méthode de préparation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Hoppe-Seyler'S Z.Physiol.Chem, Bd 360, S 1619-1632, November 1979, PRITZ MAKI et al, "Synthesis and Biological Activity of Seventeen Analogues of Human Insulin", *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5426036A (en) * 1987-05-05 1995-06-20 Hoechst Aktiengesellschaft Processes for the preparation of foreign proteins in streptomycetes
WO1989012647A1 (fr) * 1988-06-20 1989-12-28 Novo-Nordisk A/S Precurseurs d'insuline
JPH03505206A (ja) * 1988-06-20 1991-11-14 ノボ　ノルデイスク　アクツイエセルスカプ プロペプチド
US5202415A (en) * 1988-06-20 1993-04-13 Novo Nordisk A/S Insulin precursors
WO1990001038A1 (fr) * 1988-07-20 1990-02-08 Nordisk Gentofte A/S Analogues d'insuline humaine et preparations les contenant
EP0367163A2 (fr) * 1988-11-03 1990-05-09 Hoechst Aktiengesellschaft Procédé de préparation d'un précurseur d'insuline chez les streptomyces
EP0367163A3 (fr) * 1988-11-03 1991-03-06 Hoechst Aktiengesellschaft Procédé de préparation d'un précurseur d'insuline chez les streptomyces
US5506202A (en) * 1988-12-29 1996-04-09 Hoechst Aktiengesellschaft Insulin derivatives, a process for the preparation thereof, the use thereof, and a pharmaceutical formulation containing them
WO1990011299A1 (fr) * 1989-03-20 1990-10-04 Novo Nordisk A/S Nouveaux composes d'insuline

Also Published As

Publication number Publication date
AU8028387A (en) 1988-04-07
ES2007110A6 (es) 1989-06-01
EP0282550A1 (fr) 1988-09-21
DK437786D0 (da) 1986-09-12
JPH01501150A (ja) 1989-04-20

Similar Documents

Publication Publication Date Title
AU648670B2 (en) A-C-B Proinsulin, method of manufacturing and using same, and intermediates in insulin production
KR940000756B1 (ko) 인슈린 유사체의 제조방법
EP0375437B1 (fr) Analogues de l'insuline humaine
JP2686090B2 (ja) 新規融合蛋白質およびその精製方法
AU637365B2 (en) Novel insulin compounds
AU778369B2 (en) C-peptide for the improved production of insulin and insulin analogues
WO1996034882A1 (fr) Insuline monocatenaire a bioactivite elevee
IE64303B1 (en) Propeptides
CA2208095C (fr) Production d'insuline humaine
JPS62502538A (ja) 新規インシユリン誘導体およびこれら誘導体を含有する医薬製剤
CA1340830C (fr) Methode pour la preparation d'un peptide physiologiquement actif refermant un groupe cysteine
US5218093A (en) EGF variants and pharmaceutical use thereof
CA2007124A1 (fr) Polypeptide ressemblant a la motiline et utilisation
WO1988002005A1 (fr) Precurseurs d'insuline
AU2019218315A1 (en) Codon optimized precursor gene and signal peptide gene of human insulin analogue
CA1297814C (fr) Procede de fabrication du facteur de croissance insulinoide de type i faisant appel a un plasmide
JPH06306100A (ja) Ｖｉｐアナログ調製用融合蛋白、ｖｉｐアナログの製法並びにそのための遺伝子組換えプラスミド及び形質転換微生物
JP3534434B2 (ja) トロンボモジュリン類発現用シグナルペプチド
NO315003B1 (no) Fremgangsmåte for fremstilling av polypeptid samt DNA-sekvens som koder fordette

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU DK FI JP KR NO US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1987906169

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1987906169

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1987906169

Country of ref document: EP