USRE46873E1 - Multi-targeted RNAi therapeutics for scarless wound healing of skin - Google Patents

Multi-targeted RNAi therapeutics for scarless wound healing of skin Download PDF

Info

Publication number
USRE46873E1
USRE46873E1 US15/166,223 US200815166223A USRE46873E US RE46873 E1 USRE46873 E1 US RE46873E1 US 200815166223 A US200815166223 A US 200815166223A US RE46873 E USRE46873 E US RE46873E
Authority
US
United States
Prior art keywords
sirna
seq
hoxb13
wound
skin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US15/166,223
Other languages
English (en)
Inventor
Patrick Y. Lu
Ling Li
Vera Simonenko
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Research Laboratory Inc
Sirnaomics Inc
Original Assignee
Sirnaomics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sirnaomics Inc filed Critical Sirnaomics Inc
Priority to US15/166,223 priority Critical patent/USRE46873E1/en
Assigned to SIRNAOMICS, INC. reassignment SIRNAOMICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LI, LING
Assigned to SIRNAOMICS, INC. reassignment SIRNAOMICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SIMONENKO, VERA, LU, PATRICK Y.
Application granted granted Critical
Publication of USRE46873E1 publication Critical patent/USRE46873E1/en
Assigned to GENERAL RESEARCH LABORATORY, INC. reassignment GENERAL RESEARCH LABORATORY, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SIRNAOMICS, INC.
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to compositions and methods for improvement of skin scarless wound healing and other skin conditions, such as psoriasis and lupus-caused cutaneous lesions, using compositions of small interfering RNA (siRNA) molecules with multiple oligonucleotide sequences targeting multiple disease causing genes.
  • siRNA small interfering RNA
  • Skin the largest organ of the body, consists of an underlying mesenchymal (dermal) layer and an outer epithelial (epidermal) layer.
  • the primary function of the skin is to serve as a protective barrier against the environment. Loss of the integrity of large portions of the skin as a result of injury or illness may lead to major disability or even death. Every year in the United States more than 1.25 million people have burns and 6.5 million have chronic skin ulcers caused by pressure, venous stasis, or diabetes mellitus. The primary goals of the treatment of wounds are rapid wound closure and a functional and aesthetically satisfactory scar (1). Recent advances in cellular and molecular biology have greatly expanded our understanding of the biologic processes involved in wound repair and tissue regeneration and have led to improvements in wound care (2).
  • the response to injury is a phylogenetically primitive, yet essential innate host immune response for restoration of tissue integrity.
  • Tissue disruption in higher vertebrates unlike lower vertebrates, results not in tissue regeneration, but in a rapid repair process leading to a fibrotic scar.
  • Wound healing proceeds via an overlapping pattern of events including coagulation, inflammation, epithelialization, formation of granulation tissue, matrix and tissue remodeling.
  • the process of repair is mediated in large part by interacting molecular signals, primarily cytokines, that motivate and orchestrate the manifold cellular activities which underscore inflammation and healing.
  • Wound healing is a dynamic, interactive process involving soluble mediators, blood cells, extracellular matrix, and parenchymal cells. Wound healing has three phases—inflammation, tissue formation, and tissue remodeling—that overlap in time (1,2).
  • keratinocytes originate from a single-cell proliferating basal layer, undergo growth arrest, and migrate upward in a tightly controlled program of differentiation to produce the morphologically distinct layers of the epidermis.
  • the epidermis is continually renewed during the life of the organism.
  • Adult mammalian skin also has tremendous capacities for repair following injury. However, responses that have been optimized for rapid wound closure and prevention of infection result in an imperfect restoration of the skin as shown by epidermal and dermal scarring.
  • cytokines cytokines, growth factors and their receptors (5-7). They influence cell migration, growth and proliferation in a complex, orchestrated manner and are involved in neutrophil and macrophage infiltration, angiogenesis, fibroplasia, matrix deposition, scarring and reepithelialization. Besides platelets and macrophages, fibroblasts are the major cellular source of cytokines or growth factors during wound healing. The scarless wound healing in fetal skin at early gestation is a result of the unique cytokine or growth factor profile.
  • TGF- ⁇ transforming growth factor-beta
  • Called growth factors for historical reasons, their main function is to control cell proliferation and differentiation and to stimulate the synthesis of extracellular matrix such as collagen.
  • TGF- ⁇ has been found by immunohistochemistry in unwounded fetal skin, and high levels of TGF- ⁇ are expressed at gestational ages associated with scarless repair. Exogenous application of TGF- ⁇ to normally scarless fetal wounds resulted in scar formation and an adult-like inflammatory response was observed. The profibrotic nature of TGF- ⁇ was confirmed in wounds of adult rats as neutralizing TGF- ⁇ antibody partially reduced the amount of scarring.
  • TGF- ⁇ stimulates collagen I production, which is the predominant collagen type in adult skin.
  • TGF- ⁇ neutralizing antibodies do not entirely prevent scarring in the adult skin, and recent studies question the efficacy of TGF- ⁇ as an dominant Scar-forming factor (8-15).
  • TGF-beta 1 and -beta 2 expression accompanied by increased and prolonged TGF-beta 3 levels in wounded E16 animals correlated with organized collagen deposition.
  • increased and prolonged TGF-beta 1 and -beta 2 expression accompanied by decreased and delayed TGF-beta 3 expression in wounded E19 animals correlated with disorganized collagen architecture.
  • increased TGF-beta 1, -beta 2, and decreased TGF-beta 3 expression is responsible for the late gestation fetal scar formation.
  • COX-2 has also received much attention recently as it is involved in diseases associated with dysregulated inflammatory conditions, such as rheumatoid and osteoarthritis, cardiovascular disease, and the carcinogenesis process (16-20).
  • COX-2 undergoes immediate-early up-regulation in response to an inflammatory stimulus (20, 21), such as a wound. It functions by producing prostaglandins that control many aspects of the resulting inflammation, including the induction of vascular permeability and the infiltration and activation of inflammatory cells (22).
  • Interest in the role of the COX-2 pathway and other aspects of inflammation in the adult wound repair process is increasing (35) as these early events have been shown to regulate the outcome of repair.
  • PGE 2 a COX-2 product shown to mediate many processes in the skin, caused a delay in healing and the production of a scar when introduced into early fetal wounds.
  • the involvement of the COX-2 pathway in scar formation is further highlighted by the fact that increasing PGE 2 levels in scarless wounds results in the conversion of a scarless healing process into one of repair with the generation of a scar.
  • the introduction of PGE 2 induced inflammation in fetal wounds (26), although their effect on collagen deposition or fibrosis was not examined. Whether PGE 2 displays immunosuppressive or anti-inflammatory properties or instead acts as a pro-inflammatory molecule most likely results from differences in the expression or activity of the receptors for PGE 2 .
  • PGE 2 could be inducing scar formation in fetal wounds.
  • PGE 2 could be enhancing acute inflammation, already known to interfere with scarless healing, thereby indirectly promoting scar formation through the recruitment and activation of inflammatory cells.
  • PGE 2 treatment could be both delaying healing and promoting scar tissue deposition through increases in the pro-fibrotic TGF ⁇ 1 (27).
  • Disruption of the TGF ⁇ signaling pathway in smad3-deficient mice has been shown to speed the rate of healing, and extensive data demonstrates restricted TGF ⁇ 3 levels are crucial to scarless healing.
  • fibroblast proliferation in response to PGE 2 suggests that PGE 2 could be directly stimulating fibroblasts to proliferate, amplifying collagen production and scarring.
  • HoxB13 The evolutionarily conserved families of Hox transcription factors have been considered attractive candidates for regulation of fetal skin regeneration due to their critical roles for directing differentiation during organogenesis.
  • Second trimester fetal skin which heals without a scar
  • human adult skin demonstrated that HoxB13 is differentially expressed in fetal vs. adult wounds.
  • HoxB13 expression was significantly down-regulated in fetal wounds compared with unwounded controls.
  • down-regulation of HoxB13 expression may be necessary for fetal scarless wound healing. It also raises the possibility that reducing or eliminating HoxB13 from adult skin could improve wound healing.
  • HoxB13 KO wounds exhibit several characteristics of early gestational fetal wounds, including faster closure, increased tensile strength, and less dermal scarring when compared with wounds from their wild-type (WT) counterparts.
  • Biochemical evaluation revealed that levels of epidermal and dermal HA are significantly higher in unwounded adult HoxB13 KO skin compared with WT skin.
  • HoxB13 KO incisional wounds exhibit enhanced healing with better restored dermal integrity of HoxB13 KO wounds than in WT wounds.
  • HoxB13 KO adult excisional wounds also close faster than WT excisional wounds.
  • PDGF platelet-derived growth factor
  • a key feature of scarless fetal healing appears to be a lack of inflammation in response to the wounding event.
  • the early phases of wound healing in late fetal and adult skin are characterized by a robust inflammatory response, and eventually a permanent scar in the wound area.
  • the interleukins IL-6 and IL-8 have been studied in fetal wound repair, the role of other classic inflammatory mediators in scarless healing is not known.
  • Smad3 protein is involved in mediating intracellular signaling by members of the transforming growth factor-beta superfamily and plays a critical role in the cellular proliferation, differentiation, migration, and elaboration of matrix pivotal to cutaneous wound healing.
  • Mutant monocytes could be lipopolysaccharide stimulated to produce specific pro-inflammatory agents (macrophage monocyte inhibitory factor) in a fashion similar to wild-type cells, but exhibited a muted response to androgen-mediated stimulation while maintaining a normal response to estrogen-induced macrophage inhibitory factor inhibition.
  • Smad3 plays a role in mediating androgen signaling during the normal wound healing response and implicate Smad3 in the modulation of inflammatory cell activity by androgens.
  • Fibronectin is a multi-functional, adhesion protein and involved in multi-steps of the wound healing process. Strong evidence suggests that FN protein diversity is controlled by alternative RNA splicing; a coordinated transcription and RNA processing that is development-, age-, and tissue/cell type-regulated. Expression, regulation, and biological function of the FN gene and various spliced forms in this model are unknown. Airway and skin incisional wounds were made in fetal (gestation days 21-23), weanling (4-6 weeks) and adult (>6 months) rabbits. Expression profiles were obtained using mRNA differential display and cDNAs of interest were cloned, sequenced and validated by real-time PCR.
  • RNA interference is a sequence-specific RNA degradation process that provides a relatively easy and direct way to knockdown, or silence, theoretically any gene (33, 34).
  • RNA interference a double stranded RNA is cleaved by an RNase III/helicase protein, Dicer, into small interfering RNA (siRNA) molecules, a dsRNA of 19-23 nucleotides (nt) with 2-nt overhangs at the 3′ ends.
  • siRNA small interfering RNA
  • RISC RNA-induced-silencing-complex
  • siRNA One strand of siRNA remains associated with RISC, and guides the complex towards a cognate RNA that has sequence complementary to the guider ss-siRNA in RISC. This siRNA-directed endonuclease digests the RNA, thereby inactivating it.
  • Studies have revealed that the use of chemically synthesized 21-25-nt siRNAs exhibit RNAi effects in mammalian cells, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function (33, 36, 37).
  • siRNA duplexes it is presently not possible to predict with a high degree of confidence which of many possible candidate siRNA sequences potentially targeting a mRNA sequence of a disease gene in fact exhibit effective RNAi activity. Instead, individually specific candidate siRNA polynucleotide or oligonucleotide sequences must be generated and tested in the mammalian cell culture to determine whether the intended interference with expression of a targeted gene has occurred.
  • the unique advantage of siRNA makes it possible to be combined with multiple siRNA duplexes to target multiple disease causing genes in the same treatment, since all siRNA duplexes are chemically homogenous with same source of origin and same manufacturing process (33, 36-40).
  • the invention relates to siRNA molecules for use in treating skin wounds.
  • the invention provides a small interfering RNA (siRNA) molecule comprising a double stranded (duplex) oligonucleotide, wherein the oligonucleotide targets a complementary nucleotide sequence in a single stranded (ss) target RNA molecule.
  • the ss target RNA target molecule is an mRNA encoding at least part of a peptide or protein whose activity promotes inflammation, wound healing, or scar formation in skin tissue, or it is a micro RNA (miRNA) functioning as a regulatory molecule whose activity promotes inflammation, wound healing, or scar formation in skin tissue.
  • miRNA micro RNA
  • compositions for administering to a subject are added to a pharmaceutically acceptable carrier to provide compositions for administering to a subject.
  • the composition comprises a pharmaceutically acceptable carrier and at least three siRNA molecules, wherein each siRNA molecule binds an mRNA molecule that encodes a gene selected from the group consisting of pro-inflammatory pathway genes, pro-angiogenesis pathway genes, and pro-cell proliferation pathway genes.
  • the invention also provides a method for treating a dermal or epidermal wound in a subject, wherein the wound is characterized at least in part by inflammation and neovascularization.
  • the method comprises administering to the subject a composition comprising at least one siRNA molecule of the invention and a pharmaceutically acceptable carrier, wherein the molecule inhibits expression of at least one gene that promotes pathological or undesired processes in the healing of the wound.
  • compositions of this invention are useful for improvement of skin wound healing and other skin conditions.
  • FIG. 1 Hematoxylin and Eosin staining of wild type lip and back skin.
  • FIG. 2 Collagen organization in WT and Hoxb13 KO wound biopsies.
  • FIG. 3 Scratch wound assays using primary dermal fibroblast isolated from WT and Hoxb13 KO mice.
  • FIG. 4 Reduced proliferation rate in HOXB13 expressing rat epithelial keratinocyte (REK).
  • FIG. 5 Overexpression of HOXB13 results in aberrant differentiation in day 5 lifted culture.
  • FIG. 6 GFP-HOXB13 protein is localized to the nucleus in REK and 293 cells (human epithelial cells).
  • FIG. 7 A. Locations of targeted sequences on mouse VEGF, VEGFR1, and VEGFR2 mRNAs. B. Measurements of mRNA knockdown after siRNA transfection in vitro.
  • FIG. 8 Local delivery of siRNAs targeting VEGF pathway genes inhibits the CpG ODN-induced angiogenesis.
  • FIG. 9 Raf-1 siRNA inhibits tumor growth in vivo after HK polymer mediated intratumoral delivery.
  • FIG. 10 Detection of sequences of all three mRNA species in PC3 cell total RNA samples.
  • FIG. 11 TGF-beta-1 siRNA is able to significantly knock down targeted gene expression in the PC3 cell.
  • FIG. 12 Cox1 siRNA is able to significantly knock down targeted gene expression in the PC3 cell.
  • FIG. 13 Hoxb13 siRNA is able to significantly knock down targeted gene expression in the PC3 cell.
  • FIG. 14 RT-PCR analyses for selection of potent siRNA oligos. The silencing activities of three siRNA oligos targeting the corresponding gene were demonstrated through gel electrophoresis analyses.
  • C Potent siRNA oligo Hxsi-A targeting Hoxb13 was identified based on silencing activity in human cell.
  • FIG. 15 Mouse skin excisional wound model.
  • A Comparison of control group and treatment group at Day 1, 3 and 5.
  • B Observation on Day 5 of a paired 5 mm diameter full-thickness excisional skin wounds created on both sides of the dorsal mid-line of a C57 mouse.
  • C RT-PCR detection of target gene expression from the total RNA isolated from the mouse skin samples.
  • FIG. 16 HK polymer for in vivo siRNA delivery.
  • HKP mixed with siRNA in the aqueous solution
  • nanoparticle was formed as seen in the left panel, observed with Scaning Electron Microscope (SEM).
  • SEM Scaning Electron Microscope
  • Two species of HK polymer have been used for the skin wound siRNA delivery.
  • H3K4b disclosed as SEQ ID NO: 65.
  • HK73b disclosed as SEQ ID NO: 326.
  • FIG. 17 Animal Skin Model for Wound Healing. Use mouse skin excisional wound model to analyze the therapeutic benefit of the nanoparticle-enhanced topical delivery of TGF ⁇ -1-siRNA. Ten mice were used with two wound on the back skin. The diameter of each wound was measured and the images of each wound were also recorded with photo images.
  • FIG. 18 The therapeutic benefit of nanoparticle-TGF ⁇ -1 siRNA was results of target gene knockdown.
  • the RT-PCR analysis demonstrated the TGF ⁇ -1 specific knockdown with either specific siRNA or cocktail siRNA contains TGF ⁇ -1 specific siRNA.
  • the lower row shows the house keeping gene expression.
  • FIG. 19 Nanoparticle-TGF ⁇ -1 siRNA for Wound Healing.
  • group 2 demonstrated smaller wounds on day 5 th and achieved completed closure on day 9 th .
  • the only active TGF ⁇ -1 siRNA without HK polymer nanoparticle (group 3) showed weaker effect and the control siRNA showed no effect even packaged with HK polymer.
  • FIG. 20 Similar Effects of the Hoxb13 siRNA on the Wound Closure. Using nanoparticle packaged Hoxb13 siRNA, we can observe the quantified results regarding wound closure at day 4 and day 7. Hoxb13 siRNA packaged with HK polymer had better and faster wound closure.
  • FIG. 21 Nanoparticle for TGF ⁇ -1, Hoxb13 and Cox-2 siRNA delivery
  • the skin delivery of nanoparticle packaged TGF ⁇ -1, Hoxb13 and Cox-2 siRNA duplexes showed better wound healing using mouse skin wound
  • FIG. 22 Collagen organization in WT mouse wound biopsies.
  • Column A low magnification of (10 ⁇ or 20 ⁇ ) of WT mouse wound biopsies;
  • Column B high magnification (100 ⁇ ) of WT mouse wound biopsies;
  • Column C low magnification (10 ⁇ or 20 ⁇ ) of Hoxb13 KO mouse wound biopsies;
  • Column D high magnification (100 ⁇ ) of mouse wound biopsies.
  • Row 1 unwounded skin; row 2: day 20 wound biopsies; row 3: day 30 wound biopsies; row 4: day 60 wound biopsies. Arrows identify India ink location.
  • FIG. 23 Nanoparticle/Cox-2 siRNA treatment resulted in similar tissue structures. Neodermis in treated wounds looks more like normal dermis; the collagen has interwoven loose structure. By contrast, the collagen fibers in the neodermis of sham control wounds and control siRNA-nanoplexes treated wounds are placed in an abnormal parallel pattern.
  • FIG. 24 H2K4b demonstrated potent antifungal activity.
  • Several doses of H2K4b or histatin 5 ranging up to 100 mg/ml were added to YM (yeast-maltose) medium containing C. albicans. The fungi were then rotated at RT for 24 h and growth inhibition by the polymer was determined as indicated in FIG. 2 .
  • Experiments were performed in triplicate and the data are represented as means ⁇ standard errors. *, P ⁇ 0.001, **, P ⁇ 0.01; H2K4b vs. Histatin 5.
  • FIG. 25 Cytotoxicity Study of HK polymers.
  • LDH-cytotoxicity assay of BHKP Peptides H3K4b, H3(G)K4b (PT73), and H2K4b
  • NHDF normal human dermal fibroblasts
  • BAEC bovine endothelial cells
  • HVEC human umbilical vasculature endothelial cells
  • the present invention relates to various siRNA molecules, compositions containing the molecules, and their methods of use, which are directed to promoting wound healing in skin.
  • the invention provides a small interfering RNA (siRNA) molecule comprising a double stranded (duplex) oligonucleotide, wherein the oligonucleotide targets a complementary nucleotide sequence in a single stranded (ss) target RNA molecule.
  • the ss target RNA target molecule is an mRNA encoding at least part of a peptide or protein whose activity promotes inflammation, wound healing, or scar formation in skin tissue, or it is a micro RNA (miRNA) functioning as a regulatory molecule whose activity promotes inflammation, wound healing, or scar formation in skin tissue.
  • a target mRNA molecule encodes a gene selected from the group of pro-inflammatory pathway genes, pro-angiogenesis pathway genes, and pro-cell proliferation pathway genes.
  • the genes are Hoxb13, TGF- ⁇ 1, TGF- ⁇ 2, or Cox-2.
  • the siRNA sequences are prepared in such way that each duplex can target and inhibit the same gene from, at least, both human and mouse, or non-human primates.
  • an siRNA molecule binds to an mRNA molecule that encodes at least one protein.
  • an siRNA molecule binds to a mRNA molecule encodes at least one human protein.
  • an siRNA molecule binds to human mRNA molecule and to a homologous mouse mRNA molecule, i.e., mRNAs in the respective species that encode the same or similar protein.
  • the siRNA molecule are constructed with reference to the target mRNA coding sequences listed in Tables 2-9.
  • the siRNA molecule has a length of 19-27 base pairs.
  • the molecule can have blunt ends at both ends, or sticky ends at both ends, or one of each.
  • the siRNA molecule may include a chemical modification at the individual nucleotide level or at the oligonucleotide backbone level, or it may have no modifications.
  • the molecules are added to a pharmaceutically acceptable carrier to provide compositions for administering to a subject.
  • the subject is a human.
  • the composition comprises a pharmaceutically acceptable carrier and at least three siRNA molecules, wherein each siRNA molecule binds an mRNA molecule that encodes a gene selected from the group consisting of pro-inflammatory pathway genes, pro-angiogenesis pathway genes, and pro-cell proliferation pathway genes.
  • each siRNA cocktail contains at least three siRNA duplexes that target at least three different gene sequences.
  • each gene is selected from a different pathway.
  • a composition that is a mixture of siRNA molecules may be termed a “cocktail.”
  • a cocktail mixture is chosen from a mixture listed in Tables A, B, C, or D.
  • Table A One particular embodiment is disclosed in Table A, wherein an siRNA (sense: 5′-caaggauaucgaaggcuugcuggga-3′ (SEQ ID NO: 1), antisense: 5′-ucccagcaagccuucgauauccuug-3′ (SEQ ID NO: 2)) binds to mRNA molecules that encode both human and mouse HoxB13 protein, an siRNA molecule (sense: 5′-gucuuuggucuggugccuggucuga-3′ (SEQ ID NO: 3), antisense: 5′-ucagaccaggcaccagaccaaagac-3′ (SEQ ID NO: 4)) binds to mRNA molecules that encode both human and mouse COX-2 protein, and an siRNA molecule (sense: 5′-ccccggaggugauuuccaucuacaa
  • an siRNA (sense: 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ (SEQ ID NO: 7), antisense: 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ (SEQ ID NO: 8)) targets an mRNA molecule that encodes human and mouse both Hoxb13 protein, at least one siRNA molecule (sense: 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9), antisense: 5′-ACAUCAUCAGACCAGGCACCAGACC-3′ (SEQ ID NO: 10)) targets an mRNA molecule that encodes both human and mouse Cox-2 protein, and at least one siRNA molecule (sense: 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11), antisense: 5′-AGAAGUUGGCAUGGUAGCCCUUGGG-3′ (SEQ ID NO: 12)) targets an mRNA molecule
  • an siRNA (sense: 5′-caaggauaucgaaggcuugcuggga-3′ (SEQ ID NO: 1), antisense: 5′-ucccagcaagccuucgauauccuug-3′ (SEQ ID NO: 2)) binds to mRNA molecules that encode both human and mouse HoxB13 protein
  • an siRNA molecule (sense: 5′-ggucuggugccuggucugaugaugu-3′ (SEQ ID NO: 9), antisense: 5′-acaucaucagaccaggcaccagacc-3′ (SEQ ID NO: 10)) binds to mRNA molecules that encode both human and mouse COX-2 protein
  • an siRNA molecule (5′-cacgagcccaagggcuaccaugcca-3′ (SEQ ID NO: 13), antisense: 5′-uggcaugguagcccuugggcucgug-3′ (SEQ ID NO: 14)) binds to
  • the mRNA molecules encode one or more HoxB13 pathway genes, COX-2 pathway genes, TGF-beta pathway genes, or a combination thereof.
  • the mRNA molecules encode one or more pro-angiogenesis genes, pro-inflammatory genes, or a combination thereof, and in yet further embodiments the mRNA molecules encode one or more pro-inflammation genes, or a combination thereof.
  • at least three siRNA molecules therein bind to at least two or more different mRNA molecules.
  • the mixture of siRNA molecules is selected from mixtures presented in Tables E-H.
  • the siRNA cocktail inhibits expression of at least one gene selected from the group consisting of a pro-inflammatory pathway gene, a pro-angiogenesis pathway gene, and a pro-cell proliferation pathway gene.
  • the siRNA cocktail inhibits expression of multiple genes.
  • the siRNA cocktail contains sequences that target those listed in Tables 2, 3, 4 and 5 and that inhibit expression of HoxB13, TGF-beta1, TGF-beta2, and COX-2 in both human and mouse cells.
  • the siRNA cocktail contains sequences presented in Tables 6, 7, and 9 that inhibit expression of PDGFa, VEGFA FGF-2, and Lamin B1 proteins in both human and mouse cells.
  • the siRNA cocktail contains at least three siRNA duplexes at a 1:1:1 ratio, or 1:1.5:0.5 ratio, or 0.5:0.5:2 ratio, or other ratios according to the potency of each siRNA duplex and therapeutic requirements for the application.
  • the invention further provides pharmaceutically effective carriers for enhancing the siRNA cocktail delivery into the disease tissues and cells.
  • the carrier comprises one or more components selected from the group consisting of a saline solution, a sugar solution, a polymer, a lipid, a cream, a gel, and a micellar material.
  • Further components or carriers include a polycationic binding agent, cationic lipid, cationic micelle, cationic polypeptide, hydrophilic polymer grafted polymer, non-natural cationic polymer, cationic polyacetal, hydrophilic polymer grafted polyacetal, ligand functionalized cationic polymer, and ligand functionalized-hydrophilic polymer grafted polymer, biodegradable polyesters, such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), PEG-PEI (polyethylene glycol and polyethylene imine), Poly-Spermine (Spermidine), and polyamidoamine (PAMAM) dendrimers.
  • PLA poly(lactic acid)
  • the carrier is a histidine-lysine copolymer that is believed to form a nanoparticle containing an siRNA molecule, wherein the nanoparticle has a size of about 100-400 nm in diameter formulated with Methylcellulose gel for topical administration.
  • the siRNA molecules may be identified by the following steps: 1) creating a collection of siRNA duplexes designed to target a complementary nucleotide sequence in the ss target RNA molecule, wherein the targeting strands of said siRNA molecules comprise various sequences of nucleotides; 2) selecting the siRNA molecules that show the highest desired effect against said target molecules in vitro; 3) evaluating the selected siRNA molecules in an animal wound model; and 4) selecting the siRNA molecules that show the greatest efficacy in the model.
  • a pharmaceutically acceptable carrier may be added to each of the siRNA molecules selected by step (2) to form pharmaceutical compositions, each of which is evaluated in the animal wound model.
  • the animal wound model is a lip excisional wound model in a Hoxb13 knockout mouse or a back excisional wound model in a Hoxb13 knockout mouse.
  • the siRNA molecules are evaluated in both animal models. Since the targeted genes may express in different cell types in the disease tissues, the efficacy of the particular siRNA cocktail is tested and confirmed not only in the cell culture but also in animal disease models.
  • the components of the siRNA cocktail are selected so that the therapeutic benefit of the cocktail is better than the therapeutic benefit of a single siRNA component by itself.
  • the invention also provides methods to prepare the proper ratio of each duplex in order to allow the siRNA cocktail to achieve the most potent synergistic effect.
  • the ratio is determined by determining the expression level of the target sequence compared to that of the control sequence. A higher expressing target sequence will require a higher ratio of the corresponding siRNA molecules.
  • the invention also provides a method for treating a dermal or epidermal wound in a subject.
  • the wound may be caused by physical injury, a burn, an allergy, diabetic disease, inflammation, or a tumor.
  • the wound may be characterized at least in part by inflammation and neovascularization.
  • the method comprises administering to the subject a composition comprising at least one siRNA molecule of the invention and a pharmaceutically acceptable carrier, wherein the molecule inhibits expression of at least one gene that promotes pathological or undesired processes in the healing of the wound.
  • the composition may be applied in a salve, spray, transdermal patch, or other ways known to those skilled in the art.
  • siRNA-mediated therapy not only depends on identification of the targets and sequence of active siRNA molecules, but also on efficient in vivo delivery to the target tissues and into the cytoplasm (41-43).
  • the routes of delivery of siRNA cocktail formulation for treatment of skin wound healing should be local and topical with appropriate clinically validated carriers.
  • three polymer-based carriers including histidine-lysine polymers (HKP) (44), pegylated PEI (45) and PAMAM dendrimer (46) are particularly useful carriers.
  • the siRNA cocktail inhibits expression of a pro-angiogenesis gene, a pro-inflammatory gene, a gene that promotes scar formation, or a combination thereof.
  • an siRNA is employed against target sequences presented in Tables 2-9.
  • a cocktail employed in the method is one of the mixtures of siRNA molecules disclosed in Tables A-H.
  • HoxB13 KO and WT adult mice (8-16 week old) were given a single 0.5 cm full thickness skin incisional wound in parallel with their front teeth followed by suturing (6.0 Nylon) the wound, mimicking the cleft lip and palate surgery. 10% sterile India ink was administrated so the wound can be traced. Each animal was housed individually after the surgery. Lip wound biopsies were harvested for histological, immuno-histological and gene expression analysis at each desired time point. The expression of HoxB13 was confirmed in the mouse lip skin by RT-PCR with total RNA samples isolated from WT mouse lip skin tissue. Reverse transcription was carried out using a Bio-Rad iScript cDNA synthesis kit.
  • PCR was performed with the forward primer, 5′-CTCCAGCTCCTGTGCCTTAT-3′ (SEQ ID NO: 17) and the reverse primer, 5′-ACTGGCCATAGGCTGGTATG-3′ (SEQ ID NO: 18).
  • the HoxB13 product was detected and confirmed by sequencing (Seq Wright Inc).
  • HoxB13 KO mice (kindly provided by Dr. Mario R. Capecchi) were subjected to the identical surgeries. The KO mice were back crossed with WT, C57BL6 mice for at least 10 generations to ensure that WT and KO mice have the same genetic background.
  • Lip incisional wound biopsies were harvested from day 20, 30 and 60 wounds, and the collagen organization was determined by Masson Trichrome collagen staining ( FIG. 2 ). Day 20 (B-Day20) and 30 (B-Day30) wounds showed more dense collagen staining and greater wound contractions in WT than in HoxB13 KO mice.
  • HOXB13 is an inhibitor of neuronal cell proliferation activator of apoptotic pathways (Economides et al., 2003).
  • HoxB13 knockout fibroblasts were expected to be increased, which is in contrast with what we have observed. It is possible that roles of HoxB13 may be cell type specific. In fact, the over expression of HoxB13 has been correlated with prostate cancer and HoxB13 has been proposed to be a biomarker for prostate cancer (Edwards et al., 2005).
  • REK Rat Epithelial Keratinocytes
  • REK cells were transduced by the retroviral particles with HoxB13 or vector only at MOI ⁇ 10 and selected in 2 ⁇ g/ml puromycin (Note: 1 ⁇ g/ml puromycin is sufficient to kill all un-transduced cells).
  • the puromycin resistant cells were seeded into three 96-well-dishes at one cell per well density. After two week's incubation, the cells in each well were visualized and individual clones were transferred, expanded and maintained in 1 ⁇ g/ml puromycin.
  • the expression of HoxB13 or vector was confirmed by RT-PCR using one primer located in the vector and the other primer located in HoxB13 cDNA.
  • REK cell expressing HoxB13 displayed reduced proliferation rate when compared with REK transduced with vector only using the MTT assay ( FIG. 4 ).
  • Overexpression of HoxB13 in REK resulted in excessive terminal differentiation when these REK cells were raised to air liquid interface ( FIG. 5 ). This result was reproduced with two additional REK-HoxB13 clones.
  • overexpression of HOXB13 affects keratinocyte cells' proliferation and stratification.
  • HOXB13 is a Nuclear Protein
  • GFP-HoxB13 fusion protein was generated by the removal of the termination codon of GFP and initiation codon of HoxB13. GFP-HoxB13 expression was driven by a CMV promoter.
  • the plasmid containing GFP-HoxB13 cDNA was transfected into REK or 293T human kidney epithelial cells using Lipofectamine (Invitrogen, CA) and the expression of GFP was monitored under a fluorescent microscope at 24 hour post transfection.
  • Double-stranded siRNAs were prepared to target the VEGF-pathway factors: mVEGF-A (XM_192823), mVEGFR1 (D88689), and mVEGFR-2 (MN_010612). Two target sequences were picked up from each gene. These sequences are (from 5′ to 3′): mVEGF-A (1. AAGCCGUCCUGUGUGCCGCUG (SEQ ID NO: 19); 2. AACGAUGAAGCCCUGGAGUGC (SEQ ID NO: 20)); mVEGFR1 (1. AAGUUAAAAGUGCCUGAACUG (SEQ ID NO: 21); 2. AAGCAGGCCAGACUCUCUUUC (SEQ ID NO: 22)); mVEGFR2 (1.
  • AAGCUCAGCACACAGAAAGAC (SEQ ID NO: 23); 2. AAUGCGGCGGUGGUGACAGUA (SEQ ID NO: 24)).
  • two siRNA sequences from firefly luciferase (Luc, AF434924) were selected as Luc (1.
  • AAGCUAUGAAACGAUAUGGGC (SEQ ID NO: 25); 2.
  • AACCGCUGGAGAGCAACUGCA (SEQ ID NO: 26)).
  • Blast sequence searching confirmed the specificity of these siRNAs with their targeted sequences, and the mVEGF-A targets were designed to be shared by different mVEGF-A isomers.
  • siRNAs were custom-prepared as 21-nt double stranded RNA oligonucleotides with 19-nt duplex in the middle and dTdT overhang at the 3′-end of either RNA strand, synthesized by Qiagen. To get better RNAi effect, we routinely used a mixture of two double-stranded 21-nucleotide RNA duplexes targeting two different sequences on a single mRNA molecule. The RT-PCR was performed for detection of mRNA knockdown by siRNAs in vitro.
  • Cytoplasmic RNA was isolated by RNAwiz (Ambion, #9736) according to manufacturer's instruction with additional DNAse treatment, and subjected to RT-PCR with specially prepared primers.
  • the mRNA-specific reverse primers for the RT reaction were all 47-mer oligonucleotides with the 5′-end 30-mer of unique sequence (called “TS1” sequence, indicated in uppercase below) linked to a 17-mer sequence unique for each mRNA molecule (in lower case below).
  • mVEGFA Dn GAACATCGATGACAAGCTTAGGTATCGATAcaagctgcctcgccttg (SEQ ID NO: 27); 2): mVEGFR1 Dn: GAACATCGATGACAAGCTTAGGTATCGATAtagattgaagattccgc (SEQ ID NO: 28); 3) mVEGFR2 Dn: GAACATCGATGACAAGCTTAGGTATCGATaggtcactgaca gaggcg (SEQ ID NO: 29).
  • PCR assays for all the tested genes, that follow the RT assay used a same reverse primer, TS1: GAACATCGATGACAAGCTTAGGTATCGATA (SEQ ID NO: 30).
  • the forward primers for PCR all were 30-mer oligonucleotides, unique for each gene: VEGFA Up: GATGTCTACCAGCGAAGCTACTGCCGTCCG (SEQ ID NO: 31); 2) mVEGFR1 Up: GTCAGCTGCTGGGACACCGCGGTCTTGCCT (SEQ ID NO: 32); 3) mVEGFR2 Up: GGCGCTGCTAGCTGTCGCTCTGTGGT TCTG (SEQ ID NO: 33).
  • RT-PCR of housekeeping gene GAPDH was used as control for RNA amount used in RS-PCR.
  • An oligonucleotide dT primer (19-mer) was used for RT assay of GAPDH.
  • the primers used for the followed PCR were 20-mer oligonucleotides: 1) GAPDH Up: CCTGGTCACCAGGGCTGCTT (SEQ ID NO: 34); 2) GAPDH Dn: CCAGCCTTCTCCATGGTGGT (SEQ ID NO: 35).
  • RT-PCR was also used according to the protocol described previously.
  • FIG. 7 shows that all three siRNA pairs are effectively knocking down the target gene expression.
  • siRNAs were tested individually as well as a 1:1:1 mixture of all three (siVEGFA, siVEGFR1, and siVEGFR2). New blood vessel formation in the corneal limbus was monitored at both days 4 and 7 after pellet implantation. As shown in FIG. 8 , significant inhibition of corneal neovascularization resulted with all three test siRNAs compared to those given control siLacZ at day 4 after pellet implantation (P ⁇ 0.05). The combination of the three tested siRNAs was the most effective inhibitor, providing an 60% reduction in neovascularization (P ⁇ 0.01). The local siRNA delivery was carried out with histidine-lysine polymer nanoparticles though subconjunctival administration.
  • the synergistic benefit of the multi-targeted siRNA cocktail was demonstrated in this ocular angiogenesis model.
  • the data provide strong support to the use of multi-targeted siRNA cocktails as disclosed herein to improve adult skin wound healing with less scar tissue formation and stronger tensile strength.
  • siRNA sequences are prepared that target homologous sequences of both human and mouse in the orthologous genes.
  • the siRNA duplex sequence targeting HoxB13 is able to target both human HoxB13 and mouse HoxB13 genes.
  • Table 1 provides sequences identified for siRNA therapeutics (36-37). Each sequence targets both human and mouse corresponding gene. Therefore, the potent sequences defined from the mouse cells can be confirmed again using human cells. If the particular siRNA duplex is potent in both tests, the silencing activity revealed in the mouse animal model could be assumed to be active in human. Using this approach, we can address a general concern about the species specificity of this type of inhibitors, such as the monoclonal antibody, have encountered. In addition, for the therapeutic candidates of siRNA duplexes, the efficacy and toxicity data achieved from the study using mouse model can be easily translated into the human setting.
  • HK polymer-siRNA nanoparticle mediated local delivery has achieved potent anti-angiogenic activity.
  • the tumor growth curves have shown significant anti-tumor efficacy with clear down regulation of the target gene expression.
  • mice with visible tumors were separated into treatment groups. Each group had four mice with eight tumors and tumor size was assessed in two dimensions and calculated. Mice received 4 ⁇ g/tumor of siRNA with each intratumoral injection every 5 days.
  • mice with tumors were divided into these groups: untreated, b-galactosidase siRNA and Raf-1 siRNA.
  • Raf-1 siRNA inhibits tumor growth in vivo after HK polymer mediated intratumoral delivery.
  • HK polymer has been validated as an effective local siRNA delivery carrier. This led us to conclude that HK polymer would facilitate the local siRNA delivery onto the skin wounds with the appropriate formulations.
  • biodegradable polyesters such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), have been extensively studied for a wide variety of pharmaceutical and biomedical applications.
  • the biodegradable polyester family has been regarded as one of the few synthetic biodegradable polymers with controllable biodegradability, excellent biocompatibility, and high safety.
  • block copolymers e.g., diblock, triblock, multiblock, and star-shaped block
  • PEG poly(ethylene glycol)
  • PAMAM dendrimers represent an exciting new class of macromolecular architecture called “dense star” polymers. Unlike classical polymers, dendrimers have a high degree of molecular uniformity, narrow molecular weight distribution, specific size and shape characteristics, and a highly functionalized terminal surface. The manufacturing process is a series of repetitive steps starting with a central initiator core. Each subsequent growth step represents a new “generation” of polymer with a larger molecular diameter, twice the number of reactive surface sites, and approximately double the molecular weight of the preceding generation.
  • Polyamidoamine (PAMAM) dendrimers are the most common class of dendrimers suitable for many materials science and biotechnology applications. PAMAM dendrimers consist of alkyl-diamine core and tertiary amine branches.
  • Lu25-a sense 5′-r(GAGGAGCCUUCAGGAUUACAAGAUU)-3′ (SEQ ID NO: 50) antisense 5′-r(AAUCUUGUAAUCCUGAAGGCUCCUC)-3′ (SEQ ID NO: 51) GF25-a sense 5′-r(GCUGACCCUGAAGUUCAUC)dTdT (SEQ ID NO: 52) antisense 5′-r(GAUGAACUUCAGGGUCAGC)dTdT (SEQ ID NO: 53)
  • Table 1 provides 10 siRNA sequences for each of the targeted gene, HoxB13, COX-2 and TGF- ⁇ .
  • siRNA control sequence was selected targeting a non-related sequence and without homologue in both human and mouse. It is Lu25-a: (sense, 5′-GAGGAGCCUUCAGGAUUACAAGAUU-3′ (SEQ ID NO: 50) and antisense, 5′-AAUCUUGUAAUCCU GAAGGCUCCUC-3′ (SEQ ID NO: 51)).
  • hmHX-1 (sense, 5′-GGUGGCUGGAACAGCCAGAUGUGUU-3′ (SEQ ID NO: 7) and anti-sense, 5′-AACACAUCUGGCUGUUCCAGCCACC-3′ (SEQ ID NO: 8)); hmHX-2: (sense, 5′-GCUGGAACAGCCAGAUGUGUUGCCA-3′ (SEQ ID NO: J and antisense, 5′-UGGCAACACAUCUGGCUGUUCCAGC-3′ (SEQ ID NO: 39)); hmHX-3: (sense, 5′-CGCCAGAUUACCAUCUGGUUUCAGA-3′ (SEQ ID NO: 40) and antisense, 5′-UCUGAAACCAGAUGGUAAUCUGGCG-3′ (SEQ ID NO: 41)); and hmHX-4: (sense, 5′-CAAGGAUAUCGAAGGCUUGCUGGGA-3′ (SEQ ID NO: 7) and anti-sense, 5′-A
  • hmCX-1 (sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9) and antisense, 5′-ACAUCAUCAGACCAGGCACCAGACC-3′ (SEQ ID NO: 10)); hmCX-2: (sense, 5′-GAGCACCAUUCUCCUUGAAAGGACU-3′ (SEQ ID NO: 46) and antisense, 5′-AGUCCUUUCAAGGAGAAUGGUGCUC-3′ (SEQ ID NO: 47)); hmCX-3: (sense, 5′-CCUCAAUU CAGUCUCUCAUCUGCAA-3′ (SEQ ID NO: 48) and antisense, 5′-UUGCAGAUGAGAGACUGAAUUGAGG-3′ (SEQ ID NO: 49)); and hmCX-4: (sense, 5′-GUCUUUGGUCUGGUGCCUGGUCUGA-3′ (SEQ ID NO: 9) and antisense, 5′-ACAUCA
  • hmTF-1 (sense, 5′-GGAUCCACGAGCCCAAGGGCUACCA-3′ (SEQ ID NO: 42) and antisense, 5′-UGGUAGCCCUUGGGCUCGUGGAUCC-3′ (SEQ ID NO: 43));
  • hmTF-2 (sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11) and antisense, 5′-AGAAGUUGGCAUGGUAGCCCUUGGG-3′ (SEQ ID NO: 12));
  • hmTF-3 (sense, 5′-GAGCCCAAGGGCUACCAUGCCAACU-3′ (SEQ ID NO: 44) and antisense, 5′-AGUUGGCAUGGUAGCCCUUGGGCUC-3′ (SEQ ID NO: 45));
  • hmTF-4 (sense, 5′-CCCCGGAGGUGAUUUCCAUCUACAA-3′
  • HFF human foreskin fibroblasts
  • the cells should be washed twice with PBS and incubated in FBS-free medium for 24 h. FBS-free medium was replaced with medium containing 10% FBS to initiate the cell cycle.
  • the mouse embryonic endothelial cells (MEECs) should be transfected with siRNA-LipofectAmine 2000 followed by RT-PCR analysis. Potential pitfalls: the transfection of those cells with LipofectAmine 2000 may not always works efficiently, the alternative transfection methods should be applied such as electroporation or other transfection agents. The efficient transfection and following RT-PCR analysis may need to work in concert to achieve satisfactory data.
  • RNA from each of those transfected cell lines including HoxB13 (mouse) expressing REK cells, COX-2 (human) expressing cells and mouse embryonic endothelial cells are isolated and purified for RT-PCR analysis.
  • HoxB13 amplicon an RT reaction is followed with a PCR reaction using forward primer, 5′-CTCCAGCTCCTGTGCCTTAT-3′ (SEQ ID NO: 17) and the reverse primer, 5′-ACT GGCCATAGGCTGGTATG-3′ (SEQ ID NO: 18).
  • COX-2 amplicon human
  • an RT reaction is followed with a PCR reaction using forward primer, 5′-CGGGCTGGGCCATGGGGTGGA-3′ (SEQ ID NO: 56) and the reverse primer, 5% CCTATCAGTATTAGCCTGCTT-3′ (SEQ ID NO: 57).
  • TGF- ⁇ 1 amplicon human
  • an RT reaction is followed with a PCR reaction using forward primer, 5′-CTACTGTGTGCTGAGCACCT′′T-3′ (SEQ ID NO: 62) and the reverse primer, 5′-CGCTGCTCGGCCACTCTGGCT-3′ (SEQ ID NO: 63).
  • the PCR products should be loaded on a 1% agarose gel and stained with ethidium bromide.
  • the PCR product should exhibit the levels of the knockdown of each particular mRNA using the particular siRNA duplexes.
  • the result from this experiment is to determine the potency of each siRNA duplex and provide the first look if a particular siRNA duplex should be the most potent one.
  • the RT-PCR analysis is closely coordinated with the transfection experiment so that proper conditions are optimized for efficient transfection for particular cell line, in order to achieve sufficient amount of total RNA for the PCR analysis.
  • the selection of the most potent siRNA duplex for each gene should be based on three repeated experiments.
  • the Western blot analysis and ELISA analysis should be sufficient and satisfactory.
  • the cell lysates or cell culture media would be used for the protein detection.
  • the ELISA assay for detection of mouse HoxB13 is not commercial available, we can use the a rat polyclonal antibody to mouse HoxB13 (Aviva Systems Biologics, San Diego, Calif.) to detect siRNA-mediated knockdown in the HoxB13 expressing REK cells with a Western blot analysis.
  • Rabbit anti-Hoxb 13 antibody was generated against the N-terminal (amino acids 1-7 9) portion of mouse HoxB13. This antibody should recognize both the WT and knockout HoxB13 protein.
  • the latter is a truncated protein that stops at amino acid 33 of the homeodomain.
  • the antisera should be positively affinity purified followed by negative affinity purification against mouse Hoxc13 and chicken Hoxd13 to eliminate possible cross-reactivity with the other Hox13 proteins. Staining should be viewed using a Leica DMLB microscope, and images should be captured using an Optronics DEI750D Digital System (Goleta, Calif.).
  • the human COX-2 is analyzed using COX-2 ELISA kit (Zymed, San Francisco, Calif.) which is an enzyme-linked immunosorbent sandwich assay for quantitative detection of human COX-2 in cell culture supernatants and cell lysates.
  • Cyclooxygenase is a membrane-bound enzyme, which has a molecular weight of 71 kDa
  • the cell lysate should be prepared for the ELISA analysis.
  • the mouse TGF- ⁇ 1 is analyzed using Human/Mouse TGFb1 (Transforming Growth Factor beta 1, TGF-beta1, TGF-b1) ELISA Ready-SET-Go Kit (with Pre-Coated Plates).
  • the selection of the most potent siRNA duplex for each gene should be based on three repeated experiments. The potential pitfall is that sometime the most potent siRNA duplex selected from the mRNA knockdown is not correlated with the one selected from the protein knockdown.
  • siRNA cocktail with several ratios of the combinations can be used such as 1:1:1, 2:1:1 and 3:1:1, etc. Because of the importance of HoxB13 in the adult skin wound healing, an appropriate ratio change of the siRNA duplex specific to HoxB13 is determined.
  • HoxB13 knockout (KO) adult mouse In order to evaluate the appropriate siRNA cocktail and most suitable formulation, we have access to the HoxB13 knockout (KO) adult mouse. We found that HoxB13 KO wounds exhibit several characteristics of early gestational fetal wounds, including faster closure, increased tensile strength, and less dermal scarring when compared with wounds from their wild-type (WT) counterparts. Biochemical evaluation revealed that levels of epidermal and dermal HA are significantly higher in unwounded adult HoxB13 KO skin compared with WT skin. Based on these results, we postulated that HoxB13 in adult skin promotes differentiation, whereas its absence creates a more fetal-like environment, and that one consequence of this fetal-like state is enhanced wound healing.
  • WT wild-type
  • mice In addition to a well accepted model using the back skin wounds in HoxB13 KO mice, we have also established a mouse lip surgery model to mimic cleft lip and palate surgery, performed under general anesthesia and sterile conditions.
  • HoxB13 KO and WT adult mice (8-16 week old) are given a single 0.5 cm full thickness skin incisional wound in parallel with their front teeth followed by suturing (6.0 Nylon) the wound, mimicking the cleft lip and palate surgery.
  • the HKP can be dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter.
  • the HKP-siRNA aqueous solutions were semi-transparent without noticeable aggregation of precipitate, and can be stored at 4° C. for at least three months.
  • HK polymers we may also test two different types of polymer carriers, pegylated PEI and PAMAM dendrimer, with our siRNA cocktail for efficient delivery into the surrounding areas of the skin wounds. All these siRNA polymer formulations are dissolved in the RNAse free D5W solution.
  • RNA duplexes targeting HoxB13, COX-2 and TGF- ⁇ 1 at 1:1:1, 2:1:1 and 3:1:1 formulated with H3K4b polymer.
  • the study groups are: G1: 20 ⁇ g of Control siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G2: 20 ⁇ g of HoxB13 siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G3: 20 ⁇ g of COX-2 siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G4: 20 ⁇ g of TGF- ⁇ 1 siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G5: 20 ⁇ g of ratio one cocktail siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G6: 20 ⁇ g of ratio two siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; and G7: 20 ⁇ g of ratio three siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound.
  • Four animals are in each group. The same administration is available to both HoxB13 KO and WT mouse. The outcome of this study is to demonstrate the synerg
  • the experiment includes G1: 20 ⁇ g of control siRNA-HK polymer formulation (50 ⁇ L); G2: 20 ⁇ g of control siRNA-Pegylated PEI polymer formulation (50 ⁇ L); G3: 20 ⁇ g of control siRNA-PAMAM dendritic polymer formulation (50 ⁇ L); G4: 20 ⁇ g of cocktail siRNA-HK polymer formulation (50 ⁇ L); G5: 20 ⁇ g of cocktail siRNA-pegylated PEI polymer formulation (50 ⁇ L), and G6: 20 ⁇ g of cocktail siRNA-PAMAM dendritic polymer formulation (50 ⁇ L). Each group has four animals. The mRNA and protein level analyses are followed as other in vivo studies. The results provide an optimal formulation of the multi-targeted siRNA cocktail for a clinically viable protocol.
  • RNA samples are excised from both HoxB13 KO and WT mouse, either the back skin wound or lip surgery wounds, and immersed in high-glucose DMEM containing 10% FBS and antibiotics/fungizone, surface sterilized in 70% ethanol, dissected into -'5-mm 2 sections, and digested in dispase in DMEM (5 mg/ml) overnight at 4° C.
  • Total RNA samples from tissue and cells are reverse transcribed using the RETRO-script kit and protocol (Ambion).
  • paraformaldehyde-fixed adult WT and HoxB13 KO skin samples should be processed, embedded in paraffin, sectioned (6 ⁇ m), and baked overnight at 55°.
  • RNA isolation and sample preparation for immunohistochemistry can be used for COX-2 and TGF- ⁇ 1 detections in vivo.
  • the judgment of the most potent siRNA cocktail formulation should be made in consideration of the skin wound model, the genotype of HoxB13 and the ratio of each siRNA duplex.
  • the same principle should be considered that mRNA level knockdown is the key indication of the potency of the multi-target siRNA cocktail.
  • HA detection skin sections are blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 ⁇ g/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described.
  • bHABP biotinylated HA binding protein
  • Cy-3-streptavidin 1:500; Jackson Immunoresearch Laboratories
  • a suitable ratio of siRNA duplexes in formulating a cocktail are defined with an optimized polymer formulation, and correlated with a particular mouse model. siRNAs, and cocktails thereof, are tested in the lip surgery model.
  • the testing groups are going to be G1: apply 2 ⁇ g/50 ⁇ L onto the wound; G2: apply 10 ⁇ g/50 ⁇ L onto the wound; G3: apply 20 ⁇ g/50 ⁇ L onto the wound; G4: apply 30 ⁇ g/50 ⁇ L onto the wound, G5: apply 40 ⁇ g/50 ⁇ L onto the wound and G6: apply 60 ⁇ g/50 ⁇ L onto the wound.
  • Each group contains four animals. The molecular biological and biochemical readouts should be measured along with the histology and morphology evaluation.
  • Paraformaldehyde-fixed skin samples are processed, embedded in paraffin, and sectioned (6 ⁇ m). Slides are baked overnight at 55° C. and stained with hematoxylin and eosin or Masson's trichrome for collagen, using standard protocols.
  • HA detection skin sections are blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 ⁇ g/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described.
  • biotinylated HA binding protein bHABP, 1 ⁇ g/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.
  • tissue should be incubated in PBS alone. Immunofluoresence should be viewed using a Leica DMLB microscope and images captured using an Optronics DEI-750D Digital System. The histology analysis provides graphic information about the morphological difference between the treated and untreated skin wounds and the intensities of presence of the HA protein.
  • Collagen content is determined by measuring hydroxyproline contents of samples.
  • full-thickness dorsal skin samples ⁇ 16 mg
  • the samples are diluted to 5 ml with H 2 O and filtered using Whatman filter paper.
  • chloramine T solution 1.0 ml, 0.05 M, room temperature for 20 min
  • perchloric acid 1.0 ml, 3.15 M, room temperature for 5 min
  • 20% p-dimethylaminobenzaldehyde 1.0 ml
  • the samples should be incubated at 60° C. for 20 min and cooled to room temperature. Absorbances are going to be read at a wavelength of 557.5 nm, and hydroxyproline concentrations are going to be determined using a standard curve.
  • the raw strain values and cross-sectional areas will not vary significantly at any time point postwounding between WT and HoxB13 KO wounds (data not shown). Thus, the differences in the Y-modulus values are primarily due to the force component of the stress value.
  • the present invention provides a novel approach to prepare siRNA targeting sequences. There are three important aspects that differ from other approaches:
  • An oligonucleotide that is an siRNA may have any number of nucleotides between 19 and 30 nucleotides. In a preferred embodiment, an siRNA may have any number of nucleotides between 19 and 27 nucleotides.
  • the siRNA may have two blunt ends, or two sticky ends, or one blunt end with one sticky end. The overhang nucleotides of a sticky end can range from one to four or more.
  • the invention provides siRNA of 21, 23 and 25 base pairs with blunt ends.
  • This invention provides the therapeutic siRNA cocktail targeting multiple disease controlling genes in the same treatment.
  • This invention provides for RNAi agents, such as siRNA oligonucleotides, that are chemically similar to the same source of supply and the same manufacturing process, and they are comprised of four types of nucleotides with different sequences.
  • the invention provides an siRNA cocktail drug for improvement of scarless wound healing by targeting genes involved in the wound healing process, including TGF- ⁇ , COX-2, HoxB13 and others.
  • the siRNA cocktail has the following characteristics:
  • siRNA cocktail targeting HoxB13, COX-2 and TGF- ⁇ 1 SEQ ID NOS 1, 3, 5, 1, 9, 15, 1, 46, 83, 40, 9 and 83, respectively in order of appearance.
  • siRNA Cocktail Combinations HoxB13 COX-2 TGF- ⁇ 1 Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-gucuuuggucuggugccuggucuga-3′ TGF- ⁇ 1 5′-ccccggaggugauuuccaucuacaa-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′ TGF- ⁇ 1 5′-ccggaggugauuuccaucuacaaca-3′ Cocktail 3 HoxB13 5′-caaggauaucgaaggcuugcugggaaca-3
  • siRNA cocktail targeting HoxB13, COX-2 and VEGFA (SEQ ID NOS 1, 3, 317, 1, 46, 317, 40, 9 and 317, respectively in order of appearance).
  • siRNA Cocktail Combinations targeting sequences
  • HoxB13 COX-2 VEGFA Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-gucuuuggucuggugccuggucuga-3′ VEGFA 5′-ccaugccaaguggucccaggcugca-3′
  • HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′
  • siRNA Cocktail Combinations targeting HoxB13, COX-2, TGF- ⁇ 1 & TGF- ⁇ 2 (SEQ ID NOS 318-321, 1, 9, 13, 15, 1, 46, 42, 80, 40, 9, 42, and 80, repectively in order of appearance): siRNA Cocktail Combinations (targeted sequences) HoxB13 COX-2 TGF- ⁇ 1 TGF- ⁇ 2 Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcu-3′ COX-2 5′-gucuuuggucuggugccuggu-3′ TGF- ⁇ 1 5′-cacgagcccaagggcuaccau-3′ TGF- ⁇ 2 5′-ggaggugauuuccaucuacaa-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′ TGF- ⁇ 1 5′-ca
  • siRNA cocktail targeting HoxB13, TGF- ⁇ 1 &TGF- ⁇ 2 (SEQ ID NOS 318, 320, 119, 1, 13, 136, 1, 42, 134, 40, 42 and 134, respectively in order of appearance): siRNA Cocktail Combinations (targeted sequences) HoxB13 TGF- ⁇ 1 TGF- ⁇ 2 Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcu-3′ TGF- ⁇ 1 5′-cacgagcccaagggcuaccau-3′ TGF- ⁇ 2 5′-ggaggtgatttccatctacaa-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ TGF- ⁇ 1 5′-cacgagcccaagggcuaccaugcca-3′ TGF- ⁇ 2 5′-ccggaggtgatttccatctacaaca-3′ Cocktail 3 HoxB13
  • siRNA Cocktail Combinations HoxB13 COX-2 TGF- ⁇ 1 Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcu-3′ COX-2 5′-gucuuuggucuggugccuggucu-3′ TGF- ⁇ 1 5′-cacgagcccaagggcuaccau-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′ TGF- ⁇ 1 5′-ggauccacgagcccaagggcuacca-3′ Cocktail 3 HoxB13 5′-caaggauaucgaaggcuuua-3′ BuxB13 5′-caaggauaucgaaggcuacca-3′ BuxB13 5′-caaggauaucgaaggcuugcuggga-3′ TGF-2 5′-ggucuggugc
  • siRNA cocktail targeting HoxB13, COX-2, TGF- ⁇ 1 and PDGFa SEQ ID NOS 318, 322, 320 ,202, 1, 9, 42, 321, 1, 46, 42, 323, 40, 9, 42 and 323, respectively in order of appearance
  • siRNA Cocktail Combinations (siRNA sequences) HoxB13 COX-2 TGF- ⁇ 1 PDGFa Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcu-3′ COX-2 5′-gucuuuggucuggugccuggucu-3′ TGF- ⁇ 1 5′-cacgagcccaagggcuaccau-3′ PDGF a 5′-gtactgaatttcgccgccaca-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′ TGF- ⁇
  • siRNA cocktail targeting HoxB13, COX-2, TGF- ⁇ 1 and Lamin (SEQ ID NOS 318, 322, 320, 324, 1, 9, 42, 324, 1, 46, 42, 325, 40, 9, 42 and 325, respectively in order of appearance): siRNA Cocktail Combinations (siRNA sequences) HoxB13 COX-2 TGF- ⁇ 1 Lamin Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcu-3′ COX-2 5′-gucuuuggucuggugccuggucu-3′ TGF- ⁇ 1 5′-cacgagcccaagggcuaccau-3′ Lamin 5′-gagccuuacugaggacuuggaguuu-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′ TGF- ⁇ 1 5
  • siRNA Cocktail Combinations HoxB13 COX-2 Lamin Human and Mouse homologues Cocktail 1 HoxB13 5′-caaggauaucgaaggcuugcu-3′ COX-2 5′-gucuuuggucuggugccuggucu-3′ Lamin 5′-gagccuuacugaggacuuggaguuu-3′ Cocktail 2 HoxB13 5′-caaggauaucgaaggcuugcuggga-3′ COX-2 5′-ggucuggugccuggucugaugaugu-3′ Lamin 5′-gagccuuacugaggacuuggaguuu-3′ Cocktail 3 HoxB13 5′-caaggauaucgaaggcuugcugg, and Lamin 5′-gagccuuacugaggacuuggaguuu-3′ Cocktail 3 HoxB13 5′-caaggauaucgaaggcuugcuggaguuu-3′ Cocktail 3 HoxB13 5′-
  • siRNA duplex sequence targeting Hoxb13 is able to target both human Hoxb13 and mouse Hoxb13 genes.
  • Sequences have been designed in silico using the general rules for siRNA design and a proprietary algorithm to ensure the following characteristics: (1) optimum thermodynamics, (2) enhance RISC binding, (3) eliminate immune stimulation motifs, (4) human-mouse homology, (5) “off-target” potential blasted and (6) multi-targeted siRNA cocktail. Each sequence is able to target both human and mouse corresponding genes. Therefore, the potent sequences defined from the mouse cell study can be further confirmed using human cells.
  • siRNA oligos synthetic siRNA sequences
  • PC-3 cell a bone metastasis of a grade N prostatic adenocarcinoma
  • RT-PCR a bone metastasis of a grade N prostatic adenocarcinoma
  • hmTF-2 sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11), antisense, 5′-AGAAGUUGGCAUGGUAGCCCUUGGG-3′ (SEQ ID NO: 12);
  • hmCX-1 sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9), antisense, 5′-ACAUCAUCAGACCAGG CACCAGACC-3′ (SEQ ID NO: 10); (3) hmTF-2: sense, 5′-CCCAAGGGCUACCAUGCCAACUUCU-3′ (SEQ ID NO: 11), antisense, 5′-AGAAGUUGGCAUGGUAGCCCUUGGG-3′ (SEQ ID NO: 12);
  • hmCX-1 sense, 5′-GGUCUGGUGCCUGGUCUGAUGAUGU-3′ (SEQ ID NO: 9), antisense, 5′-ACAUCAUCAGACCAGG CACCAGACC-3′ (SEQ ID
  • RNA samples were extracted form skin samples according to the manufacture's instructions (RNAqueous-4PCR, Ambion).
  • RNA 0.25 ⁇ g of total RNA was incubated at 70° C. for 3 min with oligo (dT) primers and then reverse-transcribed at 42° C. for 30 min in 20 ⁇ l reaction mixture containing reverse transcriptase followed by PCR (35 cycles) using specific primers for TGF- ⁇ 1, Cox-2 and HoxB13 genes.
  • Mouse TGF- ⁇ forward: 5′-CTACTGTGTGCTGAGCACCTT-3′ (SEQ ID NO: 62), reverse: 5′-CGCTGCTCGGCCACTCTGGCT-3′ (SEQ ID NO: 63), and product: 488 bp;
  • Mouse Cox-2 forward: 5′-GGAAGCCTTCTCCAACCTCT-3′ (SEQ ID NO: 58), reverse: 5′-GGATACACCTCTCCACCAAT-3′ (SEQ ID NO: 59), product: 371 bp;
  • Mouse HoxB13 forward 5′-CTCCAGCTCCTGTGCCTTAT-3′ (SEQ ID NO: 17), reverse: 5′-ACTGGCCATAGGCTGGTATG-3′ (SEQ ID NO: 18), product: 205 bp.
  • Optimized histidine-lysine polymers have been applied for siRNA deliveries in vitro and in vivo.
  • a pair of the HK polymer species, H3K4b and PT73 has a Lysine backbone with four branches containing multiple repeats of Histidine, Lysine or Asparagine.
  • this HKP aqueous solution was mixed with siRNA in aqueous solution at a N/P ratio of 4:1 by mass, the nanoparticles (average size of 100-200 nm in diameter) were self-assembled ( FIG. 16 ).
  • Optimal branched histidine-lysine polymer, HKP was synthesized on a Ranin Voyager synthesizer (PTI, Arlington, Ariz.).
  • the HKP was dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter.
  • the HKP-siRNA aqueous solution was semi-transparent without noticeable aggregation of precipitate, and can be stored at 4° C. for at least three months.
  • the first experiment we did with the skin excisional wound model is to analyze the therapeutic benefit of TGF ⁇ -siRNA with Histidine-Lysine polymer-mediated topical administration.
  • the conventional methylcellulose was used as the topical administration carrier with or without nanoparticle/siRNA.
  • Two wounds on each mouse were either treated with only methylcellulose or methylcellulose plus nanoparticle/siRNA daily for the first 5 days. The observations were taken on day 0, 5, 9 and 15 th . When the images were put together ( FIG.
  • siRNA cocktail targeting TGF ⁇ -1, Hoxb13 and Cox-2 packaged with HK polymer demonstrated similar knockdown activity as TGF ⁇ -1 siRNA package with HK polymer, while siRNA duplexes specific to either Hoxb13 or Cox-2 packaged with HK polymer did show TGF ⁇ -1 down regulation.
  • collagen fibers in the neodermis of sham control wounds and control siRNA-nanoplexes treated wounds are densely placed in an abnormal parallel pattern. These events allow collagen fibers to lie closer together ( FIG. 22 ), facilitating collagen cross-linking and ultimately decreasing scar thickness. Intramolecular and intermolecular collagen cross-links result in increased wound bursting strength.
  • nanoparticle-enhanced TGF ⁇ -1 was responsible to the therapeutic benefit for the skin wound closure.
  • siRNA duplexes targeting Cox-2 and Hoxb13 genes were able to enhance the wound closure.
  • the histopathological changes are the result of nanoparticle/siRNA ( FIG. 23 ).
  • the images are showing that nanoparticle/Cox-2 siRNA are the potent contributors resulting similar skin structure as the normal tissue.
  • the tensile strength of a wound is a measurement of its load capacity per unit area.
  • the bursting strength of a wound is the force required to break a wound regardless of its dimension. Bursting strength varies with skin thickness. Peak tensile strength of a wound occurs approximately 60 days after injury. A healed wound only reaches approximately 80% of the tensile strength of unwounded skin.
  • HK peptides are more effective delivering siRNA into cells than their linear counterparts.
  • HK peptides that varied in their number of branches were studied for inhibition of C. albicans growth ( FIG. 24 ).
  • H2K3b reduced growth of C. albicans by 11.3% at 37.5 ⁇ g/ml (4.5 ⁇ M) and by 61.7% at 50 ⁇ g/ml (6.0 ⁇ M).
  • H2K4b had the strongest antifungal effect reducing growth of C. albicans to nearly 40% at 37.5 ⁇ g/ml (3.4 ⁇ M) and 85% at 50 ⁇ g/ml (4.5 ⁇ M).
  • H3K(G)4b Relative to H2K4b, a decrease in cationic charge in the terminal branches of H3K4b and H3K(G)K4b may, in part, account for their reduced toxicity in vitro and in vivo; the reduction in charge may decrease their interaction with negatively charged cell membranes.
  • H3K(G)4b polymer With eight additional glycines, H3K(G)4b polymer has a reduced charge per total number of amino acids relative to H3K4b. Because there are five lysines in each terminal arm of H3K(G)4b and H3K4b, however, we doubt that minimal charge differences readily explain the reduced toxicity of H3K(G)4b relative to H3K4b.
  • glycines may disrupt alpha helices in the terminal branches, thereby enhancing the flexibility of the polymer and allowing enzymatic degradation.
  • Several secondary structure programs for peptides predict a marked difference in the alpha helical content between a glycine containing peptide, H3K(G)4b, and the non-glycine containing peptides, H2K4b and H3K4b. Indeed, preliminary data with circular dichroism spectroscopy demonstrate that H3K(G)4b have less alpha helical structure relative to its H3K4b counterpart.
  • siRNA sequences in silico for each of the targeted genes, Hoxb13, COX-2 and TGF- ⁇ 1.
  • siRNA duplexes TGF- ⁇ 1, Cox-2 and Hoxb13.
  • CT-1 sense, 5′-GAGGAGCCUUCAGGAUUACAAGAUU-3′ (SEQ ID NO: 50) and antisense, 5′-AAUCUUGUAAUCCUGAAGGCUCCUC-3′ (SEQ ID NO: 51)), which has been validated in several our previous publications (35, 49).
  • hmHX-1 (sense, 5′-CAAGGAUAUCGAAGGCUUGCUGGGA-3′ (SEC) ID NO: 1), antisense, 5′-UCCCAGCAAGCCUUCGAUAUCCUUG-3′ (SEQ ID NO: 2)); hmHX-2: (sense, 5′-GGACAAGAGGCGCAAGAUCUCGGCA-3′ (SEQ ID NO: 69), antisense, 5′-UGCCGAGAUCUUGCG CCUCUUGUCC-3′ (SEQ ID NO: 327)); hmHX-3: (sense, 5′-GCAAGAUCUCGGCAGCCACCAGCCU-3′ (SEQ ID NO: 68), antisense, 5′-AGGCUGGUGGCUGCCGAGAUCUUGC-3′ (SEQ ID NO: 328)).
  • hmCX-1 (sense, 5′-CAUCAGUUUUUCAAGACAGAUCAUA-3′ (SEQ ID NO: 73), antisense, 5′-UAUGAUCUGUCUUGAAAAACUGAUG-3′ (SEQ ID NO: 329)); hmCX-2: (sense, 5′-GUCUUUGGUCUGGUGCCUGGUCUGA-3′ (SEQ ID NO: 3), antisense, 5′-UCAGACCAGGCACCAGACCAAAGAC-3′ (SEQ ID NO: 4)); hmCX-3: (sense, 5′-GUGCCUGGUCU GAUGAUGUAUGCCA-3′ (SEQ ID NO: 75), antisense, 5′-UGGCAUACAUCAUCAGACCAGGCAC-3′ (SEQ ID NO: 330)).
  • hmTF-1 (sense, 5′-GAUCCACGAGCCCAAGGGCUACCAU-3′ (SEQ ID NO: 331), antisense, 5′-AUGGUAGCCCUUGGGCUCGUGGAUC-3′ (SEQ ID NO: 332)); hmTF-2: (sense, 5′-CACGAGCCCAAGGGCUACCAUGCCA-3′ (SEQ ID NO: 13), antisense, 5′-UGGCAUGGUAGCCCUUGGGCUCGUG-3′ (SEQ ID NO: 14)); hmTF-3: (sense, 5′-GGCGCCGCCUCCCCCAUGCCGCCCU-3′ (SEQ ID NO: 333), antisense, 5′-AGGGCGGC AUGGGGGAGGCGGCGCC-3′ (SEQ ID NO: 64)).
  • a series of transfection experiments are going to be conducted followed by RNA isolation and RT-PCR analyses, to determine if any these additional siRNA du
  • the cells should be washed twice with PBS and incubated in FBS-free medium for 24 h. FBS-free medium was replaced with medium containing 10% FBS to initiate the cell cycle.
  • the transfection experiments will have reagent control group, non-specific siRNA control group, three different dosages for transfecting the specific siRNA duplexes: 0.5, 1.0 and 2.0 ug per well on 6 well plate. Potential pitfalls: the transfection of those cells with Lipofectamin 2000 may not always work efficiently. Alternative transfection methods can be used, such as electroporation or other transfection agents. The efficient transfection and following RT-PCR analysis may need to work in concert to achieve satisfactory data.
  • RNA from each of those transfected cell lines PC-3 and C166.
  • Hoxb13 amplicon mouse
  • an RT reaction will be followed with a PCR reaction using forward primer, 5′-CTCCAGCTCCTGTGCCTTAT-3′ (SEQ ID NO: 17) and the reverse primer, 5′-ACT GGCCATAGGCTGGTATG-3′ (SEQ ID NO: 18).
  • Cox-2 amplicon human
  • an RT reaction will be followed with a PCR reaction using forward primer, 5′-CGGGCTGGGCCATGGGGTGGA-3′ (SEQ ID NO: 56) and the reverse primer, 5′-CCTATCAGTATTAGCCTGCTT-3′ (SEQ ID NO: 57).
  • TGF- ⁇ 1 amplicon For detection of TGF- ⁇ 1 amplicon (mouse), an RT reaction will be followed with a PCR reaction using forward primer, 5′-CTACTGTGTGCTGAGCACCTT-3′ (SEQ ID NO: 62) and the reverse primer, 5′-CGCTGCTCGG CCACTCTGGCT-3′ (SEQ ID NO: 63).
  • the PCR products should be loaded on a 1% agarose gel and stained with ethidium bromide.
  • the PCR product should exhibit the levels of the knockdown of each particular mRNA using the particular siRNA duplexes. The result from this experiment will determine the potency of each siRNA duplex and provide the first look if a particular siRNA duplex should be the most potent one.
  • the RT-PCR analysis may need to work closely with the transfection experiment so that a proper condition can be optimized for efficient transfection for particular cell line, in order to achieve sufficient amount of total RNA for the PCR analysis.
  • the selection of the most potent siRNA duplex for each gene will be based on three repeated experiments. The silencing efficacies will be compared between the additional three siRNA duplexes and the previously identified siRNA duplexes.
  • the Western blot analysis and ELISA analysis should be sufficient and satisfactory.
  • the cell lysates or cell culture media would be used for the protein detection.
  • the ELISA assay for detection of mouse Hoxb13 is not commercially available, we can use the a rat polycolonal antibody to mouse Hoxb13 (Aviva Systems Biologics, San Diego, Calif.) to detect siRNA-mediated knockdown in the Hoxb13 expressing REK cells with a Western blot analysis.
  • Rabbit anti-Hoxb13 antibody was generated against the N-terminal (amino acids 1-7 9) portion of mouse Hoxb13. This antibody should recognize both the WT and knockout Hoxb13 protein.
  • the latter is a truncated protein that stops at amino acid 33 of the homeodomain.
  • the antisera should be positively affinity purified followed by negative affinity purification against mouse Hoxc13 and chicken Hoxd13 to eliminate possible cross-reactivity with the other Hox13 proteins. Staining should be viewed using a Leica DMLB microscope, and images should be captured using an Optronics DEI750D Digital System (Goleta, Calif.).
  • the human COX-2 will be analyzed using COX-2 ELISA kit (Zymed, San Francisco, Calif.) which is an enzyme-linked immunosorbent sandwich assay for quantitative detection of human COX-2 in cell culture supernatants and cell lysates.
  • Cyclooxygenase is a membrane-bound enzyme, which has a molecular weight of 71 kDa
  • the cell lysate should be prepared for the ELISA analysis.
  • the mouse TGF- ⁇ 1 will be analyzed using Human/Mouse TGF- ⁇ 1 (Transforming Growth Factor beta 1, TGF- ⁇ 1/TGF- ⁇ 1) ELISA Ready-SET-Go Kit (with Pre-Coated Plates). The selection of the most potent siRNA duplex for each gene should be based on three repeated experiments.
  • siRNA cocktail with several ratios.
  • the combinations can be used as 1:1:1, 2:1:1 and 3:1:1, etc.
  • the HKP can be dissolved in aqueous solution and then mixed with siRNA aqueous solution at a ratio of 4:1 by mass, forming nanoparticles of average size of 150-200 nm in diameter.
  • the HKP-siRNA aqueous solutions were semi-transparent without noticeable aggregation of precipitate, and can be stored at 4° C. for at least three months (50).
  • HK polymers we may also test two different types of polymer carriers, pegylated PEI and PAMAM dendrimer, with our siRNA cocktail for efficient delivery into the areas of the skin wounds. All these siRNA polymer formulations will be dissolved in the RNAse free D5W solution and then incorporated into 2% Methylcellulose (1:1) or 2% Methylcellulose:PBS (1:1). The formulation will be applied onto the wound beds and either covered or not with transparent Tegaderm dressing.
  • siRNA duplexes targeting Hoxb13, Cox-2 and TGF- ⁇ 1 at 1:1:1, 2:1:1 and 3:1:1 formulated with H3K4b polymer.
  • the study groups are going to be: G1: 20 ⁇ g of Control siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G2: 20 ⁇ g of Hoxb13 siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G3: 20 ⁇ g of Cox-2 siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G4: 20 ⁇ g of TGF- ⁇ 1 siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G5: 20 ⁇ g of ratio one cocktail siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; G6: 20 ⁇ g of ratio two siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound; and G7: 20 ⁇ g of ratio three siRNA-HK polymer formulation (50 ⁇ L) for each lip surgery wound.
  • the experiment will focus on one ratio of siRNA combination such as 1:1:1.
  • the experiment will include G1: 20 ⁇ g of control siRNA-HK polymer formulation (50 ⁇ L); G2: 20 ⁇ g of control siRNA-Pegylated PEI polymer formulation (50 ⁇ L); G3: 20 ⁇ g of control siRNA-PAMAM dendritic polymer formulation (50 ⁇ L); G4: 20 ⁇ g of cocktail siRNA-HK polymer formulation (50 ⁇ L); G5: 20 ⁇ g of cocktail siRNA-pegylated PEI polymer formulation (50 ⁇ L), and G6: 20 ⁇ g of cocktail siRNA-PAMAM dendritic polymer formulation (50 ⁇ L).
  • Each group will have four animals.
  • the mRNA and protein level analyses will be followed as other in vivo studies. This study will help us to determine the best formulation of the multi
  • Skin samples will be excised from both Hoxb13 KO and WT mouse, either the back skin wound or lip surgery wounds, and immersed in high-glucose DMEM containing 10% FBS and antibiotics/fungizone, surface sterilized in 70% ethanol, dissected into -'5-mm 2 sections, and digested in dispase in DMEM (5 mg/ml) overnight at 4° C.
  • Total RNA samples from tissue and cells will be reverse transcribed using the RETRO-script kit and protocol (Ambion).
  • paraformaldehyde-fixed adult WT and Hoxb13 KO skin samples should be processed, embedded in paraffin, sectioned (6 ⁇ m), and baked overnight at 55°.
  • RNA isolation and sample preparation for immunohistochemistry can be used for Cox-2 and TGF- ⁇ 1 detections in vivo.
  • the judgment of the most potent siRNA cocktail formulation should be made in consideration of the skin wound model, the genotype of Hoxb13 and the ratio of each siRNA duplex.
  • the same principle should be considered that mRNA level knockdown is the key indication of the potency of the multi-target siRNA cocktail.
  • HA detection skin sections will be blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 ⁇ g/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described.
  • bHABP biotinylated HA binding protein
  • Cy-3-streptavidin 1:500; Jackson Immunoresearch Laboratories
  • siRNA cocktail A proper ratio of siRNA cocktail will be defined with an optimized polymer formulation, and correlated with a particular mouse model. We will design the experiments to test this candidate therapeutic protocol for the pharmacological characteristics and any visible toxicity or adverse effect. In order to present a clear picture, we just assume that the lip surgery model is going to be the one we select at the time (although the real result can only be reached when we complete the first two studies).
  • the testing groups are going to be G1: apply 2 ⁇ g/50 ⁇ L onto the wound; G2: apply 10 ⁇ g/50 ⁇ L onto the wound; G3: apply 20 ⁇ g/50 ⁇ L onto the wound; G4: apply 30 ⁇ g/50 ⁇ L onto the wound, G5: apply 40 ⁇ g/50 ⁇ L onto the wound and G6: apply 60 ⁇ g/50 ⁇ L onto the wound.
  • Each group will contain four animals. The molecular biological and biochemical readouts should be measured along with the histology and morphology evaluation.
  • Paraformaldehyde-fixed skin samples will be processed, embedded in paraffin, and sectioned (6 ⁇ m). Slides will be baked overnight at 55° C. and stained with hematoxylin and eosin or Masson's trichrome for collagen, using standard protocols.
  • HA detection skin sections will be blocked in 2% FBS, incubated with biotinylated HA binding protein (bHABP, 1 ⁇ g/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.) overnight at 4° C., rinsed in PBS, incubated with Cy-3-streptavidin (1:500; Jackson Immunoresearch Laboratories) for 30 min at room temperature, rinsed in PBS, and mounted as previously described.
  • biotinylated HA binding protein bHABP, 1 ⁇ g/ml in PBS; Associates of Cape Cod, Inc., Falmouth, Mass.
  • tissue should be incubated in PBS alone. Immunofluoresence should be viewed using a Leica DMLB microscope and images captured using an Optronics DEI-750D Digital System. The histology analysis will provide graphic information about the morphological difference between the treated and untreated skin wounds and the intensities of presence of the HA protein.
  • Collagen content will be determined by measuring hydroxyproline contents of samples.
  • full-thickness dorsal skin samples ⁇ 16 mg
  • the samples will be lyophilized overnight and hydrolyzed in 6 N HCl for 18 h at 110° C. (use enough to cover the tissue), and the pH are then adjusted to between 6 and 7 with NaOH.
  • the samples will be diluted to 5 ml with H 2 O and filtered using Whatman filter paper.
  • chloramine T solution 1.0 ml, 0.05 M, room temperature for 20 min
  • perchloric acid 1.0 ml, 3.15 M, room temperature for 5 min
  • 20% p-dimethylaminobenzaldehyde 1.0 ml
  • the samples should be incubated at 60° C. for 20 min and cooled to room temperature. Absorbances are going to be read at a wavelength of 557.5 nm, and hydroxyproline concentrations are going to be determined using a standard curve.
  • the raw strain values and cross-sectional areas will not vary significantly at any time point postwounding between WT and Hoxb13 KO wounds (data not shown). Thus, the differences in the Y-modulus values are primarily due to the force component of the stress value.
  • the abundant data set from the proposed study will provide us substantial information for understanding the characteristics of the multi-targeted siRNA cocktail formulation and therefore, define a clinical protocol for improvement of adult skin wound healing with less scar tissue formation. stronger tensile strength, and faster closure.
  • the multi-targeted siRNA cocktail represents a novel therapeutic approach to treat various skin wounds and will be very valuable for both pharmaceutical and cosmaceutical markets.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US15/166,223 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin Active 2029-07-13 USRE46873E1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/166,223 USRE46873E1 (en) 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US98582007P 2007-11-06 2007-11-06
US15/166,223 USRE46873E1 (en) 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin
PCT/US2008/012498 WO2009061417A1 (en) 2007-11-06 2008-11-06 Multi-targeted rnai therapeutics for scarless wound healing of skin
US12/741,645 US8735567B2 (en) 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin

Publications (1)

Publication Number Publication Date
USRE46873E1 true USRE46873E1 (en) 2018-05-29

Family

ID=40626059

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/741,645 Ceased US8735567B2 (en) 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin
US15/166,223 Active 2029-07-13 USRE46873E1 (en) 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US12/741,645 Ceased US8735567B2 (en) 2007-11-06 2008-11-06 Multi-targeted RNAi therapeutics for scarless wound healing of skin

Country Status (7)

Country Link
US (2) US8735567B2 (es)
EP (1) EP2217062B1 (es)
JP (1) JP2011504170A (es)
CN (1) CN101917846B (es)
DK (1) DK2217062T3 (es)
ES (1) ES2545963T3 (es)
WO (1) WO2009061417A1 (es)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10421970B2 (en) 2004-05-12 2019-09-24 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
WO2019226940A1 (en) 2018-05-24 2019-11-28 Sirnaomics, Inc. Composition and methods of controllable co-coupling polypeptide nanoparticle delivery system for nucleic acid therapeutics
US20210324384A1 (en) * 2018-12-27 2021-10-21 Sirnaomics, Inc. SILENCING TGF-BETA 1 and COX2 USING siRNAs DELIVERED in a POLYPEPTIDE NANOPARTICLE ALONE and in COMBINATION with IMMUNE CHECKPOINT INHIBITORS to TREAT CANCER

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
HUE037173T2 (hu) 2006-08-08 2018-08-28 Univ Bonn Rheinische Friedrich Wilhelms 5'-Foszfát-oligonukleotidok szerkezete és alkalmazása
JP2010519907A (ja) * 2007-03-02 2010-06-10 エムディーアールエヌエー，インコーポレイテッド Ｖｅｇｆファミリー遺伝子の発現を抑制するための核酸化合物およびその使用
WO2009061417A1 (en) 2007-11-06 2009-05-14 Sirnaomics, Inc. Multi-targeted rnai therapeutics for scarless wound healing of skin
JP5689413B2 (ja) 2008-05-21 2015-03-25 ライニッシュ フリードリッヒ−ウィルヘルムズ−ユニバーシタット ボン 平滑末端を有する５’三リン酸オリゴヌクレオチドおよびその使用
US8541568B2 (en) * 2008-05-24 2013-09-24 Hai Yan Compositions and methods using siRNA molecules for treatment of gliomas
US9012622B2 (en) 2008-12-31 2015-04-21 Patrick Y. Lu Compositions and methods using siRNA molecules and siRNA cocktails for the treatment of breast cancer
CN101897982A (zh) * 2009-05-31 2010-12-01 苏州圣诺生物医药技术有限公司 治疗癌症的siRNA药物组合物
CN102985546A (zh) * 2010-05-04 2013-03-20 圣诺制药公司 TGF-beta和Cox-2抑制剂的联合及其治疗应用的方法
WO2011153323A2 (en) * 2010-06-02 2011-12-08 Alnylam Pharmaceuticals, Inc. Compositions and methods directed to treating liver fibrosis
WO2012016139A2 (en) 2010-07-29 2012-02-02 Sirnaomics, Inc. Sirna compositions and methods for treatment of hpv and other infections
CN102031260A (zh) * 2010-08-24 2011-04-27 苏州圣诺生物医药技术有限公司 促进皮肤伤口无疤痕愈合的siRNA及应用
AU2015261583C1 (en) * 2010-10-14 2017-07-06 Mie University Preventative or therapeutic agent for fibrosis
AR083445A1 (es) * 2010-10-14 2013-02-27 Univ Mie siARN CONTRA LA FIBROSIS
EP2508530A1 (en) 2011-03-28 2012-10-10 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
WO2013120726A2 (en) 2012-02-13 2013-08-22 Unilever N.V. A skin lightening composition
CN102671243A (zh) * 2012-05-10 2012-09-19 浙江大学 一种负载季铵化壳聚糖/siRNA复合粒子的皮肤再生材料及其制备方法
EP2712870A1 (en) 2012-09-27 2014-04-02 Rheinische Friedrich-Wilhelms-Universität Bonn Novel RIG-I ligands and methods for producing them
CN103736102A (zh) * 2013-11-14 2014-04-23 黄兵 可用于治疗银屑病的小rna及其衍生物和药物制剂
US10105305B2 (en) 2014-02-19 2018-10-23 The Johns Hopkins University Compositions and methods for promoting skin regeneration and hair growth
CN106456659A (zh) * 2014-03-11 2017-02-22 戴念梓 一种用于减少疤痕形成的医药组合物和方法
CN105063044A (zh) * 2014-10-17 2015-11-18 苏州圣诺生物医药技术有限公司 可抑制埃博拉病毒基因复制的活性分子及其使用方法
CN106730038A (zh) * 2017-01-12 2017-05-31 广东泰宝医疗器械技术研究院有限公司 一种用于气管软组织修复的纤维膜及其制备方法
CN107982536B (zh) * 2017-10-27 2021-04-09 上海交通大学医学院附属第九人民医院 一种药物作用靶点的组合物和应用
EP3825321A4 (en) * 2018-07-20 2022-06-15 Guangzhou Ribobio Co., Ltd. NUCLEIC ACID UNIT, POLYMERIC NUCLEIC ACID AND THEIR USE
US11969402B2 (en) 2019-05-16 2024-04-30 The Johns Hopkins University Compositions and methods for skin rejuvenation
CZ2019720A3 (cs) 2019-11-23 2021-01-13 Grade Medical s.r.o. Zařízení pro přípravu funkcionalizovaných substrátů
DE102020207195B4 (de) 2020-06-09 2024-05-29 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung eingetragener Verein Nanopartikel als bioresorbierbare und röntgenopake Wirkstoffträger für die Therapie von Krebserkrankungen der Bauchspeicheldrüse
CN114854738A (zh) * 2021-02-04 2022-08-05 纳肽得(青岛)生物医药有限公司 用于治疗与TGFβ1表达相关的疾病的siRNA
US20220333108A1 (en) * 2021-04-01 2022-10-20 Sirnaomics, Inc. Combinations of sirnas with sirnas against sulf2 or gpc3 for use in treating cancer
CN115381951A (zh) * 2022-09-28 2022-11-25 孙良丹 Vegf基因表达抑制剂在制备或作为用于治疗银屑病的制剂中的应用

Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001047496A1 (en) 1999-12-29 2001-07-05 Mixson A James Histidine copolymer and methods for using same
WO2003040399A2 (en) 2001-11-02 2003-05-15 Intradigm Corporation Therapeutic methods for nucleic acid delivery vehicles
WO2003070918A2 (en) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Rna interference by modified short interfering nucleic acid
WO2003090719A1 (en) 2002-04-25 2003-11-06 Mixson James A Histidine copolymer and methods for using same
US20050176024A1 (en) 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of epidermal growth factor receptor (EGFR) gene expression using short interfering nucleic acid (siNA)
WO2005076999A2 (en) 2004-02-05 2005-08-25 Intradigm Corporation Methods and compositions for combination rnai therapeutics
WO2006060182A2 (en) 2004-11-17 2006-06-08 University Of Maryland, Baltimore HIGHLY BRANCHED HK PEPTIDES AS EFFECTIVE CARRIERS OF siRNA
US20060121514A1 (en) 1998-12-18 2006-06-08 Human Genome Sciences, Inc. Prostacyclin-stimulating Factor-2
US20060134787A1 (en) 2004-12-22 2006-06-22 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US20060265765A1 (en) 2005-05-19 2006-11-23 Sankyo Company, Limited Oncogene HOXB13 and its siRNAs
US20070003519A1 (en) 2003-04-01 2007-01-04 Lu Patrick Y Targets for tumor growth inhibition
WO2007079224A2 (en) 2005-12-30 2007-07-12 Wei-Wu He Sirna compositions promoting scar-free wound healing of skin and methods for wound treatment
US20080015161A1 (en) 2006-03-16 2008-01-17 Hans-Peter Vornlocher RNAi modulation of TGF-beta and therapeutic uses thereof
US20080241198A1 (en) 2005-04-12 2008-10-02 Yijia Liu Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases
US20080279920A1 (en) 2004-11-05 2008-11-13 Intradigm Corporation Compositions For Treating Respiratory Viral Infections and Their Use
US7465708B2 (en) 2002-11-25 2008-12-16 Mixson A James Branched cationic copolymers and methods for antimicrobial use
WO2008154482A2 (en) 2007-06-08 2008-12-18 Sirnaomics, Inc. Sirna compositions and methods of use in treatment of ocular diseases
WO2009061417A1 (en) 2007-11-06 2009-05-14 Sirnaomics, Inc. Multi-targeted rnai therapeutics for scarless wound healing of skin
US20110165227A1 (en) 2008-05-24 2011-07-07 Hai Yan Compositions and Methods Using siRNA Molecules for Treatment of Gliomas
US20120071540A1 (en) 2008-12-31 2012-03-22 Lu Patrick Y Compositions and Methods Using siRNA Molecules and siRNA Cocktails for the Treatment of Breast Cancer
US20130225655A1 (en) 2010-05-04 2013-08-29 Patrick Y. Lu Combinations of TGFBeta and COX-2 Inhibitors and Methods for Their Therapeutic Application

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060121514A1 (en) 1998-12-18 2006-06-08 Human Genome Sciences, Inc. Prostacyclin-stimulating Factor-2
WO2001047496A1 (en) 1999-12-29 2001-07-05 Mixson A James Histidine copolymer and methods for using same
US7163695B2 (en) 1999-12-29 2007-01-16 Mixson A James Histidine copolymer and methods for using same
US7070807B2 (en) 1999-12-29 2006-07-04 Mixson A James Branched histidine copolymers and methods for using same
US20050176024A1 (en) 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of epidermal growth factor receptor (EGFR) gene expression using short interfering nucleic acid (siNA)
WO2003040399A2 (en) 2001-11-02 2003-05-15 Intradigm Corporation Therapeutic methods for nucleic acid delivery vehicles
WO2003070918A2 (en) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Rna interference by modified short interfering nucleic acid
WO2003090719A1 (en) 2002-04-25 2003-11-06 Mixson James A Histidine copolymer and methods for using same
US7465708B2 (en) 2002-11-25 2008-12-16 Mixson A James Branched cationic copolymers and methods for antimicrobial use
US20070003519A1 (en) 2003-04-01 2007-01-04 Lu Patrick Y Targets for tumor growth inhibition
WO2005076999A2 (en) 2004-02-05 2005-08-25 Intradigm Corporation Methods and compositions for combination rnai therapeutics
US20080279920A1 (en) 2004-11-05 2008-11-13 Intradigm Corporation Compositions For Treating Respiratory Viral Infections and Their Use
US7772201B2 (en) 2004-11-17 2010-08-10 “University of Maryland, Baltimore” Highly branched HK peptides as effective carriers of siRNA
WO2006060182A2 (en) 2004-11-17 2006-06-08 University Of Maryland, Baltimore HIGHLY BRANCHED HK PEPTIDES AS EFFECTIVE CARRIERS OF siRNA
US20060134787A1 (en) 2004-12-22 2006-06-22 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US20080241198A1 (en) 2005-04-12 2008-10-02 Yijia Liu Composition and methods of RNAi therapeutics for treatment of cancer and other neovascularization diseases
US20060265765A1 (en) 2005-05-19 2006-11-23 Sankyo Company, Limited Oncogene HOXB13 and its siRNAs
WO2007079224A2 (en) 2005-12-30 2007-07-12 Wei-Wu He Sirna compositions promoting scar-free wound healing of skin and methods for wound treatment
US20080015161A1 (en) 2006-03-16 2008-01-17 Hans-Peter Vornlocher RNAi modulation of TGF-beta and therapeutic uses thereof
WO2008154482A2 (en) 2007-06-08 2008-12-18 Sirnaomics, Inc. Sirna compositions and methods of use in treatment of ocular diseases
WO2009061417A1 (en) 2007-11-06 2009-05-14 Sirnaomics, Inc. Multi-targeted rnai therapeutics for scarless wound healing of skin
US20100319074A1 (en) 2007-11-06 2010-12-16 Sir Naomics, Inc. Multi-targeted rnai therapeutics for scarless wound healing of skin
US20110165227A1 (en) 2008-05-24 2011-07-07 Hai Yan Compositions and Methods Using siRNA Molecules for Treatment of Gliomas
US8541568B2 (en) 2008-05-24 2013-09-24 Hai Yan Compositions and methods using siRNA molecules for treatment of gliomas
US20120071540A1 (en) 2008-12-31 2012-03-22 Lu Patrick Y Compositions and Methods Using siRNA Molecules and siRNA Cocktails for the Treatment of Breast Cancer
US9012622B2 (en) 2008-12-31 2015-04-21 Patrick Y. Lu Compositions and methods using siRNA molecules and siRNA cocktails for the treatment of breast cancer
US20130225655A1 (en) 2010-05-04 2013-08-29 Patrick Y. Lu Combinations of TGFBeta and COX-2 Inhibitors and Methods for Their Therapeutic Application
US9642873B2 (en) 2010-05-04 2017-05-09 Sirnaomics, Inc. Combinations of TGFβ and COX-2 inhibitors and methods for their therapeutic application

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
Barik, Sailen, "Control of nonsegmented negative-strand RNA virus replication by siRNA," Virus Research, vol. 102, 2004, pp. 27-35.
Bitko, Vira, et al., "Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses," BMC Microbiology, vol. 1, No. 34, Dec. 20, 2001, pp. 1-11.
Cheema, Sangeeta, et al., "Regulation and Guidance of Cell Behavior for Tissue Regeneration Via the Sirna Mechanism", Wound Repair and Regeneration, vol. 15, No. 3, 2007, pp. 286-295.
Choi, Byung-Min, et al., "Control of Scarring in Adult Wounds Using Antisense Transforming Growth Factor-Beta1 Oligodeoxynucleotides", Immunology and Cell Biology, vol. 74, 1996, pp. 144-150.
De Wolf, Holger, et al., "Effect of Cationic Carriers on the Pharmacokinetics and Tumor Localization of Nucleic Acids after Intravenous Administration," International Journal of Pharmaceutics, 331, 2007, pp. 167-175.
European Patent Office Search Report and Opinion for App. No. 08846548.9-2107 of Sirnaomics, Inc., dated Sep. 26, 2011.
International Search Report and Written Opinion of the International Searching Authority on International App. No. PCT/US2008/12498 (WO 2009/061417) of Sirnaomics, Inc., dated Feb. 23, 2009.
Kim et al. (Biochemical and Biophysical Research Communications 343 (2006) 1072-1078). *
Kim, et al., "The Anti-Fibrotic Effect of TGF-Beta1 SiRNA's in Murine Model of Liver Cirrhosis," Biochemical and Biophysical Research Communications 343 (2008) 1072-1078.
Leng, Qixin, et al., "Highly Branched HK Peptides Are Effective Carriers of siRNA," The Journal of Gene Medicine, 2005, 7, pp. 977-986.
Mack, Judith, et al., "Hoxb13 Knockout Adult Skin Exhibits High Levels of Hyaluronan and Enhanced Wound Healing", FASEB Journal, vol. 17, Jul. 2003, pp. 1352-1354.
Michels, Stephan, et al., "Promising New Treatments for Neovascular Age-Related Macular Degeneration," Expert Opin. Investig. Drugs, 2006, 15(7), pp. 779-793.
Pickering, Lulu, "Progress in RNA-based therapeutics," Spectrum Drug Discovery and Design, Decision Resources, Inc., Waltham, Massachusetts, Aug. 4, 2005, pp. 6-1 to 6-20.
Stelnicki, Eric, et al., "Modulation of the Human Homeobox Genes PRX-2 and HOXB13 in Scarless Fetal Wounds", Journal of Investigative Dermatology, vol. 111, 1998, pp. 57-63.
Whitmore, Mark, et al., "Synergistic Activation of Innate Immunity by Double-Stranded RNA and CpG DNA Promotes Enhanced Antitumor Activity," Cancer Research 64, 5850-5860, Aug. 15, 2004.
Wilgus, Traci, et al, "Reduction of Scar Formation in Full-Thickness Wounds With Topical Celecoxib Treatment", Wound Repair and Regeneration, Mosby-Year Book, St. Louis, Mo, US, vol. 11, 2003, pp. 25-34.

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10421970B2 (en) 2004-05-12 2019-09-24 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
WO2019226940A1 (en) 2018-05-24 2019-11-28 Sirnaomics, Inc. Composition and methods of controllable co-coupling polypeptide nanoparticle delivery system for nucleic acid therapeutics
US20210324384A1 (en) * 2018-12-27 2021-10-21 Sirnaomics, Inc. SILENCING TGF-BETA 1 and COX2 USING siRNAs DELIVERED in a POLYPEPTIDE NANOPARTICLE ALONE and in COMBINATION with IMMUNE CHECKPOINT INHIBITORS to TREAT CANCER

Also Published As

Publication number Publication date
ES2545963T3 (es) 2015-09-17
WO2009061417A1 (en) 2009-05-14
EP2217062A1 (en) 2010-08-18
JP2011504170A (ja) 2011-02-03
CN101917846B (zh) 2014-06-25
EP2217062B1 (en) 2015-05-27
US8735567B2 (en) 2014-05-27
US20100319074A1 (en) 2010-12-16
CN101917846A (zh) 2010-12-15
DK2217062T3 (en) 2015-08-24
EP2217062A4 (en) 2011-11-09

Similar Documents

Publication Publication Date Title
USRE46873E1 (en) Multi-targeted RNAi therapeutics for scarless wound healing of skin
US9642873B2 (en) Combinations of TGFβ and COX-2 inhibitors and methods for their therapeutic application
US8541568B2 (en) Compositions and methods using siRNA molecules for treatment of gliomas
US20120115923A1 (en) Sirna Compositions Promoting Scar-Free Wound Healing of Skin and Methods for Wound Treatment
KR20170093988A (ko) Gst-pi 유전자 조정을 위한 rna 제제
Kushibiki et al. Delivery of plasmid DNA expressing small interference RNA for TGF-β type II receptor by cationized gelatin to prevent interstitial renal fibrosis
Kang et al. An in vitro study on the suppressive effect of glioma cell growth induced by plasmid-based small interference RNA (siRNA) targeting human epidermal growth factor receptor
CA2856329A1 (en) Compositions and methods for treating glioma
US20170253879A1 (en) APTAMER-RNAi THERAPEUTIC COMPOSITIONS
CN112725436A (zh) 一种人circMKLN1基因的用途及相关产品
CA2745111A1 (en) Modulation of olfml-3 mediated angiogenesis
US10443059B2 (en) Pharmaceutical composition and method for reducing scar formation
US20100093830A1 (en) Modulation of MLCK-L Expression and Uses Thereof
US8759311B2 (en) Use of siRNA targetting SIPA1L1 for the reduction of adipogenesis
JP4480125B2 (ja) ｓｉＲＮＡを用いたヒト血管内皮増殖因子の発現の強い抑制。
JP2012508224A (ja) 脂肪生成の調節のためのＰｌａｃ８活性の阻害剤の使用
EP3820483A2 (en) Compositions and methods for treating endometriosis
CA2762813A1 (en) Use of inhibitors of zdhhc2 activity for modulation of adipogenesis
JPWO2005063984A1 (ja) 遺伝子発現を抑制する二本鎖ｒｎａ

Legal Events

Date Code Title Description
AS Assignment

Owner name: SIRNAOMICS, INC., MARYLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LU, PATRICK Y.;SIMONENKO, VERA;SIGNING DATES FROM 20140616 TO 20141013;REEL/FRAME:044914/0956

Owner name: SIRNAOMICS, INC., MARYLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LI, LING;REEL/FRAME:044916/0875

Effective date: 20090825

AS Assignment

Owner name: GENERAL RESEARCH LABORATORY, INC., MARYLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SIRNAOMICS, INC.;REEL/FRAME:056839/0189

Effective date: 20101130

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 8