US6200806B1 - Primate embryonic stem cells - Google Patents

Primate embryonic stem cells Download PDF

Info

Publication number
US6200806B1
US6200806B1 US09/106,390 US10639098A US6200806B1 US 6200806 B1 US6200806 B1 US 6200806B1 US 10639098 A US10639098 A US 10639098A US 6200806 B1 US6200806 B1 US 6200806B1
Authority
US
United States
Prior art keywords
cells
primate
human
cell
ssea
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US09/106,390
Inventor
James A. Thomson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wisconsin Alumni Research Foundation
Original Assignee
Wisconsin Alumni Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=23484566&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US6200806(B1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to US09/106,390 priority Critical patent/US6200806B1/en
Application filed by Wisconsin Alumni Research Foundation filed Critical Wisconsin Alumni Research Foundation
Priority to US09/761,289 priority patent/US20010024825A1/en
Publication of US6200806B1 publication Critical patent/US6200806B1/en
Application granted granted Critical
Priority to US09/982,637 priority patent/US7029913B2/en
Priority to US10/430,496 priority patent/US20060040383A1/en
Priority to US11/033,335 priority patent/US20050158854A1/en
Priority to US11/036,245 priority patent/US7582479B2/en
Priority to US12/047,135 priority patent/US7781216B2/en
Priority to US12/822,004 priority patent/US8273569B2/en
Priority to US13/595,587 priority patent/US20120328582A1/en
Assigned to WISCONSIN ALUMNI RESEARCH FOUNDATION reassignment WISCONSIN ALUMNI RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: THOMSON, JAMES
Priority to US14/281,341 priority patent/US20150056698A1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • C12N5/0605Cells from extra-embryonic tissues, e.g. placenta, amnion, yolk sac, Wharton's jelly
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • C12N5/0606Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00Coculture with; Conditioned medium produced by
    • C12N2502/13Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells

Definitions

  • the field of the present invention is stem cell cultures.
  • the field of the present invention is primate embryonic stem cell cultures.
  • stem cells are undifferentiated cells which can give rise to a succession of mature functional cells.
  • a hematopoietic stem cell may give rise to any of the different types of terminally differentiated blood cells.
  • Embryonic stem (ES) cells are derived from the embryo and are pluripotent, thus possessing the capability of developing into any organ or tissue type or, at least potentially, into a complete embryo.
  • Mouse ES cells are undifferentiated, pluripotent cells derived in vitro from preimplantation embryos (Evans, et al. Nature 292:154-159, 1981; Martin, Proc. Natl. Acad. Sci. USA 78:7634-7638, 1981) or from fetal germ cells (Matsui, et al., Cell 70:841-847, 1992).
  • Mouse ES cells maintain an undifferentiated state through serial passages when cultured in the presence of fibroblast feeder layers in the presence of Leukemia Inhibitory Factor (LIF) (Williams, et al., Nature 336:684-687, 1988). If LIF is removed, mouse ES cells differentiate.
  • LIF Leukemia Inhibitory Factor
  • Mouse ES cells cultured in non-attaching conditions aggregate and differentiate into simple embryoid bodies, with an outer layer of endoderm and an inner core of primitive ectoderm. If these embryoid bodies are then allowed to attach onto a tissue culture surface, disorganized differentiation occurs of various cell types, including nerves, blood cells, muscle, and cartilage (Martin, 1981, supra; Doetschman, et al., J. Embryol. Exp. Morph. 87:27-45, 1985).
  • Mouse ES cells injected into syngeneic mice form teratocarcinomas that exhibit disorganized differentiation, often with representatives of all three embryonic germ layers. Mouse ES cells combined into chimeras with normal preimplantation embryos and returned to the uterus participate in normal development (Richard, et al., Cytogenet. Cell Genet. 65:169-171, 1994).
  • mouse ES cells to contribute to functional germ cells in chimeras provides a method for introducing site-specific mutations into mouse lines.
  • homologous recombination can be used to derive ES cell lines with planned alterations of specific genes. These genetically altered cells can be used to form chimeras with normal embryos and chimeric animals are recovered. If the ES cells contribute to the germ line in the chimeric animal, then in the next generation a mouse line for the planned mutation is established.
  • mouse ES cells have the potential to differentiate into any cell type in the body, mouse ES cells allow the in vitro study of the mechanisms controlling the differentiation of specific cells or tissues. Although the study of mouse ES cells provides clues to understanding the differentiation of general mammalian tissues, dramatic differences in primate and mouse development of specific lineages limits the usefulness of mouse ES cells as a model of human development.
  • Mouse and primate embryos differ meaningfully in the timing of expression of the embryonic genome, in the formation of an egg cylinder versus an embryonic disc (Kaufman, The Atlas of Mouse Development , London: Academic Press, 1992), in the proposed derivation of some early lineages (O'Rahilly & Muller, Developmental Stages in Human Embryos , Washington: Carnegie Institution of Washington, 1987), and in the structure and function in the extraembryonic membranes and placenta (Mossman, Vertebrate Fetal Membranes , New Brunswick: Rutgers, 1987). Other tissues differ in growth factor requirements for development (e.g.
  • primate ES cells lines will provide a faithful model for understanding the differentiation of primate tissues in general and human tissues in particular.
  • the placenta provides just one example of how primate ES cells will provide an accurate model of human development that cannot be provided by ES cells from other species.
  • the placenta and extraembryonic membranes differ dramatically between mice and humans. Structurally, the mouse placenta is classified as labyrinthine, whereas the human and the rhesus monkey placenta are classified as villous.
  • Chorionic gonadotropin, expressed by the trophoblast is an essential molecule involved in maternal recognition of pregnancy in all primates, including humans (Hearn, J Reprod Fertil 76:809-819, 1986; Hearn et al., J Reprod Fert 92:497-509, 1991).
  • Trophoblast secretion of chorionic gonadotropin in primates maintains the corpus luteum of pregnancy and, thus, progesterone secretion. Without progesterone, pregnancy fails. Yet mouse trophoblast produces no chorionic gonadotropin, and mice use entirely different mechanisms for pregnancy maintenance (Hearn et al., “Normal and abnormal embryo-fetal development in mammals,” In: Lamming E, ed. Marshall's Physiology of Reproduction. 4th ed. Edinburgh, N.Y.: Churchill Livingstone, 535-676, 1994).
  • An immortal, euploid, primate ES cell line with the developmental potential to form trophoblast in vitro, will allow the study of the ontogeny and function of genes such as chorionic gonadotropin which are critically important in human pregnancy. Indeed, the differentiation of any tissue for which there are significant differences between mice and primates will be more accurately reflected in vitro by primate ES cells than by mouse ES cells.
  • the major in vitro models for studying trophoblast function include human choriocarcinoma cells, which are malignant cells that may not faithfully reflect normal trophectoderm; short-term primary cultures of human and non-human primate cytotrophoblast, which in present culture conditions quickly form non-dividing syncytial trophoblast; and in vitro culture of preimplantation non-human primate embryos (Hearn, et al., J. Endocrinol. 119:249-255, 1988; Coutifaris, et al., Ann. NY Acad. Sci. 191-201, 1994).
  • An immortal, euploid, non-human primate embryonic stem (ES) cell line with the developmental potential to form trophectoderm offers significant advantages over present in vitro models of human trophectoderm development and function, as trophoblast-specific genes such as chorionic gonadotropin could be stably altered in the ES cells and then studied during differentiation to trophectoderm.
  • ES embryonic stem
  • EC human embryonic carcinoma
  • EC cells can be induced to differentiate in culture, and the differentiation is characterized by the loss of specific cell surface markers (SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81) and the appearance of new markers (Andrews, et al., 1987, supra).
  • SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 specific cell surface markers
  • Human EC cells will form teratocarcinomas with derivatives of multiple embryonic lineages in tumors in nude mice.
  • the range of differentiation of these human EC cells is limited compared to the range of differentiation obtained with mouse ES cells, and all EC cell lines derived to date are aneuploid (Andrews, et al., 1987, supra).
  • teratocarcinomas are tumors derived from germ cells, and although germ cells (like ES cells) are theoretically totipotent (i.e. capable of forming all cell types in the body), the more limited developmental potential and the abnormal karyotypes of EC cells are thought to result from selective pressures in the teratocarcinoma tumor environment (Roimpuls & Papaioannou, Cell Differ 15:155-161, 1984).
  • ES cells are thought to retain greater developmental potential because they are derived from normal embryonic cells in vitro, without the selective pressures of the teratocarcinoma environment. Nonetheless, mouse EC cells and mouse ES cells share the same unique combination of cell surface markers (SSEA-1 (+), SSEA-3 ( ⁇ ), SSEA-4 ( ⁇ ), and alkaline phosphatase (+)).
  • Pluripotent cell lines have also been derived from preimplantation embryos of several domestic and laboratory animals species (Evans, et al., Theriogenology 33(1):125-128, 1990; Evans, et al., Theriogenology 33(1):125-128, 1990; Notarianni, et al., J. Reprod. Fertil. 41(Suppl.):51-56, 1990; Giles, et al., Mol. Reprod. Dev. 36:130-138, 1993; Graves, et al., Mol. Reprod. Dev. 36:424-433, 1993; Sukoyan, et al., Mol. Reprod. Dev.
  • ES cells lines are true ES cells lines.
  • True ES cells should: (i) be capable of indefinite proliferation in vitro in an undifferentiated state; (ii) maintain a normal karyotype through prolonged culture; and (iii) maintain the potential to differentiate to derivatives of all three embryonic germ layers (endoderm, mesoderm, and ectoderm) even after prolonged culture. Strong evidence of these required properties have been published only for rodents ES cells including mouse (Evans & Kaufman, Nature 292:154-156, 1981; Martin, Proc Natl Acad Sci USA 78:7634-7638, 1981) hamster (Doetschmanet al.
  • the present invention is a purified preparation of primate embryonic stem cells.
  • the primate ES cell lines are true ES cell lines in that they: (i) are capable of indefinite proliferation in vitro in an undifferentiated state; (ii) are capable of differentiation to derivatives, of all three embryonic germ layers (endoderm, mesoderm, and ectoderm) even after prolonged culture; and (iii) maintain a normal karyotype throughout prolonged culture.
  • the true primate ES cells lines are therefore pluripotent.
  • primate ES cell lines are preferably negative for the SSEA-1 marker, preferably positive for the SSEA-3 marker, and positive for the SSEA-4 marker.
  • the primate ES cell lines are also positive for the TRA-1-60, and TRA-1-81 markers, as well as positive for the alkaline phosphatase marker.
  • the primate ES cell lines continue to proliferate in an undifferentiated state after continuous culture for at least one year.
  • the cells remain euploid after proliferation in an undifferentiated state.
  • the cells can differentiate to trophoblast in vitro and express chorionic gonadotropin.
  • the present invention is also a purified preparation of primate embryonic stem cells that has the ability to differentiate into cells derived from mesoderm, endoderm, and ectoderm germ layers after the cells have been injected into an immunocompromised mouse, such as a SCID mouse.
  • the present invention is also a method of isolating a primate embryonic stem cell line.
  • the method comprises the steps of isolating a primate blastocyst, isolating cells from the inner cellular mass (ICM) of the blastocyst, plating the ICM cells on a fibroblast layer (wherein ICM-derived cell masses are formed) removing an ICM-derived cell mass and dissociating the mass into dissociated cells, replating the dissociated cells on embryonic feeder cells and selecting colonies with compact morphology containing cells with a high nucleus/cytoplasm ratio, and prominent nucleoli. The cells of the selected colonies are then cultured.
  • ICM inner cellular mass
  • FIG. 1 is a photomicrograph illustrating normal XY karyotype of rhesus ES cell line R278.5 after 11 months of continuous culture.
  • Photograph 2 A demonstrates the distinct cell borders, high nucleus to cytoplasm ratio, and prominent nucleoli, of undifferentiated rhesus ES cells.
  • Photographs 2 B- 2 D shows differentiated cells eight days after plating R278.5 cells on gel treated tissue culture plastic (with 10 3 units/ml added human LIF). Cells of these three distinct morphologies are consistently present when R278.5 cells are allowed to differentiate at low density without fibroblasts either in the presence or absence of soluble human LIF.
  • Photograph 3 A shows Alkaline Phosphatase (+);
  • Photograph 3 B shows SSEA-1 ( ⁇ );
  • Photograph 3 C shows SSEA-3 (+);
  • Photograph 3 D shows SSEA-4 (+);
  • Photograph 3 E shows TRA-1-60 (+); and
  • Photograph 3 F shows TRA-1-81 (+).
  • FIGS. 4A-4B are photographs illustrating expression of ⁇ -fetoprotein mRNA and ⁇ - and ⁇ -chorionic gonadotrophin mRNA expression in rhesus ES cells (R278.5) allowed to differentiate in culture.
  • FIGS. 5A-5F include six photomicrographs of sections of tumors formed by injection of 0.5 ⁇ 10 6 rhesus ES (R278.5) cells into the hindleg muscles of SCID mice and analyzed 15 weeks later.
  • Photograph 5 D shows stratified layers of neural cells in the pattern of a developing neural tube.
  • FIGS. 6A-6B include photographs of an embryoid Body. This embryoid body was formed from a marmoset ES cell line (Cj62) that had been continuously passaged in vitro for over 6 months.
  • Photograph 6 A (above) shows a section of the anterior 1 ⁇ 3 of the embryonic disc. Note the primitive ectoderm (E) forms a distinct cell layer from the underlying primitive endoderm (e), with no mixing of the cell layers. Note also that amnion (a) is composed of two distinct layers; the inner layer is continuous with the primitive ectoderm at the margins.
  • Photograph 6 B (below) shows a section in the caudal 1 ⁇ 3 of embryonic disc. Note central groove (arrow) and mixing of primitive ectoderm and endoderm representing early primitive streak formation, indicating the beginning of gastrulation. 400 ⁇ , toluidine blue stain.
  • the present invention is a pluripotent, immortal euploid primate ES cell line, as exemplified by the isolation of ES cell lines from two primate species, the common marmoset ( Callithrix jacchus ) and the rhesus monkey ( Macaca mulatta ). Primate embryonic stem cells are useful for:
  • primate ES cells By manipulating culture conditions, primate ES cells, human and non-human, can be induced to differentiate to specific cell types, such as blood cells, neuron cells, or muscle cells.
  • primate ES cells can be allowed to differentiate in tumors in SCID mice, the tumors can be disassociated, and the specific differentiated cell types of interest can be selected by the usage of lineage specific markers through the use of fluorescent activated cell sorting (FACS) or other sorting method or by direct microdissection of tissues of interest.
  • FACS fluorescent activated cell sorting
  • Macaques and marmosets were used as exemplary species for isolation of a primate ES cell line.
  • Macaques such as the rhesus monkey, are Old World species that are the major primates used in biomedical research. They are relatively large (about 7-10 kg). Males take 4-5 years to mature, and females have single young.
  • rhesus monkey true ES cell lines provide a very accurate in vitro model for human differentiation.
  • Rhesus monkey ES cell lines and rhesus monkeys will be particularly useful in the testing of the safety and efficacy of the transplantation of differentiated cell types into whole animals for the treatment of specific diseases or conditions.
  • the techniques developed for the rhesus ES cell lines model the generation, characterization and manipulation of human ES cell lines.
  • the common marmoset ( Callithrix jacchus ) is a New World primate species with reproductive characteristics that make it an excellent choice for ES cell derivation.
  • Marmosets are small (about 350-400 g), have a short gestation period (144 days), reach sexual maturity in about 18 months, and routinely have twins or triplets. Unlike in macaques, it is possible to routinely synchronize ovarian cycles in the marmoset with prostaglandin analogs, making collection of age-matched embryos from multiple females possible, and allowing efficient embryo transfer to synchronized recipients with 70%-80% of embryos transferred resulting in pregnancies. Because of these reproductive characteristics that allow for the routine efficient transfer of multiple embryos, marmosets provide an excellent primate species in which to generate transgenic models for human diseases.
  • human ES cell lines will be permanent cell lines that will also be distinguished from all other permanent human cell lines by their normal karyotype and the expression of the same combination of cell surface markers (alkaline phosphotase, preferably SSEA-3, SSEA-4, TRA-1-60 and TRA-1-81) that characterize other primate ES cell lines.
  • a normal karyotype and the expression of this combination of cell surface markers will be defining properties of true human ES cell lines, regardless of the method used for their isolation and regardless of their tissue of origin.
  • ES medium consists of 80% Dulbecco's modified Eagle's medium (DMEM; no pyruvate, high glucose formulation, Gibco BRL), with 20% fetal bovine serum (FBS; Hyclone), 0.1 mM ⁇ -mercaptoethanol (Sigma), 1% non-essential amino acid stock (Gibco BRL).
  • fetal bovine serum batches are compared by testing clonal plating efficiency of a low passage mouse ES cell line (ES jt3 ), a cell line developed just for the purpose of this test.
  • FBS batches must be compared because it has been found that batches vary dramatically in their ability to support embryonic cell growth, but any other method of assaying the competence of FBS batches for support of embryonic cells will work as an alternative.
  • ES cells are isolated on a confluent layer of murine embryonic fibroblast in the presence of ES cell medium.
  • Embryonic fibroblasts are preferably obtained from 12 day old fetuses from outbred CF1 mice (SASCO), but other strains may be used as an alternative.
  • Tissue culture dishes are preferably treated with 0.1% gelatin (type I; Sigma).
  • the zona pellucida is removed from blastocysts by brief exposure to pronase (Sigma).
  • blastocysts are exposed to a 1:50 dilution of rabbit anti-marmoset spleen cell antiserum (for marmoset blastocysts) or a 1:50 dilution of rabbit anti-rhesus monkey (for rhesus monkey blastocysts) in DMEM for 30 minutes, then washed for 5 minutes three times in DMEM, then exposed to a 1:5 dilution of Guinea pig complement (Gibco) for 3 minutes.
  • lysed trophectoderm cells are removed from the intact inner cell mass (ICM) by gentle pipetting, and the ICM plated on mouse inactivated (3000 rads gamma irradiation) embryonic fibroblasts.
  • ICM-derived masses are removed from endoderm outgrowths with a micropipette with direct observation under a stereo microscope, exposed to 0.05% Trypsin-EDTA (Gibco) supplemented with 1% chicken serum for 3-5 minutes and gently dissociated by gentle pipetting through a flame polished micropipette.
  • Trypsin-EDTA Gibco
  • Dissociated cells are replated on embryonic feeder layers in fresh ES medium, and observed for colony formation. Colonies demonstrating ES-like morphology are individually selected, and split again as described above. The ES-like morphology is defined as compact colonies having a high nucleus to cytoplasm ratio and prominent nucleoli. Resulting ES cells are then routinely split by brief trypsinization or exposure to Dulbecco's Phosphate Buffered Saline (without calcium or magnesium and with 2 mM EDTA) every 1-2 weeks as the cultures become dense. Early passage cells are also frozen and stored in liquid nitrogen.
  • Cell lines may be karyotyped with a standard G-banding technique (such as by the Cytogenetics Laboratory of the University of Wisconsin State Hygiene Laboratory, which provides routine karyotyping services) and compared to published karyotypes for the primate species.
  • G-banding technique such as by the Cytogenetics Laboratory of the University of Wisconsin State Hygiene Laboratory, which provides routine karyotyping services
  • Isolation of ES cell lines from other primate species would follow a similar procedure, except that the rate of development to blastocyst can vary by a few days between species, and the rate of development of the cultured ICMs will vary between species. For example, six days after ovulation, rhesus monkey embryos are at the expanded blastocyst stage, whereas marmoset embryos don't reach the same stage until 7-8 days after ovulation. The Rhesus ES cell lines were obtained by splitting the ICM-derived cells for the first time at 7-16 days after immunosurgery; whereas the marmoset ES cells were derived with the initial split at 7-10 days after immunosurgery. Because other primates also vary in their developmental rate, the timing of embryo collection, and the timing of the initial ICM split will vary between primate species, but the same techniques and culture conditions will allow ES cell isolation.
  • human ES cells that are derived from preimplantation embryos will be derived from in vitro fertilized (IVF) embryos.
  • IVF in vitro fertilized
  • Experiments on unused (spare) human IVF-produced embryos are allowed in many countries, such as Singapore and the United Kingdom, if the embryos are less than 14 days old. Only high quality embryos are suitable for ES isolation.
  • Present defined culture conditions for culturing the one cell human embryo to the expanded blastocyst are suboptimal but practicable, Bongso et al., Hum Reprod 4:706-713, 1989.
  • Primate embryonic stem cells share features with the primate ICM and with pluripotent human embryonal carcinoma cells.
  • Putative primate ES cells may therefore be characterized by morphology and by the expression of cell surface markers characteristic of human EC cells. Additionally, putative primate ES cells may be characterized by developmental potential, karyotype and immortality.
  • primate embryonic stem cell lines The colony morphology of primate embryonic stem cell lines is similar to, but distinct from, mouse embryonic stem cells. Both mouse and primate ES cells have the characteristic features of undifferentiated stem cells, with high nuclear/cytoplasmic ratios, prominent nucleoli, and compact colony formation. The colonies of primate ES cells are flatter than mouse ES cell colonies and individual primate ES cells can be easily distinguished.
  • reference character A indicates a phase contrast photomicrograph of cell line R278.5 demonstrating the characteristic primate ES cell morphology.
  • a primate ES cell line of the present invention is distinct from mouse ES cell lines by the presence or absence of the cell surface markers described below.
  • One set of glycolipid cell surface markers is known as the Stage-specific embryonic antigens 1 through 4. These antigens can be identified using antibodies for SSEA 1, preferably SSEA-3 and SSEA-4 which are available from the Developmental Studies Hybridoma Bank of the National Institute of Child Health and Human Development.
  • SSEA 1-60 and TRA-1-81 designate antibodies from hybridomas developed by Peter Andrews of the University of Sheffield and are described in Andrews et al., “Cell lines from human germ cell tumors,” In: Robertson E, ed. Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. Oxford: IRL Press, 207-246, 1987.
  • NTERA-2 cl. D1 a pluripotent human EC cell line (gift of Peter Andrews), may be used as a negative control for SSEA-1, and as a positive control for SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81. This cell line was chosen for positive control only because it has been extensively studied and reported in the literature, but other human EC cell lines may be used as well.
  • Mouse ES cells (ES jt3 ) are used as a positive control for SSEA-1, and for a negative control for SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81.
  • Other routine negative controls include omission of the primary or secondary antibody and substitution of a primary antibody with an unrelated specificity.
  • Alkaline phosphatase may be detected following fixation of cells with 4% para-formaldehyde using “Vector Red” (Vector Laboratories) as a substrate, as described by the manufacturer (Vector Laboratories).
  • Vector Red Vector Laboratories
  • the precipitate formed by this substrate is red when viewed with a rhodamine filter system, providing substantial amplification over light microscopy.
  • Table 1 diagrams a comparison of mouse ES cells, primate ES cells, and human EC cells.
  • the only cells reported to express the combination of markers SSEA-3; SSEA-4, TRA-1-60, and TRA-1-81 other than primate ES cells are human EC cells.
  • the globo-series glycolipids SSEA-3 and SSEA-4 are consistently present on human EC cells, and are of diagnostic value in distinguishing human EC cell tumors from human yolk sac carcinomas, choriocarcinomas, and other lineages which lack these markers, Wenk et al., Int J Cancer 58:108-115, 1994.
  • TRA-1-60 and TRA-1-81 antigens have been studied extensively on a particular pluripotent human EC cell line, NTERA-2 CL. D1, Andrews et al, supra. Differentiation of NTERA-2 CL. D1 cells in vitro results in the loss of SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 expression and the increased expression of the lacto-series glycolipid SSEA-1, Andrews et al, supra. This contrasts with undifferentiated mouse ES cells, which express SSEA-1, and neither SSEA-3 nor SSEA-4. Although the function of these antigens are unknown, their shared expression by R278.5 cells and human EC cells suggests a close embryological similarity. Alkaline phosphatase will also be present on all primate ES cells. A successful primate ES cell culture of the present invention will correlate with the cell surface markers found in the rhesus macaque and marmoset cell lines described in Table 1.
  • the rhesus macaque and marmoset cell lines are identical to human EC cell lines for the 5 described markers. Therefore, a successful primate ES cell culture will also mimic human EC cells. However, there are other ways to discriminate ES cells from EC cells. For example, the primate ES cell line has a normal karyotype and the human EC cell line is aneuploid.
  • FIG. 3 the photographs labelled A through F demonstrate the characteristic staining of these markers on a rhesus monkey ES cell line designated R278.5.
  • Primate ES cells of the present invention are pluripotent.
  • pluripotent we mean that the cell has the ability to develop into any cell derived from the three main germ cell layers or an embryo itself.
  • a successful primate ES cell line will differentiate into cells derived from all three embryonic germ layers including: bone, cartilage, smooth muscle, striated muscle, and hematopoietic cells (mesoderm); liver, primitive gut and respiratory epithelium (endoderm); neurons, glial cells, hair follicles, and tooth buds (ectoderm).
  • This experiment can be accomplished by injecting approximately 0.5-1.0 ⁇ 10 6 primate ES cells into the rear leg muscles of 8-12 week old male SCID mice.
  • the resulting tumors can be fixed in 4% paraformaldehyde and examined histologically after paraffin embedding at 8-16 weeks of development.
  • FIG. 1 In FIG. 1
  • photomicrographs designated A-F are of sections of tumors formed by injection of rhesus ES cells into the hind leg muscles of SCID mice and analyzed 15 weeks later demonstrating cartilage, smooth muscle, and striated muscle (mesoderm); stratified squamous epithelium with hair follicles, neural tube with ventricular, intermediate, and mantle layers (ectoderm); ciliated columnar epithelium and villi lined by absorptive enterocytes and mucus-secreting goblet cells (endoderm).
  • a successful nonhuman primate ES cell line will have the ability to participate in normal development when combined in chimeras with normal preimplantation embryos. Chimeras between preimplantation nonhuman primate embryos and nonhuman primate ES cells can be formed by routine methods in several ways.
  • injection chimeras 10-15 nonhuman primate ES cells can be microinjected into the cavity of an expanded nonhuman primate blastocyst;
  • aggregation chimeras nonhuman primate morulae can be co-cultured on a lawn of nonhuman primate ES cells and allowed to aggregate; and
  • tetraploid chimeras 10-15 nonhuman primate ES cells can be aggregated with tetraploid nonhuman primate morulae obtained by electrofusion of 2-cell embryos, or incubation of morulae in the cytoskeletal inhibitor cholchicine.
  • the chimeras can be returned to the uterus of a female nonhuman primate and allowed to develop to term, and the ES cells will contribute to normal differentiated tissues derived from all three embryonic germ layers and to germ cells. Because nonhuman primate ES can be genetically manipulated prior to chimera formation by standard techniques, chimera formation followed by embryo transfer can lead to the production of transgenic nonhuman primates.
  • Successful primate ES cell lines have normal karyotypes. Both XX and XY cells lines will be derived. The normal karyotypes in primate ES cell lines will be in contrast to the abnormal karyotype found in human embryonal carcinoma (EC), which are derived from spontaneously arising human germ cell tumors (teratocarcinomas). Human embryonal carcinoma cells have a limited ability to differentiate into multiple cell types and represent the closest existing cell lines to primate ES cells. Although tumor-derived human embryonal carcinoma cell lines have some properties in common with embryonic stem cell lines, all human embryonal carcinoma cell lines derived to date are aneuploid.
  • EC human embryonal carcinoma
  • primate ES cell lines and human EC cell lines can be distinguished by the normal karyotypes found in primate ES cell lines and the abnormal karyotypes found in human EC lines.
  • normal karyotype it is meant that all chromosomes normally characteristic of the species are present and have not been noticeably altered.
  • Immortal cells are capable of continuous indefinite replication in vitro. Continued proliferation for longer than one year of culture is a sufficient evidence for immortality, as primary cell cultures without this property fail to continuously divide for this length of time (Freshney, Culture of animal cells . New York: Wiley-Liss, 1994). Primate ES cells will continue to proliferate in vitro with the culture conditions described above for longer than one year, and will maintain the developmental potential to contribute all three embryonic germ layers. This developmental potential can be demonstrated by the injection of ES cells that have been cultured for a prolonged period (over a year) into SCID mice and then histologically examining the resulting tumors. Although karyotypic changes can occur randomly with prolonged culture, some primate ES cells will maintain a normal karyotype for longer than a year of continuous culture.
  • LIF Leukemia inhibitory factor
  • primate ES cells of the present invention spontaneously differentiate and will produce chorionic gonadotropin, indicating trophoblast differentiation (a component of the placenta) and produce ⁇ -fetoprotein, indicating endoderm differentiation.
  • Chorionic gonadotropin activity can be assayed in the medium conditioned by differentiated cells by Leydig cell bioassay, Seshagiri & Hearn, Hum Reprod 8:279-287, 1992.
  • RNA can be prepared by guanidine isothiocyanate-phenol/chloroform extraction (1) from approximately 0.2 ⁇ 10 6 differentiated cells and from 0.2 ⁇ 10 6 undifferentiated cells.
  • the relative levels of the mRNA for ⁇ -fetoprotein and the ⁇ - and ⁇ -subunit of chorionic gonadotropin relative to glyceraldehyde-3-phosphate dehydrogenase can be determined by semi-quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR).
  • the PCR primers for glyceraldehyde 3-phosphate dehydrogenase are based on the human cDNA sequence, and do not amplify mouse G3PDH mRNA under our conditions.
  • the identity of the ⁇ -fetoprotein, CG ⁇ and CG ⁇ cDNAs can be verified by subcloning and sequencing.
  • the number of amplification rounds which produced linear increases in target cDNAs and the relation between input RNA and amount of PCR product is empirically determined as by Golos et al. Samples were fractionated in 3% Nusieve (FMC, Rockland, Me.) agarose gels (1 ⁇ TBE running buffer) and DNA bands of interest were cut out, melted at 65° C. in 0.5 ml TE, and radioactivity determined by liquid scintillation counting. The ratio of counts per minute in a specific PCR product relative to cpm of G3PDH PCR product is used to estimate the relative levels of a mRNAs among differentiated and undifferentiated cells.
  • Nusieve FMC, Rockland, Me.
  • the ability to differentiate into trophectoderm in vitro and the ability of these differentiated cells to produce chorionic gonadotropin distinguishes the primate ES cell line of the present invention from all other published ES cell lines.
  • the Wisconsin Regional Primate Research Center provides a preimplantation embryo recovery service for the rhesus monkey, using the non-surgical flush procedure described above.
  • WRPRC Wisconsin Regional Primate Research Center
  • 151 uterine flushes were attempted from rhesus monkeys, yielding 80 viable embryos (0.53 embryos per flush attempt).
  • R278.5 three independent embryonic stem cell lines from two rhesus monkey blastocysts (R278.5, R366, and R367).
  • R278.5 remains undifferentiated and continues to proliferate after continuous culture for over one year.
  • R278.5 cells have also been frozen and successfully thawed with the recovery of viable cells.
  • R278.5 cells The morphology and cell surface markers of R278.5 cells are indistinguishable from human EC cells, and differ significantly from mouse ES cells.
  • R278.5 cells have a high nucleus/cytoplasm ratio and prominent nucleoli, but rather than forming compact, piled-up colonies with indistinct cell borders similar to mouse ES cells, R278.5 cells form flatter colonies with individual, distinct cells (FIG. 2 A).
  • R278.5 cells express the SSEA-3, SSEA-4, TRA-1-60, and TRA-81 antigens (FIG. 3 and Table 1), none of which are expressed by mouse ES cells.
  • the only cells known to express the combination of markers SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 other than primate ES cells are human EC cells.
  • the globo-series glycolipids SSEA-3 and SSEA-4 are consistently present on human EC cells, and are of diagnostic value in distinguishing human EC cell tumors from yolk sac carcinomas, choriocarcinomas and other stem cells derived from human germ cell tumors which lack these markers, Wenk et al, Int J Cancer 58:108-115, 1994. A recent survey found SSEA-3 and SSEA-4 to be present on all of over 40 human EC cell lines examined (Wenk et al.).
  • TRA-1-60 and TRA-1-81 antigens have been studied extensively on a particular pluripotent human EC cell line, NTERA-2 CL. D1 (Andrews et al.). Differentiation of NTERA-2 CL. D1 cells in vitro results in the loss of SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 expression and the increased expression of the lacto-series glycolipid SSEA-1. Undifferentiated mouse ES cells, on the other hand, express SSEA-1, and not SSEA-3, SSEA-4, TRA-1-60 or TRA-1-81 (Wenk et al.). Although the function of these antigens is unknown, their expression by R278.5 cells suggests a close embryological similarity between primate ES cells and human EC cells, and fundamental differences between primate ES cells and mouse ES cells.
  • R278.5 cells also express alkaline phosphatase.
  • alkaline phosphatase The expression of alkaline phosphatase is shared by both primate and mouse ES cells, and relatively few embryonic cells express this enzyme.
  • Positive cells include the ICM and primitive ectoderm (which are the most similar embryonic cells in the intact embryo to ES cells), germ cells, (which are totipotent), and a very limited number of neural precursors, Kaufman M H. The atlas of mouse development . London: Academic Press, 1992. Cells not expressing this enzyme will not be primate ES cells.
  • R278.5 cells grown on mouse embryonic fibroblasts without exogenous LIF remain undifferentiated and continued to proliferate.
  • Up to 10 4 units/ml human LIF fails to prevent differentiation.
  • added LIF fails to increase the cloning efficiency or proliferation rate of R278.5 cells on fibroblasts.
  • R366 and R367 Since the derivation of the R278.5 cell line, we have derived two additional rhesus ES cell lines (R366 and R367) on embryonic fibroblasts without any exogenously added LIF at initial derivation. R366 and R367 cells, like R278.5 cells, continue to proliferate on embryonic fibroblasts without exogenously added LIF and differentiate in the absence of fibroblasts, regardless of the presence of added LIF.
  • RT-PCR performed on mRNA from spontaneously differentiated R278.5 cells revealed ⁇ -fetoprotein mRNA (FIG. 4 ).
  • ⁇ -fetoprotein is a specific marker for endoderm, and is expressed by both extra-embryonic (yolk sac) and embryonic (fetal liver and intestines) endoderm-derived tissues.
  • Epithelial cells resembling extraembryonic endoderm are present in cells differentiated in vitro from R278.5 cells (FIG. 2 ).
  • Bioactive CG (3.89 mI units/ml) was present in culture medium collected from differentiated cells, but not in medium collected from undifferentiated cells (less than 0.03 mI units/ml), indicating the differentiation of trophoblast, a trophectoderm derivative.
  • the relative level of the CG ⁇ mRNA increased 23.9-fold after differentiation (FIG. 4 ).
  • Such structures included gut lined by villi with both absorptive enterocytes and mucus-secreting goblet cells, and sometimes encircled by layers of smooth muscle in the same orientation as muscularis mucosae (circular) and muscularis (outer longitudinal layer aid inner circular layer); neural tubes with ventricular, intermediate, and mantle layers; and hair follicles with hair shafts (FIG. 5 ).
  • R278.5 cells The essential characteristics that define R278.5 cells as ES cells include: indefinite (greater than one year) undifferentiated proliferation in vitro, normal karyotype, and potential to differentiate to derivatives of trophectoderm and all three embryonic germ layers.
  • indefinite greater than one year
  • the last cells capable of contributing to derivatives of both trophectoderm and ICM are early ICM cells.
  • the timing of commitment to ICM or trophectoderm has not been established for any primate species, but the potential of rhesus ES cells to contribute to derivatives of both suggests that they most closely resemble early totipotent embryonic cells.
  • the ability of rhesus ES cells to form trophoblast in vitro distinguishes primate ES cell lines from mouse ES cells.
  • Mouse ES cell have not been demonstrated to form trophoblast in vitro, and mouse trophoblast does not produce gonadotropin.
  • Rhesus ES cells and mouse ES cells do demonstrate the similar wide range of differentiation in tumors that distinguishes ES cells from EC cells.
  • the development of structures composed of multiple cell types such as hair follicles, which require inductive interactions between the embryonic epidermis and underlying mesenchyme, demonstrates the ability of rhesus ES cells to participate in complex developmental processes.
  • the rhesus ES lines R366 and R367 have also been further cultured and analyzed. Both lines have a normal XY karyotype and were proliferated in an undifferentiated state for about three months prior to freezing for later analysis. Samples of each of the cell lines R366 and R367 were injected into SCID mice which then formed teratomas identical to those formed by R278.5 cells. An additional rhesus cell line R394 having a normal XX karyotype was also recovered. All three of these cell lines, R366, R367 and R394 are identical in morphology, growth characteristics, culture requirements and in vitro differentiation characteristics, i.e. the trait of differentiation to multiple cell types in the absence of fibroblasts, to cell line 278.5.
  • fibroblasts for co-culture are not critical.
  • Several fibroblast cell lines have been tested both with rhesus line R278.5 and with the marmoset cell lines described below.
  • the fibroblasts tested include mouse STO cells (ATCC 56-X), mouse 3T3 cells (ATCC 48-X), primary rhesus monkey embryonic fibroblasts derived from 36 day rhesus fetuses, and mouse Sl/Sl 4 cells, which are deficient in the steel factor. All these fibroblast cell lines were capable of maintaining the stem cell lines in an undifferentiated state. Most rapid proliferation of the stem cells was observed using primary mouse embryonic fibroblasts.
  • rhesus ES cells Unlike mouse ES cells, neither rhesus ES cells nor feeder-dependent human EC cells remain undifferentiated and proliferate in the presence of soluble human LIF without fibroblasts.
  • the factors that fibroblasts produce that prevent the differentiation of rhesus ES cells or feeder-dependent human EC cells are unknown, but the lack of a dependence on LIF is another characteristic that distinguishes primate ES cells from mouse ES cells.
  • Rhesus ES cells will be important for elucidating the mechanisms that control the differentiation of specific primate cell types. Given the close evolutionary distance and the developmental and physiological similarities between humans and rhesus monkeys, the mechanisms controlling the differentiation of rhesus cells will be very similar to the mechanisms controlling the differentiation of human cells. The importance of elucidating these mechanisms is that once they are understood, it will be possible to direct primate ES cells to differentiate to specific cell types in vitro, and these specific cell types can be used for transplantation to treat specific diseases.
  • ES cells have the developmental potential to give rise to any differentiated cell type, any disease that results in part or in whole from the failure (either genetic or acquired) of specific cell types will be potentially treatable through the transplantation of cells derived from ES cells.
  • Rhesus ES cells and rhesus monkeys will be invaluable for testing the efficacy and safety of the transplantation of specific cell types derived from ES cells.
  • a few examples of human diseases potentially treatable by this approach with human ES cells include degenerative neurological disorders such as Parkinson's disease (dopanergic neurons), juvenile onset diabetes (pancreatic ⁇ -islet cells) or Acquired Immunodeficiency Disease (lymphocytes).
  • undifferentiated ES cells can proliferate indefinitely in vitro, they can be genetically manipulated with standard techniques either to prevent immune rejection after transplantation, or to give them new genetic properties to combat specific diseases.
  • cells derived from rhesus monkey ES cells or other non-human primate ES cells could be used for transplantation to humans to treat specific diseases.
  • Cj11 was cultured continuously for over 14 months, and then frozen for later analysis.
  • the Cj11 cell line and other marmoset ES cell lines have been successfully frozen and then thawed with the recovery of viable cells.
  • These cells have a high nuclear/cytoplasmic ratio, prominent nucleoli, and a compact colony morphology similar to the pluripotent human embryonal carcinoma (EC) cell line NT2/D2.
  • the putative marmoset ES cells When the putative marmoset ES cells were removed from fibroblast feeders, they differentiated into cells of several distinct morphologies. Among the differentiated cells, trophectoderm is indicated by the secretion of chorionic gonadotropin and the presence of the chorionic gonadotropin ⁇ -subunit mRNA. 12.7 mIU/ml luteinizing hormone (LH) activity was measured in the WRPRC core assay lab using a mouse Leydig cell bioassay in medium conditioned 24 hours by putative ES cells allowed to differentiate for one week. Note that chorionic gonadotrophin has both LH and FSH activity, and is routinely measured by LH assays. Control medium from undifferentiated ES cells had less than 1 mIU/ml LH activity.
  • LH luteinizing hormone
  • Chorionic gonadotropin ⁇ -subunit mRNA was detected by reverse transcriptase-polymerase chain reaction (RT-PCR). DNA sequencing confirmed the identity of the chorionic gonadotrophin ⁇ -subunit.
  • Endoderm differentiation (probably extraembryonic endoderm) was indicated by the presence of ⁇ -fetoprotein mRNA, detected by RT-PCR.
  • the embryonic disc was composed of a polarized, columnar epithelial epiblast (primitive ectoderm) layer separated from a visceral endoderm (primitive endoderm) layer. Electron microscopy of the epiblast revealed apical junctional complexes, apical microvilli, subapical intermediate filaments, and a basement membrane separating the epiblast from underlying visceral endoderm. All of these elements are features of the normal embryonic disc.
  • the amnion was composed of an inner squamous (ectoderm) layer continuous with the epiblast and an outer mesoderm layer.
  • the bilayered yolk sac had occasional endothelial-lined spaces containing possible hematopoietic precursors.
  • the morphology, immortality, karyotype, and cell surface markers of these marmoset cells identify these marmoset cells as primate ES cells similar to the rhesus ES cells. Since the last cells in the mammalian embryo capable of contributing to both trophectoderm derivatives and endoderm derivatives are the totipotent cells of the early ICM, the ability of marmoset ES cells to contribute to both trophoblast and endoderm demonstrates their similarities to early totipotent embryonic cells of the intact embryo. The formation of embryoid bodies by marmoset ES cells, with remarkable structural similarities to the early post-implantation primate embryo, demonstrates the potential of marmoset ES cells to participate in complex developmental processes requiring the interaction of multiple cell types.
  • marmoset ES cells Given the reproductive characteristics of the common marmoset described above (efficient embryo transfer, multiple young, short generation time), marmoset ES cells will be particularly useful for the generation of transgenic primates. Although mice have provided invaluable insights into gene function and regulation, the anatomical and physiological differences between humans and mice limit the usefulness of transgenic mouse models of human diseases. Transgenic primates, in addition to providing insights into the pathogenesis of specific diseases, will provide accurate animal models to test the efficacy and safety of specific treatments.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Reproductive Health (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Diabetes (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Pregnancy & Childbirth (AREA)
  • Obesity (AREA)
  • Immunology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)
  • Psychology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A purified preparation of primate embryonic stem cells is disclosed. This preparation is characterized by the following cell surface markers: SSEA-1 (-); SSEA-4 (+); TRA-1-60 (+); TRA-1-81 (+); and alkaline phosphatase (+). In a particularly advantageous embodiment, the cells of the preparation are human embryonic stem cells, have normal karyotypes, and continue to proliferate in an undifferentiated state after continuous culture for eleven months. The embryonic stem cell lines also retain the ability, throughout the culture, to form trophoblast and to differentiate into all tissues derived from all three embryonic germ layers (endoderm, mesoderm and ectoderm). A method for isolating a primate embryonic stem cell line is also disclosed.

Description

CROSS REFERENCES TO RELATED APPLICATIONS
This application is a divisional of U.S. Ser. No. 08/591,246 which was filed on Jan. 18, 1996, issued as U.S. Pat. No. 5,843,780, Dec. 1, 1998 and is a continuation-in-part of U.S. Ser. No. 08/376,327 which was filed on Jan. 20, 1995, abandoned.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
Not Applicable.
BACKGROUND OF THE INVENTION
In general, the field of the present invention is stem cell cultures. Specifically, the field of the present invention is primate embryonic stem cell cultures.
In general, stem cells are undifferentiated cells which can give rise to a succession of mature functional cells. For example, a hematopoietic stem cell may give rise to any of the different types of terminally differentiated blood cells. Embryonic stem (ES) cells are derived from the embryo and are pluripotent, thus possessing the capability of developing into any organ or tissue type or, at least potentially, into a complete embryo.
One of the seminal achievements of mammalian embryology of the last decade is the routine insertion of specific genes into the mouse genome through the use of mouse ES cells. This alteration has created a bridge between the in vitro manipulations of molecular biology and an understanding of gene function in the intact animal. Mouse ES cells are undifferentiated, pluripotent cells derived in vitro from preimplantation embryos (Evans, et al. Nature 292:154-159, 1981; Martin, Proc. Natl. Acad. Sci. USA 78:7634-7638, 1981) or from fetal germ cells (Matsui, et al., Cell 70:841-847, 1992). Mouse ES cells maintain an undifferentiated state through serial passages when cultured in the presence of fibroblast feeder layers in the presence of Leukemia Inhibitory Factor (LIF) (Williams, et al., Nature 336:684-687, 1988). If LIF is removed, mouse ES cells differentiate.
Mouse ES cells cultured in non-attaching conditions aggregate and differentiate into simple embryoid bodies, with an outer layer of endoderm and an inner core of primitive ectoderm. If these embryoid bodies are then allowed to attach onto a tissue culture surface, disorganized differentiation occurs of various cell types, including nerves, blood cells, muscle, and cartilage (Martin, 1981, supra; Doetschman, et al., J. Embryol. Exp. Morph. 87:27-45, 1985). Mouse ES cells injected into syngeneic mice form teratocarcinomas that exhibit disorganized differentiation, often with representatives of all three embryonic germ layers. Mouse ES cells combined into chimeras with normal preimplantation embryos and returned to the uterus participate in normal development (Richard, et al., Cytogenet. Cell Genet. 65:169-171, 1994).
The ability of mouse ES cells to contribute to functional germ cells in chimeras provides a method for introducing site-specific mutations into mouse lines. With appropriate transfection and selection strategies, homologous recombination can be used to derive ES cell lines with planned alterations of specific genes. These genetically altered cells can be used to form chimeras with normal embryos and chimeric animals are recovered. If the ES cells contribute to the germ line in the chimeric animal, then in the next generation a mouse line for the planned mutation is established.
Because mouse ES cells have the potential to differentiate into any cell type in the body, mouse ES cells allow the in vitro study of the mechanisms controlling the differentiation of specific cells or tissues. Although the study of mouse ES cells provides clues to understanding the differentiation of general mammalian tissues, dramatic differences in primate and mouse development of specific lineages limits the usefulness of mouse ES cells as a model of human development. Mouse and primate embryos differ meaningfully in the timing of expression of the embryonic genome, in the formation of an egg cylinder versus an embryonic disc (Kaufman, The Atlas of Mouse Development, London: Academic Press, 1992), in the proposed derivation of some early lineages (O'Rahilly & Muller, Developmental Stages in Human Embryos, Washington: Carnegie Institution of Washington, 1987), and in the structure and function in the extraembryonic membranes and placenta (Mossman, Vertebrate Fetal Membranes, New Brunswick: Rutgers, 1987). Other tissues differ in growth factor requirements for development (e.g. the hematopoietic system (Lapidot et al., Lab An Sci 43:147-149, 1994)), and in adult structure and function (e.g. the central nervous system). Because humans are primates, and development is remarkably similar among primates, primate ES cells lines will provide a faithful model for understanding the differentiation of primate tissues in general and human tissues in particular.
The placenta provides just one example of how primate ES cells will provide an accurate model of human development that cannot be provided by ES cells from other species. The placenta and extraembryonic membranes differ dramatically between mice and humans. Structurally, the mouse placenta is classified as labyrinthine, whereas the human and the rhesus monkey placenta are classified as villous. Chorionic gonadotropin, expressed by the trophoblast, is an essential molecule involved in maternal recognition of pregnancy in all primates, including humans (Hearn, J Reprod Fertil 76:809-819, 1986; Hearn et al., J Reprod Fert 92:497-509, 1991). Trophoblast secretion of chorionic gonadotropin in primates maintains the corpus luteum of pregnancy and, thus, progesterone secretion. Without progesterone, pregnancy fails. Yet mouse trophoblast produces no chorionic gonadotropin, and mice use entirely different mechanisms for pregnancy maintenance (Hearn et al., “Normal and abnormal embryo-fetal development in mammals,” In: Lamming E, ed. Marshall's Physiology of Reproduction. 4th ed. Edinburgh, N.Y.: Churchill Livingstone, 535-676, 1994). An immortal, euploid, primate ES cell line with the developmental potential to form trophoblast in vitro, will allow the study of the ontogeny and function of genes such as chorionic gonadotropin which are critically important in human pregnancy. Indeed, the differentiation of any tissue for which there are significant differences between mice and primates will be more accurately reflected in vitro by primate ES cells than by mouse ES cells.
The major in vitro models for studying trophoblast function include human choriocarcinoma cells, which are malignant cells that may not faithfully reflect normal trophectoderm; short-term primary cultures of human and non-human primate cytotrophoblast, which in present culture conditions quickly form non-dividing syncytial trophoblast; and in vitro culture of preimplantation non-human primate embryos (Hearn, et al., J. Endocrinol. 119:249-255, 1988; Coutifaris, et al., Ann. NY Acad. Sci. 191-201, 1994). An immortal, euploid, non-human primate embryonic stem (ES) cell line with the developmental potential to form trophectoderm offers significant advantages over present in vitro models of human trophectoderm development and function, as trophoblast-specific genes such as chorionic gonadotropin could be stably altered in the ES cells and then studied during differentiation to trophectoderm.
The cell lines currently available that resembles primate ES cells most closely are human embryonic carcinoma (EC) cells, which are pluripotent, immortal cells derived from teratocarcinomas (Andrews, et al., Lab. Invest. 50(2):147-162, 1984; Andrews, et al., in: Robertson E., ed. Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. Oxford: IRL press, pp. 207-246, 1987). EC cells can be induced to differentiate in culture, and the differentiation is characterized by the loss of specific cell surface markers (SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81) and the appearance of new markers (Andrews, et al., 1987, supra). Human EC cells will form teratocarcinomas with derivatives of multiple embryonic lineages in tumors in nude mice. However, the range of differentiation of these human EC cells is limited compared to the range of differentiation obtained with mouse ES cells, and all EC cell lines derived to date are aneuploid (Andrews, et al., 1987, supra). Similar mouse EC cell lines have been derived from teratocarcinomas, and, in general their developmental potential is much more limited than mouse ES cells (Rossant, et al., Cell Differ. 15:155-161, 1984). Teratocarcinomas are tumors derived from germ cells, and although germ cells (like ES cells) are theoretically totipotent (i.e. capable of forming all cell types in the body), the more limited developmental potential and the abnormal karyotypes of EC cells are thought to result from selective pressures in the teratocarcinoma tumor environment (Rossant & Papaioannou, Cell Differ 15:155-161, 1984). ES cells, on the other hand, are thought to retain greater developmental potential because they are derived from normal embryonic cells in vitro, without the selective pressures of the teratocarcinoma environment. Nonetheless, mouse EC cells and mouse ES cells share the same unique combination of cell surface markers (SSEA-1 (+), SSEA-3 (−), SSEA-4 (−), and alkaline phosphatase (+)).
Pluripotent cell lines have also been derived from preimplantation embryos of several domestic and laboratory animals species (Evans, et al., Theriogenology 33(1):125-128, 1990; Evans, et al., Theriogenology 33(1):125-128, 1990; Notarianni, et al., J. Reprod. Fertil. 41(Suppl.):51-56, 1990; Giles, et al., Mol. Reprod. Dev. 36:130-138, 1993; Graves, et al., Mol. Reprod. Dev. 36:424-433, 1993; Sukoyan, et al., Mol. Reprod. Dev. 33:418-431, 1992; Sukoyan, et al., Mol. Reprod. Dev. 36:148-158, 1993; Iannaccone, et al., Dev. Biol. 163:288-292, 1994).
Whether or not these cell lines are true ES cells lines is a subject about which there may be some difference of opinion. True ES cells should: (i) be capable of indefinite proliferation in vitro in an undifferentiated state; (ii) maintain a normal karyotype through prolonged culture; and (iii) maintain the potential to differentiate to derivatives of all three embryonic germ layers (endoderm, mesoderm, and ectoderm) even after prolonged culture. Strong evidence of these required properties have been published only for rodents ES cells including mouse (Evans & Kaufman, Nature 292:154-156, 1981; Martin, Proc Natl Acad Sci USA 78:7634-7638, 1981) hamster (Doetschmanet al. Dev Biol 127:224-227, 1988), and rat (Iannaccone et al. Dev Biol 163:288-292, 1994), and less conclusively for rabbit ES cells (Gileset al. Mol Reprod Dev 36:130-138, 1993; Graves & Moreadith, Mol Reprod Dev 36:424-433, 1993). However, only established ES cell lines from the rat (Iannaccone, et al., 1994, supra) and the mouse (Bradley, et al., Nature 309:255-256, 1984) have been reported to participate in normal development in chimeras. There are no reports of the derivation of any primate ES cell line.
BRIEF SUMMARY OF THE INVENTION
The present invention is a purified preparation of primate embryonic stem cells. The primate ES cell lines are true ES cell lines in that they: (i) are capable of indefinite proliferation in vitro in an undifferentiated state; (ii) are capable of differentiation to derivatives, of all three embryonic germ layers (endoderm, mesoderm, and ectoderm) even after prolonged culture; and (iii) maintain a normal karyotype throughout prolonged culture. The true primate ES cells lines are therefore pluripotent.
The present invention is also summarized in that primate ES cell lines are preferably negative for the SSEA-1 marker, preferably positive for the SSEA-3 marker, and positive for the SSEA-4 marker. The primate ES cell lines are also positive for the TRA-1-60, and TRA-1-81 markers, as well as positive for the alkaline phosphatase marker.
It is an advantageous feature of the present invention that the primate ES cell lines continue to proliferate in an undifferentiated state after continuous culture for at least one year. In a particularly advantageous embodiment, the cells remain euploid after proliferation in an undifferentiated state.
It is a feature of the primate ES cell lines in accordance with the present invention that the cells can differentiate to trophoblast in vitro and express chorionic gonadotropin.
The present invention is also a purified preparation of primate embryonic stem cells that has the ability to differentiate into cells derived from mesoderm, endoderm, and ectoderm germ layers after the cells have been injected into an immunocompromised mouse, such as a SCID mouse.
The present invention is also a method of isolating a primate embryonic stem cell line. The method comprises the steps of isolating a primate blastocyst, isolating cells from the inner cellular mass (ICM) of the blastocyst, plating the ICM cells on a fibroblast layer (wherein ICM-derived cell masses are formed) removing an ICM-derived cell mass and dissociating the mass into dissociated cells, replating the dissociated cells on embryonic feeder cells and selecting colonies with compact morphology containing cells with a high nucleus/cytoplasm ratio, and prominent nucleoli. The cells of the selected colonies are then cultured.
It is an object of the present invention to provide a primate embryonic stem cell line.
It is an object of the present invention to provide a primate embryonic stem cell line characterized by the following markers: alkaline phosphatase(+); SSEA-1(−); preferably SSEA-3(+); SSEA-4(+); TRA-1-60(+); and TRA-1-81(+).
It is an object of the present invention to provide a primate embryonic stem cell line capable of proliferation in an undifferentiated state after continuous culture for at least one year. Preferably, these cells remain euploid.
It is another object of the present invention to provide a primate embryonic stem cell line wherein the cells differentiate into cells derived from mesoderm, endoderm, and ectoderm germ layers when the cells are injected into an immunocompromised mouse.
Other objects, features, and advantages of the present invention will become obvious after study of the specification, drawings, and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a photomicrograph illustrating normal XY karyotype of rhesus ES cell line R278.5 after 11 months of continuous culture.
FIGS. 2A-2D are a set of phase-contrast photomicrographs demonstrating the morphology of undifferentiated rhesus ES (R278.5) cells and of cells differentiated from R278.5 in vitro (bar=100μ). Photograph 2A demonstrates the distinct cell borders, high nucleus to cytoplasm ratio, and prominent nucleoli, of undifferentiated rhesus ES cells. Photographs 2B-2D shows differentiated cells eight days after plating R278.5 cells on gel treated tissue culture plastic (with 103 units/ml added human LIF). Cells of these three distinct morphologies are consistently present when R278.5 cells are allowed to differentiate at low density without fibroblasts either in the presence or absence of soluble human LIF.
FIGS. 3A-F are photomicrographs demonstrating the expression of cell surface markers on undifferentiated rhesus ES (R278.5) cells (bar=100μ). Photograph 3A shows Alkaline Phosphatase (+); Photograph 3B shows SSEA-1 (−); Photograph 3C shows SSEA-3 (+); Photograph 3D shows SSEA-4 (+); Photograph 3E shows TRA-1-60 (+); and Photograph 3F shows TRA-1-81 (+).
FIGS. 4A-4B are photographs illustrating expression of α-fetoprotein mRNA and α- and β-chorionic gonadotrophin mRNA expression in rhesus ES cells (R278.5) allowed to differentiate in culture.
FIGS. 5A-5F include six photomicrographs of sections of tumors formed by injection of 0.5×106 rhesus ES (R278.5) cells into the hindleg muscles of SCID mice and analyzed 15 weeks later. Photograph 5A shows a low power field demonstrating disorganized differentiation of multiple cell types. A gut-like structure is encircled by smooth muscle(s), and elsewhere foci of cartilage (c) are present (bar=400μ); Photograph 5B shows striated muscle (bar=40μ); Photograph 5C shows stratified squamous epithelium with several hair follicles. The labeled hair follicle (f) has a visible hair shaft (bar=200μ); Photograph 5D shows stratified layers of neural cells in the pattern of a developing neural tube. An upper “ventricular” layer, containing numerous mitotic figures (arrows), overlies a lower “mantle” layer. (bar=100μ); Photograph 5E shows ciliated columnar epithelium (bar=40μ); Photograph 5F shows villi covered with columnar epithelium with interspersed mucus-secreting goblet cells (bar=200μ).
FIGS. 6A-6B include photographs of an embryoid Body. This embryoid body was formed from a marmoset ES cell line (Cj62) that had been continuously passaged in vitro for over 6 months. Photograph 6A (above) shows a section of the anterior ⅓ of the embryonic disc. Note the primitive ectoderm (E) forms a distinct cell layer from the underlying primitive endoderm (e), with no mixing of the cell layers. Note also that amnion (a) is composed of two distinct layers; the inner layer is continuous with the primitive ectoderm at the margins. Photograph 6B (below) shows a section in the caudal ⅓ of embryonic disc. Note central groove (arrow) and mixing of primitive ectoderm and endoderm representing early primitive streak formation, indicating the beginning of gastrulation. 400×, toluidine blue stain.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(1) In General
(a) Uses of Primate ES Cells
The present invention is a pluripotent, immortal euploid primate ES cell line, as exemplified by the isolation of ES cell lines from two primate species, the common marmoset (Callithrix jacchus) and the rhesus monkey (Macaca mulatta). Primate embryonic stem cells are useful for:
(i) Generating transgenic non-human primates for models of specific human genetic diseases. Primate embryonic stem cells will allow the generation of primate tissue or animal models for any human genetic disease for which the responsible gene has been cloned. The human genome project will identify an increasing number of genes related to human disease, but will not always provide insights into gene function. Transgenic nonhuman primates will be essential for elucidating mechanisms of disease and for testing new therapies.
(ii) Tissue transplantation. By manipulating culture conditions, primate ES cells, human and non-human, can be induced to differentiate to specific cell types, such as blood cells, neuron cells, or muscle cells. Alternatively, primate ES cells can be allowed to differentiate in tumors in SCID mice, the tumors can be disassociated, and the specific differentiated cell types of interest can be selected by the usage of lineage specific markers through the use of fluorescent activated cell sorting (FACS) or other sorting method or by direct microdissection of tissues of interest. These differentiated cells could then be transplanted back to the adult animal to treat specific diseases, such as hematopoietic disorders, endocrine deficiencies, degenerative neurological disorders or hair loss.
(b) Selection of Model Species
Macaques and marmosets were used as exemplary species for isolation of a primate ES cell line. Macaques, such as the rhesus monkey, are Old World species that are the major primates used in biomedical research. They are relatively large (about 7-10 kg). Males take 4-5 years to mature, and females have single young. Because of the extremely close anatomical and physiological similarities between humans and rhesus monkeys, rhesus monkey true ES cell lines provide a very accurate in vitro model for human differentiation. Rhesus monkey ES cell lines and rhesus monkeys will be particularly useful in the testing of the safety and efficacy of the transplantation of differentiated cell types into whole animals for the treatment of specific diseases or conditions. In addition, the techniques developed for the rhesus ES cell lines model the generation, characterization and manipulation of human ES cell lines.
The common marmoset (Callithrix jacchus) is a New World primate species with reproductive characteristics that make it an excellent choice for ES cell derivation. Marmosets are small (about 350-400 g), have a short gestation period (144 days), reach sexual maturity in about 18 months, and routinely have twins or triplets. Unlike in macaques, it is possible to routinely synchronize ovarian cycles in the marmoset with prostaglandin analogs, making collection of age-matched embryos from multiple females possible, and allowing efficient embryo transfer to synchronized recipients with 70%-80% of embryos transferred resulting in pregnancies. Because of these reproductive characteristics that allow for the routine efficient transfer of multiple embryos, marmosets provide an excellent primate species in which to generate transgenic models for human diseases.
There are approximately 200 primate species in the world. The most fundamental division that divides higher primates is between Old World and New world species. The evolutionary distance between the rhesus monkey and the common marmoset is far greater than the evolutionary distance between humans and rhesus monkeys. Because it is here demonstrated that it is possible to isolate ES cell lines from a representative species of both the Old World and New World group using similar conditions, the techniques described below may be used successfully in deriving ES cell lines in other higher primates as well. Given the close evolutionary distance between rhesus macaques and humans, and the fact that feeder-dependent human EC cell lines can be grown in conditions similar to those that support primate ES cell lines, the same growth conditions will allow the isolation and growth of human ES cells. In addition, human ES cell lines will be permanent cell lines that will also be distinguished from all other permanent human cell lines by their normal karyotype and the expression of the same combination of cell surface markers (alkaline phosphotase, preferably SSEA-3, SSEA-4, TRA-1-60 and TRA-1-81) that characterize other primate ES cell lines. A normal karyotype and the expression of this combination of cell surface markers will be defining properties of true human ES cell lines, regardless of the method used for their isolation and regardless of their tissue of origin.
No other primate (human or non-human) ES cell line is known to exist. The only published permanent, euploid, embryo-derived cell lines that have been convincingly demonstrated to differentiate into derivatives of all three germ layers have been derived from rodents (the mouse, rat, and hamster), and possibly from rabbit. The published reports of embryo-derived cell lines from domestic species have failed to convincingly demonstrate differentiation of derivatives of all three embryonic germ layers or have not been permanent cell lines. Research groups in Britain and Singapore are informally reported, later than the work described here, to have attempted to derive human ES cell lines from surplus in vitro fertilization-produced human embryos, although they have not yet reported success in demonstrating pluripotency of their cells and have failed to isolate permanent cell lines. In the only published report on attempts to isolate human ES cells, conditions were used (LIF in the absence of fibroblast feeder layers) that the results below will indicate will not result in primate ES cells which can remain in an undifferentiated state. It is not surprising, then that the cells grown out of human ICMs failed to continue to proliferate after 1 or 2 subcultures, Bongso et al. Hum. Reprod. 9:2100-2117 (1994).
(2) Embryonic Stem Cell Isolation
A preferable medium for isolation of embryonic stem cells is “ES medium.” ES medium consists of 80% Dulbecco's modified Eagle's medium (DMEM; no pyruvate, high glucose formulation, Gibco BRL), with 20% fetal bovine serum (FBS; Hyclone), 0.1 mM β-mercaptoethanol (Sigma), 1% non-essential amino acid stock (Gibco BRL). Preferably, fetal bovine serum batches are compared by testing clonal plating efficiency of a low passage mouse ES cell line (ESjt3), a cell line developed just for the purpose of this test. FBS batches must be compared because it has been found that batches vary dramatically in their ability to support embryonic cell growth, but any other method of assaying the competence of FBS batches for support of embryonic cells will work as an alternative.
Primate ES cells are isolated on a confluent layer of murine embryonic fibroblast in the presence of ES cell medium. Embryonic fibroblasts are preferably obtained from 12 day old fetuses from outbred CF1 mice (SASCO), but other strains may be used as an alternative. Tissue culture dishes are preferably treated with 0.1% gelatin (type I; Sigma).
For rhesus monkey embryos, adult female rhesus monkeys (greater than four years old) demonstrating normal ovarian cycles are observed daily for evidence of menstrual bleeding (day 1 of cycle=the day of onset of menses). Blood samples are drawn daily during the follicular phase starting from day 8 of the menstrual cycle, and serum concentrations of luteinizing hormone are determined by radioimmunoassay. The female is paired with a male rhesus monkey of proven fertility from day 9 of the menstrual cycle until 48 hours after the luteinizing hormone surge; ovulation is taken as the day following the luteinizing hormone surge. Expanded blastocysts are collected by non-surgical uterine flushing at six days after ovulation. This procedure routinely results in the recovery of an average 0.4 to 0.6 viable embryos per rhesus monkey per month, Seshagiri et al. Am J Primatol 29:81-91, 1993.
For marmoset embryos, adult female marmosets (greater than two years of age) demonstrating regular ovarian cycles are maintained in family groups, with a fertile male and up to five progeny. Ovarian cycles are controlled by intramuscular injection of 0.75 g of the prostaglandin PGF2a analog cloprostenol (Estrumate, Mobay Corp, Shawnee, KS) during the middle to late luteal phase. Blood samples are drawn on day 0 (immediately before cloprostenol injection), and on days 3, 7, 9, 11, and 13. Plasma progesterone concentrations are determined by ELISA. The day of ovulation is taken as the day preceding a plasma progesterone concentration of 10 ng/ml or more. At eight days after ovulation, expanded blastocysts are recovered by a non-surgical uterine flush procedure, Thomson et al. “Non-surgical uterine stage preimplantation embryo collection from the common marmoset,” J Med Primatol, 23:333-336 (1994). This procedure results in the average production of 1.0 viable embryos per marmoset per month.
The zona pellucida is removed from blastocysts by brief exposure to pronase (Sigma). For immunosurgery, blastocysts are exposed to a 1:50 dilution of rabbit anti-marmoset spleen cell antiserum (for marmoset blastocysts) or a 1:50 dilution of rabbit anti-rhesus monkey (for rhesus monkey blastocysts) in DMEM for 30 minutes, then washed for 5 minutes three times in DMEM, then exposed to a 1:5 dilution of Guinea pig complement (Gibco) for 3 minutes.
After two further washes in DMEM, lysed trophectoderm cells are removed from the intact inner cell mass (ICM) by gentle pipetting, and the ICM plated on mouse inactivated (3000 rads gamma irradiation) embryonic fibroblasts.
After 7-21 days, ICM-derived masses are removed from endoderm outgrowths with a micropipette with direct observation under a stereo microscope, exposed to 0.05% Trypsin-EDTA (Gibco) supplemented with 1% chicken serum for 3-5 minutes and gently dissociated by gentle pipetting through a flame polished micropipette.
Dissociated cells are replated on embryonic feeder layers in fresh ES medium, and observed for colony formation. Colonies demonstrating ES-like morphology are individually selected, and split again as described above. The ES-like morphology is defined as compact colonies having a high nucleus to cytoplasm ratio and prominent nucleoli. Resulting ES cells are then routinely split by brief trypsinization or exposure to Dulbecco's Phosphate Buffered Saline (without calcium or magnesium and with 2 mM EDTA) every 1-2 weeks as the cultures become dense. Early passage cells are also frozen and stored in liquid nitrogen.
Cell lines may be karyotyped with a standard G-banding technique (such as by the Cytogenetics Laboratory of the University of Wisconsin State Hygiene Laboratory, which provides routine karyotyping services) and compared to published karyotypes for the primate species.
Isolation of ES cell lines from other primate species would follow a similar procedure, except that the rate of development to blastocyst can vary by a few days between species, and the rate of development of the cultured ICMs will vary between species. For example, six days after ovulation, rhesus monkey embryos are at the expanded blastocyst stage, whereas marmoset embryos don't reach the same stage until 7-8 days after ovulation. The Rhesus ES cell lines were obtained by splitting the ICM-derived cells for the first time at 7-16 days after immunosurgery; whereas the marmoset ES cells were derived with the initial split at 7-10 days after immunosurgery. Because other primates also vary in their developmental rate, the timing of embryo collection, and the timing of the initial ICM split will vary between primate species, but the same techniques and culture conditions will allow ES cell isolation.
Because ethical considerations in the U.S. do not allow the recovery of human in vivo fertilized preimplantation embryos from the uterus, human ES cells that are derived from preimplantation embryos will be derived from in vitro fertilized (IVF) embryos. Experiments on unused (spare) human IVF-produced embryos are allowed in many countries, such as Singapore and the United Kingdom, if the embryos are less than 14 days old. Only high quality embryos are suitable for ES isolation. Present defined culture conditions for culturing the one cell human embryo to the expanded blastocyst are suboptimal but practicable, Bongso et al., Hum Reprod 4:706-713, 1989. Co-culturing of human embryos with human oviductal cells results in the production of high blastocyst quality. IVF-derived expanded human blastocysts grown in cellular co-culture, or in improved defined medium, will allow the isolation of human ES cells with the same procedures described above for nonhuman primates.
(3) Defining Characteristics of Primate ES Cells
Primate embryonic stem cells share features with the primate ICM and with pluripotent human embryonal carcinoma cells. Putative primate ES cells may therefore be characterized by morphology and by the expression of cell surface markers characteristic of human EC cells. Additionally, putative primate ES cells may be characterized by developmental potential, karyotype and immortality.
(a) Morphology
The colony morphology of primate embryonic stem cell lines is similar to, but distinct from, mouse embryonic stem cells. Both mouse and primate ES cells have the characteristic features of undifferentiated stem cells, with high nuclear/cytoplasmic ratios, prominent nucleoli, and compact colony formation. The colonies of primate ES cells are flatter than mouse ES cell colonies and individual primate ES cells can be easily distinguished. In FIG. 2, reference character A indicates a phase contrast photomicrograph of cell line R278.5 demonstrating the characteristic primate ES cell morphology.
(b) Cell Surface Markers
A primate ES cell line of the present invention is distinct from mouse ES cell lines by the presence or absence of the cell surface markers described below.
One set of glycolipid cell surface markers is known as the Stage-specific embryonic antigens 1 through 4. These antigens can be identified using antibodies for SSEA 1, preferably SSEA-3 and SSEA-4 which are available from the Developmental Studies Hybridoma Bank of the National Institute of Child Health and Human Development. The cell surface markers referred to as TRA-1-60 and TRA-1-81 designate antibodies from hybridomas developed by Peter Andrews of the University of Sheffield and are described in Andrews et al., “Cell lines from human germ cell tumors,” In: Robertson E, ed. Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. Oxford: IRL Press, 207-246, 1987. The antibodies were localized with a biotinylated secondary antibody and then an avidin/biotinylated horseradish peroxidase complex (Vectastain ABC System, Vector Laboratories). Alternatively, it should also be understood that other antibodies for these same cell surface markers can be generated. NTERA-2 cl. D1, a pluripotent human EC cell line (gift of Peter Andrews), may be used as a negative control for SSEA-1, and as a positive control for SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81. This cell line was chosen for positive control only because it has been extensively studied and reported in the literature, but other human EC cell lines may be used as well.
Mouse ES cells (ESjt3) are used as a positive control for SSEA-1, and for a negative control for SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81. Other routine negative controls include omission of the primary or secondary antibody and substitution of a primary antibody with an unrelated specificity.
Alkaline phosphatase may be detected following fixation of cells with 4% para-formaldehyde using “Vector Red” (Vector Laboratories) as a substrate, as described by the manufacturer (Vector Laboratories). The precipitate formed by this substrate is red when viewed with a rhodamine filter system, providing substantial amplification over light microscopy.
Table 1 diagrams a comparison of mouse ES cells, primate ES cells, and human EC cells. The only cells reported to express the combination of markers SSEA-3; SSEA-4, TRA-1-60, and TRA-1-81 other than primate ES cells are human EC cells. The globo-series glycolipids SSEA-3 and SSEA-4 are consistently present on human EC cells, and are of diagnostic value in distinguishing human EC cell tumors from human yolk sac carcinomas, choriocarcinomas, and other lineages which lack these markers, Wenk et al., Int J Cancer 58:108-115, 1994. A recent survey found SSEA-3 and SSEA-4 to be present on all of over 40 human EC cell lines examined, Wenk et al. TRA-1-60 and TRA-1-81 antigens have been studied extensively on a particular pluripotent human EC cell line, NTERA-2 CL. D1, Andrews et al, supra. Differentiation of NTERA-2 CL. D1 cells in vitro results in the loss of SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 expression and the increased expression of the lacto-series glycolipid SSEA-1, Andrews et al, supra. This contrasts with undifferentiated mouse ES cells, which express SSEA-1, and neither SSEA-3 nor SSEA-4. Although the function of these antigens are unknown, their shared expression by R278.5 cells and human EC cells suggests a close embryological similarity. Alkaline phosphatase will also be present on all primate ES cells. A successful primate ES cell culture of the present invention will correlate with the cell surface markers found in the rhesus macaque and marmoset cell lines described in Table 1.
As disclosed below in Table 1, the rhesus macaque and marmoset cell lines are identical to human EC cell lines for the 5 described markers. Therefore, a successful primate ES cell culture will also mimic human EC cells. However, there are other ways to discriminate ES cells from EC cells. For example, the primate ES cell line has a normal karyotype and the human EC cell line is aneuploid.
In FIG. 3, the photographs labelled A through F demonstrate the characteristic staining of these markers on a rhesus monkey ES cell line designated R278.5.
TABLE 1
Mouse C. jacchus M. mulatta Human EC
ES ES ES (NTERA-2 cl.D1)
SSEA-1 +
SSEA-3 + + +
SSEA-4 + + +
Tra-1-60 + + +
Tra-1-81 + + +
(c) Developmental Potential
Primate ES cells of the present invention are pluripotent. By “pluripotent” we mean that the cell has the ability to develop into any cell derived from the three main germ cell layers or an embryo itself. When injected into SCID mice, a successful primate ES cell line will differentiate into cells derived from all three embryonic germ layers including: bone, cartilage, smooth muscle, striated muscle, and hematopoietic cells (mesoderm); liver, primitive gut and respiratory epithelium (endoderm); neurons, glial cells, hair follicles, and tooth buds (ectoderm).
This experiment can be accomplished by injecting approximately 0.5-1.0×106 primate ES cells into the rear leg muscles of 8-12 week old male SCID mice. The resulting tumors can be fixed in 4% paraformaldehyde and examined histologically after paraffin embedding at 8-16 weeks of development. In FIG. 4, photomicrographs designated A-F are of sections of tumors formed by injection of rhesus ES cells into the hind leg muscles of SCID mice and analyzed 15 weeks later demonstrating cartilage, smooth muscle, and striated muscle (mesoderm); stratified squamous epithelium with hair follicles, neural tube with ventricular, intermediate, and mantle layers (ectoderm); ciliated columnar epithelium and villi lined by absorptive enterocytes and mucus-secreting goblet cells (endoderm).
A successful nonhuman primate ES cell line will have the ability to participate in normal development when combined in chimeras with normal preimplantation embryos. Chimeras between preimplantation nonhuman primate embryos and nonhuman primate ES cells can be formed by routine methods in several ways. (i) injection chimeras: 10-15 nonhuman primate ES cells can be microinjected into the cavity of an expanded nonhuman primate blastocyst; (ii) aggregation chimeras: nonhuman primate morulae can be co-cultured on a lawn of nonhuman primate ES cells and allowed to aggregate; and (iii) tetraploid chimeras: 10-15 nonhuman primate ES cells can be aggregated with tetraploid nonhuman primate morulae obtained by electrofusion of 2-cell embryos, or incubation of morulae in the cytoskeletal inhibitor cholchicine. The chimeras can be returned to the uterus of a female nonhuman primate and allowed to develop to term, and the ES cells will contribute to normal differentiated tissues derived from all three embryonic germ layers and to germ cells. Because nonhuman primate ES can be genetically manipulated prior to chimera formation by standard techniques, chimera formation followed by embryo transfer can lead to the production of transgenic nonhuman primates.
(d) Karyotype
Successful primate ES cell lines have normal karyotypes. Both XX and XY cells lines will be derived. The normal karyotypes in primate ES cell lines will be in contrast to the abnormal karyotype found in human embryonal carcinoma (EC), which are derived from spontaneously arising human germ cell tumors (teratocarcinomas). Human embryonal carcinoma cells have a limited ability to differentiate into multiple cell types and represent the closest existing cell lines to primate ES cells. Although tumor-derived human embryonal carcinoma cell lines have some properties in common with embryonic stem cell lines, all human embryonal carcinoma cell lines derived to date are aneuploid. Thus, primate ES cell lines and human EC cell lines can be distinguished by the normal karyotypes found in primate ES cell lines and the abnormal karyotypes found in human EC lines. By “normal karyotype” it is meant that all chromosomes normally characteristic of the species are present and have not been noticeably altered.
Because of the abnormal karyotypes of human embryonal carcinoma cells, it is not clear how accurately their differentiation reflects normal differentiation. The range of embryonic and extra-embryonic differentiation observed with primate ES cells will typically exceed that observed in any human embryonal carcinoma cell line, and the normal karyotypes of the primate ES cells suggests that this differentiation accurately recapitulates normal differentiation.
(e) Immortality
Immortal cells are capable of continuous indefinite replication in vitro. Continued proliferation for longer than one year of culture is a sufficient evidence for immortality, as primary cell cultures without this property fail to continuously divide for this length of time (Freshney, Culture of animal cells. New York: Wiley-Liss, 1994). Primate ES cells will continue to proliferate in vitro with the culture conditions described above for longer than one year, and will maintain the developmental potential to contribute all three embryonic germ layers. This developmental potential can be demonstrated by the injection of ES cells that have been cultured for a prolonged period (over a year) into SCID mice and then histologically examining the resulting tumors. Although karyotypic changes can occur randomly with prolonged culture, some primate ES cells will maintain a normal karyotype for longer than a year of continuous culture.
(f) Culture Conditions
Growth factor requirements to prevent differentiation are different for the primate ES cell line of the present invention than the requirements for mouse ES cell lines. In the absence of fibroblast feeder layers, Leukemia inhibitory factor (LIF) is necessary and sufficient to prevent differentiation of mouse ES cells and to allow their continuous passage. Large concentrations of cloned LIF fail to prevent differentiation of primate ES cell lines in the absence of fibroblast feeder layers. In this regard, primate ES stem cells are again more similar to human EC cells than to mouse ES cells, as the growth of feeder-dependent human EC cells lines is not supported by LIF in the absence of fibroblasts.
(g) Differentiation to Extra Embryonic Tissues
When grown on embryonic fibroblasts and allowed to grow for two weeks after achieving confluence (i.e., continuously covering the culture surface), primate ES cells of the present invention spontaneously differentiate and will produce chorionic gonadotropin, indicating trophoblast differentiation (a component of the placenta) and produce α-fetoprotein, indicating endoderm differentiation. Chorionic gonadotropin activity can be assayed in the medium conditioned by differentiated cells by Leydig cell bioassay, Seshagiri & Hearn, Hum Reprod 8:279-287, 1992. For mRNA analysis, RNA can be prepared by guanidine isothiocyanate-phenol/chloroform extraction (1) from approximately 0.2×106 differentiated cells and from 0.2×106 undifferentiated cells. The relative levels of the mRNA for α-fetoprotein and the α- and β-subunit of chorionic gonadotropin relative to glyceraldehyde-3-phosphate dehydrogenase can be determined by semi-quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). The PCR primers for glyceraldehyde 3-phosphate dehydrogenase (G3PDH), obtained from Clontech (Palo Alto, Calif.), are based on the human cDNA sequence, and do not amplify mouse G3PDH mRNA under our conditions. Primers for the α-fetoprotein mRNA are based on the human sequence and flank the 7th intron (5′ primer=(5′) GCTGGATTGTCTGCAGGATGGGGAA (SEQ ID NO: 1); 3′ primer=(5′) TCCCCTGAAGAAAATTGGTTAAAAT (SEQ ID NO: 2)). They amplify a cDNA of 216 nucleotides. Primers for the β-subunit of chorionic gonadotropin flank the second intron (5′ primer=(5′) ggatc CACCGTCAACACCACCATCTGTGC (SEQ ID NO: 3); 3′ primer=(5′) ggatc CACAGGTCAAAGGGTGGTCCTTGGG (SEQ ID NO: 4)) (nucleotides added to the hCGb sequence to facilitate sub-cloning are shown in lower case italics). They amplify a cDNA of 262 base pairs. The primers for the CGα subunit can be based on sequences of the first and fourth exon of the rhesus gene (5′ primer=(5′) gggaattc GCAGTTACTGAGAACTCACAAG (SEQ ID NO: 5); 3′ primer=(5′) gggaattc GAAGCATGTCAAAGTGGTATGG (SEQ ID NO: 6)) and amplify a cDNA of 556 base pairs. The identity of the α-fetoprotein, CGα and CGβ cDNAs can be verified by subcloning and sequencing.
For Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR), 1 to 5 μl of total R278.5 RNA can be reverse transcribed as described Golos et al. Endocrinology 133(4):1744-1752, 1993, and one to 20 μl of reverse transcription reaction was then subjected to the polymerase chain reaction in a mixture containing 1-12.5 pmol of each G3PDH primer, 10-25 pmol of each mRNA specific primer, 0.25 mM dNTPs (Pharmacia, Piscataway, N.J.), 1× AmpliTaq buffer (final reaction concentrations=10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% (w/v) gelatin) 2.5 μCi of deoxycytidine 5′a[32P]triphosphate (DuPont, Boston, Mass.), 10% glycerol and 1.25 U of AmpliTaq (Perkin-Elmer, Oak Brook, Ill.) in a total volume of 50 μl. The number of amplification rounds which produced linear increases in target cDNAs and the relation between input RNA and amount of PCR product is empirically determined as by Golos et al. Samples were fractionated in 3% Nusieve (FMC, Rockland, Me.) agarose gels (1× TBE running buffer) and DNA bands of interest were cut out, melted at 65° C. in 0.5 ml TE, and radioactivity determined by liquid scintillation counting. The ratio of counts per minute in a specific PCR product relative to cpm of G3PDH PCR product is used to estimate the relative levels of a mRNAs among differentiated and undifferentiated cells.
The ability to differentiate into trophectoderm in vitro and the ability of these differentiated cells to produce chorionic gonadotropin distinguishes the primate ES cell line of the present invention from all other published ES cell lines.
EXAMPLES
(1) Animals and Embryos
As described above, we have developed a technique for non-surgical, uterine-stage embryo recovery from the rhesus macaque and the common marmoset.
To supply rhesus embryos to interested investigators, The Wisconsin Regional Primate Research Center (WRPRC) provides a preimplantation embryo recovery service for the rhesus monkey, using the non-surgical flush procedure described above. During 1994, 151 uterine flushes were attempted from rhesus monkeys, yielding 80 viable embryos (0.53 embryos per flush attempt).
By synchronizing the reproductive cycles of several marmosets, significant numbers of in vivo produced, age-matched, preimplantation primate embryos were studied in controlled experiments for the first time. Using marmosets from the self-sustaining colony (250 animals) of the Wisconsin Regional Primate Research Center (WRPRC), we recovered 54 viable morulae or blastocysts, 7 unfertilized oocytes or degenerate embryos, and 5 empty zonae pellucidae in a total of 54 flush attempts (1.0 viable embryo-flush attempt). Marmosets have a 28 day ovarian cycle, and because this is a non-surgical procedure, females can be flushed on consecutive months, dramatically increasing the embryo yield compared to surgical techniques which require months of rest between collections.
(2) Rhesus Macaque Embryonic Stem Cells
Using the techniques described above, we have derived three independent embryonic stem cell lines from two rhesus monkey blastocysts (R278.5, R366, and R367). One of these, R278.5, remains undifferentiated and continues to proliferate after continuous culture for over one year. R278.5 cells have also been frozen and successfully thawed with the recovery of viable cells.
The morphology and cell surface markers of R278.5 cells are indistinguishable from human EC cells, and differ significantly from mouse ES cells. R278.5 cells have a high nucleus/cytoplasm ratio and prominent nucleoli, but rather than forming compact, piled-up colonies with indistinct cell borders similar to mouse ES cells, R278.5 cells form flatter colonies with individual, distinct cells (FIG. 2A). R278.5 cells express the SSEA-3, SSEA-4, TRA-1-60, and TRA-81 antigens (FIG. 3 and Table 1), none of which are expressed by mouse ES cells. The only cells known to express the combination of markers SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 other than primate ES cells are human EC cells. The globo-series glycolipids SSEA-3 and SSEA-4 are consistently present on human EC cells, and are of diagnostic value in distinguishing human EC cell tumors from yolk sac carcinomas, choriocarcinomas and other stem cells derived from human germ cell tumors which lack these markers, Wenk et al, Int J Cancer 58:108-115, 1994. A recent survey found SSEA-3 and SSEA-4 to be present on all of over 40 human EC cell lines examined (Wenk et al.).
TRA-1-60 and TRA-1-81 antigens have been studied extensively on a particular pluripotent human EC cell line, NTERA-2 CL. D1 (Andrews et al.). Differentiation of NTERA-2 CL. D1 cells in vitro results in the loss of SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 expression and the increased expression of the lacto-series glycolipid SSEA-1. Undifferentiated mouse ES cells, on the other hand, express SSEA-1, and not SSEA-3, SSEA-4, TRA-1-60 or TRA-1-81 (Wenk et al.). Although the function of these antigens is unknown, their expression by R278.5 cells suggests a close embryological similarity between primate ES cells and human EC cells, and fundamental differences between primate ES cells and mouse ES cells.
R278.5 cells also express alkaline phosphatase. The expression of alkaline phosphatase is shared by both primate and mouse ES cells, and relatively few embryonic cells express this enzyme. Positive cells include the ICM and primitive ectoderm (which are the most similar embryonic cells in the intact embryo to ES cells), germ cells, (which are totipotent), and a very limited number of neural precursors, Kaufman M H. The atlas of mouse development. London: Academic Press, 1992. Cells not expressing this enzyme will not be primate ES cells.
Although cloned human LIF was present in the medium at cell line derivation and for initial passages, R278.5 cells grown on mouse embryonic fibroblasts without exogenous LIF remain undifferentiated and continued to proliferate. R278.5 cells plated on gelatin-treated tissue culture plates without fibroblasts differentiated to multiple cell types or failed to attach and died, regardless of the presence or absence of exogenously added human LIF (FIG. 2). Up to 104 units/ml human LIF fails to prevent differentiation. In addition, added LIF fails to increase the cloning efficiency or proliferation rate of R278.5 cells on fibroblasts. Since the derivation of the R278.5 cell line, we have derived two additional rhesus ES cell lines (R366 and R367) on embryonic fibroblasts without any exogenously added LIF at initial derivation. R366 and R367 cells, like R278.5 cells, continue to proliferate on embryonic fibroblasts without exogenously added LIF and differentiate in the absence of fibroblasts, regardless of the presence of added LIF. RT-PCR performed on mRNA from spontaneously differentiated R278.5 cells revealed α-fetoprotein mRNA (FIG. 4). α-fetoprotein is a specific marker for endoderm, and is expressed by both extra-embryonic (yolk sac) and embryonic (fetal liver and intestines) endoderm-derived tissues. Epithelial cells resembling extraembryonic endoderm are present in cells differentiated in vitro from R278.5 cells (FIG. 2). Bioactive CG (3.89 mI units/ml) was present in culture medium collected from differentiated cells, but not in medium collected from undifferentiated cells (less than 0.03 mI units/ml), indicating the differentiation of trophoblast, a trophectoderm derivative. The relative level of the CGα mRNA increased 23.9-fold after differentiation (FIG. 4).
All SCID mice injected with R278.5 cells in either intra-muscular or intra-testicular sites formed tumors, and tumors in both sites demonstrated a similar range of differentiation. The oldest tumors examined (15 weeks) had the most advanced differentiation, and all had abundant, unambiguous derivatives of all three embryonic germ layers, including gut and respiratory epithelium (endoderm); bone, cartilage, smooth muscle, striated muscle (mesoderm); ganglia, glia, neural precursors, and stratified squamous epithelium (ectoderm), and other unidentified cell types (FIG. 5). In addition to individual cell types, there was organized development of some structures which require complex interactions between different cell types. Such structures included gut lined by villi with both absorptive enterocytes and mucus-secreting goblet cells, and sometimes encircled by layers of smooth muscle in the same orientation as muscularis mucosae (circular) and muscularis (outer longitudinal layer aid inner circular layer); neural tubes with ventricular, intermediate, and mantle layers; and hair follicles with hair shafts (FIG. 5).
The essential characteristics that define R278.5 cells as ES cells include: indefinite (greater than one year) undifferentiated proliferation in vitro, normal karyotype, and potential to differentiate to derivatives of trophectoderm and all three embryonic germ layers. In the mouse embryo, the last cells capable of contributing to derivatives of both trophectoderm and ICM are early ICM cells. The timing of commitment to ICM or trophectoderm has not been established for any primate species, but the potential of rhesus ES cells to contribute to derivatives of both suggests that they most closely resemble early totipotent embryonic cells. The ability of rhesus ES cells to form trophoblast in vitro distinguishes primate ES cell lines from mouse ES cells. Mouse ES cell have not been demonstrated to form trophoblast in vitro, and mouse trophoblast does not produce gonadotropin. Rhesus ES cells and mouse ES cells do demonstrate the similar wide range of differentiation in tumors that distinguishes ES cells from EC cells. The development of structures composed of multiple cell types such as hair follicles, which require inductive interactions between the embryonic epidermis and underlying mesenchyme, demonstrates the ability of rhesus ES cells to participate in complex developmental processes.
The rhesus ES lines R366 and R367 have also been further cultured and analyzed. Both lines have a normal XY karyotype and were proliferated in an undifferentiated state for about three months prior to freezing for later analysis. Samples of each of the cell lines R366 and R367 were injected into SCID mice which then formed teratomas identical to those formed by R278.5 cells. An additional rhesus cell line R394 having a normal XX karyotype was also recovered. All three of these cell lines, R366, R367 and R394 are identical in morphology, growth characteristics, culture requirements and in vitro differentiation characteristics, i.e. the trait of differentiation to multiple cell types in the absence of fibroblasts, to cell line 278.5.
It has been determined that LIF is not required either to derive or proliferate these ES cultures. Each of the cell lines R366, R367 and R394 were derived and cultured without exogenous LIF.
It has also been demonstrated that the particular source of fibroblasts for co-culture is not critical. Several fibroblast cell lines have been tested both with rhesus line R278.5 and with the marmoset cell lines described below. The fibroblasts tested include mouse STO cells (ATCC 56-X), mouse 3T3 cells (ATCC 48-X), primary rhesus monkey embryonic fibroblasts derived from 36 day rhesus fetuses, and mouse Sl/Sl4 cells, which are deficient in the steel factor. All these fibroblast cell lines were capable of maintaining the stem cell lines in an undifferentiated state. Most rapid proliferation of the stem cells was observed using primary mouse embryonic fibroblasts.
Unlike mouse ES cells, neither rhesus ES cells nor feeder-dependent human EC cells remain undifferentiated and proliferate in the presence of soluble human LIF without fibroblasts. The factors that fibroblasts produce that prevent the differentiation of rhesus ES cells or feeder-dependent human EC cells are unknown, but the lack of a dependence on LIF is another characteristic that distinguishes primate ES cells from mouse ES cells. The growth of rhesus monkey ES cells in culture conditions similar to those required by feeder-dependent human EC cells, and the identical morphology and cell surface markers of rhesus ES cells and human EC cells, suggests that similar culture conditions will support human ES cells.
Rhesus ES cells will be important for elucidating the mechanisms that control the differentiation of specific primate cell types. Given the close evolutionary distance and the developmental and physiological similarities between humans and rhesus monkeys, the mechanisms controlling the differentiation of rhesus cells will be very similar to the mechanisms controlling the differentiation of human cells. The importance of elucidating these mechanisms is that once they are understood, it will be possible to direct primate ES cells to differentiate to specific cell types in vitro, and these specific cell types can be used for transplantation to treat specific diseases.
Because ES cells have the developmental potential to give rise to any differentiated cell type, any disease that results in part or in whole from the failure (either genetic or acquired) of specific cell types will be potentially treatable through the transplantation of cells derived from ES cells. Rhesus ES cells and rhesus monkeys will be invaluable for testing the efficacy and safety of the transplantation of specific cell types derived from ES cells. A few examples of human diseases potentially treatable by this approach with human ES cells include degenerative neurological disorders such as Parkinson's disease (dopanergic neurons), juvenile onset diabetes (pancreatic β-islet cells) or Acquired Immunodeficiency Disease (lymphocytes). Because undifferentiated ES cells can proliferate indefinitely in vitro, they can be genetically manipulated with standard techniques either to prevent immune rejection after transplantation, or to give them new genetic properties to combat specific diseases. For specific cell types where immune rejection can be prevented, cells derived from rhesus monkey ES cells or other non-human primate ES cells could be used for transplantation to humans to treat specific diseases.
(3) Marmoset Embryonic Stem Cells
Our method for creating an embryonic stem cell line is described above. Using isolated ICM's derived by immunosurgery from marmoset blastocysts, we have isolated 7 putative ES cell lines, each of which have been cultured for over 6 months.
One of these, Cj11, was cultured continuously for over 14 months, and then frozen for later analysis. The Cj11 cell line and other marmoset ES cell lines have been successfully frozen and then thawed with the recovery of viable cells. These cells have a high nuclear/cytoplasmic ratio, prominent nucleoli, and a compact colony morphology similar to the pluripotent human embryonal carcinoma (EC) cell line NT2/D2.
Four of the cell lines we have isolated have normal XX karyotypes, and one has a normal XY karyotype (Karyotypes were performed by Dr. Charles Harris, University of Wisconsin). These cells were positive for a series of cell surface markers (alkaline phosphatase, SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81) that in combination are definitive markers for undifferentiated human embryonal carcinoma cells (EC) cells and primate ES cells. In particular, these markers distinguish EC cells from the earliest lineages to differentiate in the human preimplantation embryo, trophectoderm (represented by BeWO choriocarcinoma cells) and extraembryonic endoderm (represented by 1411H yolk sac carcinoma cells).
When the putative marmoset ES cells were removed from fibroblast feeders, they differentiated into cells of several distinct morphologies. Among the differentiated cells, trophectoderm is indicated by the secretion of chorionic gonadotropin and the presence of the chorionic gonadotropin β-subunit mRNA. 12.7 mIU/ml luteinizing hormone (LH) activity was measured in the WRPRC core assay lab using a mouse Leydig cell bioassay in medium conditioned 24 hours by putative ES cells allowed to differentiate for one week. Note that chorionic gonadotrophin has both LH and FSH activity, and is routinely measured by LH assays. Control medium from undifferentiated ES cells had less than 1 mIU/ml LH activity.
Chorionic gonadotropin β-subunit mRNA was detected by reverse transcriptase-polymerase chain reaction (RT-PCR). DNA sequencing confirmed the identity of the chorionic gonadotrophin β-subunit.
Endoderm differentiation (probably extraembryonic endoderm) was indicated by the presence of α-fetoprotein mRNA, detected by RT-PCR.
When the marmoset ES cells were grown in high densities, over a period of weeks epithelial cells differentiated and covered the culture dish. The remaining groups of undifferentiated cells rounded up into compact balls and then formed embryoid bodies (as shown in FIG. 6) that recapitulated early development with remarkable fidelity. Over 3-4 weeks, some of the embryoid bodies formed a bilaterally symmetric pyriform embryonic disc, an amnion, a yolk sac, and a mesoblast outgrowth attaching the caudal pole of the amnion to the culture dish.
Histological and ultrastructural examination of one of these embryoid bodies (formed from a cell line that had been passaged continuously for 6 months) revealed a remarkable resemblance to a stage 6-7 post-implantation embryo. The embryonic disc was composed of a polarized, columnar epithelial epiblast (primitive ectoderm) layer separated from a visceral endoderm (primitive endoderm) layer. Electron microscopy of the epiblast revealed apical junctional complexes, apical microvilli, subapical intermediate filaments, and a basement membrane separating the epiblast from underlying visceral endoderm. All of these elements are features of the normal embryonic disc. In the caudal third of the embryonic disc, there was a midline groove, disruption of the basement membrane, and mixing of epiblast cells with underlying endodermal cells (early primitive streak). The amnion was composed of an inner squamous (ectoderm) layer continuous with the epiblast and an outer mesoderm layer. The bilayered yolk sac had occasional endothelial-lined spaces containing possible hematopoietic precursors.
The morphology, immortality, karyotype, and cell surface markers of these marmoset cells identify these marmoset cells as primate ES cells similar to the rhesus ES cells. Since the last cells in the mammalian embryo capable of contributing to both trophectoderm derivatives and endoderm derivatives are the totipotent cells of the early ICM, the ability of marmoset ES cells to contribute to both trophoblast and endoderm demonstrates their similarities to early totipotent embryonic cells of the intact embryo. The formation of embryoid bodies by marmoset ES cells, with remarkable structural similarities to the early post-implantation primate embryo, demonstrates the potential of marmoset ES cells to participate in complex developmental processes requiring the interaction of multiple cell types.
Given the reproductive characteristics of the common marmoset described above (efficient embryo transfer, multiple young, short generation time), marmoset ES cells will be particularly useful for the generation of transgenic primates. Although mice have provided invaluable insights into gene function and regulation, the anatomical and physiological differences between humans and mice limit the usefulness of transgenic mouse models of human diseases. Transgenic primates, in addition to providing insights into the pathogenesis of specific diseases, will provide accurate animal models to test the efficacy and safety of specific treatments.
6 1 25 DNA Artificial Sequence Description of Artificial Sequence Oligonucleotide Primer 1 gctggattgt ctgcaggatg gggaa 25 2 25 DNA Artificial Sequence Description of Artificial Sequence Oligonucleotide Primer 2 tcccctgaag aaaattggtt aaaat 25 3 29 DNA Artificial Sequence Description of Artificial Sequence Oligonucleotide Primer 3 ggatccaccg tcaacaccac catctgtgc 29 4 30 DNA Artificial Sequence Description of Artificial Sequence Oligonucleotide Primer 4 ggatccacag gtcaaagggt ggtccttggg 30 5 30 DNA Artificial Sequence Description of Artificial Sequence Oligonucleotide Primer 5 gggaattcgc agttactgag aactcacaag 30 6 30 DNA Artificial Sequence Description of Artificial Sequence Oligonucleotide Primer 6 gggaattcga agcatgtcaa agtggtatgg 30

Claims (11)

I claim:
1. A purified preparation of pluripotent human embryonic stem cells which (i) will proliferate in an in vitro culture for over one year, (ii) maintains a karyotype in which the chromosomes are euploid and not altered through prolonged culture, (iii) maintains the potential to differentiate to derivatives of endoderm, mesoderm, and ectoderm tissues throughout the culture, and (iv) is inhibited from differentiation when cultured on a fibroblast feeder layer.
2. The preparation of claim 1, wherein the stem cells will spontaneously differentiate to trophoblast and produce chorionic gonadotropin when cultured to high density.
3. A purified preparation of pluripotent human embryonic stem cells wherein the cells are negative for the SSEA-1 marker, positive for the SSEA-4 marker, express alkaline phosphatase activity, are pluripotent, and have euploid karyotypes and in which none of the chromosomes are altered.
4. The preparation of claim 3, wherein the cells are positive for the TRA-1-60, and TRA-1-81 markers.
5. The preparation of claim 3, wherein the cells continue to proliferate in an undifferentiated state after continuous culture for at least one year.
6. The preparation of claim 3, wherein the cells will differentiate to trophoblast when cultured beyond confluence and will produce chorionic gonadotropin.
7. The preparation of claim 3, wherein the cells remain euploid for more than one year of continuous culture.
8. The preparation of claim 3, wherein the cells differentiate into cells derived from mesoderm, endoderm and ectoderm germ layers when the cells are injected into a SCID mouse.
9. A method of isolating a pluripotent human embryonic stem cell line, comprising the steps of:
(a) isolating a human blastocyst;
(b) isolating cells from the inner cell mass of the blastocyte of (a);
(c) plating the inner cell mass cells on embryonic fibroblasts, wherein inner cell mass-derived cell masses are formed;
(d) dissociating the mass into dissociated cells;
(e) replating the dissociated cells on embryonic feeder cells;
(f) selecting colonies with compact morphologies and cells with high nucleus to cytoplasm ratios and prominent nucleoli; and
(g) culturing the cells of the selected colonies to thereby obtain an isolated pluripotent human embryonic stem cell line.
10. A method as claimed in claim 9, further comprising maintaining the isolated cells on a fibroblast feeder layer to prevent differentiation.
11. A cell line developed by the method of claim 9.
US09/106,390 1995-01-20 1998-06-26 Primate embryonic stem cells Expired - Lifetime US6200806B1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
US09/106,390 US6200806B1 (en) 1995-01-20 1998-06-26 Primate embryonic stem cells
US09/761,289 US20010024825A1 (en) 1995-01-20 2001-01-16 Primate embryonic stem cells
US09/982,637 US7029913B2 (en) 1995-01-20 2001-10-18 Primate embryonic stem cells
US10/430,496 US20060040383A1 (en) 1995-01-20 2003-05-06 Primate embryonic stem cells
US11/033,335 US20050158854A1 (en) 1995-01-20 2005-01-11 Primate embryonic stem cells
US11/036,245 US7582479B2 (en) 1995-01-20 2005-01-14 Primate embryonic stem cell line
US12/047,135 US7781216B2 (en) 1995-01-20 2008-03-12 Spontaneous differentiation of human embryonic stem cells in culture
US12/822,004 US8273569B2 (en) 1995-01-20 2010-06-23 Preparation of human embryonic stem cells
US13/595,587 US20120328582A1 (en) 1995-01-20 2012-08-27 Primate Embryonic Stem Cells
US14/281,341 US20150056698A1 (en) 1995-01-20 2014-05-19 Primate embryonic stem cells

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US37632795A 1995-01-20 1995-01-20
US08/591,246 US5843780A (en) 1995-01-20 1996-01-18 Primate embryonic stem cells
US09/106,390 US6200806B1 (en) 1995-01-20 1998-06-26 Primate embryonic stem cells

Related Parent Applications (4)

Application Number Title Priority Date Filing Date
US37632795A Division 1995-01-20 1995-01-20
US37632795A Continuation-In-Part 1995-01-20 1995-01-20
US08/591,246 Division US5843780A (en) 1995-01-20 1996-01-18 Primate embryonic stem cells
US08/591,246 Continuation US5843780A (en) 1995-01-20 1996-01-18 Primate embryonic stem cells

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US09/761,289 Continuation US20010024825A1 (en) 1995-01-20 2001-01-16 Primate embryonic stem cells

Publications (1)

Publication Number Publication Date
US6200806B1 true US6200806B1 (en) 2001-03-13

Family

ID=23484566

Family Applications (11)

Application Number Title Priority Date Filing Date
US08/591,246 Expired - Lifetime US5843780A (en) 1995-01-20 1996-01-18 Primate embryonic stem cells
US09/106,390 Expired - Lifetime US6200806B1 (en) 1995-01-20 1998-06-26 Primate embryonic stem cells
US09/761,289 Abandoned US20010024825A1 (en) 1995-01-20 2001-01-16 Primate embryonic stem cells
US09/982,637 Expired - Fee Related US7029913B2 (en) 1995-01-20 2001-10-18 Primate embryonic stem cells
US10/430,496 Abandoned US20060040383A1 (en) 1995-01-20 2003-05-06 Primate embryonic stem cells
US11/033,335 Abandoned US20050158854A1 (en) 1995-01-20 2005-01-11 Primate embryonic stem cells
US11/036,245 Expired - Fee Related US7582479B2 (en) 1995-01-20 2005-01-14 Primate embryonic stem cell line
US12/047,135 Expired - Fee Related US7781216B2 (en) 1995-01-20 2008-03-12 Spontaneous differentiation of human embryonic stem cells in culture
US12/822,004 Expired - Fee Related US8273569B2 (en) 1995-01-20 2010-06-23 Preparation of human embryonic stem cells
US13/595,587 Abandoned US20120328582A1 (en) 1995-01-20 2012-08-27 Primate Embryonic Stem Cells
US14/281,341 Abandoned US20150056698A1 (en) 1995-01-20 2014-05-19 Primate embryonic stem cells

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/591,246 Expired - Lifetime US5843780A (en) 1995-01-20 1996-01-18 Primate embryonic stem cells

Family Applications After (9)

Application Number Title Priority Date Filing Date
US09/761,289 Abandoned US20010024825A1 (en) 1995-01-20 2001-01-16 Primate embryonic stem cells
US09/982,637 Expired - Fee Related US7029913B2 (en) 1995-01-20 2001-10-18 Primate embryonic stem cells
US10/430,496 Abandoned US20060040383A1 (en) 1995-01-20 2003-05-06 Primate embryonic stem cells
US11/033,335 Abandoned US20050158854A1 (en) 1995-01-20 2005-01-11 Primate embryonic stem cells
US11/036,245 Expired - Fee Related US7582479B2 (en) 1995-01-20 2005-01-14 Primate embryonic stem cell line
US12/047,135 Expired - Fee Related US7781216B2 (en) 1995-01-20 2008-03-12 Spontaneous differentiation of human embryonic stem cells in culture
US12/822,004 Expired - Fee Related US8273569B2 (en) 1995-01-20 2010-06-23 Preparation of human embryonic stem cells
US13/595,587 Abandoned US20120328582A1 (en) 1995-01-20 2012-08-27 Primate Embryonic Stem Cells
US14/281,341 Abandoned US20150056698A1 (en) 1995-01-20 2014-05-19 Primate embryonic stem cells

Country Status (5)

Country Link
US (11) US5843780A (en)
EP (2) EP1640448A3 (en)
AU (1) AU4758496A (en)
CA (1) CA2190528C (en)
WO (1) WO1996022362A1 (en)

Cited By (515)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010001662A1 (en) * 1995-09-12 2001-05-24 John Sinden Neural transplantation using pluripotent neuroepithelial cells
WO2001068815A1 (en) * 2000-03-14 2001-09-20 Es Cell International Pte Ltd Embryonic stem cells and neural progenitor cells derived therefrom
US20020019046A1 (en) * 2000-01-11 2002-02-14 Carpenter Melissa K. Direct differentiation of human pluripotent stem cells and characterization of differentiated cells
US20020160509A1 (en) * 1998-11-09 2002-10-31 Reubinoff Benjamin Eithan Embryonic stem cells
US20020182728A1 (en) * 2001-03-29 2002-12-05 Vijayakumar Ramiya Method for transdifferentiation of non pancreatic stem cells to the pancreatic differentiation pathway
WO2003000868A1 (en) 2001-06-21 2003-01-03 Geron Corporation Dopaminergic neurons and proliferation-competent precursor cells for treating parkinson's disease
US20030008392A1 (en) * 1995-01-20 2003-01-09 Thomson James A. Primate embryonic stem cells
DE10136719A1 (en) * 2001-07-27 2003-02-20 Georg S Wengler Recovering omnipotent human embryonic stem cells, comprises separating them from a blastocyte which remains viable, useful for gene therapy especially autotransplants
US20030040111A1 (en) * 2000-11-27 2003-02-27 Gold Joseph D. Differentiated cells suitable for human therapy
US6534052B1 (en) 2000-09-05 2003-03-18 Yong-Fu Xiao Cardiac function comprising implantation of embryonic stem cell in which differentiation has been initiated
US20030064512A1 (en) * 1988-08-04 2003-04-03 Williams Robert Lindsay In vitro propagation of embryonic stem cells
US20030068819A1 (en) * 2001-10-03 2003-04-10 Su-Chun Zhang Method of in vitro differentiation of transplantatable neural precursor cells from primate embryonic stem cells
US20030068818A1 (en) * 2001-03-21 2003-04-10 Chris Denning Animal tissue with carbohydrate antigens compatible for human transplantation and a carbohydrate determinant selection system for homologous recombination
US20030079536A1 (en) * 2001-09-10 2003-05-01 Frank Fischer Method and system for monitoring a tire air pressure
US20030082806A1 (en) * 2001-04-27 2003-05-01 Xcyte Therapies, Inc. Maturation of antigen-presenting cells using activated T cells
US20030087431A1 (en) * 2001-11-08 2003-05-08 Mina Alikani Composite blastocysts (CBs) from aggregates of dissociated cells of non-viable pre-embryos
US6562619B1 (en) * 1997-03-31 2003-05-13 The Johns Hopkins University School Of Medicine Differentiation of human embryonic germ cells
US6569421B2 (en) 1999-03-29 2003-05-27 Reneuron Limited Treatment of brain damage
US20030104616A1 (en) * 2001-08-23 2003-06-05 Reliance Life Sciences Pvt. Ltd. Isolation of inner cell mass for the establishment of human embryonic stem cell (hESC) lines
US20030109038A1 (en) * 2001-12-07 2003-06-12 Thies R. Scott Chondrocyte precursors derived from human embryonic stem cells
WO2003050249A2 (en) 2001-12-07 2003-06-19 Geron Corporation Islet cells from human embryonic stem cells
US20030113910A1 (en) * 2001-12-18 2003-06-19 Mike Levanduski Pluripotent stem cells derived without the use of embryos or fetal tissue
US6602711B1 (en) * 2000-02-21 2003-08-05 Wisconsin Alumni Research Foundation Method of making embryoid bodies from primate embryonic stem cells
US6607720B1 (en) 2000-09-05 2003-08-19 Yong-Fu Xiao Genetically altered mammalian embryonic stem cells, their living progeny, and their therapeutic application for improving cardiac function after myocardial infarction
US20030161818A1 (en) * 2002-02-25 2003-08-28 Kansas State University Research Foundation Cultures, products and methods using stem cells
US20030162290A1 (en) * 2002-01-25 2003-08-28 Kazutomo Inoue Method for inducing differentiation of embryonic stem cells into functioning cells
US20030166272A1 (en) * 1995-02-02 2003-09-04 Abuljadayel Ilham Saleh Method of preparing an undifferentiated cell
US20030166273A1 (en) * 2001-11-02 2003-09-04 Kaufman Dan S. Endothelial cells derived from primate embryonic stem cells
US20030185805A1 (en) * 2000-12-04 2003-10-02 Tei Biosciences, Inc., A Massachusetts Corporation Use of stem cells derived from dermal skin
US6630349B1 (en) * 1998-09-23 2003-10-07 Mount Sinai Hospital Trophoblast cell preparations
US20030207448A1 (en) * 2002-05-06 2003-11-06 Revera Gregory Henry Methodologies for the creation of pluripotent or multipotent human stem cells without creating or destroying a human embryo
US20030211605A1 (en) * 2001-05-01 2003-11-13 Lee Sang-Hun Derivation of midbrain dopaminergic neurons from embryonic stem cells
US20030210845A1 (en) * 2002-05-09 2003-11-13 Lynx Photonic Networks Inc. Constant power operation thermo-optic switch
WO2003100018A2 (en) 2002-05-24 2003-12-04 Advanced Cell Technology, Inc. A bank of stem cells for transplantation
US20030224411A1 (en) * 2003-03-13 2003-12-04 Stanton Lawrence W. Genes that are up- or down-regulated during differentiation of human embryonic stem cells
US20030229908A1 (en) * 1996-08-19 2003-12-11 Advanced Cell Technology Embryonic or stem-like cell lines produced by cross species nuclear transplantation and methods for enhancing embryonic development by genetic alteration of donor cells or by tissue culture conditions
US20030228295A1 (en) * 2002-04-25 2003-12-11 Svendsen Clive N. Use of human neural stem cells secreting GDNF for treatment of parkinson's and other neurodegenerative diseases
US20030232358A1 (en) * 2002-03-15 2003-12-18 Thomson James A. Method of identifying genes controlling differentiation
US20040005701A1 (en) * 2002-03-15 2004-01-08 Ren-He Xu Method for generating primate trophoblasts
US20040009593A1 (en) * 2002-07-11 2004-01-15 Keirstead Hans S. Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
WO2003055992A3 (en) * 2001-12-28 2004-01-15 Cell Therapeutics Scandinavia A method for the establishment of a pluripotent human blastocyst-derived stem cell line
US20040014206A1 (en) * 1999-10-28 2004-01-22 Robl James M. Gynogenetic or androgenetic production of pluripotent cells and cell lines, and use thereof to produce differentiated cells and tissues
US20040048370A1 (en) * 2002-06-14 2004-03-11 Case Western Reserve University Cell targeting methods and compositions
US20040046337A1 (en) * 2000-03-10 2004-03-11 James Sproatt Apparatus and method for automatically leveling an object
US20040053869A1 (en) * 2000-08-19 2004-03-18 Peter Andrews Stem cell differentiation
US20040067580A1 (en) * 2002-10-07 2004-04-08 Technion Research & Development Foundation Ltd. Human foreskin cells suitable for culturing stem cells
US20040071672A1 (en) * 1992-10-08 2004-04-15 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US20040072348A1 (en) * 2002-03-28 2004-04-15 Leishman Andrew James Tolerogenic antigen-presenting cells
WO2004038012A1 (en) * 2002-10-25 2004-05-06 Hunan Hui-Lin Life Technology Co. Ltd The feeder cell layer for in vitro culturing human embryonic stem cells and the method for culturing embryonic stem cells
US20040107453A1 (en) * 2001-02-14 2004-06-03 Furcht Leo T Multipotent adult stem cells, sources thereof, methods of obtaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof
US20040110286A1 (en) * 2002-12-06 2004-06-10 The John P. Robarts Research Institute Method for making hematopoietic cells
US20040111285A1 (en) * 2002-04-09 2004-06-10 Mark Germain Method for human pluripotent stem cells
US20040121460A1 (en) * 2001-01-24 2004-06-24 Lumelsky Nadya L Differentiation of stem cells to pancreatic endocrine cells
US20040136967A1 (en) * 2002-02-25 2004-07-15 Kansas State University Research Foundation Cultures, products and methods using stem cells
US20040146881A1 (en) * 2002-08-02 2004-07-29 Osi Pharmaceuticals. Inc. Species specific DNA detection
US20040152189A1 (en) * 2000-11-27 2004-08-05 Mcwhir Jim Selective antibody targeting of undifferentiated stem cells
US20040180347A1 (en) * 2003-03-13 2004-09-16 Stanton Lawrence W. Marker system for preparing and characterizing high-quality human embryonic stem cells
US6800480B1 (en) 1997-10-23 2004-10-05 Geron Corporation Methods and materials for the growth of primate-derived primordial stem cells in feeder-free culture
US20040224403A1 (en) * 2001-12-07 2004-11-11 Robarts Research Institute Reconstituting hematopoietic cell function using human embryonic stem cells
US20040235159A1 (en) * 2000-01-11 2004-11-25 Ramkumar Mandalam Medium for growing human embryonic stem cells
US20040241162A1 (en) * 2000-02-24 2004-12-02 Xcyte Therapies, Inc. Activation and expansion of cells
US6828145B2 (en) 2000-05-10 2004-12-07 Cedars-Sinai Medical Center Method for the isolation of stem cells by immuno-labeling with HLA/MHC gene product marker
US20040256815A1 (en) * 2000-03-10 2004-12-23 Eichhorn Mark M. Apparatus and method for automatically leveling an object
US20050019907A1 (en) * 2003-07-22 2005-01-27 Santiago Munne Obtaining normal disomic stem cells from chromosomally abnormal embryos
US20050019865A1 (en) * 2003-06-27 2005-01-27 Kihm Anthony J. Cartilage and bone repair and regeneration using postpartum-derived cells
US20050026133A1 (en) * 2002-01-31 2005-02-03 Asahi Techno Glass Corporation Cryopreservation medium for primate embryo stem cells and cryopreservation method
US20050037492A1 (en) * 2000-01-11 2005-02-17 Chunhui Xu Medium for growing human embryonic stem cells
US20050037488A1 (en) * 2001-08-06 2005-02-17 Maisam Mitalipova Alternative compositions and methods for the culture of stem cells
US20050042595A1 (en) * 2003-08-14 2005-02-24 Martin Haas Banking of multipotent amniotic fetal stem cells
US20050042749A1 (en) * 2001-05-16 2005-02-24 Carpenter Melissa K. Dopaminergic neurons and proliferation-competent precursor cells for treating Parkinson's disease
WO2004090096A3 (en) * 2002-08-08 2005-03-03 Bresagen Inc Methods for neural differentiation of embryonic stem cells using protease passaging techniques
US20050054100A1 (en) * 2003-09-08 2005-03-10 Rennard Stephen I. Methods for fibroblast differentiation
US20050058628A1 (en) * 2003-06-11 2005-03-17 Jan Remmereit Nuclear reprogramming of cells for therapeutic use
WO2004099394A3 (en) * 2003-05-08 2005-04-07 Cellartis Ab A method for efficient transfer of human blastocyst-derived stem cells (hbs cells) from a feeder-supported to a feeder-free culture system
US20050079608A1 (en) * 2002-02-05 2005-04-14 Skorecki Karl L. Lineage committed stem cells selected for telomerase promoter activity
US20050095706A1 (en) * 2001-10-03 2005-05-05 Su-Chun Zhang Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US20050096274A1 (en) * 1998-04-07 2005-05-05 Lough John W. Bone morphogenetic protein and fibroblast growth factor compositions and methods for the induction of cardiogenesis
US20050095702A1 (en) * 2003-09-03 2005-05-05 Reliance Life Sciences Pvt. Ltd. In vitro generation of GABAergic neurons from embryonic stem cells and their use in the treatment of neurological disorders
US20050100924A1 (en) * 2003-11-06 2005-05-12 National University Of Singapore C/EBPalpha gene targeting constructs and uses thereof
US20050101014A1 (en) * 2002-07-11 2005-05-12 Keirstead Hans S. Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US20050106724A1 (en) * 2002-02-06 2005-05-19 Joerg Schierholz Pluripotent embryonic-like stem cells derived from teeth and uses thereof
US20050106725A1 (en) * 2003-11-19 2005-05-19 Palecek Sean P. Method of reducing cell differentiation
US20050118561A1 (en) * 2003-12-02 2005-06-02 Catholic Healthcare West Compositions and methods for propagation of neural progenitor cells
US20050124003A1 (en) * 2001-11-15 2005-06-09 Anthony Atala Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US20050164385A1 (en) * 1998-10-23 2005-07-28 Gold Joseph D. Embryonic stem cells having genetic modifications
US20050176665A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hairless (HR) gene expression using short interfering nucleic acid (siNA)
US20050181502A1 (en) * 1999-08-05 2005-08-18 Athersys, Inc. Multipotent adult stem cells and methods for isolation
US20050186672A1 (en) * 2004-01-27 2005-08-25 Reliance Life Sciences Pvt. Ltd. Tissue system with undifferentiated stem cells derived from corneal limbus
US20050244962A1 (en) * 2000-03-09 2005-11-03 Thomson James A Cultivation of primate embryonic stem cells
US20050255592A1 (en) * 2004-04-23 2005-11-17 Bioe, Inc., A Minnesota Corporation Multi-lineage progenitor cells
US20050266554A1 (en) * 2004-04-27 2005-12-01 D Amour Kevin A PDX1 expressing endoderm
US20050282272A1 (en) * 2001-12-07 2005-12-22 The Robarts Research Institute Using undifferentiated embryonic stem cells to control the immune system
US20050287547A1 (en) * 2002-07-23 2005-12-29 Judith Seligman Embryonic stem cell markers and uses thereof
US20060003313A1 (en) * 2003-12-23 2006-01-05 D Amour Kevin A Methods for identifying factors for differentiating definitive endoderm
US20060008451A1 (en) * 2004-07-06 2006-01-12 Michigan State University In vivo methods for effecting tissue specific differentiation of embryonic stem cells
US20060014281A1 (en) * 2004-06-09 2006-01-19 Luciano Conti Neural stem cells
US20060014280A1 (en) * 2002-09-25 2006-01-19 Condie Brian G Compositions and methods for enrichment of neural stem cells using ceramide analogs
US20060030042A1 (en) * 2003-12-19 2006-02-09 Ali Brivanlou Maintenance of embryonic stem cells by the GSK-3 inhibitor 6-bromoindirubin-3'-oxime
WO2006017134A2 (en) 2004-07-09 2006-02-16 Cythera, Inc. Preprimitive streak and mesendoderm cells
WO2006016999A1 (en) 2004-07-09 2006-02-16 Cythera, Inc. Methods for identifying factors for differentiating definitive endoderm
WO2006017370A2 (en) 2004-07-13 2006-02-16 Geron Corporation Medium for growing human embryonic stem cells
US20060040392A1 (en) * 2004-04-23 2006-02-23 Collins Daniel P Multi-lineage progenitor cells
US7005252B1 (en) * 2000-03-09 2006-02-28 Wisconsin Alumni Research Foundation Serum free cultivation of primate embryonic stem cells
US20060078545A1 (en) * 2000-05-17 2006-04-13 Carpenter Melissa K Neural progenitor cell populations
US20060104959A1 (en) * 2004-09-30 2006-05-18 John Sinden Cell lines
US20060110375A1 (en) * 2002-08-09 2006-05-25 Herbert Zech Method for producing cell lines and organs by means of differentiable cells
EP1674563A1 (en) * 2004-12-23 2006-06-28 Wolfgang Würfel Isolation of pluripotent embryonic stem cells without destroying the embryo, stem cells obtained by this method and their use
WO2006071911A2 (en) 2004-12-23 2006-07-06 Cythera, Inc. Expansion of definitive endoderm cells
US20060148081A1 (en) * 2003-12-23 2006-07-06 Olivia Kelly Expansion of definitive endoderm cells
US20060153815A1 (en) * 2004-12-21 2006-07-13 Agnieszka Seyda Tissue engineering devices for the repair and regeneration of tissue
US20060166361A1 (en) * 2004-12-21 2006-07-27 Agnieszka Seyda Postpartum cells derived from placental tissue, and methods of making, culturing, and using the same
US20060171930A1 (en) * 2004-12-21 2006-08-03 Agnieszka Seyda Postpartum cells derived from umbilical cord tissue, and methods of making, culturing, and using the same
US20060211111A1 (en) * 2002-12-18 2006-09-21 Maisam Mitalipova Compositions and methods for neural cell production and stabilization
US20060211109A1 (en) * 2003-03-12 2006-09-21 Reliance Life Sciences Pvt. Ltd. Derivation of terminally differentiated dopaminergic neurons from human embryonic stem cells
US7112440B2 (en) 1995-02-02 2006-09-26 Ghazi Jaswinder Dhoot Method of increasing the relative number of CD45 low cells in a cell population
US20060216821A1 (en) * 2004-02-26 2006-09-28 Reliance Life Sciences Pvt. Ltd. Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
US20060222636A1 (en) * 2003-09-19 2006-10-05 The Rockefeller University Compositions, methods and kits relating to reprogramming adult differentiated cells and production of embryonic stem cell-like cells
US20060246488A1 (en) * 2005-04-01 2006-11-02 Jason Hipp Transcriptional profiling of stem cells and their multilineage differentiation
US20060263879A1 (en) * 2004-12-30 2006-11-23 Stemlifeline, Inc. Methods and systems relating to embryonic stem cell lines
US20060275899A1 (en) * 2004-12-30 2006-12-07 Stemlifeline, Inc. Methods and compositions relating to embryonic stem cell lines
US20060280729A1 (en) * 2005-06-08 2006-12-14 Sanjay Mistry Cellular therapy for ocular degeneration
US20060286544A1 (en) * 2005-05-17 2006-12-21 Arundhati Mandal Establishment of a human embryonic stem cell line using mammalian cells
US20060292695A1 (en) * 2005-06-22 2006-12-28 Roslin Institute Methods and kits for drug screening and toxicity testing using promoter-reporter cells derived from embryonic stem cells
US20060292694A1 (en) * 2005-06-22 2006-12-28 Roslin Institute Reporter hepatocytes and other cells for drug screening and toxicity testing
WO2007002136A2 (en) 2005-06-22 2007-01-04 Geron Corporation Differentiation of primate pluripotent stem cells to cardiomyocyte-lineage cells
US20070004038A1 (en) * 2004-07-09 2007-01-04 D Amour Kevin A Preprimitive streak and mesendoderm cells
WO2007002086A2 (en) 2005-06-22 2007-01-04 Geron Corporation Suspension culture of human embryonic stem cells
US20070020242A1 (en) * 2003-03-27 2007-01-25 Ixion Biotechnology, Inc. Method for transdifferentiation of non-pancreatic stem cells to the pancreatic pathway
US20070037282A1 (en) * 2003-03-31 2007-02-15 Masayo Takahashi Method of producing lens cell and lens cell obtained by the method
WO2007030811A2 (en) 2005-09-09 2007-03-15 Duke University Tissue engineering methods and compositions
US20070098696A1 (en) * 2005-10-31 2007-05-03 President And Fellows Of Harvard College Immortalized fibroblasts
US7220412B2 (en) 1995-02-02 2007-05-22 Ghazi Jaswinder Dhoot Method of preparing an undifferentiated cell
US20070122905A1 (en) * 2005-10-27 2007-05-31 D Amour Kevin A PDX1-expressing dorsal and ventral foregut endoderm
US20070122903A1 (en) * 2005-05-27 2007-05-31 Alireza Rezania Amniotic fluid derived cells
US20070141700A1 (en) * 2005-12-19 2007-06-21 Ethicon, Incorporated In vitro expansion of postpartum-derived cells in roller bottles
US20070160588A1 (en) * 2005-12-28 2007-07-12 Ethicon, Incorporated Treatment Of Peripheral Vascular Disease Using Postpartum-Derived Cells
WO2007103282A2 (en) 2006-03-02 2007-09-13 Cythera, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
US20070248947A1 (en) * 2006-04-10 2007-10-25 Wisconsin Alumni Research Foundation Reagents and Methods for Using Human Embryonic Stem Cells to Evaluate Toxicity of Pharmaceutical Compounds and Other Chemicals
US20070249047A1 (en) * 2006-04-17 2007-10-25 Bioe, Inc. Differentiation of Multi-Lineage Progenitor Cells to Respiratory Epithelial Cells
US20070254359A1 (en) * 2006-04-28 2007-11-01 Lifescan, Inc. Differentiation of human embryonic stem cells
US20070253910A1 (en) * 2006-04-14 2007-11-01 Carnegie Mellon University Cellular labeling and quantification for nuclear magnetic resonance techniques
US20070258886A1 (en) * 2006-04-14 2007-11-08 Celsense Inc. Methods for assessing cell labeling
US20070264269A1 (en) * 2005-12-16 2007-11-15 Ethicon, Incorporated Compositions and methods for inhibiting adverse immune response in histocompatibility-mismatched transplantation
US20070269411A1 (en) * 2006-03-10 2007-11-22 Wei Sun Porous silicon materials and devices
US20070269412A1 (en) * 2003-12-02 2007-11-22 Celavie Biosciences, Llc Pluripotent cells
US20070281355A1 (en) * 2004-08-13 2007-12-06 Stephen Dalton Compositions And Methods For Self-Renewal And Differentiation In Human Embryonic Stem Cells
WO2008013557A1 (en) 2006-07-24 2008-01-31 International Stem Cell Corporation Synthetic cornea from retinal stem cells
US20080152632A1 (en) * 2005-06-22 2008-06-26 Roslin Institute Promoter-reporter cells for determining drug metabolism, drug interactions, and the effects of allotype variation
WO2008087257A1 (en) 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel methods and reagents directed to production of cells
WO2008087258A1 (en) 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel carbohydrate from human cells and methods for analysis and modification thereof
US20080175816A1 (en) * 2007-01-22 2008-07-24 Board Of Trustees Of The University Of Arkansas Maintenance and Propagation of Mesenchymal Stem Cells
US20080200369A1 (en) * 2007-02-08 2008-08-21 Michiko Fukuda Trophinin-Binding Peptides and Uses Thereof
US20080227137A1 (en) * 2001-10-03 2008-09-18 Su-Chun Zhang Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US20080241107A1 (en) * 2004-01-23 2008-10-02 Copland Iii John A Methods and Compositions For Preparing Pancreatic Insulin Secreting Cells
US20080267874A1 (en) * 2007-03-28 2008-10-30 The Buck Institute For Age Research Targeted Neuronal And Glial Human Embryonic Stem Cell Line
US20090004152A1 (en) * 2006-03-02 2009-01-01 Cythera, Inc. Methods of producing pancreatic hormones
US20090011502A1 (en) * 2004-04-27 2009-01-08 Novocell, Inc. Pdx1 Expressing Endoderm
US20090029462A1 (en) * 2007-06-29 2009-01-29 Cellular Dynamics International, Inc. Automated method and apparatus for embryonic stem cell culture
US20090029463A1 (en) * 2007-07-25 2009-01-29 Bioe, Inc. Differentiation of Multi-Lineage Progenitor Cells to Chondrocytes
WO2009026106A1 (en) 2007-08-16 2009-02-26 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Methods for promoting stem cell proliferation and survival
WO2009032194A1 (en) 2007-08-31 2009-03-12 Whitehead Institute For Biomedical Research Wnt pathway stimulation in reprogramming somatic cells
US20090074673A1 (en) * 2007-07-10 2009-03-19 Carnegie Mellon University Compositions and methods for producing cellular labels for nuclear magnetic resonance techniques
US7510876B2 (en) 2003-12-23 2009-03-31 Cythera, Inc. Definitive endoderm
US20090092653A1 (en) * 2007-10-05 2009-04-09 Ethicon, Incorporated Repair and regeneration of renal tissue using human umbilical cord tissue-derived cells
WO2009052505A1 (en) 2007-10-19 2009-04-23 Bresagen, Inc. Feeder-free pluripotent stem cell media containing human serum
US20090170198A1 (en) * 2007-11-27 2009-07-02 Alireza Rezania Differentiation of human embryonic stem cells
US20090166178A1 (en) * 2007-12-20 2009-07-02 Ethicon, Incorporated Methods for sterilizing materials containing biologically active agents
US20090175927A1 (en) * 2006-05-11 2009-07-09 Regenics A/S Administration of cells and cellular extracts for rejuvenation
WO2009092092A1 (en) 2008-01-18 2009-07-23 Regents Of The University Of Minnesota Stem cell aggregates and methods for making and using
US20090191626A1 (en) * 2008-01-30 2009-07-30 Christopher Bankole Shogbon Synthetic Surfaces for Culturing Stem Cell Derived Oligodendrocyte Progenitor Cells
US7572631B2 (en) 2000-02-24 2009-08-11 Invitrogen Corporation Activation and expansion of T cells
US20090203141A1 (en) * 2003-05-15 2009-08-13 Shi-Lung Lin Generation of tumor-free embryonic stem-like pluripotent cells using inducible recombinant RNA agents
US20090220959A1 (en) * 2003-12-23 2009-09-03 D Amour Kevin Allen Markers of definitive endoderm
EP2100954A1 (en) 2008-03-10 2009-09-16 Assistance Publique - Hopitaux de Paris Method for generating primate cardiac progenitor cells for clinical use from primate embryonic stem cells, and their applications
US20090246869A1 (en) * 2008-03-27 2009-10-01 Geron Corporation Differentiation of Primate Pluripotent Stem Cells to Hematopoietic Lineage Cells
US20090263896A1 (en) * 2008-04-21 2009-10-22 Olivia Kelly Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
US20090269845A1 (en) * 2008-04-24 2009-10-29 Alireza Rezania Pluripotent cells
WO2009131568A1 (en) 2008-04-21 2009-10-29 Cythera, Inc. Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
US20090274770A1 (en) * 2006-05-11 2009-11-05 Regenics As Cellular extracts
US20090280096A1 (en) * 2008-05-09 2009-11-12 Atsushi Kubo Pancreatic endocrine progenitor cells derived from pluripotent stem cells
US20090291494A1 (en) * 2008-05-21 2009-11-26 Bioe, Inc. Differentiation of Multi-Lineage Progenitor Cells to Pancreatic Cells
US20090298178A1 (en) * 2008-06-03 2009-12-03 D Amour Kevin Allen Growth factors for production of definitive endoderm
US20090298170A1 (en) * 2006-04-28 2009-12-03 D Amour Kevin Hepatocyte lineage cells
US20090298169A1 (en) * 2006-06-02 2009-12-03 The University Of Georgia Research Foundation Pancreatic and Liver Endoderm Cells and Tissue by Differentiation of Definitive Endoderm Cells Obtained from Human Embryonic Stems
US20090325293A1 (en) * 2008-04-24 2009-12-31 Janet Davis Treatment of pluripotent cells
US20090325294A1 (en) * 2007-07-01 2009-12-31 Shelley Nelson Single pluripotent stem cell culture
US20100015711A1 (en) * 2008-06-30 2010-01-21 Janet Davis Differentiation of Pluripotent Stem Cells
US20100015100A1 (en) * 2007-07-31 2010-01-21 Jean Xu Differentiation of human embryonic stem cells
AU2005220066B2 (en) * 2004-02-26 2010-01-21 Reliance Life Sciences Pvt. Ltd. Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
US20100028307A1 (en) * 2008-07-31 2010-02-04 O'neil John J Pluripotent stem cell differentiation
US20100068187A1 (en) * 2006-08-31 2010-03-18 Roisen Fred J Transcription factors for differentiation of adult human olfactory progenitor cells
US7695963B2 (en) 2007-09-24 2010-04-13 Cythera, Inc. Methods for increasing definitive endoderm production
US20100105043A1 (en) * 2007-03-26 2010-04-29 Ko Minoru S H Methods for modulating embryonic stem cell differentiation
US20100112692A1 (en) * 2008-10-31 2010-05-06 Alireza Rezania Differentiation of Human Embryonic Stem Cells
US20100112693A1 (en) * 2008-10-31 2010-05-06 Alireza Rezania Differentiation of Human Embryonic Stem Cells
WO2010053472A1 (en) 2008-11-04 2010-05-14 Novocell, Inc. Stem cell aggregate suspension compositions and methods for differentiation thereof
US20100124783A1 (en) * 2008-11-20 2010-05-20 Ya Xiong Chen Methods and Compositions for Cell Attachment and Cultivation on Planar Substrates
US20100124564A1 (en) * 2008-11-14 2010-05-20 Laura Martinson Encapsulation of pancreatic cells derived from human pluripotent stem cells
US20100144031A1 (en) * 2003-11-26 2010-06-10 Rudolf Jaenisch Methods for reprogramming somatic cells
US20100150876A1 (en) * 2006-11-24 2010-06-17 Regents Of The Univeristy Of Minnesota Endodermal progenitor cells
US20100159588A1 (en) * 2008-12-19 2010-06-24 Ethicon, Incorporated Conditioned media and methods of making a conditioned media
US20100158880A1 (en) * 2008-12-19 2010-06-24 Ethicon, Incorporated Regeneration and repair of neural tissue following injury
US20100159025A1 (en) * 2003-06-27 2010-06-24 Ethicon, Incorporated Systemically and locally administered cells for neuropathic pain
WO2010077955A1 (en) 2008-12-17 2010-07-08 The Scripps Research Institute Generation and maintenance of stem cells
US20100184160A1 (en) * 2005-11-21 2010-07-22 The Board Of Trustees Of The University Of Arkansas Staphylococus aureus strain cyl1892
US20100209399A1 (en) * 2009-02-13 2010-08-19 Celavie Biosciences, Llc Brain-derived stem cells for repair of musculoskeletal system in vertebrate subjects
US20100215714A1 (en) * 2003-06-27 2010-08-26 Ethicon, Incorporated Treatment of stroke and other acute neural degenerative disorders using postpartum-derived cells
US20100233804A1 (en) * 2008-03-17 2010-09-16 The Scripps Research Institute Generation of pluripotent stem cells using recombinant proteins
EP2233566A1 (en) 2009-03-17 2010-09-29 Vrije Universiteit Brussel Generation of pancreatic progenitor cells
US20100247499A1 (en) * 2009-03-26 2010-09-30 Ethicon, Inc. hUTC AS THERAPY FOR ALZHEIMER'S DISEASE
WO2010116148A1 (en) 2009-04-09 2010-10-14 Antoxis Limited Use of compounds for differentiation of cells
US20100272803A1 (en) * 2003-06-27 2010-10-28 Sanjay Mistry Repair and regeneration of ocular tissue using postpartum-derived cells
US20100272695A1 (en) * 2009-04-22 2010-10-28 Alan Agulnick Cell compositions derived from dedifferentiated reprogrammed cells
US20100285584A1 (en) * 2006-11-03 2010-11-11 Ron Weiss Engineered cellular pathways for programmed autoregulation of differentiation
US7838292B1 (en) 2001-03-29 2010-11-23 University Of Louisville Research Foundation, Inc. Methods for obtaining adult human olfactory progenitor cells
US20100297087A1 (en) * 2006-04-11 2010-11-25 Nanodiagnostics Israel., Ltd Pluripotent stem cells characterized by expression of germline specific genes
WO2010144696A1 (en) 2009-06-11 2010-12-16 Burnham Institute For Medical Research Directed differentiation of stem cells
US20100317100A1 (en) * 2009-06-12 2010-12-16 Soumen Paul Compositions and methods for establishing and maintaining stem cells in an undifferentiated state
US20100323442A1 (en) * 2006-10-17 2010-12-23 Emmanuel Edward Baetge Modulation of the phosphatidylinositol-3-kinase pathway in the differentiation of human embryonic stem cells
WO2010149346A1 (en) 2009-06-26 2010-12-29 Ge Healthcare Uk Limited Methods for predicting the toxicity of a chemical
WO2011005326A1 (en) 2009-07-09 2011-01-13 Massachusetts Institute Of Technology Methods and compositions for increased safety of stem cell-derived populations
US20110014703A1 (en) * 2009-07-20 2011-01-20 Jean Xu Differentiation of Human Embryonic Stem Cells
US20110014702A1 (en) * 2009-07-20 2011-01-20 Jean Xu Differentiation of Human Embryonic Stem Cells
US7875273B2 (en) 2004-12-23 2011-01-25 Ethicon, Incorporated Treatment of Parkinson's disease and related disorders using postpartum derived cells
WO2011011477A1 (en) 2009-07-21 2011-01-27 Abt Holding Company Use of stem cells to reduce leukocyte extravasation
WO2011011500A1 (en) 2009-07-21 2011-01-27 Abt Holding Company Use of stem cells to reduce leukocyte extravasation
WO2011011300A2 (en) 2009-07-20 2011-01-27 Centocor Ortho Biotech Inc. Differentiation of human embryonic stem cells
WO2011017315A2 (en) 2009-08-03 2011-02-10 Recombinetics, Inc. Methods and compositions for targeted gene modification
US20110046092A1 (en) * 2007-12-11 2011-02-24 Research Development Foundation Small molecules for neuronal differentiation of embryonic stem cells
WO2011025736A1 (en) 2009-08-22 2011-03-03 The Board Of Trustees Of The Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
WO2011025566A1 (en) 2009-08-26 2011-03-03 Shi-Lung Lin Development of universal cancer drugs and vaccines
EP2292734A1 (en) 2001-12-07 2011-03-09 Geron Corporation Hematopoietic cells from human embryonic stem cells
WO2011028880A2 (en) 2009-09-04 2011-03-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for enhancing genome stability and telomere elongation in embryonic stem cells
US20110076678A1 (en) * 2007-04-07 2011-03-31 Rudolf Jaenisch Reprogramming of somatic cells
US20110097804A1 (en) * 1997-04-24 2011-04-28 University Of Washington Targeted gene modification by parvoviral vectors
US20110104805A1 (en) * 2009-10-29 2011-05-05 Centocor Ortho Biotech Inc. Pluripotent Stem Cells
EP2319544A1 (en) 2004-01-16 2011-05-11 Carnegie Mellon University Cellular labeling for nuclear magnetic resonance techniques
US20110110863A1 (en) * 2008-05-02 2011-05-12 Celsense, Inc. Compositions and methods for producing emulsions for nuclear magnetic resonance techniques and other applications
US20110136114A1 (en) * 2008-04-30 2011-06-09 Sanbio Inc. Neural regenerating cells with alterations in dna methylation
US20110136681A1 (en) * 2009-12-02 2011-06-09 Olivier Preynat-Seauve Selection of stem cell clones with defined differentiation capabilities
US20110143431A1 (en) * 1995-02-02 2011-06-16 Ilham Saleh Abuljadayel Method Of Preparing An Undifferentiated Cell
US20110151560A1 (en) * 2009-12-23 2011-06-23 Jean Xu Differentiation of human embryonic stem cells
US20110151561A1 (en) * 2009-12-23 2011-06-23 Janet Davis Differentiation of human embryonic stem cells
US20110158966A1 (en) * 2002-07-23 2011-06-30 Judith Seligman Stem cells characterized by expression of germline specific genes
EP2341147A2 (en) 2004-07-09 2011-07-06 Viacyte, Inc. Preprimitive streak and mesendoderm cells
WO2011091944A1 (en) 2010-01-26 2011-08-04 Université Libre de Bruxelles Tools for isolating and following cardiovascular progenitor cells
WO2011106521A1 (en) 2010-02-25 2011-09-01 Abt Holding Company Modulation of macrophage activation
US20110212067A1 (en) * 2010-03-01 2011-09-01 Centocor Ortho Biotech Inc. Methods for Purifying Cells Derived from Pluripotent Stem Cells
WO2011106365A1 (en) 2010-02-25 2011-09-01 Abt Holding Company Modulation of angiogenesis
US20110223205A1 (en) * 2003-06-27 2011-09-15 Advanced Technologies And Regenerative Medicine, Llc Treatment of amyotrophic lateral sclerosis using umbilical derived cells
WO2011119507A2 (en) 2010-03-25 2011-09-29 International Stem Cell Corporation Method of altering the differentiative state of a cell and compositions thereof
WO2011119637A1 (en) 2010-03-22 2011-09-29 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomics
WO2011124894A1 (en) 2010-04-08 2011-10-13 The University Court Of The University Of Edinburgh Chondrogenic progenitor cells, protocol for derivation of cells and uses thereof
WO2011133889A2 (en) 2010-04-23 2011-10-27 Cold Spring Harbor Laboratory NOVEL STRUCTURALLY DESIGNED shRNAs
WO2011133284A1 (en) 2010-04-22 2011-10-27 Oregon Health & Science University Fumarylacetoacetate hydrolase (fah)-deficient pigs and uses thereof
WO2011143415A1 (en) 2010-05-12 2011-11-17 Abt Holding Company Modulation of splenocytes in cell therapy
WO2011160128A2 (en) 2010-06-18 2011-12-22 Cellular Dynamics International, Inc. Cardiomyocyte medium with dialyzed serum
WO2011158125A2 (en) 2010-06-17 2011-12-22 Katholieke Universiteit Leuven Methods for differentiating cells into hepatic stellate cells and hepatic sinusoidal endothelial cells, cells produced by the methods, and methods for using the cells
WO2012021698A2 (en) 2010-08-12 2012-02-16 Janssen Biotech, Inc. Treatment of diabetes with pancreatic endocrine precursor cells
EP2420565A1 (en) 2006-02-23 2012-02-22 ViaCyte, Inc. Compositions and methods useful for culturing differentiable cells
EP2422797A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
WO2012027474A1 (en) 2010-08-24 2012-03-01 Regents Of The University Of Minnesota Non-static suspension culture of cell aggregates
WO2012027358A1 (en) 2010-08-23 2012-03-01 President And Fellows Of Harvard College Optogenetic probes for measuring membrane potential
WO2012030919A2 (en) 2010-09-01 2012-03-08 Thomas Jefferson University Composition and method for muscle repair and regeneration
WO2012030540A2 (en) 2010-08-31 2012-03-08 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
WO2012037456A1 (en) 2010-09-17 2012-03-22 President And Fellows Of Harvard College Functional genomics assay for characterizing pluripotent stem cell utility and safety
WO2012044979A2 (en) 2010-10-01 2012-04-05 The Goverment Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Manipulation of stem cell function by p53 isoforms
US8163536B2 (en) 2000-05-10 2012-04-24 Tristem Trading (Cyprus) Limited Device for preparing an undifferentiated cell from a more committed cell
US8187875B2 (en) 2004-02-26 2012-05-29 Reliance Life Sciences Pvt. Ltd. Dopaminergic neurons derived from corneal limbus, methods of isolation and uses thereof
EP2481287A1 (en) 2003-08-01 2012-08-01 Stratatech Corporation Human skin equivalents expressing exogenous polypeptides
WO2012101181A1 (en) 2011-01-25 2012-08-02 Université Catholique de Louvain Compositions and methods for cell transplantation
US8252280B1 (en) 1999-08-05 2012-08-28 Regents Of The University Of Minnesota MAPC generation of muscle
WO2012116185A1 (en) 2011-02-23 2012-08-30 The Board Of Trustees Of The Leland Stanford Junior University Methods of detecting aneuploidy in human embryos
WO2012135621A2 (en) 2011-03-30 2012-10-04 Cellular Dynamics International. Inc Priming of pluripotent stem cells for neural differentiation
WO2012135253A1 (en) 2011-03-29 2012-10-04 Geron Corporation Enriched populations of cardiomyocyte lineage cells from pluripotent stem cells
WO2012168295A1 (en) 2011-06-06 2012-12-13 ReGenesys BVBA Expansion of stem cells in hollow fiber bioreactors
WO2012172354A1 (en) 2011-06-16 2012-12-20 Isis Innovation Limited Method of cryopreserving pluripotent stem cells
WO2013010965A1 (en) 2011-07-15 2013-01-24 Universite Libre De Bruxelles Generation of mesodermal cells from pluripotent stem cells
WO2013019661A1 (en) 2011-07-29 2013-02-07 Cellular Dynamics International, Inc. Metabolic maturation in stem cell-derived tissue cells
EP2562248A1 (en) 2007-07-18 2013-02-27 Lifescan, Inc. Differentiation of human embryonic stem cells
WO2013032918A1 (en) 2011-08-26 2013-03-07 Yecuris Corporation Fumarylacetoacetate hydrolase (fah)-deficient and immunodeficient rats and uses thereof
US8415153B2 (en) 2006-06-19 2013-04-09 Geron Corporation Differentiation and enrichment of islet-like cells from human pluripotent stem cells
EP2584034A1 (en) 2007-07-31 2013-04-24 Lifescan, Inc. Pluripotent stem cell differentiation by using human feeder cells
WO2013068557A1 (en) 2011-11-09 2013-05-16 Katholieke Universiteit Leuven Virus infectable stem cells
EP2594635A1 (en) 2011-11-18 2013-05-22 Univercell Biosolutions Method for generating primate cardiovascular progenitor cells for clinical and drug cells testing use from primate embryonic stem cells or embryonic-like state cells, and their applications
WO2013082106A1 (en) 2011-12-02 2013-06-06 The General Hospital Corporation Differentiation into brown adipocytes
WO2013082509A1 (en) 2011-12-01 2013-06-06 The New York Stem Cell Foundation Automated system for producing induced pluripotent stem cells or differentiated cells
WO2013082268A1 (en) 2011-11-30 2013-06-06 The Wistar Institute Of Anatomy And Biology Methods and compositions for regulation of cell aging, carcinogenesis, and reprogramming
US8481308B2 (en) 2010-07-01 2013-07-09 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions
WO2013110354A1 (en) 2012-01-25 2013-08-01 Université Catholique de Louvain Compositions and methods for cell transplantation
US8518390B2 (en) 2003-06-27 2013-08-27 Advanced Technologies And Regenerative Medicine, Llc Treatment of stroke and other acute neural degenerative disorders via intranasal administration of umbilical cord-derived cells
US8557295B2 (en) 2006-05-11 2013-10-15 Regenics As Use of cellular extracts for skin rejuvenation
WO2013163228A1 (en) 2012-04-24 2013-10-31 International Stem Cell Corporation Derivation of neural stem cells and dopaminergic neurons from human pluripotent stem cells
WO2013163739A1 (en) 2012-04-30 2013-11-07 University Health Network METHODS AND COMPOSITIONS FOR GENERATING PANCREATIC PROGENITORS AND FUNCTIONAL BETA CELLS FROM hPSCs
WO2013168403A1 (en) 2012-05-08 2013-11-14 株式会社大塚製薬工場 Trehalose-containing mammalian cell suspension for prevention of pulmonary embolism formation
US8597944B2 (en) 2004-01-02 2013-12-03 Advanced Cell Technology, Inc. Culture systems for ex vivo development
WO2013181549A2 (en) 2012-05-31 2013-12-05 Auxogyn, Inc. In vitro embryo blastocyst prediction methods
WO2014071137A1 (en) 2012-11-02 2014-05-08 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomic ratios
EP2730649A1 (en) 2012-11-08 2014-05-14 Viacyte, Inc. Scalable primate pluripotent stem cell aggregate suspension culture and differentiation thereof
US8765467B2 (en) 2003-05-05 2014-07-01 Technion Research And Development Foundation Ltd. Multicellular compositions of pluripotent human embryonic stem cells and cancer cells
US8778673B2 (en) 2004-12-17 2014-07-15 Lifescan, Inc. Seeding cells on porous supports
US8785190B2 (en) 2011-04-06 2014-07-22 Sanbio, Inc. Methods and compositions for modulating peripheral immune function
US8808687B2 (en) 2010-07-12 2014-08-19 Mark Humayun Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same
WO2014127289A1 (en) 2013-02-15 2014-08-21 International Stem Cell Corporation Use of neural cells derived from human pluripotent stem cells for the treatment of neurodegenerative diseases
US8815587B2 (en) 2003-06-27 2014-08-26 DePuy Synthes Products, LLC Postpartum cells derived from umbilical tissue and methods of making and using the same
US8815592B2 (en) 2010-04-21 2014-08-26 Research Development Foundation Methods and compositions related to dopaminergic neuronal cells
WO2014143383A1 (en) 2013-03-13 2014-09-18 Agilent Technologies, Inc. Transposome tethered to a gene delivery vehicle
WO2014153230A1 (en) 2013-03-14 2014-09-25 The Regents Of The University Of California In vitro production of medial ganglionic eminence precursor cells
WO2014160413A1 (en) 2013-03-14 2014-10-02 Viacyte, Inc. In vitro differentiation of pluripotent stem cells to pancreatic endoderm cells (pec) and endocrine cells
WO2014161075A1 (en) 2013-04-05 2014-10-09 University Health Network Methods and compositions for generating chondrocyte lineage cells and/or cartilage like tissue
WO2014169277A1 (en) 2013-04-12 2014-10-16 Lafrancesca Saverio Improving organs for transplantation
US8877489B2 (en) 2011-12-05 2014-11-04 California Institute Of Technology Ultrathin parylene-C semipermeable membranes for biomedical applications
US8876532B2 (en) 2002-07-31 2014-11-04 Dentsply International Inc. Bone repair putty
WO2014184666A2 (en) 2013-04-30 2014-11-20 Katholieke Universiteit Leuven Cell therapy for myelodysplastic syndromes
US20140356952A1 (en) * 2004-11-04 2014-12-04 Advanced Cell Technology, Inc. Derivation of embryonic stem cells and embryo-derived cells
WO2014200340A1 (en) 2013-06-10 2014-12-18 Academisch Ziekenhuis Leiden Differentiation and expansion of endothelial cells from pluripotent stem cells and the in vitro formation of vasculature like structures
WO2014200905A2 (en) 2013-06-10 2014-12-18 President And Fellows Of Harvard College Early developmental genomic assay for characterizing pluripotent stem cell utility and safety
WO2014208053A1 (en) 2013-06-28 2014-12-31 株式会社大塚製薬工場 Trehalose and dextran-containing solution for transplanting mammalian cells
WO2015023720A1 (en) 2013-08-16 2015-02-19 Yale University Epithelial cell differentiation of human mesenchymal stromal cells
EP2853589A1 (en) 2010-08-31 2015-04-01 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9005968B2 (en) 2009-10-16 2015-04-14 The Scripps Research Institute Induction of pluripotent cells
WO2015112839A1 (en) 2014-01-23 2015-07-30 President And Fellows Of Harvard College Engineered polymeric valves, tubular structures, and sheets and uses thereof
US9109245B2 (en) 2009-04-22 2015-08-18 Viacyte, Inc. Cell compositions derived from dedifferentiated reprogrammed cells
US9125906B2 (en) 2005-12-28 2015-09-08 DePuy Synthes Products, Inc. Treatment of peripheral vascular disease using umbilical cord tissue-derived cells
WO2015143125A1 (en) 2014-03-19 2015-09-24 The Brigham And Women's Hospital, Inc. Methods relating to pluripotent cells
WO2015143342A1 (en) 2014-03-21 2015-09-24 Cellular Dynamics International, Inc. Production of midbrain dopaminergic neurons and methods for the use thereof
WO2015143350A1 (en) 2014-03-20 2015-09-24 Auxogyn, Inc. Quantitative measurement of human blastocyst and morula morphology developmental kinetics
DE202013012241U1 (en) 2012-05-25 2016-01-18 Emmanuelle Charpentier Compositions for RNA-directed modification of a target DNA and for RNA-driven modulation of transcription
US9248013B2 (en) 2011-12-05 2016-02-02 California Institute Of Technology 3-Dimensional parylene scaffold cage
WO2016025510A1 (en) 2014-08-12 2016-02-18 Rappolee Daniel A Systems and methods to detect stem cell stress and uses thereof
EP2993226A1 (en) 2008-06-03 2016-03-09 Viacyte, Inc. Growth factors for production of definitive endoderm
WO2016036754A1 (en) 2014-09-02 2016-03-10 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification
WO2016040794A1 (en) 2014-09-12 2016-03-17 Whitehead Institute For Biomedical Research Cells expressing apolipoprotein e and uses thereof
WO2016044271A2 (en) 2014-09-15 2016-03-24 Children's Medical Center Corporation Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation
US9315779B2 (en) 2010-03-31 2016-04-19 The Scripps Research Institute Reprogramming cells
US9376664B2 (en) 2010-06-14 2016-06-28 The Scripps Research Institute Reprogramming of cells to a new fate
WO2016131137A1 (en) 2015-02-17 2016-08-25 University Health Network Methods for making and using sinoatrial node-like pacemaker cardiomyocytes and ventricular-like cardiomyocytes
US9434920B2 (en) 2012-03-07 2016-09-06 Janssen Biotech, Inc. Defined media for expansion and maintenance of pluripotent stem cells
US9458425B1 (en) * 1999-05-14 2016-10-04 Technion Research And Development Foundation Ltd. Differentiated human embryoid cells and a method for producing them
US9497943B2 (en) 2008-06-13 2016-11-22 Whitehead Institute For Biomedical Research Nucleic acid constructs encoding reprogramming factors linked by self-cleaving peptides
US9506036B2 (en) 2010-08-31 2016-11-29 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9550974B2 (en) 2004-11-04 2017-01-24 Astellas Institute For Regenerative Medicine Derivation of embryonic stem cells
US9567591B2 (en) 2003-05-15 2017-02-14 Mello Biotechnology, Inc. Generation of human embryonic stem-like cells using intronic RNA
US9572840B2 (en) 2003-06-27 2017-02-21 DePuy Synthes Products, Inc. Regeneration and repair of neural tissue using postpartum-derived cells
US9592258B2 (en) 2003-06-27 2017-03-14 DePuy Synthes Products, Inc. Treatment of neurological injury by administration of human umbilical cord tissue-derived cells
WO2017044483A1 (en) 2015-09-08 2017-03-16 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for reproducible differentiation of clinical-grade retinal pigment epithelium cells
WO2017044488A1 (en) 2015-09-08 2017-03-16 Cellular Dynamics International, Inc. Macs-based purification of stem cell-derived retinal pigment epithelium
US9611513B2 (en) 2011-12-23 2017-04-04 DePuy Synthes Products, Inc. Detection of human umbilical cord tissue derived cells
US9617511B2 (en) 2010-09-07 2017-04-11 The Board Of Regents Of The University Of Texas System Tissue-specific differentiation matrices and uses thereof
US9624471B2 (en) 2013-06-12 2017-04-18 University Of Washington Through Its Center For Commercialization Methods for maturing cardiomyocytes and uses thereof
WO2017064546A1 (en) 2015-09-24 2017-04-20 Crispr Therapeutics Ag Novel family of rna-programmable endonucleases and their uses in genome editing and other applications
WO2017070145A1 (en) 2015-10-19 2017-04-27 Cellular Dynamics International, Inc. Production of virus-receptive pluripotent stem cell (psc)-derived hepatocytes
WO2017070333A1 (en) 2015-10-20 2017-04-27 Cellular Dynamics International, Inc. Multi-lineage hematopoietic precursor cell production by genetic programming
WO2017075389A1 (en) 2015-10-30 2017-05-04 The Regents Of The Universtiy Of California Methods of generating t-cells from stem cells and immunotherapeutic methods using the t-cells
US9644184B2 (en) 2008-06-04 2017-05-09 Cellular Dynamics International, Inc. Methods for the production of IPS cells using Epstein-Barr (EBV)-based reprogramming vectors
WO2017100313A1 (en) 2015-12-07 2017-06-15 Biotime, Inc. Methods for the re-derivation of diverse pluripotent stem cell-derive brown fat cells
WO2017117333A1 (en) 2015-12-30 2017-07-06 Cellular Dynamics International, Inc. Microtissue formation using stem cell-derived human hepatocytes
US9714280B2 (en) 2012-07-31 2017-07-25 Escape Therapeutics, Inc. HLA G-modified cells and methods
US9732319B2 (en) 2010-12-22 2017-08-15 Fate Therapeutics, Inc. Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs
WO2017147536A1 (en) 2016-02-24 2017-08-31 The Rockefeller University Embryonic cell-based therapeutic candidate screening systems, models for huntington's disease and uses thereof
US9752125B2 (en) 2010-05-12 2017-09-05 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9758763B2 (en) 2013-05-29 2017-09-12 The Regents Of The University Of California Methods and compositions for somatic cell proliferation and viability
WO2017172086A1 (en) 2016-02-19 2017-10-05 Leung Chuen Yan Genetic markers for engraftment of human cardiac ventricular progenitor cells
WO2017176810A1 (en) 2016-04-04 2017-10-12 Biotime, Inc. Pluripotent stem cell-derived 3d retinal tissue and uses thereof
US9808489B2 (en) 2009-11-09 2017-11-07 Aal Scientifics, Inc. Treatment of heart disease
WO2017202949A1 (en) 2016-05-25 2017-11-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers
WO2017202814A1 (en) 2016-05-24 2017-11-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of neuropathological disorders characterized by a loss of cortical neurons
WO2017210537A1 (en) 2016-06-02 2017-12-07 The Cleveland Clinic Foundation Complement inhibition for improving cell viability
EP3255142A1 (en) 2009-10-19 2017-12-13 Cellular Dynamics International, Inc. Cardiomyocyte production
WO2017216771A2 (en) 2016-06-17 2017-12-21 Genesis Technologies Limited Crispr-cas system, materials and methods
WO2018005975A1 (en) 2016-07-01 2018-01-04 Research Development Foundation Elimination of proliferating cells from stem cell-derived grafts
WO2018035214A1 (en) 2016-08-16 2018-02-22 Cellular Dynamics International., Inc. Methods for differentiating pluripotent cells
US9914911B2 (en) 2012-10-29 2018-03-13 Scripps Health Methods of reprogramming chondrocytes
US9932607B2 (en) 2013-11-15 2018-04-03 The Board Of Trustees Of The Leland Stanford Junior University Site-specific integration of transgenes into human cells
WO2018067826A1 (en) 2016-10-05 2018-04-12 Cellular Dynamics International, Inc. Generating mature lineages from induced pluripotent stem cells with mecp2 disruption
WO2018085516A2 (en) 2016-11-02 2018-05-11 Aal Scientifics, Inc. Non-mesenchymal human lung stem cells and methods of their use for treating respiratory diseases
WO2018084228A1 (en) 2016-11-04 2018-05-11 国立大学法人東京大学 Solution for cryopreservation of animal cells or animal tissues, cryopreserved product, and cryopreservation method
US9969972B2 (en) 2008-11-20 2018-05-15 Janssen Biotech, Inc. Pluripotent stem cell culture on micro-carriers
US9974885B2 (en) 2012-10-29 2018-05-22 Scripps Health Methods of transplanting chondrocytes
WO2018097253A1 (en) 2016-11-25 2018-05-31 国立研究開発法人理化学研究所 Cell population for transplantation and method for producing same
WO2018100433A1 (en) 2016-11-29 2018-06-07 Procella Therapeutics Ab Methods for isolating human cardiac ventricular progenitor cells
WO2018110159A1 (en) 2016-12-14 2018-06-21 株式会社大塚製薬工場 Mammalian cell cryopreservation liquid
US10006006B2 (en) 2014-05-16 2018-06-26 Janssen Biotech, Inc. Use of small molecules to enhance MAFA expression in pancreatic endocrine cells
US10066203B2 (en) 2008-02-21 2018-09-04 Janssen Biotech Inc. Methods, surface modified plates and compositions for cell attachment, cultivation and detachment
US10066210B2 (en) 2012-06-08 2018-09-04 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into pancreatic endocrine cells
WO2018164240A1 (en) 2017-03-08 2018-09-13 大日本住友製薬株式会社 Method for producing retinal pigment epithelial cells
EP3375877A1 (en) 2013-11-18 2018-09-19 Crispr Therapeutics AG Crispr-cas system materials and methods
WO2018195418A1 (en) 2017-04-20 2018-10-25 Oregon Health & Science University Human gene correction
WO2018195175A1 (en) 2017-04-18 2018-10-25 FUJIFILM Cellular Dynamics, Inc. Antigen-specific immune effector cells
US10138465B2 (en) 2012-12-31 2018-11-27 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into pancreatic endocrine cells using HB9 regulators
WO2019017492A1 (en) 2017-07-20 2019-01-24 国立研究開発法人理化学研究所 Method for maturation of retinal tissue containing continuous epithelium
WO2019017491A1 (en) 2017-07-20 2019-01-24 国立研究開発法人理化学研究所 Method for preserving neural tissue
DE202014011287U1 (en) 2013-06-11 2019-02-06 The President And Fellows Of Harvard College SC-β cells and compositions for producing the cells
WO2019028088A1 (en) 2017-07-31 2019-02-07 Biotime, Inc. Compositions and methods for restoring or preventing loss of vision caused by disease or traumatic injury
WO2019038587A1 (en) 2017-08-23 2019-02-28 Procella Therapeutics Ab Use of neuropilin-1 (nrp1) as a cell surface marker for isolating human cardiac ventricular progenitor cells
WO2019050015A1 (en) 2017-09-08 2019-03-14 国立研究開発法人理化学研究所 Cell aggregate including retinal tissue and production method therefor
WO2019054515A1 (en) 2017-09-14 2019-03-21 国立研究開発法人理化学研究所 Method for amplifying cone photoreceptors or rod photoreceptors using dorsalization signal transmitter or ventralization signal transmitter
WO2019054514A1 (en) 2017-09-14 2019-03-21 国立研究開発法人理化学研究所 Method for producing retinal tissues
US10241108B2 (en) 2013-02-01 2019-03-26 Ares Trading S.A. Abnormal syngamy phenotypes observed with time lapse imaging for early identification of embryos with lower development potential
EP3483261A1 (en) 2012-04-24 2019-05-15 VCell Therapeutics, Inc. Generating pluripotent cells de novo
WO2019092505A1 (en) 2017-11-09 2019-05-16 Casebia Therapeutics Llp Self-inactivating (sin) crispr/cas or crispr/cpf1 systems and uses thereof
WO2019096787A1 (en) 2017-11-14 2019-05-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Regulatory t cells genetically modified for the lymphotoxin alpha gene and uses thereof
WO2019099725A1 (en) 2017-11-15 2019-05-23 Semma Therapeutics, Inc. Islet cell manufacturing compositions and methods of use
WO2019103129A1 (en) 2017-11-24 2019-05-31 住友化学株式会社 Method for producing cell mass including pituitary tissue, and cell mass thereof
WO2019103125A1 (en) 2017-11-24 2019-05-31 住友化学株式会社 Production method for cell mass including neural cells/tissue and non-neural epithelial tissue, and cell mass from same
WO2019101956A1 (en) 2017-11-24 2019-05-31 Institut National De La Santé Et De La Recherche Médicale (Inserm) Methods and compositions for treating cancers
EP3498818A1 (en) 2011-02-28 2019-06-19 President and Fellows of Harvard College Cell culture system
WO2019118935A1 (en) 2017-12-14 2019-06-20 Casebia Therapeutics Limited Liability Partnership Novel rna-programmable endonuclease systems and their use in genome editing and other applications
US10344264B2 (en) 2012-12-31 2019-07-09 Janssen Biotech, Inc. Culturing of human embryonic stem cells at the air-liquid interface for differentiation into pancreatic endocrine cells
US10358628B2 (en) 2011-12-22 2019-07-23 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into single hormonal insulin positive cells
US10370644B2 (en) 2012-12-31 2019-08-06 Janssen Biotech, Inc. Method for making human pluripotent suspension cultures and cells derived therefrom
US10377989B2 (en) 2012-12-31 2019-08-13 Janssen Biotech, Inc. Methods for suspension cultures of human pluripotent stem cells
EP3524673A1 (en) 2014-08-22 2019-08-14 Procella Therapeutics AB Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells
EP3527658A1 (en) 2006-04-28 2019-08-21 Lifescan, Inc. Differentiation of human embryonic stem cells
WO2019160148A1 (en) 2018-02-19 2019-08-22 大日本住友製薬株式会社 Cell aggregate, mixture of cell aggregates, and method for preparing same
US10400214B2 (en) 2008-12-23 2019-09-03 Boco Silicon Valley, Inc. Target populations of oligodendrocyte precursor cells and methods of making and using same
US10420803B2 (en) 2016-04-14 2019-09-24 Janssen Biotech, Inc. Differentiation of pluripotent stem cells to intestinal midgut endoderm cells
WO2019183150A1 (en) 2018-03-19 2019-09-26 Casebia Therapeutics Limited Liability Partnership Novel rna-programmable endonuclease systems and uses thereof
WO2019204817A1 (en) 2018-04-20 2019-10-24 FUJIFILM Cellular Dynamics, Inc. Method for differentiation of ocular cells and use thereof
WO2019213276A1 (en) 2018-05-02 2019-11-07 Novartis Ag Regulators of human pluripotent stem cells and uses thereof
US10478206B2 (en) 2011-04-29 2019-11-19 University Of Southern California Instruments and methods for the implantation of cell-seeded substrates
EP3572512A1 (en) 2018-05-24 2019-11-27 B.R.A.I.N. Ag A method for engineering a protein
US10557116B2 (en) 2008-12-19 2020-02-11 DePuy Synthes Products, Inc. Treatment of lung and pulmonary diseases and disorders
WO2020030634A1 (en) 2018-08-06 2020-02-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers
WO2020039732A1 (en) 2018-08-24 2020-02-27 住友化学株式会社 Cell aggregation including olfactory neuron or precursor cell thereof, and method for producing same
US10584313B2 (en) 2007-02-23 2020-03-10 Astellas Institute For Regenerative Medicine Method of producing a differentiated mammalian cell comprising culturing a single mammalian blastomere
WO2020051429A1 (en) 2018-09-07 2020-03-12 Hebecell Corporation Methods and compositions for retinal neuron generation in carrier-free 3d sphere suspension culture
US10596200B2 (en) 2014-08-22 2020-03-24 Procella Therapeutics Ab Use of LIFR or FGFR3 as a cell surface marker for isolating human cardiac ventricular progenitor cells
WO2020066991A1 (en) 2018-09-28 2020-04-02 株式会社大塚製薬工場 Mammal cell preserving solution containing acarbose or stachyose
US10633625B2 (en) 2013-11-16 2020-04-28 Terumo Bct, Inc. Expanding cells in a bioreactor
US10638734B2 (en) 2004-01-05 2020-05-05 Abt Holding Company Multipotent adult stem cells, sources thereof, methods of obtaining and maintaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof
WO2020100481A1 (en) 2018-11-15 2020-05-22 Jsr株式会社 Method for producing brain organoids
WO2020106622A1 (en) 2018-11-19 2020-05-28 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Biodegradable tissue replacement implant and its use
US10669519B2 (en) 2010-10-08 2020-06-02 Terumo Bct, Inc. Customizable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
WO2020130068A1 (en) 2018-12-20 2020-06-25 住友化学株式会社 Embryonic erythroblast-containing cell population and method for producing same, cell culture composition, and compound test method
WO2020138430A1 (en) 2018-12-28 2020-07-02 国立研究開発法人理化学研究所 Therapeutic drug for disease accompanied by disorders in retinal system cells or retinal tissue
US10711246B2 (en) 2013-09-13 2020-07-14 University Health Network Methods and compositions for generating epicardium cells
US10724005B2 (en) 2012-09-28 2020-07-28 Scripps Health Methods of differentiating stem cells into chondrocytes
WO2020184720A1 (en) 2019-03-13 2020-09-17 大日本住友製薬株式会社 Method for evaluating quality of transplant neural retina, and transplant neural retina sheet
WO2020186059A2 (en) 2019-03-12 2020-09-17 Crispr Therapeutics Ag Novel high fidelity rna-programmable endonuclease systems and uses thereof
WO2020209959A1 (en) 2019-03-08 2020-10-15 Crispr Therapeutics Ag Nucleobase-editing fusion protein systems, compositions, and uses thereof
WO2020218480A1 (en) 2019-04-26 2020-10-29 国立研究開発法人理化学研究所 Composite including neural retina, retinal pigment epithelial cells, and hydrogel, and method for producing same
WO2020218461A1 (en) 2019-04-26 2020-10-29 株式会社大塚製薬工場 Trehalose-containing liquid for mammalian cell preservation
US10821155B2 (en) 2018-06-27 2020-11-03 Juvena Therapeutics, Inc. Heparin-associated polypeptides and uses thereof
US10828330B2 (en) 2017-02-22 2020-11-10 IO Bioscience, Inc. Nucleic acid constructs comprising gene editing multi-sites and uses thereof
EP3736343A1 (en) 2013-03-15 2020-11-11 Whitehead Institute For Biomedical Research Cellular discovery platform for neurodegenerative diseases
WO2020225606A1 (en) 2019-05-08 2020-11-12 Crispr Therapeutics Ag Crispr/cas all-in-two vector systems for treatment of dmd
WO2020229546A1 (en) 2019-05-14 2020-11-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Regulatory t cells targeted by lymphotoxin alpha blocking agent and uses thereof
WO2020264072A1 (en) 2019-06-25 2020-12-30 Semma Therapeutics, Inc. Enhanced differentiation of beta cells
WO2020262613A1 (en) 2019-06-27 2020-12-30 国立大学法人東京大学 Method for separating pancreatic progenitor cells
WO2021030424A1 (en) 2019-08-13 2021-02-18 Semma Therapeutics, Inc. Pancreatic differentiation
WO2021045217A1 (en) 2019-09-06 2021-03-11 学校法人慶應義塾 Method for producing cell aggregate including glial progenitor cells
US10961531B2 (en) 2013-06-05 2021-03-30 Agex Therapeutics, Inc. Compositions and methods for induced tissue regeneration in mammalian species
WO2021069593A1 (en) 2019-10-09 2021-04-15 INSERM (Institut National de la Santé et de la Recherche Médicale) T cells modified to express mutated cxcr4 or partially deleted and uses thereof
US11007385B2 (en) 2012-12-10 2021-05-18 Regenics As Use of cellular extracts for skin rejuvenation
EP3822340A1 (en) 2012-01-13 2021-05-19 The General Hospital Corporation Isolated human lung progenitor cells and uses thereof
WO2021100829A1 (en) 2019-11-20 2021-05-27 大日本住友製薬株式会社 Method for freezing neural cells
WO2021100830A1 (en) 2019-11-20 2021-05-27 大日本住友製薬株式会社 Method for freezing cell aggregates
EP3835419A1 (en) 2013-12-12 2021-06-16 The Regents of The University of California Methods and compositions for modifying a single stranded target nucleic acid
EP3833365A1 (en) 2018-08-10 2021-06-16 Vertex Pharmaceuticals Incorporated Stem cell derived islet differentiation
US11078462B2 (en) 2014-02-18 2021-08-03 ReCyte Therapeutics, Inc. Perivascular stromal cells from primate pluripotent stem cells
EP3868873A1 (en) 2014-10-24 2021-08-25 Sumitomo Dainippon Pharma Co., Ltd. Production method for retinal tissue
WO2021243203A1 (en) 2020-05-29 2021-12-02 FUJIFILM Cellular Dynamics, Inc. Bilayer of retinal pigmented epithelium and photoreceptors and use thereof
WO2021243256A1 (en) 2020-05-29 2021-12-02 FUJIFILM Cellular Dynamics, Inc. Retinal pigmented epithelium and photoreceptor dual cell aggregates and methods of use thereof
WO2021250058A2 (en) 2020-06-12 2021-12-16 Bayer Aktiengesellschaft CRISPR-Cas12a DIRECTED RANDOM MUTAGENESIS AGENTS AND METHODS
DE212020000516U1 (en) 2019-03-07 2022-01-17 The Regents of the University of California CRISPR-CAS effector polypeptides
US11254916B2 (en) 2006-03-02 2022-02-22 Viacyte, Inc. Methods of making and using PDX1-positive pancreatic endoderm cells
US11268069B2 (en) 2014-03-04 2022-03-08 Fate Therapeutics, Inc. Reprogramming methods and cell culture platforms
US11274281B2 (en) 2014-07-03 2022-03-15 ReCyte Therapeutics, Inc. Exosomes from clonal progenitor cells
WO2022054924A1 (en) 2020-09-11 2022-03-17 大日本住友製薬株式会社 Medium for tissue for transplantation
WO2022054925A1 (en) 2020-09-11 2022-03-17 国立研究開発法人理化学研究所 Complex containing neural retina-containing cell aggregates and matrix, and method for manufacturing same
WO2022063224A1 (en) 2020-09-24 2022-03-31 中国科学院动物研究所 Activated pluripotent stem cell, and preparation method therefor and use thereof
WO2022087260A1 (en) 2020-10-22 2022-04-28 The Regents Of The University Of California Devices and methods for evaluating the viability of embryos
WO2022110494A1 (en) 2020-11-26 2022-06-02 北京赛尔湃腾科技咨询合伙企业(有限合伙) Method for reprogramming cell
US11352606B2 (en) 2014-02-10 2022-06-07 The Johns Hopkins University Low oxygen tension enhances endothelial fate of human pluripotent stem cells
US11441126B2 (en) 2015-10-16 2022-09-13 Fate Therapeutics, Inc. Platform for the induction and maintenance of ground state pluripotency
WO2022191216A1 (en) 2021-03-09 2022-09-15 国立研究開発法人理化学研究所 Method for producing hypoimmunogenic retinal pigment epithelial cells
WO2022207889A1 (en) 2021-04-01 2022-10-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Liver organoid manufacturing methods, liver organoids obtained with the same, and uses thereof
WO2022216911A1 (en) 2021-04-07 2022-10-13 FUJIFILM Cellular Dynamics, Inc. Dopaminergic precursor cells and methods of use
WO2022221051A1 (en) 2021-04-11 2022-10-20 President And Fellows Of Harvard College Cardiomyocytes and compositions and methods for producing the same
EP4092109A1 (en) 2015-09-08 2022-11-23 Sumitomo Pharma Co., Ltd. Method for producing retinal pigment epithelial cells
WO2022251499A1 (en) 2021-05-28 2022-12-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods to generate macular, central and peripheral retinal pigment epithelial cells
WO2022251477A1 (en) 2021-05-28 2022-12-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Biodegradable tissue scaffold with secondary matrix to host weakly adherent cells
EP4101928A1 (en) 2021-06-11 2022-12-14 Bayer AG Type v rna programmable endonuclease systems
WO2022258753A1 (en) 2021-06-11 2022-12-15 Bayer Aktiengesellschaft Type v rna programmable endonuclease systems
WO2022265086A1 (en) 2021-06-17 2022-12-22 国立大学法人京都大学 Method for producing cerebral cortical cell preparation derived from human pluripotent stem cells
US11534466B2 (en) 2016-03-09 2022-12-27 Aal Scientifics, Inc. Pancreatic stem cells and uses thereof
EP4144841A1 (en) 2021-09-07 2023-03-08 Bayer AG Novel small rna programmable endonuclease systems with impoved pam specificity and uses thereof
WO2023039588A1 (en) 2021-09-13 2023-03-16 FUJIFILM Cellular Dynamics, Inc. Methods for the production of committed cardiac progenitor cells
WO2023049826A1 (en) 2021-09-23 2023-03-30 President And Fellows Of Harvard College Genetically encoded voltage indicators and uses thereof
WO2023054395A1 (en) 2021-09-30 2023-04-06 住友ファーマ株式会社 Cell aggregate including pituitary hormone-producing cells and method for producing same
WO2023054396A1 (en) 2021-09-30 2023-04-06 住友化学株式会社 Method for producing cell mass including pituitary tissue and cell mass
WO2023070019A1 (en) 2021-10-21 2023-04-27 Vertex Pharmaceuticals Incorporated Hypoimmune cells
WO2023077140A2 (en) 2021-11-01 2023-05-04 Vertex Pharmaceuticals Incorporated Stem cell derived pancreatic islet differentiation
WO2023090427A1 (en) 2021-11-19 2023-05-25 国立研究開発法人理化学研究所 Production method for sheet-like retinal tissue
WO2023118068A1 (en) 2021-12-23 2023-06-29 Bayer Aktiengesellschaft Novel small type v rna programmable endonuclease systems
WO2023127824A1 (en) 2021-12-27 2023-07-06 住友ファーマ株式会社 Neural crest cell culturing method and production method
WO2023167986A1 (en) 2022-03-02 2023-09-07 Lineage Cell Therapeutics, Inc. Methods and compositions for treating hearing loss
WO2023176906A1 (en) 2022-03-16 2023-09-21 住友ファーマ株式会社 Transplantation medium
WO2023178239A1 (en) 2022-03-16 2023-09-21 The Children's Medical Center Corporation Hpsc-derived articular chondrocyte compositions, systems and methods of use thereof
US11767507B2 (en) 2013-11-08 2023-09-26 The Mclean Hospital Corporation Methods for efficient generation of GABAergic interneurons from pluripotent stem cells
WO2023199641A1 (en) 2022-04-12 2023-10-19 株式会社大塚製薬工場 Mammalian cell cryopreservation liquid
WO2023199113A1 (en) 2022-04-15 2023-10-19 Smartcella Solutions Ab COMPOSITIONS AND METHODS FOR EXOSOME-MEDIATED DELIVERY OF mRNA AGENTS
WO2023230391A1 (en) 2022-05-26 2023-11-30 Tender Food, Inc. Plant-based shredded meat products, and methods of producing the same
WO2023237587A1 (en) 2022-06-10 2023-12-14 Bayer Aktiengesellschaft Novel small type v rna programmable endonuclease systems
WO2024059358A1 (en) 2022-09-16 2024-03-21 Tender Food, Inc. Plant and animal cell blended meat products and methods of producing the same
WO2024073776A1 (en) 2022-09-30 2024-04-04 FUJIFILM Cellular Dynamics, Inc. Methods for the production of cardiac fibroblasts
EP4386081A2 (en) 2019-05-21 2024-06-19 President and Fellows of Harvard College Endocrine differentiation-inducing molecule
WO2024129234A1 (en) 2022-12-16 2024-06-20 Tender Food, Inc. Plant-based poultry products, and methods of producing the same
US12098202B2 (en) 2016-10-10 2024-09-24 The National Institute for Biotechnology in the Negev Ltd. Non-cytotoxic modified cells and use thereof
US12263227B2 (en) 2018-11-28 2025-04-01 Crispr Therapeutics Ag Optimized mRNA encoding CAS9 for use in LNPs
EP4534650A2 (en) 2012-09-25 2025-04-09 Yale University Differentiation of human ips cells to human alveolar type ii via definitive endoderm
US12329801B2 (en) 2021-06-21 2025-06-17 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof
WO2025126208A1 (en) 2023-12-12 2025-06-19 Accellta Ltd. Media for maintaining, differentiating, or both, pluripotent stem cells
US12358963B2 (en) 2019-12-24 2025-07-15 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof

Families Citing this family (324)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0688358A4 (en) * 1993-03-12 1997-10-01 Univ Creighton IMPROVED VECTORS IN GENE THERAPY
US20040071637A1 (en) * 1993-04-27 2004-04-15 Elia James P. Method for repairing a damaged portion of a human organ
US5874301A (en) * 1994-11-21 1999-02-23 National Jewish Center For Immunology And Respiratory Medicine Embryonic cell populations and methods to isolate such populations
US20030190753A1 (en) * 1995-11-09 2003-10-09 Nature Technology Corporation Vectors for gene transfer
US7544511B2 (en) * 1996-09-25 2009-06-09 Neuralstem Biopharmaceuticals Ltd. Stable neural stem cell line methods
AU3392697A (en) * 1996-06-14 1998-01-07 Regents Of The University Of California, The (in vitro) derivation and culture of primate pluripotent stem cells and therapeutic uses thereof
US20020194637A1 (en) * 2001-06-06 2002-12-19 University Of Massachussetts Embryonic or stem-like cell lines produced by cross species nuclear transplantation
US6090622A (en) * 1997-03-31 2000-07-18 The Johns Hopkins School Of Medicine Human embryonic pluripotent germ cells
US6479285B1 (en) * 1997-07-02 2002-11-12 Board Of Regents, The University Of Texas System p53 as a regulator of cell differentiation
WO1999027076A1 (en) * 1997-11-25 1999-06-03 Arc Genomic Research Pluripotent embryonic stem cells and methods of obtaining them
WO1999056759A1 (en) 1998-05-07 1999-11-11 University Of South Florida Bone marrow cells as a source of neurons for brain and spinal cord repair
US20080206206A1 (en) 1998-05-07 2008-08-28 University Of South Florida Bone marrow-derived neuronal cells
US6767737B1 (en) * 1998-08-31 2004-07-27 New York University Stem cells bearing an FGF receptor on the cell surface
CA2342205A1 (en) * 1998-09-01 2000-03-09 Wisconsin Alumni Research Foundation Primate embryonic stem cells with compatible histocompatibility genes
US20020168766A1 (en) * 2000-01-11 2002-11-14 Gold Joseph D. Genetically altered human pluripotent stem cells
CA2370781A1 (en) * 1999-04-30 2000-11-09 Joseph P. Vacanti Fabrication of vascularized tissue using microfabricated two-dimensional molds
US7759113B2 (en) * 1999-04-30 2010-07-20 The General Hospital Corporation Fabrication of tissue lamina using microfabricated two-dimensional molds
WO2001019977A1 (en) * 1999-09-14 2001-03-22 University Of Massachusetts, A Public Institution Of Higher Education By The Commonwealth Of Massachusetts, As Represented By Its Amherst Campus Embryonic or stem-like cell lines produced by cross species nuclear transplantation and methods for enhancing embryonic development by genetic alteration of donor cells or by tissue culture conditions
AUPQ307399A0 (en) * 1999-09-24 1999-10-21 Luminis Pty Limited Cell cycle control
EP1218489B1 (en) * 1999-09-24 2009-03-18 Cybios LLC Pluripotent embryonic-like stem cells, compositions, methods and uses thereof
BR0014864A (en) * 1999-10-15 2002-11-19 Advanced Cell Tech Inc Methods of producing differentiated progenitor cells and defective embryonic stem cells in lineage
CA2388510A1 (en) * 1999-11-02 2001-05-10 James M. Robl Use of haploid genomes for genetic diagnosis, modification and multiplication
US6280718B1 (en) 1999-11-08 2001-08-28 Wisconsin Alumni Reasearch Foundation Hematopoietic differentiation of human pluripotent embryonic stem cells
EP1241935A2 (en) * 1999-12-17 2002-09-25 Gerald Schatten Methods for producing transgenic animals
JP2003533976A (en) * 2000-01-07 2003-11-18 オレゴン ヘルス アンド サイエンス ユニバーシティ Clonal propagation of primate offspring by embryo division
US20030134413A1 (en) * 2000-01-14 2003-07-17 Rathjen Peter David Cell production
US6458589B1 (en) 2000-04-27 2002-10-01 Geron Corporation Hepatocyte lineage cells derived from pluripotent stem cells
US7776021B2 (en) 2000-04-28 2010-08-17 The Charles Stark Draper Laboratory Micromachined bilayer unit for filtration of small molecules
US8273570B2 (en) * 2000-05-16 2012-09-25 Riken Process of inducing differentiation of embryonic cell to cell expressing neural surface marker using OP9 or PA6 cells
CA2381065C (en) * 2000-06-01 2007-06-05 Japan Science And Technology Corporation Method for enrichment and/or isolation of dopaminergic neurons
EP1290141A4 (en) * 2000-06-05 2005-01-05 Burnham Inst METHOD FOR DIFFERENTIATING AND PROTECTING CELLS BY MODULATING THE P38 / MEF METABOLIC WAYS
DE60140120D1 (en) 2000-06-14 2009-11-19 Vistagen Inc TOXICITY TYPING USING LIVESTOCK CELLS
AU2001274540A1 (en) * 2000-06-15 2001-12-24 Tanabe Seiyaku Co., Ltd. Monkey-origin embryonic stem cells
AU6842001A (en) * 2000-06-15 2001-12-24 Tanja Dominko Pluripotent mammalian cells
JP5014535B2 (en) * 2000-06-15 2012-08-29 田辺三菱製薬株式会社 Cynomolgus monkey-derived embryonic stem cells
EP2298867A3 (en) * 2000-06-20 2013-01-16 ES Cell International Pte Ltd. Method of controlling differentiation of embryonic stem (ES) cells by culturing ES cells in the presence of bmp-2 pathway antagonists
EP1315835A2 (en) 2000-08-01 2003-06-04 Yissum Research Development Company of the Hebrew University of Jerusalem Directed differentiation of embryonic cells
AU2001284923A1 (en) * 2000-08-15 2002-02-25 Geron Corporation Reprogramming cells for enhanced differentiation capacity using pluripotent stemcells
CN1350059A (en) * 2000-08-30 2002-05-22 玛利亚生物技术株式会社 Human embryonic stem cell obtained by freezing-unfreezing embryo
WO2002022789A1 (en) * 2000-09-14 2002-03-21 Atsushi Yuki Process for producing normal parenchymal cells, tissue or organ by bioincubator
AUPR095200A0 (en) * 2000-10-24 2000-11-16 Bresagen Limited Cell production
US20040072343A1 (en) * 2000-11-09 2004-04-15 Verma Paul John Cell reprogramming
IL155728A0 (en) * 2000-11-22 2003-11-23 Geron Corp Tolerizing allografts of pluripotent stem cells
US20030027331A1 (en) * 2000-11-30 2003-02-06 Yan Wen Liang Isolated homozygous stem cells, differentiated cells derived therefrom, and materials and methods for making and using same
IL156234A0 (en) * 2000-11-30 2004-01-04 Stemron Inc Isolated homozygous stem cells, differentiated cells derived therefrom, and materials and methods for making and using same
AU2002251681A1 (en) * 2000-12-05 2002-08-28 Layton Bioscience Inc. Production and use of dopaminergic cells to treat dopaminergic deficiencies
JP4223284B2 (en) * 2001-01-02 2009-02-12 ステムロン インコーポレイテッド Method for producing homozygous stem cell group having previously selected immunotype and / or genotype, cell suitable for transplantation derived from the cell, and material and method using the same
AU2002239810A1 (en) 2001-01-02 2002-07-16 The Charles Stark Draper Laboratory, Inc. Tissue engineering of three-dimensional vascularized using microfabricated polymer assembly technology
AUPR349501A0 (en) * 2001-03-02 2001-03-29 Bresagen Limited Cellular production control
JP2004535808A (en) * 2001-07-06 2004-12-02 ジェロン コーポレイション Mesenchymal and osteoblasts derived from human embryonic stem cells
CN1543500B (en) * 2001-07-12 2014-04-09 杰龙公司 Generation of cardiomyocyte lineage cells from human pluripotent stem cells
US7732199B2 (en) 2001-07-12 2010-06-08 Geron Corporation Process for making transplantable cardiomyocytes from human embryonic stem cells
US20030017587A1 (en) * 2001-07-18 2003-01-23 Rader William C. Embryonic stem cells, clinical applications and methods for expanding in vitro
US20040092013A1 (en) * 2001-08-14 2004-05-13 Snyder Evan Y. Method of treating alzheimer's disease with cell therapy
US20030211603A1 (en) * 2001-08-14 2003-11-13 Earp David J. Reprogramming cells for enhanced differentiation capacity using pluripotent stem cells
US7491690B2 (en) * 2001-11-14 2009-02-17 Northwestern University Self-assembly and mineralization of peptide-amphiphile nanofibers
JP4408371B2 (en) 2001-12-21 2010-02-03 トロンボジェニクス・ナムローゼ・フエンノートシャップ Composition for in vitro induction and culture of embryonic stem (ES) cells having germline transmission ability
GB0220145D0 (en) * 2002-08-30 2002-10-09 Thromb X Nv Novel compositions for the in vitro derivation and culture of embryonic stem (ES) cell lines with germline transmission capability
US7190781B2 (en) * 2002-01-04 2007-03-13 Telefonaktiebolaget Lm Ericsson (Publ) Message transfer part point code mapping method and node
US20040043482A1 (en) * 2002-01-04 2004-03-04 Kye-Hyung Paik Method of producing stem cell lines
US20030134422A1 (en) * 2002-01-16 2003-07-17 Sayre Chauncey Bigelow Stem cell maturation for all tissue lines
US20050170506A1 (en) * 2002-01-16 2005-08-04 Primegen Biotech Llc Therapeutic reprogramming, hybrid stem cells and maturation
US20050090004A1 (en) * 2003-01-16 2005-04-28 Sayre Chauncey B. Stem cell maturation for all tissue lines
WO2003070749A2 (en) * 2002-02-15 2003-08-28 Northwestern University Self-assembly of peptide-amphiphile nanofibers under physiological conditions
WO2003078967A2 (en) * 2002-03-12 2003-09-25 Oregon Health & Science University Stem cell selection and differentiation
WO2003075648A1 (en) * 2002-03-13 2003-09-18 Fundacion Ivi Para El Estudio De La Reproduccion Humana (Fivier) Method of producing cell lines
CA2684022C (en) * 2002-05-17 2014-09-23 Mount Sinai School Of Medicine Of New York University Mesoderm and definitive endoderm cell populations
US20060003446A1 (en) 2002-05-17 2006-01-05 Gordon Keller Mesoderm and definitive endoderm cell populations
WO2003104423A2 (en) * 2002-06-11 2003-12-18 Roy Ogle Meningeal-derived stem cells
US7422736B2 (en) * 2002-07-26 2008-09-09 Food Industry Research And Development Institute Somatic pluripotent cells
US7534761B1 (en) 2002-08-21 2009-05-19 North Western University Charged peptide-amphiphile solutions and self-assembled peptide nanofiber networks formed therefrom
CA2404540A1 (en) * 2002-09-20 2004-03-20 Institut Pasteur A method for measuring a marker indicative of the exposure of a patient to nicotine; a kit for measuring such a marker
US7554021B2 (en) 2002-11-12 2009-06-30 Northwestern University Composition and method for self-assembly and mineralization of peptide amphiphiles
US7683025B2 (en) 2002-11-14 2010-03-23 Northwestern University Synthesis and self-assembly of ABC triblock bola peptide amphiphiles
AU2003302701A1 (en) * 2002-11-29 2004-06-23 Technion Research And Development Foundation Ltd. Method of dynamically culturing embryonic stem cells
WO2004055155A2 (en) 2002-12-16 2004-07-01 Technion Research & Development Foundation Ltd. Methods of preparing feeder cells-free, xeno-free human embryonic stem cells and stem cell cultures prepared using same
WO2004065616A2 (en) 2003-01-16 2004-08-05 The General Hospital Corporation Use of three-dimensional microfabricated tissue engineered systems for pharmacologic applications
KR20050100397A (en) * 2003-02-11 2005-10-18 노오쓰웨스턴 유니버시티 Methods and materials for nanocrystalline surface coatings and attachment of peptide amphiphile nanofibers thereon
US20040191839A1 (en) * 2003-03-28 2004-09-30 National Institute Of Agrobiological Sciences Japan Methods for sorting undifferentiated cells and uses thereof
JP4502317B2 (en) * 2003-03-28 2010-07-14 独立行政法人農業生物資源研究所 Method for selecting undifferentiated cells and use thereof
EP1611233B1 (en) 2003-04-08 2016-01-06 Yeda Research And Development Co., Ltd. Stem cells having increased sensitivity to sdf-1 and methods of generating and using same
US20060037086A1 (en) * 2003-04-09 2006-02-16 Schatten Gerald P Methods for correcting mitotic spindle defects and optimizing preimplantation embryonic developmental rates associated with somatic cell nuclear transfer in animals
FR2853551B1 (en) 2003-04-09 2006-08-04 Lab Francais Du Fractionnement STABILIZING FORMULATION FOR IMMUNOGLOBULIN G COMPOSITIONS IN LIQUID FORM AND LYOPHILIZED FORM
KR20060057528A (en) * 2003-04-09 2006-05-26 마제-위민스 헬스 코퍼레이션 How to correct mitotic spindle defects associated with somatic cell nuclear transfer in animals
US20070020608A1 (en) * 2003-05-08 2007-01-25 Peter Eriksson Method for the generation of neural progenitor cells
WO2005034624A2 (en) 2003-05-21 2005-04-21 The General Hospital Corporation Microfabricated compositions and processes for engineering tissues containing multiple cell types
US20080057033A1 (en) * 2003-06-11 2008-03-06 Peter Lonai Neural Stem Cells and Methods of Generating and Utilizing Same
DE602004031033D1 (en) * 2003-10-09 2011-02-24 Core Dynamics Ltd PROCESS FOR FREEZE FREEZING, DEFROSTING AND TRANSPLANTING VITAL BODY
US20050123525A1 (en) * 2003-11-13 2005-06-09 Ulrich Martin Composition and method for inducing immune tolerance towards cell, tissue and/or organ transplants
IL158868A0 (en) * 2003-11-13 2004-05-12 Yeda Res & Dev Methods of generating and using stem cells enriched with immature primitive progenitor
US20050106554A1 (en) * 2003-11-19 2005-05-19 Palecek Sean P. Cryopreservation of pluripotent stem cells
US20080220520A1 (en) * 2003-11-19 2008-09-11 Palecek Sean P Cryopreservation of human embryonic stem cells in microwells
US7790039B2 (en) * 2003-11-24 2010-09-07 Northwest Biotherapeutics, Inc. Tangential flow filtration devices and methods for stem cell enrichment
MXPA06006387A (en) * 2003-12-05 2006-09-04 Univ Northwestern Branched peptide amphiphiles, related epitope compounds and self assembled structures thereof.
JP4851939B2 (en) 2003-12-05 2012-01-11 ノースウエスタン ユニバーシティ Self-assembling peptide amphiphiles and related methods for growth factor delivery
TWI280280B (en) * 2003-12-09 2007-05-01 Ind Tech Res Inst Culture system and method for expansion and undifferentiated growth of human embryonic stem cells
US20050214257A1 (en) 2003-12-23 2005-09-29 Northwestern University Compositions and methods for controlling stem cell and tumor cell differentiation, growth, and formation
US20050233446A1 (en) * 2003-12-31 2005-10-20 Parsons Xuejun H Defined media for stem cell culture
EP1711053A2 (en) * 2004-02-02 2006-10-18 I.M.T. Interface Multigrad Technology Ltd. Biological material and methods and solutions for preservation thereof
WO2005072790A1 (en) * 2004-02-02 2005-08-11 I.M.T. Interface Multigrad Technology Ltd. Device for directional cooling of biological matter
US20070298453A1 (en) * 2004-02-12 2007-12-27 University Of Newcastle Upon Tyne Stem Cells
US20050214938A1 (en) * 2004-03-26 2005-09-29 Gold Joseph D Cardiac bodies: clusters of spontaneously contracting cells for regenerating cardiac function
US7452718B2 (en) * 2004-03-26 2008-11-18 Geron Corporation Direct differentiation method for making cardiomyocytes from human embryonic stem cells
JP5138367B2 (en) * 2004-05-07 2013-02-06 ウイスコンシン アラムニ リサーチ ファンデーション Method for forming mesenchymal stem cells from embryonic stem cells
ATE460947T1 (en) * 2004-06-07 2010-04-15 Core Dynamics Ltd METHOD FOR STERILIZING BIOLOGICAL PREPARATIONS
US20060068496A1 (en) * 2004-07-29 2006-03-30 Kelly James H Differentiation of stem cells
US8037696B2 (en) * 2004-08-12 2011-10-18 Core Dynamics Limited Method and apparatus for freezing or thawing of a biological material
JP2008511321A (en) * 2004-09-03 2008-04-17 エージェンシー フォー サイエンス,テクノロジー アンド リサーチ Methods for maintaining stem cell / progenitor cell pluripotency
US20060177926A1 (en) * 2004-09-07 2006-08-10 Erika Sasaki Common marmoset embryonic stem cell lines
EP1819809A4 (en) * 2004-09-21 2008-08-06 Nvr Labs Ltd Compositions and methods for stem cell expansion and differentiation
US20070077654A1 (en) * 2004-11-01 2007-04-05 Thomson James A Platelets from stem cells
US9359590B2 (en) * 2004-11-16 2016-06-07 Sydney Ivf Limited Derivation and culture of human embryo-derived cells
ES2537004T3 (en) 2004-11-17 2015-06-01 Neuralstem, Inc. Transplantation of human neural cells for the treatment of neurodegenerative conditions
EP2410043A3 (en) 2004-12-29 2013-01-23 Hadasit Medical Research Services And Development Ltd. Stem cells culture systems
US8597947B2 (en) 2004-12-29 2013-12-03 Hadasit Medical Research Services & Development Limited Undifferentiated stem cell culture systems
NZ555294A (en) * 2005-01-21 2010-07-30 Univ Northwestern Methods and amphiphilic compositions for treating damaged nerve cells
US7022518B1 (en) * 2005-01-31 2006-04-04 Glen Feye Apparatus and method for co-culturing of cells
WO2006084314A1 (en) * 2005-02-09 2006-08-17 Australian Stem Cell Centre Limited Stem cell populations and classification system
US20080160496A1 (en) * 2005-02-22 2008-07-03 Victor Rzepakovsky Preserved Viable Cartilage, Method for Its Preservation, and System and Devices Used Therefor
EP1853917A4 (en) * 2005-03-04 2008-09-10 Univ Northwestern Angiogenic heparin-binding peptide amphiphiles
US20070048865A1 (en) * 2005-03-15 2007-03-01 Kenzaburo Tani Method for acceleration of stem cell differentiation
US9295543B2 (en) 2005-03-17 2016-03-29 Stratatech Corporation Skin substitutes with improved purity
US8012751B2 (en) * 2005-03-31 2011-09-06 Wisconsin Alumni Research Foundation Differentiation of pluripotent embryonic stem cells
US20070026520A1 (en) * 2005-07-29 2007-02-01 Kelly James H Novel cells, compositions, and methods
WO2007015252A2 (en) * 2005-08-03 2007-02-08 I.M.T. Interface Multigrad Technology Ltd. Somatic cells for use in cell therapy
US20090035257A1 (en) 2005-08-25 2009-02-05 Repair Technologies, Inc. Devices, compositions and methods for the protection and repair of cells and tissues
AU2006286149B2 (en) 2005-08-29 2012-09-13 Technion Research And Development Foundation Ltd. Media for culturing stem cells
JP5270362B2 (en) 2005-11-10 2013-08-21 ジェナボン バイオファーマシューティカルズ エルエルシー MNTF differentiation and growth of stem cells
US9155762B2 (en) * 2005-12-08 2015-10-13 University Of Louisville Research Foundation, Inc. Uses and isolation of stem cells from bone marrow
CN101573441A (en) 2005-12-08 2009-11-04 路易斯维尔大学研究基金会有限公司 Very small embryonic-like (vsel) stem cells and methods of isolating and using the same
US8129187B2 (en) * 2005-12-13 2012-03-06 Kyoto University Somatic cell reprogramming by retroviral vectors encoding Oct3/4. Klf4, c-Myc and Sox2
US8278104B2 (en) * 2005-12-13 2012-10-02 Kyoto University Induced pluripotent stem cells produced with Oct3/4, Klf4 and Sox2
ES2367525T3 (en) * 2005-12-13 2011-11-04 Kyoto University CELLULAR REPROGRAMATION FACTOR.
US20090227032A1 (en) * 2005-12-13 2009-09-10 Kyoto University Nuclear reprogramming factor and induced pluripotent stem cells
EP2522352B1 (en) 2006-03-02 2017-01-11 Agency for Science, Technology and Research Methods for stem cells modulation
KR101234544B1 (en) 2006-04-28 2013-03-07 다이이찌 산쿄 가부시키가이샤 Method for differentiation induction of myocardial cell from pluripotent stem cell
US7964402B2 (en) 2006-05-25 2011-06-21 Sanford-Burnham Medical Research Institute Methods for culture and production of single cell populations of human embryonic stem cells
WO2007149926A1 (en) * 2006-06-20 2007-12-27 Wisconsin Alumni Research Foundation Method for culturing stem cells
US20080003676A1 (en) * 2006-06-26 2008-01-03 Millipore Corporation Growth of embryonic stem cells
EP2617428A1 (en) 2006-08-15 2013-07-24 Agency for Science, Technology and Research Mesenchymal stem cell conditioned medium
US20090155225A1 (en) * 2006-11-02 2009-06-18 Mariusz Ratajczak Uses and isolation of very small of embryonic-like (vsel) stem cells
WO2008067142A2 (en) * 2006-11-08 2008-06-05 Wisconsin Alumni Research Foundation In vitro differentiation of hematopoietic cells from primate embryonic stem cells
US7883698B2 (en) * 2007-01-17 2011-02-08 Maria Michejda Isolation and preservation of fetal hematopoietic and mesencymal system cells from non-controversial materials and/or tissues resulting from miscarriages and methods of therapeutic use
CN103627671A (en) * 2007-01-30 2014-03-12 佐治亚大学研究基金会 Method for generating endoderm and mesoderm lineages and multipotent migratory cells (MMC), and cell population and use
DK3399025T3 (en) 2007-03-23 2025-06-16 Wisconsin Alumni Res Found Reprogramming of somatic cells
US8076295B2 (en) * 2007-04-17 2011-12-13 Nanotope, Inc. Peptide amphiphiles having improved solubility and methods of using same
CN103555654B (en) * 2007-04-18 2016-04-20 哈达锡特医学研究服务及发展有限公司 Stem cell-derived retinal pigment epithelium
JP5174019B2 (en) * 2007-06-07 2013-04-03 恵一 福田 Method for inducing differentiation into cardiomyocytes using G-CSF
US9213999B2 (en) * 2007-06-15 2015-12-15 Kyoto University Providing iPSCs to a customer
JP2008307007A (en) * 2007-06-15 2008-12-25 Bayer Schering Pharma Ag Human pluripotent stem cell induced from human tissue-originated undifferentiated stem cell after birth
WO2009006399A1 (en) * 2007-07-01 2009-01-08 Lifescan Single pluripotent stem cell culture
US10925903B2 (en) 2007-09-13 2021-02-23 Reprobiogen Inc. Use of cells derived from first trimester umbilical cord tissue
US12129481B2 (en) 2007-09-13 2024-10-29 Reprobiogen Inc. Use of cells derived from first trimester umbilical cord tissue
US20110236971A2 (en) * 2007-09-25 2011-09-29 Maksym Vodyanyk Generation of Clonal Mesenchymal Progenitors and Mesenchymal Stem Cell Lines Under Serum-Free Conditions
US7615374B2 (en) * 2007-09-25 2009-11-10 Wisconsin Alumni Research Foundation Generation of clonal mesenchymal progenitors and mesenchymal stem cell lines under serum-free conditions
WO2009097411A1 (en) 2008-01-30 2009-08-06 Geron Corporation Synthetic surfaces for culturing stem cell derived cardiomyocytes
WO2009098698A2 (en) 2008-02-07 2009-08-13 Shahar Cohen Compartmental extract compositions for tissue engineering
US20090202978A1 (en) * 2008-02-13 2009-08-13 Ginadi Shaham Method and apparatus for freezing of a biological material
US20100087002A1 (en) * 2008-02-21 2010-04-08 Benjamin Fryer Methods, Surface Modified Plates and Compositions for Cell Attachment, Cultivation and Detachment
DE102008013854A1 (en) * 2008-03-12 2009-09-24 Siemens Aktiengesellschaft Catheter and associated medical examination and treatment facility
SG188918A1 (en) 2008-03-17 2013-04-30 Agency Science Tech & Res
KR101661940B1 (en) 2008-05-02 2016-10-04 고쿠리츠 다이가쿠 호진 교토 다이가쿠 Method of nuclear reprogramming
JP2011522520A (en) * 2008-05-06 2011-08-04 エージェンシー フォー サイエンス,テクノロジー アンド リサーチ Methods for cell dedifferentiation
US20120052003A9 (en) * 2008-05-16 2012-03-01 Szalay Aladar A Microorganisms for preventing and treating neoplasms accompanying cellular therapy
EP2310035B1 (en) 2008-06-16 2015-08-26 University Of Rochester Fibroblast growth factor (fgf) analogs and uses thereof
WO2010008486A2 (en) 2008-06-24 2010-01-21 Parkinsons Institute Pluripotent cell lines and methods of use thereof
US20110305672A1 (en) 2008-07-25 2011-12-15 University Of Georgia Research Foundation, Inc. COMPOSITIONS FOR MESODERM DERIVED ISL1+ MULTIPOTENT CELLS (IMPs), EPICARDIAL PROGENITOR CELLS (EPCs) AND MULTIPOTENT CD56C CELLS (C56Cs) AND METHODS OF PRODUCING AND USING SAME
US8956867B2 (en) * 2008-11-07 2015-02-17 Wisconsin Alumni Research Foundation Method for culturing stem cells
CA2787708A1 (en) 2009-01-22 2010-07-29 Iti Scotland Limited Stem cell culture methods
KR20120012811A (en) * 2009-04-13 2012-02-10 노오쓰웨스턴 유니버시티 Novel peptide-based scaffolds for cartilage regeneration and methods of using them
GB2483195B (en) 2009-06-12 2015-02-11 Nanyang Polytechnic Novel uses
KR101755214B1 (en) 2009-08-12 2017-07-07 고쿠리츠 다이가쿠 호진 교토 다이가쿠 Method for inducing differentiation of pluripotent stem cells into neural precursor cells
US20120148546A1 (en) 2009-08-17 2012-06-14 Technion Research & Development Foundation Ltd. Pericyte progenitor cells and methods of generating and using same
CA3080762A1 (en) 2009-11-12 2011-05-19 Technion Research & Development Foundation Limited Culture media, cell cultures and methods of culturing pluripotent stem cells in an undifferentiated state
FI20096288A0 (en) 2009-12-04 2009-12-04 Kristiina Rajala Formulations and Methods for Culturing Stem Cells
CN102725399B (en) 2009-12-18 2015-03-11 上海赛傲生物技术有限公司 Materials and methods for generating pluripotent stem cells
US8778416B2 (en) 2010-02-10 2014-07-15 Nayacure Therapeutics Ltd. Pharmaceutical compositions and methods for the treatment and prevention of cancer
US8662085B2 (en) 2010-03-02 2014-03-04 Siemens Aktiengesellschaft Magnetic nanoparticle and group of nanoparticles
WO2011128897A1 (en) 2010-04-12 2011-10-20 Technion Research & Development Foundation Ltd. Populations of pancreatic progenitor cells and methods of isolating and using same
CN102242146B (en) * 2010-05-10 2015-11-25 高丽大学校产学协力团 Composition and the method with its generation generate induced pluripotent stem cells
EP2591093B1 (en) 2010-07-07 2018-11-28 FUJIFILM Cellular Dynamics, Inc. Endothelial cell production by programming
US9121011B2 (en) 2010-07-21 2015-09-01 Kyoto University Method for inducing differentiation of human pluripotent stem cell into intermediate mesoderm cell
EP2598634A1 (en) 2010-07-26 2013-06-05 The University Of Manchester Targeted differentiation of stem cells
WO2012014207A2 (en) * 2010-07-27 2012-02-02 Technion Research & Development Foundation Ltd. Method for generating induced pluripotent stem cells from keratinocytes derived from plucked hair follicles
WO2012014205A1 (en) 2010-07-27 2012-02-02 Technion Research & Development Foundation Ltd. Isolated mesenchymal progenitor cells and extracellular matrix produced thereby
CN103237553A (en) 2010-07-28 2013-08-07 神经干细胞公司 Methods for treating and/or reversing neurodegenerative diseases and/or disorders
JP6283223B2 (en) 2010-09-07 2018-02-21 テクニオン リサーチ アンド ディベロップメント ファウンデーション リミテッド Novel method and culture medium for culturing pluripotent stem cells
CA2814860C (en) 2010-10-22 2020-08-25 Biotime Inc. Methods of modifying transcriptional regulatory networks in stem cells
WO2012091978A2 (en) 2010-12-31 2012-07-05 University Of Georgia Research Foundation, Inc. Differentiation of human pluripotent stem cells to multipotent neural crest cells
US9102914B2 (en) 2011-02-03 2015-08-11 Empire Technology Development Llc 3D trophoblast matrix for preparing organ-specific stem cells
EP2673358B1 (en) 2011-02-08 2019-01-09 FUJIFILM Cellular Dynamics, Inc. Hematopoietic precursor cell production by programming
EP2678425B1 (en) 2011-02-23 2017-08-23 Kyoto University Method for producing dendritic cells from pluripotent stem cells
WO2012148549A1 (en) 2011-02-25 2012-11-01 Benaroya Research Institute Detection of an immune response
AU2012225784B2 (en) 2011-03-04 2016-03-17 The Regents Of The University Of California Locally released growth factors to mediate motor recovery after stroke
JP5840855B2 (en) 2011-03-30 2016-01-06 学校法人東京女子医科大学 Method for producing myocardial sheet from embryonic stem cells
JP5745919B2 (en) * 2011-04-28 2015-07-08 浜松ホトニクス株式会社 Cell analysis method, cell analysis apparatus, and cell analysis program
WO2013010045A1 (en) 2011-07-12 2013-01-17 Biotime Inc. Novel methods and formulations for orthopedic cell therapy
JP6063613B2 (en) 2011-08-09 2017-01-18 イェダ リサーチ アンド デベロップメント カンパニー リミテッド Down-regulation of miR-7 to promote beta cell differentiation and insulin production
EP2760995B1 (en) 2011-09-30 2019-08-07 The University Of Miami Renal stem cells isolated from kidney
GB201117469D0 (en) 2011-10-10 2011-11-23 Cell Guidance Systems Ltd Culture media for pluripotent stem cells
JP6162604B2 (en) 2011-10-21 2017-07-12 国立大学法人京都大学 Multi-dispersed monodisperse cell culture method by laminar flow
JP5999658B2 (en) 2011-11-25 2016-09-28 国立大学法人京都大学 Method for culturing pluripotent stem cells
US8497124B2 (en) 2011-12-05 2013-07-30 Factor Bioscience Inc. Methods and products for reprogramming cells to a less differentiated state
RU2624139C2 (en) 2011-12-05 2017-06-30 Фэктор Байосайенс Инк. Methods and formulations for cells transfection
WO2013094771A1 (en) 2011-12-19 2013-06-27 Kyoto University Method for inducing differentiation of human pluripotent stem cells into intermediate mesoderm cells
EP2615176A1 (en) 2012-01-11 2013-07-17 Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe Novel pseudotyped lentiviral particles and their use in the in vitro targeted transduction of undifferentiated pluripotent human embryonic stem cells and induced pluripotent stem cells
WO2013114372A1 (en) 2012-02-01 2013-08-08 Nayacure Therapeutics Ltd. Method for inducing immune tolerance to organ transplants
EP2844745A2 (en) 2012-02-22 2015-03-11 Brainstem Biotec Ltd. Generation of neural stem cells and motor neurons
US9334475B2 (en) 2012-04-06 2016-05-10 Kyoto University Method for inducing erythropoietin-producing cell
EP2925332A4 (en) 2012-08-20 2016-12-21 Boris Markosian PLACENTAL VACCINATION THERAPY AGAINST CANCER
AU2013237760A1 (en) 2012-10-08 2014-04-24 Biotime, Inc. Differentiated progeny of clonal progenitor cell lines
KR102596302B1 (en) 2012-11-01 2023-11-01 팩터 바이오사이언스 인크. Methods and products for expressing proteins in cells
WO2014104409A1 (en) 2012-12-28 2014-07-03 Kyoto University Method for inducing astrocytes
US20160002599A1 (en) 2013-02-08 2016-01-07 Kyoto University Production methods for megakaryocytes and platelets
JP2016508726A (en) 2013-02-22 2016-03-24 セルラー ダイナミクス インターナショナル, インコーポレイテッド Production of hepatocytes via forward programming with combined genetic and chemical manipulation
US9738861B2 (en) 2013-03-06 2017-08-22 Kyoto University Culture system for pluripotent stem cells and method for subculturing pluripotent stem cells
SG11201507829SA (en) 2013-03-21 2015-12-30 Univ Kyoto Pluripotent stem cell for neuronal differentiation induction
JP6473686B2 (en) 2013-03-25 2019-02-20 公益財団法人神戸医療産業都市推進機構 Cell sorting method
US10266807B2 (en) 2013-04-03 2019-04-23 FUJIFILM Cellular Dynamics, Inc. Methods and compositions for culturing endoderm progenitor cells in suspension
JP6416206B2 (en) 2013-04-10 2018-10-31 エージェンシー フォー サイエンス,テクノロジー アンド リサーチ Polycaprolactone microcarriers for stem cell culture and their production
US10961508B2 (en) 2013-04-12 2021-03-30 Kyoto University Method for inducing alveolar epithelial progenitor cells
US10920192B2 (en) 2013-04-23 2021-02-16 Yeda Research And Development Co. Ltd. Isolated naive pluripotent stem cells and methods of generating same
JP6429280B2 (en) 2013-05-14 2018-11-28 国立大学法人京都大学 Efficient cardiomyocyte induction method
TWI629360B (en) 2013-06-11 2018-07-11 國立大學法人京都大學 Method for producing kidney precursor cells and medicine containing kidney precursor cells
US10240126B2 (en) 2013-06-12 2019-03-26 Kyoto University Induced pluripotent stem cell selection method and method for inducing differentiation to blood cells
WO2015020113A1 (en) 2013-08-07 2015-02-12 国立大学法人京都大学 Method for producing pancreatic hormone-producing cell
US9765296B2 (en) 2013-09-04 2017-09-19 Otsuka Pharmaceutical Factory, Inc. Method for preparing pluripotent stem cells
DK3042951T3 (en) 2013-09-05 2019-04-15 Univ Kyoto UNKNOWN PROCEDURE FOR INducing DOPAMINE-PRODUCING NEURAL PRECURSOR CELLS
KR20160058822A (en) 2013-10-01 2016-05-25 카디마스템 리미티드 Directed differentiation of astrocytes from human pluripotent stem cells for use in drug screening and the treatment of amyotrophic lateral sclerosis (als)
KR102219743B1 (en) 2013-11-01 2021-02-23 고쿠리츠 다이가쿠 호진 교토 다이가쿠 Novel chondrocyte induction method
BR112016012129A8 (en) 2013-12-11 2020-05-12 Pfizer Ltd methods for the production, expansion and purification of retinal pigment epithelial cells, pharmaceutical composition and use of cells
EP2896688A1 (en) 2014-01-20 2015-07-22 Centre National de la Recherche Scientifique (CNRS) A method of producing beta pancreatic cells from progenitor cells through the use of hydrogen peroxide
RU2020104969A (en) 2014-01-31 2020-03-13 Фэктор Байосайенс Инк. METHODS AND PRODUCTS FOR THE PRODUCTION AND DELIVERY OF NUCLEIC ACIDS
WO2015140257A1 (en) 2014-03-19 2015-09-24 INSERM (Institut National de la Santé et de la Recherche Médicale) A method for inducing human cholangiocyte differentiation
WO2015140005A1 (en) 2014-03-19 2015-09-24 Ifom Fondazione Istituto Firc Di Oncologia Molecolare Method of generation of pluripotent cells
US20170107486A1 (en) 2014-04-21 2017-04-20 Cellular Dynamics International, Inc. Hepatocyte production via forward programming by combined genetic and chemical engineering
EP3149155B1 (en) 2014-06-02 2020-09-23 Kadimastem Ltd. Methods of inducing myelination and maturation of oligodendrocytes
EP3929302A1 (en) 2014-07-14 2021-12-29 Chugai Seiyaku Kabushiki Kaisha Method for identifying epitope on protein
CN108064274A (en) 2014-07-30 2018-05-22 耶达研究及发展有限公司 For cultivating the culture medium of multipotential stem cell
WO2016044721A1 (en) 2014-09-19 2016-03-24 Regenerative Medical Solutions, Inc. Compositions and methods for differentiating stem cells into cell populations comprising beta-like cells
WO2016061071A1 (en) 2014-10-14 2016-04-21 Cellular Dynamics International, Inc. Generation of keratinocytes from pluripotent stem cells and mantenance of keratinocyte cultures
CN107148275A (en) 2014-10-20 2017-09-08 神经干细胞公司 Stable neural stem cells comprising exogenous polynucleotides encoding growth factors and methods of use thereof
EP3220945A2 (en) 2014-11-17 2017-09-27 Yeda Research and Development Co., Ltd. Methods of treating diseases related to mitochondrial function
GB2548740A (en) 2014-11-25 2017-09-27 Harvard College Methods for generation of podocytes from pluripotent stem cells and cells produced by the same
RU2017125728A (en) 2014-12-19 2019-01-22 Янссен Байотек, Инк. CULTIVATION OF PLURIPOTENT STEM CELLS IN SUSPENSION
WO2016103269A1 (en) 2014-12-23 2016-06-30 Ramot At Tel-Aviv University Ltd. Populations of neural progenitor cells and methods of producing and using same
IL314417A (en) 2014-12-30 2024-09-01 Cell Cure Neurosciences Ltd Examination of retinal pigment epithelial cell populations
DK3240892T5 (en) 2014-12-30 2020-10-19 Cell Cure Neurosciences Ltd RPE CELL POPULATIONS AND METHODS FOR EACHING THEM
WO2016118824A1 (en) 2015-01-22 2016-07-28 Regenerative Medical Solutions, Inc. Markers for differentiation of stem cells into differentiated cell populations
AU2016218977C1 (en) 2015-02-13 2023-03-23 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof
LT3059307T (en) 2015-02-20 2019-01-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of a laminin for differentiating pluripotent cells into hepatocyte lineage cells
CA2978870C (en) 2015-03-06 2024-06-25 Kyoto University Method for inducing differentiation of alveolar epithelial cells
JP6847044B2 (en) 2015-03-11 2021-03-24 シーシーエス・ベンチャーズ・リミテッド Pancreatic endocrine progenitor cell therapy for the treatment of obesity and type 2 diabetes (T2D)
WO2016185457A1 (en) 2015-05-19 2016-11-24 Yeda Research And Development Co. Ltd. Methods of promoting lymphangiogenesis
US10669529B2 (en) 2015-07-17 2020-06-02 Kyoto University Method for inducing vascular endothelial cells
JP7055095B2 (en) 2015-07-29 2022-04-15 ハダシット メディカル リサーチ サービシーズ アンド ディベロップメント リミテッド Large-scale production of retinal pigment epithelial cells
CN108138145A (en) 2015-08-05 2018-06-08 细胞治疗神经科学有限公司 For treating the preparation of the photoreceptor of retinal disease
CA2993912A1 (en) 2015-08-05 2017-02-09 Cell Cure Neurosciences Ltd. Preparation of retinal pigment epithelium cells
US11312940B2 (en) 2015-08-31 2022-04-26 University Of Louisville Research Foundation, Inc. Progenitor cells and methods for preparing and using the same
CA2998096C (en) 2015-09-11 2024-01-30 Astellas Pharma Inc. Method for producing renal progenitor cells
ES3018474T3 (en) 2015-10-26 2025-05-16 Cell Cure Neurosciences Ltd Preparation of retinal pigment epithelial cells
NZ742327A (en) 2015-11-18 2020-01-31 Aruna Biomedical Inc Neural cell extracellular vessicles
WO2017091844A1 (en) 2015-12-04 2017-06-08 Bond University Ltd Methods of differentiating retinal cells
US11072777B2 (en) 2016-03-04 2021-07-27 University Of Louisville Research Foundation, Inc. Methods and compositions for ex vivo expansion of very small embryonic-like stem cells (VSELs)
WO2017153982A1 (en) 2016-03-06 2017-09-14 Yeda Research And Development Co. Ltd. Method for modulating myelination
JP7011260B2 (en) 2016-04-22 2022-02-10 国立大学法人京都大学 Method for producing dopamine-producing neural progenitor cells
MA45502A (en) 2016-06-21 2019-04-24 Janssen Biotech Inc GENERATION OF FUNCTIONAL BETA CELLS DERIVED FROM HUMAN PLURIPOTENT STEM CELLS WITH GLUCOSE-DEPENDENT MITOCHONDRIAL RESPIRATION AND TWO-PHASE INSULIN SECRETION RESPONSE
US20200308548A1 (en) 2016-07-01 2020-10-01 Centre National De La Recherche Scientifique (Cnrs) Amplifying Beta Cell Differentiation with Small Molecules BET (Bromodomain And Extraterminal Family Of Bromodomain-Containing Proteins) Inhibitors
IL264439B2 (en) 2016-08-17 2024-08-01 Factor Bioscience Inc non-viral, cell-free composition comprising a synthetic messenger RNA (MRNA) encoding a gene-editing protein for use in treating cancer, and a synthetic RNA encoding a gene-editing protein for use in treatment
CA3042495A1 (en) 2016-11-10 2018-05-17 Viacyte, Inc. Pdx1 pancreatic endoderm cells in cell delivery devices and methods thereof
US12281328B2 (en) 2017-02-08 2025-04-22 Hadasit Medical Research Services And Development Ltd. Photoreceptor cells for the treatment of retinal diseases
WO2018170494A1 (en) 2017-03-16 2018-09-20 Bio Time, Inc. Methods for measuring therapeutic effects of retinal disease therapies
EP3601530A1 (en) 2017-03-20 2020-02-05 IFOM Fondazione Istituto Firc di Oncologia Molecolare Method of generating 2 cell-like stem cells
CN110913689A (en) 2017-05-10 2020-03-24 罗切斯特大学 Methods of treating neuropsychiatric disorders
US20200172969A1 (en) 2017-06-19 2020-06-04 Foundation For Biomedical Research And Innovation At Kobe Method for predicting differentiation ability of pluripotent stem cell, and reagent for same
EP3700543A4 (en) 2017-10-24 2021-08-25 Elani, Dalia METHOD OF TREATMENT OF ISCHEMIC DISEASE
EP3731789A4 (en) 2017-12-29 2021-09-08 Cell Cure Neurosciences Ltd. RETINAL PIGMENT EPITHELIAL COMPOSITIONS
TWI820104B (en) 2018-03-30 2023-11-01 日商千紙鶴治療公司 Heterocyclic compound
WO2019189554A1 (en) 2018-03-30 2019-10-03 国立大学法人京都大学 Cardiomyocyte maturation promoter
US12421501B2 (en) 2018-04-16 2025-09-23 Wisconsin Alumni Research Foundation Chemically defined differentiation protocol for pericyte differentiation from pluripotent stem cells
JP7285015B2 (en) 2018-07-19 2023-06-01 国立大学法人京都大学 Lamellar cartilage derived from pluripotent stem cells and method for producing the same
WO2020022261A1 (en) 2018-07-23 2020-01-30 国立大学法人京都大学 Novel renal progenitor cell marker and method for concentrating renal progenitor cells using same
US20220010283A1 (en) 2018-10-31 2022-01-13 Kyoto University Method for producing pluripotent stem cell having released differentiation resistance to mesendoderm
US12371668B2 (en) 2018-11-28 2025-07-29 Milica Radisic Methods for tissue generation
WO2020130147A1 (en) 2018-12-21 2020-06-25 国立大学法人京都大学 Lubricin-localized cartilage-like tissue, method for producing same and composition comprising same for treating articular cartilage damage
WO2020152686A1 (en) 2019-01-23 2020-07-30 Yeda Research And Development Co. Ltd. Culture media for pluripotent stem cells
AU2020221966B2 (en) 2019-02-13 2025-07-31 Takeda Pharmaceutical Company Limited Cryopreservation of stem cells
EP3931307A1 (en) 2019-02-27 2022-01-05 TiGenix, S.A.U. Improved stem cell populations for allogeneic therapy
JP7533896B2 (en) 2019-03-29 2024-08-14 公立大学法人横浜市立大学 Screening methods and toxicity evaluation methods
CN114144514A (en) 2019-05-09 2022-03-04 富士胶片细胞动力公司 Methods of producing hepatocytes
JP7664856B2 (en) 2019-05-22 2025-04-18 ハダシット メディカル リサーチ サービシーズ アンド ディベロップメント リミテッド Methods for culturing human pluripotent cells
EP3754014A1 (en) 2019-06-21 2020-12-23 Centre d'Etude des Cellules Souches (CECS) Automated method for preparing retinal pigment epithelium cells
MX2022000183A (en) 2019-07-03 2022-05-20 Factor Bioscience Inc CATIONIC LIPIDS AND USES OF THESE.
US10501404B1 (en) 2019-07-30 2019-12-10 Factor Bioscience Inc. Cationic lipids and transfection methods
BR112022009181A2 (en) 2019-11-25 2022-07-26 Univ Kyoto SYSTEM FOR PROVIDING A T-CELL PRODUCT, METHODS FOR PRODUCING A T-CELL PRODUCT, FOR BUILDING A CELL BANK AND A T-CELL PRODUCT COLLECTION, AND FOR PROVIDING A T-CELL PRODUCT, CELL BANK, CELL BANK AND CELL PRODUCT COLLECTIONS T, E CELL, T CELL PRODUCT
WO2021105404A1 (en) 2019-11-29 2021-06-03 Novadip Biosciences Biomaterials for the prevention and the treatment of tissue disorders
WO2021105407A1 (en) 2019-11-29 2021-06-03 Novadip Biosciences miRNA-BASED PHARMACEUTICAL COMPOSITIONS AND USES THEREOF FOR THE PREVENTION AND THE TREATMENT OF TISSUE DISORDERS
US20230030814A1 (en) 2019-12-12 2023-02-02 National University Corporation Chiba University Freeze-Dried Preparations Comprising Megakaryocytes and Platelets
EP3875581A1 (en) 2020-03-02 2021-09-08 Centre d'Etude des Cellules Souches (CECS) Automated method for preparing keratinocytes
EP3875580A1 (en) 2020-03-02 2021-09-08 Centre d'Etude des Cellules Souches (CECS) Methods for preparing keratinocytes
CA3170705A1 (en) 2020-03-13 2021-09-16 Goliver Therapeutics Hepatic stem-like cells for the treatment and/or the prevention of fulminant liver disorders
CA3175573A1 (en) 2020-03-19 2021-09-23 Orizuru Therapeutics, Inc. Cardiomyocyte purification method
EP4123016A4 (en) 2020-03-19 2024-06-19 Orizuru Therapeutics, Inc. Method for purifying cardiomyocytes
WO2021205459A1 (en) 2020-04-07 2021-10-14 Ramot At Tel-Aviv University Ltd. Cannabidiol-containing compositions and uses thereof
EP4180516A4 (en) 2020-07-13 2024-01-17 Kyoto University Skeletal muscle precursor cells and method for purifying same, composition for treating myogenic diseases, and method for producing cell group containing skeletal muscle precursor cells
US20230399622A1 (en) 2020-10-16 2023-12-14 Fundació Centre De Regulació Genòmica Therapy for degenerative disease and tissue damage
EP4005577A1 (en) 2020-11-26 2022-06-01 Novadip Biosciences Cellular and/or extracellular extracts for preventing and/or treating cancer and/or inflammation
JP7734154B2 (en) 2020-12-23 2025-09-04 三井化学株式会社 Culture material and its uses
MX2023013079A (en) 2021-05-03 2023-11-16 Astellas Inst For Regenerative Medicine Methods of generating mature corneal endothelial cells.
JP2024518409A (en) 2021-05-07 2024-05-01 アステラス インスティテュート フォー リジェネラティブ メディシン Methods for producing mature hepatocytes
US20240271099A1 (en) 2021-06-07 2024-08-15 Institut National de la Santé et de la Recherche Médicale Method for generating highly functional hepatocytes by differentiating hepatoblasts
WO2022261320A1 (en) 2021-06-09 2022-12-15 Lineage Cell Therapeutics, Inc. Methods and compositions for treating retinal diseases and conditions
CA3225834A1 (en) 2021-07-28 2023-02-02 Lineage Cell Therapeutics, Inc. Expansion of retinal pigment epithelium cells
WO2023069881A1 (en) 2021-10-20 2023-04-27 University Of Rochester Treatment with genetically modified cells, and genetically modified cells per se, with increased competitive advantage and/or decreased competitive disadvantage
EP4419665A1 (en) 2021-10-20 2024-08-28 University of Rochester Rejuvenation treatment of age-related white matter loss
EP4440637A1 (en) 2021-11-29 2024-10-09 Ramot at Tel-Aviv University Ltd. Methods and compositions for treating spinal cord injury
US20250145948A1 (en) 2022-02-09 2025-05-08 Sumitomo Pharma Co., Ltd. Method for assessing differentiation potential of cells in culture broth in differentiation of pluripotent stem cells into neural cells of midbrain floor plate region
JP2025514145A (en) 2022-04-25 2025-05-02 ハダシット メディカル リサーチ サービシーズ アンド ディベロップメント リミテッド Methods and Compositions for Treating Vision Loss
US20250276020A1 (en) 2022-05-05 2025-09-04 University Of Rochester Dual macroglial-microglial approach towards therapeutic cell replacement in neurodegenerative and neuropsychiatric disease
KR20250054819A (en) 2022-09-30 2025-04-23 후지필름 가부시키가이샤 Human astrocyte cell population, cell population culture, method for preparing human astrocyte cell population, and method for evaluating test material
EP4382111A1 (en) 2022-12-09 2024-06-12 The University Court Of The University of Edinburgh Extracellular vesicles that promote angiogenesis or neovascularisation
WO2024163747A2 (en) 2023-02-02 2024-08-08 University Of Rochester Competitive replacement of glial cells
WO2025012776A1 (en) 2023-07-07 2025-01-16 Aruna Bio, Inc. Extracellular vesicles for treatment of amyotrophic lateral sclerosis
WO2025083169A1 (en) 2023-10-17 2025-04-24 Tenpoint Therapeutics Limited Combination of a vegf inhibitor and a complement pathway inhibitor for treating ocular disorders

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5061620A (en) 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
US5166065A (en) 1988-08-04 1992-11-24 Amrad Corporation Limited In vitro propagation of embryonic stem cells
WO1994003585A1 (en) 1992-08-04 1994-02-17 Commonwealth Scientific And Industrial Research Organisation A method for maintaining embryonic stem cells and avian factor useful for same
US5340740A (en) 1992-05-15 1994-08-23 North Carolina State University Method of producing an avian embryonic stem cell culture and the avian embryonic stem cell culture produced by the process
US5449620A (en) 1994-01-25 1995-09-12 Thomas Jefferson University Apparatus and method for culturing embryonic stem cells
US5453357A (en) 1992-10-08 1995-09-26 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US5523226A (en) * 1993-05-14 1996-06-04 Biotechnology Research And Development Corp. Transgenic swine compositions and methods
US5589376A (en) 1992-07-27 1996-12-31 California Institute Of Technology Mammalian neural crest stem cells
US5591625A (en) 1993-11-24 1997-01-07 Case Western Reserve University Transduced mesenchymal stem cells
US5843780A (en) * 1995-01-20 1998-12-01 Wisconsin Alumni Research Foundation Primate embryonic stem cells

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3060078A (en) * 1960-12-02 1962-10-23 Burlington Industries Inc Bonding of polyethylene terephthalate fibers to certain rubbers
BE637575A (en) * 1962-09-21 1900-01-01
US20030032178A1 (en) * 1988-08-04 2003-02-13 Williams Robert Lindsay In vitro propagation of embryonic stem cells
JP2750464B2 (en) * 1990-01-30 1998-05-13 日本ゼオン株式会社 Method for producing fiber-rubber composite
US5690926A (en) * 1992-10-08 1997-11-25 Vanderbilt University Pluripotential embryonic cells and methods of making same
US5541081A (en) * 1994-03-22 1996-07-30 President And Fellows Of Harvard College Process for assessing oocyte and embryo quality
JP3496292B2 (en) * 1994-09-30 2004-02-09 日本ゼオン株式会社 Composites of nitrile group-containing highly saturated copolymer rubber and fiber
US5654099A (en) * 1996-02-21 1997-08-05 Dayco Products, Inc. Method of improving adhesion between alkylated chlorosulfonated polyethylene (ACSM) or chlorosulfonated polyethylene (CSM), and resorcinol formaldehyde latex (RFL) treated polyester cord
EP1315835A2 (en) * 2000-08-01 2003-06-04 Yissum Research Development Company of the Hebrew University of Jerusalem Directed differentiation of embryonic cells
US20070077654A1 (en) * 2004-11-01 2007-04-05 Thomson James A Platelets from stem cells

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5166065A (en) 1988-08-04 1992-11-24 Amrad Corporation Limited In vitro propagation of embryonic stem cells
US5061620A (en) 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
US5340740A (en) 1992-05-15 1994-08-23 North Carolina State University Method of producing an avian embryonic stem cell culture and the avian embryonic stem cell culture produced by the process
US5589376A (en) 1992-07-27 1996-12-31 California Institute Of Technology Mammalian neural crest stem cells
WO1994003585A1 (en) 1992-08-04 1994-02-17 Commonwealth Scientific And Industrial Research Organisation A method for maintaining embryonic stem cells and avian factor useful for same
US5453357A (en) 1992-10-08 1995-09-26 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US5523226A (en) * 1993-05-14 1996-06-04 Biotechnology Research And Development Corp. Transgenic swine compositions and methods
US5591625A (en) 1993-11-24 1997-01-07 Case Western Reserve University Transduced mesenchymal stem cells
US5449620A (en) 1994-01-25 1995-09-12 Thomas Jefferson University Apparatus and method for culturing embryonic stem cells
US5843780A (en) * 1995-01-20 1998-12-01 Wisconsin Alumni Research Foundation Primate embryonic stem cells

Non-Patent Citations (35)

* Cited by examiner, † Cited by third party
Title
Andrews, P., et al., "Cell lines from human germ cell tumours," Teratocarcinoms and Embryonic Stem Cells; A Practical Approach, Oxford: 1RL Press, Ch. 8:207-248 (1987).
Andrews, P., et al., "Pluripotent Embryonal Carcinoma Clones Derived from the Human Teratocarcinoma Cell Line Tera-2," Lab. Invest., 50(2):147-162 (1984).
Associated Press Milwaukee Journal Article dated Nov. 4, 1994 "Embryonic Monkey Cells Isolated" (Nov. 4, 1994).
Bongso, A., et al., "Isolation and culture of inner cell mass cells from human blastocysts," Human Reprod., 9(1):2110-2117 (1994).
Bongso, A., et al., "The Growth of Inner Cell Mass Cells from Human Blastocysts," Theriogenology, 41:167 (1994).
Brown, D.G., et al., "Criteria that Optimize the Potential of Murine Embryonic Stem Cells for In Vitro and In Vivo Developmental Studies," In Vitro Cell. Dev. Bio., 28(A)773-778 (Nov., Dec. 1992).
Clark et al. Germ line manipulation: applications in agriculture and biotechnology. Transgenic Animals. Grosveld et al. eds. p. 250, 1993. *
Cruz et al. Origin of Embryonic and Extraembryonic Cell Lineages in Mammalian Embryos. Current Communications, vol. 4, pp. 147-204, 1991. *
Damjanov, Ivan., et al., Retinoic Acid-Induced Differentiation of the Developmentally Pluripotent Human Germ Cell Tumor-Derived Cell Line, NCCIT, Laboratory Investigation, 68(2):220-232 (1993).
Doetschman, T., et al., "The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium," J. Embryol. exp. Morph., 87:27-45 (1985).
Doetschman, T., et al., Establishment Of Hamster Blastocyst-Derived Embryonic Stem (ES) Cells, Developmental Biology, 127:224-227 (1988).
Evans, M., et al., "Derivation and Preliminary Characterization of Pluripotent Cell Lines from Porcine and Bovine Blastocysts," Theriogenology, 33(1):125-128 (1990).
Evans, M., et al., "Establishment in culture of pluripotential cells from mouse embryos," Nature, 292:154-156 (1981).
Giles, J., et al., "Pluripotency of Cultured Rabbit Inner Cell Mass Cells Detected by Isozyme Analysis and Eye Pigmentation of Fetuses Following Injection into Blastocysts or Morulae," Mol. Reprod. Dev., 36:130-138 (1993).
Golos, T., et al., "Cloning of Four Growth Hormone/Chorionic Somatomammotropin-related Complementary Deoxyribonucleic Acids Differentially Expressed during Pregnancy in the Rhesus Monkey Placenta," Endocrinology, 133(4):1744-1752 (1993).
Graves, K., et al., "Derivation and Characterization of Putative Pluripotential Embryonic Stem Cells from Preimplantation Rabbit Embryos," Mol. Reprod. Dev., 36:424-433 (1993).
Lapidot, T., et al., "Modeling Human Hematopoiesis in Immunodeficient Mice," Lab. Animal Sci., 43(2):147-149 (1993).
Marshall, E., "Rules on Embryo Research Due Out," Science, 265:1024-1026 (1994).
Nichols et al. Establishment of germ-line-competent embryonic stem (ES) cells using differentiation inhibiting activity. Development, vol. 110, pp. 1341-1348, 1990. *
Notarianni, E., et al., "Derivation Of Pluripotent, Embryonic Cell Lines From The Pig And Sheep," J. Rep. & Fert. 43 255-260 (1991).
Notarianni, E., et al., "Maintenance and differentiation in culture of pluripotential embryonic cell lines from pig blastocysts," J. Reprod. Fert. Suppl., 41:51-56 (1990).
Piedrahita, et al., "On The Isolation Of Embryonic Stem Cells: Comparative Behavior Of Murine, Porcine And Ovine Embryos," Theriogenology, 34(5):879-901 (1990).
Piedrahita, J. Dissertation On "Studies On The Isolation Of Embryonic Stem (ES) Cells: Comparative Behavior Of Murine, Porcine, And Ovine Species," University of California Davis, 1989.
Rossant, J., et al., "The relationship between embryonic, embryonal carcinoma and embryo-derived stem cells," Cell Diff., 15:155-161 (1984).
Seshagiri, P., et al., "Non-Surgical Uterine Flushing for the Recovery of Preimplantation Embryos in Rhesus Monkeys: Lack of Seasonal Infertility," Am. J. Primatol., 29:81-91 (1993).
Strojek, R. et al., "A Method For Cultivating Morphologically Undifferentiated Embryonic Stem Cells From Porcine Blastocysts," Theriogenology 33 901-913 (1990 .
Sukoyan, M., et al., "Embryonic Stem Cells Derived from Morulae, Inner Cell Mass, and Blastocysts of Mink: Comparisons of Their Pluripotencies," Mol. Reprod. Deve., 36:148-158 (1993).
Sukoyan, M., et al., "Isolation and Cultivation of Blastocyst-derived Stem Cell Lines from American Mink (Mustela vision)," Mol. Reprod. Dev., 33:418-431 (1992).
Talbot, et al. "Culturing The EpiBlast Cells Of The Pig Blastocyst", , In Vitro Cell. Dev. Bio., 29(A):543-554 (1993).
Thomson et al. Embryonic Stem Cell Lines Derived from Human Blastocysts. Science, vol. 282, pp. 1145-1147, Nov. 6, 1998. *
Thomson, J., et al., "Nonsurgical uterine stage preimplantation embryo collection from the common marmoset," J. Med. Primatol., 23:333-336 (1994).
Thomson, James A., et al., "Pluripotent Cell Lines Derived from Common Marmoset (Callithrix jacchus) Blastocysts," Biology of Reproduction, 55:254-259 (1996).
Ware, et al., "Development Of Embryonic Stem Cell Lines From Farm Animals", Biol. Reprod., 38(Suppl. 1):129 (1988).
Wenk, J., et al., "Glycolipods of Germ Cell Tumors: Extended Globo-series Glycolipods are a Hallmark of Human Embryonal Carcinoma Cells," Int. J. Can, 58:108-115 (1994).
Williams, R., et al., "Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells," Nature, 336:684-692 (1988).

Cited By (1106)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030064512A1 (en) * 1988-08-04 2003-04-03 Williams Robert Lindsay In vitro propagation of embryonic stem cells
US7186883B2 (en) * 1988-08-04 2007-03-06 Zenyth Operations Pty Ltd. In vitro propagation of embryonic stem cells
US20040071672A1 (en) * 1992-10-08 2004-04-15 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US20070178590A1 (en) * 1992-10-08 2007-08-02 Hogan Brigid L M Pluripotential embryonic stem cells and methods of making same
US7153684B1 (en) 1992-10-08 2006-12-26 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
US20050158854A1 (en) * 1995-01-20 2005-07-21 Thomson James A. Primate embryonic stem cells
US8273569B2 (en) 1995-01-20 2012-09-25 Wisconsin Alumni Research Foundation Preparation of human embryonic stem cells
US7582479B2 (en) 1995-01-20 2009-09-01 Wisconsin Alumni Research Foundation Primate embryonic stem cell line
US20030008392A1 (en) * 1995-01-20 2003-01-09 Thomson James A. Primate embryonic stem cells
US7029913B2 (en) * 1995-01-20 2006-04-18 Wisconsin Alumni Research Foundation Primate embryonic stem cells
US20060040383A1 (en) * 1995-01-20 2006-02-23 Thomson James A Primate embryonic stem cells
US7410773B2 (en) 1995-02-02 2008-08-12 Ghazi Jaswinder Dhoot Method of preparing an undifferentiated cell
US7220412B2 (en) 1995-02-02 2007-05-22 Ghazi Jaswinder Dhoot Method of preparing an undifferentiated cell
US20030166272A1 (en) * 1995-02-02 2003-09-04 Abuljadayel Ilham Saleh Method of preparing an undifferentiated cell
US9068164B1 (en) 1995-02-02 2015-06-30 Tristem Trading (Cyprus) Limited Method of preparing an undifferentiated cell
US7112440B2 (en) 1995-02-02 2006-09-26 Ghazi Jaswinder Dhoot Method of increasing the relative number of CD45 low cells in a cell population
US20110143431A1 (en) * 1995-02-02 2011-06-16 Ilham Saleh Abuljadayel Method Of Preparing An Undifferentiated Cell
US7371374B2 (en) 1995-09-12 2008-05-13 Reneuron Limited Neural transplantation using pluripotent neuroepithelial cells
US20060051326A1 (en) * 1995-09-12 2006-03-09 John Sinden Neural transplantation using pluripotent neuroepithelial cells
US7048921B2 (en) 1995-09-12 2006-05-23 Reneuron Limited Neural transplantation using pluripotent neuroepithelial cells
US20030147873A1 (en) * 1995-09-12 2003-08-07 John Sinden Neural transplantation using pluripotent neuroepithelial cells
US20010001662A1 (en) * 1995-09-12 2001-05-24 John Sinden Neural transplantation using pluripotent neuroepithelial cells
US20030229908A1 (en) * 1996-08-19 2003-12-11 Advanced Cell Technology Embryonic or stem-like cell lines produced by cross species nuclear transplantation and methods for enhancing embryonic development by genetic alteration of donor cells or by tissue culture conditions
US7696404B2 (en) * 1996-08-19 2010-04-13 Advanced Cell Technology, Inc. Embryonic or stem-like cell lines produced by cross species nuclear transplantation and methods for enhancing embryonic development by genetic alteration of donor cells or by tissue culture conditions
US6562619B1 (en) * 1997-03-31 2003-05-13 The Johns Hopkins University School Of Medicine Differentiation of human embryonic germ cells
US8846387B2 (en) 1997-04-24 2014-09-30 The University Of Washington Targeted gene modification by parvoviral vectors
US7972856B2 (en) 1997-04-24 2011-07-05 The University Of Washington Targeted gene modification by parvoviral vectors
US20110097804A1 (en) * 1997-04-24 2011-04-28 University Of Washington Targeted gene modification by parvoviral vectors
US7413902B2 (en) 1997-10-23 2008-08-19 Geron Corporation Feeder-free culture method for embryonic stem cells or primate primordial stem cells
US6800480B1 (en) 1997-10-23 2004-10-05 Geron Corporation Methods and materials for the growth of primate-derived primordial stem cells in feeder-free culture
US20050096274A1 (en) * 1998-04-07 2005-05-05 Lough John W. Bone morphogenetic protein and fibroblast growth factor compositions and methods for the induction of cardiogenesis
US6630349B1 (en) * 1998-09-23 2003-10-07 Mount Sinai Hospital Trophoblast cell preparations
US20050191742A1 (en) * 1998-09-23 2005-09-01 Mount Sinai Hospital Trophoblast cell preparations
US7413904B2 (en) 1998-10-23 2008-08-19 Geron Corporation Human embryonic stem cells having genetic modifications
US20100203633A1 (en) * 1998-10-23 2010-08-12 Ramkumar Mandalam Culture System for Rapid Expansion of Human Embryonic Stem Cells
US8097458B2 (en) 1998-10-23 2012-01-17 Geron Corporation Micro-carrier culture system for rapid expansion of human embryonic stem cells
US20050164385A1 (en) * 1998-10-23 2005-07-28 Gold Joseph D. Embryonic stem cells having genetic modifications
US20080299582A1 (en) * 1998-10-23 2008-12-04 Geron Corporation Culture System for Rapid Expansion of Human Embryonic Stem Cells
US20100317101A1 (en) * 1998-10-23 2010-12-16 Geron Corporation Culture System for Rapid Expansion of Human Embryonic Stem Cells
US8637311B2 (en) 1998-10-23 2014-01-28 Asterias Biotherapeutics, Inc. Human embryonic stem cells genetically modified to contain a nucleic acid and cultured with fibroblast growth factor
US8951800B2 (en) 1998-10-23 2015-02-10 Asterias Biotherapeutics, Inc. Primate pluripotent stem cell expansion without feeder cells and in the presence of FGF and matrigel or Engelbreth-Holm-Swarm tumor cell preparation
US10059939B2 (en) 1998-10-23 2018-08-28 Asterias Biotherapeutics, Inc. Screening methods for human embryonic stem cells
US20020160509A1 (en) * 1998-11-09 2002-10-31 Reubinoff Benjamin Eithan Embryonic stem cells
US6875607B1 (en) * 1998-11-09 2005-04-05 Es Cell International Pte Ltd Embryonic stem cells
US20050164383A1 (en) * 1998-11-09 2005-07-28 Reubinoff Benjamin E. Embryonic stem cells
US6569421B2 (en) 1999-03-29 2003-05-27 Reneuron Limited Treatment of brain damage
US7247298B2 (en) 1999-03-29 2007-07-24 Reneuron Limited Treatment of brain damage
US20030108535A1 (en) * 1999-03-29 2003-06-12 Helen Hodges Treatment of brain damage
US9458425B1 (en) * 1999-05-14 2016-10-04 Technion Research And Development Foundation Ltd. Differentiated human embryoid cells and a method for producing them
US7659118B2 (en) 1999-08-05 2010-02-09 Abt Holding Company Multipotent adult stem cells
US8252280B1 (en) 1999-08-05 2012-08-28 Regents Of The University Of Minnesota MAPC generation of muscle
US10226485B2 (en) 1999-08-05 2019-03-12 Abt Holding Company Multipotent adult stem cells and methods for isolation
US7015037B1 (en) 1999-08-05 2006-03-21 Regents Of The University Of Minnesota Multiponent adult stem cells and methods for isolation
US20050181502A1 (en) * 1999-08-05 2005-08-18 Athersys, Inc. Multipotent adult stem cells and methods for isolation
US9249388B2 (en) 1999-10-28 2016-02-02 University Of Massachusetts Gynogenetic or androgenetic production of pluripotent cells and cell lines, and use thereof to produce differentiated cells and tissues
US20040014206A1 (en) * 1999-10-28 2004-01-22 Robl James M. Gynogenetic or androgenetic production of pluripotent cells and cell lines, and use thereof to produce differentiated cells and tissues
US20080075702A1 (en) * 1999-10-28 2008-03-27 University Of Massachusetts, As Represented By Its Amherst Campus Gynogenetic or androgenetic production of pluripotent cells and cell lines, and use thereof to produce differentiated cells and tissues
US8273571B2 (en) 1999-10-28 2012-09-25 Advanced Cell Technology, Inc. Gynogenetic or androgenetic production of pluripotent cells and cell lines, and use thereof to produce differentiated cells and tissues
US7951591B2 (en) 1999-10-28 2011-05-31 Advanced Cell Technology, Inc. Gynogenetic or androgenetic production of pluripotent cells and cell lines, and use thereof to produce differentiated cells and tissues
US10351821B2 (en) 2000-01-11 2019-07-16 Asterias Biotherapeutics Inc. Neural cell populations from primate pluripotent stem cells
US20020019046A1 (en) * 2000-01-11 2002-02-14 Carpenter Melissa K. Direct differentiation of human pluripotent stem cells and characterization of differentiated cells
US9790466B2 (en) 2000-01-11 2017-10-17 Asterias Biotherapeutics, Inc. Neural cell populations from primate pluripotent stem cells
US20020151053A1 (en) * 2000-01-11 2002-10-17 Carpenter Melissa K. Direct differentiation of human pluripotent stem cells and characterization of differentiated cells
US7297539B2 (en) 2000-01-11 2007-11-20 Geron Corporation Medium for growing human embryonic stem cells
US20020072117A1 (en) * 2000-01-11 2002-06-13 Chunhui Xu Human feeder cells that support proliferation of undifferentiated pluripotent stem cells
US8153428B2 (en) 2000-01-11 2012-04-10 Geron Corporation Use of TGF beta superfamily antagonists and neurotrophins to make neurons from embryonic stem cells
US20090305405A1 (en) * 2000-01-11 2009-12-10 Geron Corporation Use of tgf beta superfamily antagonists and neurotrophins to make neurons from embryonic stem cells
US7560281B2 (en) 2000-01-11 2009-07-14 Geron Corporation Use of TGF beta superfamily antagonists to make dopaminergic neurons from embryonic stem cells
US8252586B2 (en) 2000-01-11 2012-08-28 Geron Corporation Neural cell populations from primate pluripotent stem cells
US20050158855A1 (en) * 2000-01-11 2005-07-21 Carpenter Melissa K. Use of TGF beta superfamily antagonists to make dopaminergic neurons from embryonic stem cells
US7455983B2 (en) 2000-01-11 2008-11-25 Geron Corporation Medium for growing human embryonic stem cells
US20090291495A1 (en) * 2000-01-11 2009-11-26 Geron Corporation Neural Cell Populations from Primate Pluripotent Stem Cells
US20050037492A1 (en) * 2000-01-11 2005-02-17 Chunhui Xu Medium for growing human embryonic stem cells
US20040235159A1 (en) * 2000-01-11 2004-11-25 Ramkumar Mandalam Medium for growing human embryonic stem cells
US6602711B1 (en) * 2000-02-21 2003-08-05 Wisconsin Alumni Research Foundation Method of making embryoid bodies from primate embryonic stem cells
US7541184B2 (en) 2000-02-24 2009-06-02 Invitrogen Corporation Activation and expansion of cells
US20040241162A1 (en) * 2000-02-24 2004-12-02 Xcyte Therapies, Inc. Activation and expansion of cells
US7572631B2 (en) 2000-02-24 2009-08-11 Invitrogen Corporation Activation and expansion of T cells
US20050244962A1 (en) * 2000-03-09 2005-11-03 Thomson James A Cultivation of primate embryonic stem cells
US7005252B1 (en) * 2000-03-09 2006-02-28 Wisconsin Alumni Research Foundation Serum free cultivation of primate embryonic stem cells
US7439064B2 (en) 2000-03-09 2008-10-21 Wicell Research Institute, Inc. Cultivation of human embryonic stem cells in the absence of feeder cells or without conditioned medium
US20040256815A1 (en) * 2000-03-10 2004-12-23 Eichhorn Mark M. Apparatus and method for automatically leveling an object
US20040046337A1 (en) * 2000-03-10 2004-03-11 James Sproatt Apparatus and method for automatically leveling an object
US7226057B2 (en) 2000-03-10 2007-06-05 Days Corporation Apparatus and method for automatically leveling an object
US20090258421A1 (en) * 2000-03-14 2009-10-15 Es Cell International Pty Ltd. Embryonic stem cells and neural progenitor cells derived therefrom
US7504257B2 (en) 2000-03-14 2009-03-17 Es Cell International Pte Ltd. Embryonic stem cells and neural progenitor cells derived therefrom
WO2001068815A1 (en) * 2000-03-14 2001-09-20 Es Cell International Pte Ltd Embryonic stem cells and neural progenitor cells derived therefrom
US7947498B2 (en) 2000-03-14 2011-05-24 Es Cell International Pte Ltd. Embryonic stem cells and neural progenitor cells derived therefrom
US20050260747A1 (en) * 2000-03-14 2005-11-24 Reubinoff Benjamin E Embryonic stem cells and neural progenitor cells derived therefrom
US20090075373A1 (en) * 2000-03-14 2009-03-19 Benjamin Eithan Reubinoff Neural progenitor cells derived from embryonic stem cells
US8460931B2 (en) 2000-03-14 2013-06-11 Es Cell International Pte Ltd. Neural progenitor cells derived from embryonic stem cells
US8137969B2 (en) 2000-03-14 2012-03-20 Es Cell International Pte Ltd. Neural progenitor cells derived from embryonic stem cells
US8163536B2 (en) 2000-05-10 2012-04-24 Tristem Trading (Cyprus) Limited Device for preparing an undifferentiated cell from a more committed cell
US6828145B2 (en) 2000-05-10 2004-12-07 Cedars-Sinai Medical Center Method for the isolation of stem cells by immuno-labeling with HLA/MHC gene product marker
US7763463B2 (en) 2000-05-17 2010-07-27 Geron Corporation Use of cyclic AMP and ascorbic acid to produce dopaminergic neurons from embryonic stem cells
US20060078545A1 (en) * 2000-05-17 2006-04-13 Carpenter Melissa K Neural progenitor cell populations
US7250294B2 (en) 2000-05-17 2007-07-31 Geron Corporation Screening small molecule drugs using neural cells differentiated from human embryonic stem cells
US8252585B2 (en) 2000-05-17 2012-08-28 Geron Corporation Neural progenitor cell populations
US20050095707A1 (en) * 2000-05-17 2005-05-05 Carpenter Malissa K. Use of cyclic AMP and ascorbic acid to produce dopaminergic neurons from embryonic stem cells
US20030103949A1 (en) * 2000-05-17 2003-06-05 Carpenter Melissa K. Screening small molecule drugs using neural cells differentiated from human embryonic stem cells
US8148148B2 (en) 2000-05-17 2012-04-03 Geron Corporation Neural progenitor cell populations
US20090117639A1 (en) * 2000-05-17 2009-05-07 Carpenter Melissa K Neural Progenitor Cell Populations
US9803174B2 (en) 2000-05-17 2017-10-31 Asterias Biotherapeutics, Inc. Neural progenitor cell populations
US20040053869A1 (en) * 2000-08-19 2004-03-18 Peter Andrews Stem cell differentiation
US6534052B1 (en) 2000-09-05 2003-03-18 Yong-Fu Xiao Cardiac function comprising implantation of embryonic stem cell in which differentiation has been initiated
US6607720B1 (en) 2000-09-05 2003-08-19 Yong-Fu Xiao Genetically altered mammalian embryonic stem cells, their living progeny, and their therapeutic application for improving cardiac function after myocardial infarction
US9023645B2 (en) 2000-11-27 2015-05-05 Asterias Biotherapeutics, Inc. Isolated in vitro cell population comprising primate pluripotent stem cells containing a nucleic acid construct and differentiated progeny of the pluripotent stem cells
US8426198B2 (en) 2000-11-27 2013-04-23 Geron Corporation In vitro differentiated cell and human embryonic stem cell population
US20030040111A1 (en) * 2000-11-27 2003-02-27 Gold Joseph D. Differentiated cells suitable for human therapy
US20070202596A1 (en) * 2000-11-27 2007-08-30 Mcwhir Jim Selective antibody targeting of undifferentiated stem cells
US6921665B2 (en) 2000-11-27 2005-07-26 Roslin Institute (Edinburgh) Selective antibody targeting of undifferentiated stem cells
US20060134782A1 (en) * 2000-11-27 2006-06-22 Gold Joseph D Differentiated cells suitable for human therapy
US20040152189A1 (en) * 2000-11-27 2004-08-05 Mcwhir Jim Selective antibody targeting of undifferentiated stem cells
US20030185805A1 (en) * 2000-12-04 2003-10-02 Tei Biosciences, Inc., A Massachusetts Corporation Use of stem cells derived from dermal skin
US20040121460A1 (en) * 2001-01-24 2004-06-24 Lumelsky Nadya L Differentiation of stem cells to pancreatic endocrine cells
US7838289B2 (en) 2001-02-14 2010-11-23 Abt Holding Company Assay utilizing multipotent adult stem cells
US20040107453A1 (en) * 2001-02-14 2004-06-03 Furcht Leo T Multipotent adult stem cells, sources thereof, methods of obtaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof
US7126039B2 (en) 2001-03-21 2006-10-24 Geron Corporation Animal tissue with carbohydrate antigens compatible for human transplantation
US20030068818A1 (en) * 2001-03-21 2003-04-10 Chris Denning Animal tissue with carbohydrate antigens compatible for human transplantation and a carbohydrate determinant selection system for homologous recombination
US20060057719A1 (en) * 2001-03-21 2006-03-16 Chris Denning Carbohydrate determinant selection system for homologous recombination
US7202080B2 (en) 2001-03-29 2007-04-10 Ixion Biotechnology, Inc. Method for transdifferentiation of non-pancreatic stem cells to the pancreatic differentiation pathway
US20020182728A1 (en) * 2001-03-29 2002-12-05 Vijayakumar Ramiya Method for transdifferentiation of non pancreatic stem cells to the pancreatic differentiation pathway
US20110014695A1 (en) * 2001-03-29 2011-01-20 Roisen Fred J Methods for obtaining adult human olfactory progenitor cells
US7838292B1 (en) 2001-03-29 2010-11-23 University Of Louisville Research Foundation, Inc. Methods for obtaining adult human olfactory progenitor cells
US20030082806A1 (en) * 2001-04-27 2003-05-01 Xcyte Therapies, Inc. Maturation of antigen-presenting cells using activated T cells
US20030211605A1 (en) * 2001-05-01 2003-11-13 Lee Sang-Hun Derivation of midbrain dopaminergic neurons from embryonic stem cells
US20050042749A1 (en) * 2001-05-16 2005-02-24 Carpenter Melissa K. Dopaminergic neurons and proliferation-competent precursor cells for treating Parkinson's disease
US20050176665A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hairless (HR) gene expression using short interfering nucleic acid (siNA)
WO2003000868A1 (en) 2001-06-21 2003-01-03 Geron Corporation Dopaminergic neurons and proliferation-competent precursor cells for treating parkinson's disease
DE10136719A1 (en) * 2001-07-27 2003-02-20 Georg S Wengler Recovering omnipotent human embryonic stem cells, comprises separating them from a blastocyte which remains viable, useful for gene therapy especially autotransplants
US20090186407A1 (en) * 2001-08-06 2009-07-23 Bresagen, Inc. Alternative Compositions and Methods for the Culture of Stem Cells
US20050037488A1 (en) * 2001-08-06 2005-02-17 Maisam Mitalipova Alternative compositions and methods for the culture of stem cells
US7432104B2 (en) 2001-08-06 2008-10-07 Bresgen Inc. Methods for the culture of human embryonic stem cells on human feeder cells
US20030104616A1 (en) * 2001-08-23 2003-06-05 Reliance Life Sciences Pvt. Ltd. Isolation of inner cell mass for the establishment of human embryonic stem cell (hESC) lines
US20070048864A2 (en) * 2001-08-23 2007-03-01 Reliance Life Sciences Pvt. Ltd. Isolation of Inner Cell Mass for the Establishment of Human Embryonic Stem Cell (hESC) Lines
US7294508B2 (en) 2001-08-23 2007-11-13 Reliance Life Sciences Pvt. Ltd. Isolation of inner cell mass for the establishment of human embryonic stem cell (hESC) lines
EP2264145A1 (en) 2001-09-05 2010-12-22 Geron Corporation Culture system for rapid expansion of human embryonic stem cells
US20030079536A1 (en) * 2001-09-10 2003-05-01 Frank Fischer Method and system for monitoring a tire air pressure
US7588937B2 (en) 2001-10-03 2009-09-15 Wisconsin Alumni Research Foundation Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US9080151B2 (en) 2001-10-03 2015-07-14 Wisconsin Alumni Research Foundation Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US20080227137A1 (en) * 2001-10-03 2008-09-18 Su-Chun Zhang Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US20080206865A1 (en) * 2001-10-03 2008-08-28 Su-Chun Zhang Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US8153424B2 (en) 2001-10-03 2012-04-10 Wisconsin Alumni Research Foundation Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US20030068819A1 (en) * 2001-10-03 2003-04-10 Su-Chun Zhang Method of in vitro differentiation of transplantatable neural precursor cells from primate embryonic stem cells
US20050095706A1 (en) * 2001-10-03 2005-05-05 Su-Chun Zhang Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US7972850B2 (en) 2001-10-03 2011-07-05 Wisonsin Alumni Research Foundation Method of in vitro differentiation of neural stem cells, motor neurons and dopamine neurons from primate embryonic stem cells
US6887706B2 (en) 2001-10-03 2005-05-03 Wisconsin Alumni Research Foundation Method of in vitro differentiation of transplantable neural precursor cells from primate embryonic stem cells
US7176023B2 (en) 2001-11-02 2007-02-13 Wisconsin Alumni Research Foundation Endothelial cells derived from primate embryonic stem cells
US20030166273A1 (en) * 2001-11-02 2003-09-04 Kaufman Dan S. Endothelial cells derived from primate embryonic stem cells
US6759244B2 (en) 2001-11-08 2004-07-06 Art Institute Of New York And New Jersey, Inc. Composite blastocysts (CBs) from aggregates of dissociated cells of non-viable pre-embryos
US20030087431A1 (en) * 2001-11-08 2003-05-08 Mina Alikani Composite blastocysts (CBs) from aggregates of dissociated cells of non-viable pre-embryos
US7968336B2 (en) 2001-11-15 2011-06-28 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US8021876B2 (en) 2001-11-15 2011-09-20 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US20050124003A1 (en) * 2001-11-15 2005-06-09 Anthony Atala Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US20070116682A1 (en) * 2001-11-15 2007-05-24 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US20070116683A1 (en) * 2001-11-15 2007-05-24 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US20070116684A1 (en) * 2001-11-15 2007-05-24 Children's Medical Center Corporation Methods of isolation, expansion and differentiation of fetal stem cells from chorionic villus, amniotic fluid, and placenta and therapeutic uses thereof
US7326572B2 (en) 2001-12-07 2008-02-05 Geron Corporation Endoderm cells from human embryonic stem cells
US20030138948A1 (en) * 2001-12-07 2003-07-24 Fisk Gregory J. Islet cells from human embryonic stem cells
WO2003050249A3 (en) * 2001-12-07 2004-02-12 Geron Corp Islet cells from human embryonic stem cells
US20040224403A1 (en) * 2001-12-07 2004-11-11 Robarts Research Institute Reconstituting hematopoietic cell function using human embryonic stem cells
US20100196916A1 (en) * 2001-12-07 2010-08-05 Fisk Gregory J Drug Screening using Islet Cells and Islet Cell Progenitors from Human Embryonic Stem Cells
GB2399823A (en) * 2001-12-07 2004-09-29 Geron Corp Islet cells from human embryonic stem cells
US7033831B2 (en) 2001-12-07 2006-04-25 Geron Corporation Islet cells from human embryonic stem cells
WO2003050250A3 (en) * 2001-12-07 2004-02-12 Geron Corp Chondrocyte precursors derived from human embryonic stem cells
GB2399823B (en) * 2001-12-07 2006-02-15 Geron Corp Islet cells from primate pluripotent stem cells
US20060040387A1 (en) * 2001-12-07 2006-02-23 Fisk Gregory J Islet cells from human embryonic stem cells
US7906330B2 (en) 2001-12-07 2011-03-15 Geron Corporation Two cell population comprising chondrocyte precursors and human embryonic stem cells
US20110129867A1 (en) * 2001-12-07 2011-06-02 Thies R Scott Compound Screening Using Chondrocytes
AU2002366602B2 (en) * 2001-12-07 2008-07-03 Asterias Biotherapeutics, Inc. Chondrocyte precursors derived from human embryonic stem cells
EP2292734A1 (en) 2001-12-07 2011-03-09 Geron Corporation Hematopoietic cells from human embryonic stem cells
US7799324B2 (en) 2001-12-07 2010-09-21 Geron Corporation Using undifferentiated embryonic stem cells to control the immune system
US20090093055A1 (en) * 2001-12-07 2009-04-09 Fisk Gregory J Islet Cells from Human Embryonic Stem Cells
GB2399348A (en) * 2001-12-07 2004-09-15 Geron Corp Chondrocyte precursors derived from human embryonic stem cells
US20060148077A1 (en) * 2001-12-07 2006-07-06 Thies R S Chondrocyte precursors derived from human embryonic stem cells
US20110065118A1 (en) * 2001-12-07 2011-03-17 Fisk Gregory J Drug Screening Using Islet Cells and Islet Cell Progenitors from Human Embryonic Stem Cells
US20090325180A1 (en) * 2001-12-07 2009-12-31 Fisk Gregory J Drug Screening using Islet Cells and Islet Cell Progenitors from Human Embryonic Stem Cells
EP2264146A1 (en) 2001-12-07 2010-12-22 Geron Corporation Islet cells from human embryonic stem cells
US9085756B2 (en) 2001-12-07 2015-07-21 Asterias Biotherapeutic, Inc. Drug screening using islet cells and islet cell progenitors from human embryonic stem cells
US20030109038A1 (en) * 2001-12-07 2003-06-12 Thies R. Scott Chondrocyte precursors derived from human embryonic stem cells
WO2003050249A2 (en) 2001-12-07 2003-06-19 Geron Corporation Islet cells from human embryonic stem cells
US20080145889A1 (en) * 2001-12-07 2008-06-19 Geron Corporation Islet Cells from Human Embryonic Stem Cells
US8546101B2 (en) 2001-12-07 2013-10-01 Geron Corporation Compound screening using chondrocytes derived from primate pluripotent stem cells
US20050282272A1 (en) * 2001-12-07 2005-12-22 The Robarts Research Institute Using undifferentiated embryonic stem cells to control the immune system
WO2003052080A3 (en) * 2001-12-18 2003-11-27 Acceptys Inc Pluripotent stem cells derived without the use of embryos or fetal tissue
US20030113910A1 (en) * 2001-12-18 2003-06-19 Mike Levanduski Pluripotent stem cells derived without the use of embryos or fetal tissue
US20050095703A1 (en) * 2001-12-28 2005-05-05 Henrik Semb Method for the establishment of a pluripotent human blastocyst - derived stem cell line
WO2003055992A3 (en) * 2001-12-28 2004-01-15 Cell Therapeutics Scandinavia A method for the establishment of a pluripotent human blastocyst-derived stem cell line
GB2398795A (en) * 2001-12-28 2004-09-01 Cellartis Ab A method for the establishment of a pluripotent human blastocyst-derived stem cell line
US20030162290A1 (en) * 2002-01-25 2003-08-28 Kazutomo Inoue Method for inducing differentiation of embryonic stem cells into functioning cells
US20040072344A1 (en) * 2002-01-25 2004-04-15 Kazutomo Inoue Method for inducing differentiation of embryonic stem cells into functioning cells
US20050026133A1 (en) * 2002-01-31 2005-02-03 Asahi Techno Glass Corporation Cryopreservation medium for primate embryo stem cells and cryopreservation method
EP1472340A4 (en) * 2002-02-05 2006-11-08 Rappaport Family Inst For Res STRAIN CELLS SELECTED FOR TELOMERASEPROMOTORACTIVITY, CELL-LINKED
US20050079608A1 (en) * 2002-02-05 2005-04-14 Skorecki Karl L. Lineage committed stem cells selected for telomerase promoter activity
US20090035282A1 (en) * 2002-02-06 2009-02-05 Stiftung Caesar Pluripotent embryonic-like stem cells derived from teeth and uses thereof
US20050106724A1 (en) * 2002-02-06 2005-05-19 Joerg Schierholz Pluripotent embryonic-like stem cells derived from teeth and uses thereof
US7736892B2 (en) 2002-02-25 2010-06-15 Kansas State University Research Foundation Cultures, products and methods using umbilical cord matrix cells
US20030161818A1 (en) * 2002-02-25 2003-08-28 Kansas State University Research Foundation Cultures, products and methods using stem cells
US8268302B2 (en) 2002-02-25 2012-09-18 Kansas State University Research Foundation Cultures, products and methods using umbilical cord matrix cells
US20040136967A1 (en) * 2002-02-25 2004-07-15 Kansas State University Research Foundation Cultures, products and methods using stem cells
US20030232358A1 (en) * 2002-03-15 2003-12-18 Thomson James A. Method of identifying genes controlling differentiation
US7148062B2 (en) 2002-03-15 2006-12-12 Wicell Research Institute, Inc. Method for generating primate trophoblasts
US20040005701A1 (en) * 2002-03-15 2004-01-08 Ren-He Xu Method for generating primate trophoblasts
US10435666B2 (en) 2002-03-15 2019-10-08 Wicell Research Institute, Inc. Method for generating primate trophoblasts
US20060147432A1 (en) * 2002-03-28 2006-07-06 Revivicor, Inc. Tolerogenic antigen-presenting cells
US20040072348A1 (en) * 2002-03-28 2004-04-15 Leishman Andrew James Tolerogenic antigen-presenting cells
US20040111285A1 (en) * 2002-04-09 2004-06-10 Mark Germain Method for human pluripotent stem cells
US20030228295A1 (en) * 2002-04-25 2003-12-11 Svendsen Clive N. Use of human neural stem cells secreting GDNF for treatment of parkinson's and other neurodegenerative diseases
US20030207448A1 (en) * 2002-05-06 2003-11-06 Revera Gregory Henry Methodologies for the creation of pluripotent or multipotent human stem cells without creating or destroying a human embryo
US20030210845A1 (en) * 2002-05-09 2003-11-13 Lynx Photonic Networks Inc. Constant power operation thermo-optic switch
WO2003100018A2 (en) 2002-05-24 2003-12-04 Advanced Cell Technology, Inc. A bank of stem cells for transplantation
EP2679671A1 (en) 2002-05-24 2014-01-01 Advanced Cell Technology, Inc. A bank of stem cells for producing cells for transplantation having HLA antigens matching those of transplant recipients, and methods for making and using such a stem cell bank
US20040048370A1 (en) * 2002-06-14 2004-03-11 Case Western Reserve University Cell targeting methods and compositions
US9321992B2 (en) 2002-06-14 2016-04-26 Case Western Reserve University Cell targeting methods and compositions
US20070231898A1 (en) * 2002-07-11 2007-10-04 Keirstead Hans S Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US7579188B2 (en) 2002-07-11 2009-08-25 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US20040009593A1 (en) * 2002-07-11 2004-01-15 Keirstead Hans S. Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US10611998B2 (en) 2002-07-11 2020-04-07 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US7285415B2 (en) 2002-07-11 2007-10-23 The Regents Of The University Of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
EP2273268A2 (en) 2002-07-11 2011-01-12 The Regents of The University of California Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US20090232779A1 (en) * 2002-07-11 2009-09-17 Keirstead Hans S Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US20050101014A1 (en) * 2002-07-11 2005-05-12 Keirstead Hans S. Oligodendrocytes derived from human embryonic stem cells for remyelination and treatment of spinal cord injury
US20110158966A1 (en) * 2002-07-23 2011-06-30 Judith Seligman Stem cells characterized by expression of germline specific genes
US20050287547A1 (en) * 2002-07-23 2005-12-29 Judith Seligman Embryonic stem cell markers and uses thereof
US8876532B2 (en) 2002-07-31 2014-11-04 Dentsply International Inc. Bone repair putty
US7462448B2 (en) 2002-08-02 2008-12-09 Stratatech Corporation Species specific DNA detection
US20040146881A1 (en) * 2002-08-02 2004-07-29 Osi Pharmaceuticals. Inc. Species specific DNA detection
US7888496B2 (en) 2002-08-02 2011-02-15 Stratatech Corporation Kit for species specific DNA detection
US20060121607A1 (en) * 2002-08-08 2006-06-08 Thomas Schulz Compositions and methods for neural differentiation of embryonic stem cells
WO2004090096A3 (en) * 2002-08-08 2005-03-03 Bresagen Inc Methods for neural differentiation of embryonic stem cells using protease passaging techniques
AU2004227366B2 (en) * 2002-08-08 2009-01-08 University Of Georgia Research Foundation, Inc. Methods for neural differentiation of embryonic stem cells using protease passaging techniques
US20060110375A1 (en) * 2002-08-09 2006-05-25 Herbert Zech Method for producing cell lines and organs by means of differentiable cells
US20090035285A1 (en) * 2002-09-25 2009-02-05 Bresagen, Inc. Compositions and Methods for Enrichment of Neural Stem Cells Using Ceramide Analogs
US20060014280A1 (en) * 2002-09-25 2006-01-19 Condie Brian G Compositions and methods for enrichment of neural stem cells using ceramide analogs
US7445931B2 (en) 2002-09-25 2008-11-04 Bresagen, Inc. Compositions and methods for enrichment of neural stem cells using ceramide analogs
US20040067580A1 (en) * 2002-10-07 2004-04-08 Technion Research & Development Foundation Ltd. Human foreskin cells suitable for culturing stem cells
US9255247B2 (en) 2002-10-07 2016-02-09 Technion Research & Development Foundation Limited Methods of deriving mammalian pluripotent stem cell lines
US7267981B2 (en) 2002-10-07 2007-09-11 Technion Research & Development Foundation Ltd. Human foreskin fibroblasts for culturing ES cells
US20100129907A1 (en) * 2002-10-07 2010-05-27 Technion Research & Development Foundation Ltd. Human foreskin fibroblast conditioned media for culturing es cells
US7790455B2 (en) 2002-10-07 2010-09-07 Technion Research & Development Foundation Ltd. Human foreskin fibroblast conditioned media for culturing ES cells
US8846400B2 (en) 2002-10-07 2014-09-30 Technion Research & Development Foundation Limited Culturing mammalian embryonic stem cells in human foreskin fibroblast conditioned medium
US8318486B2 (en) 2002-10-07 2012-11-27 Technion Research & Development Foundation Ltd. Co-culturing mammalian embryonic stem cells with human foreskin fibroblasts
WO2004038012A1 (en) * 2002-10-25 2004-05-06 Hunan Hui-Lin Life Technology Co. Ltd The feeder cell layer for in vitro culturing human embryonic stem cells and the method for culturing embryonic stem cells
US20040110286A1 (en) * 2002-12-06 2004-06-10 The John P. Robarts Research Institute Method for making hematopoietic cells
US20060211111A1 (en) * 2002-12-18 2006-09-21 Maisam Mitalipova Compositions and methods for neural cell production and stabilization
US20060211109A1 (en) * 2003-03-12 2006-09-21 Reliance Life Sciences Pvt. Ltd. Derivation of terminally differentiated dopaminergic neurons from human embryonic stem cells
US7674620B2 (en) 2003-03-12 2010-03-09 Reliance Life Sciences Pvt. Ltd. Derivation of terminally differentiated dopaminergic neurons from human embryonic stem cells
US20090263835A1 (en) * 2003-03-13 2009-10-22 Geron Corporation Genes that are Up- or Down-Regulated During Differentiation of Human Embryonic Stem Cells
US20040180347A1 (en) * 2003-03-13 2004-09-16 Stanton Lawrence W. Marker system for preparing and characterizing high-quality human embryonic stem cells
US20030224411A1 (en) * 2003-03-13 2003-12-04 Stanton Lawrence W. Genes that are up- or down-regulated during differentiation of human embryonic stem cells
US7153650B2 (en) 2003-03-13 2006-12-26 Geron Corporation Marker system for preparing and characterizing high-quality human embryonic stem cells
US20070020242A1 (en) * 2003-03-27 2007-01-25 Ixion Biotechnology, Inc. Method for transdifferentiation of non-pancreatic stem cells to the pancreatic pathway
US20070037282A1 (en) * 2003-03-31 2007-02-15 Masayo Takahashi Method of producing lens cell and lens cell obtained by the method
US8765467B2 (en) 2003-05-05 2014-07-01 Technion Research And Development Foundation Ltd. Multicellular compositions of pluripotent human embryonic stem cells and cancer cells
GB2417960A (en) * 2003-05-08 2006-03-15 Cellartis Ab A method for efficient transfer of human blastocyst-derived stem cells (HBS cells) from a feeder-supported to a feeder-free culture system
US20070010010A1 (en) * 2003-05-08 2007-01-11 Cellartis Ab Method for efficient transfer of human blastocyst-derived stem cell (hbs cells) from a feeder-supported to a feeder-free culture system
US7638328B2 (en) 2003-05-08 2009-12-29 Cellartis Ab Method for efficient transfer of human blastocyst-derived stem cells (hBS cells) from a feeder-supported to a feeder-free culture system, long-term propagation of hBS cells under feeder-free conditions and use of cultured hBS cells for applications in myocardial regeneration
WO2004099394A3 (en) * 2003-05-08 2005-04-07 Cellartis Ab A method for efficient transfer of human blastocyst-derived stem cells (hbs cells) from a feeder-supported to a feeder-free culture system
US20100183566A1 (en) * 2003-05-08 2010-07-22 Cellartis Ab METHOD FOR EFFICIENT TRANSFER OF HUMAN BLASTOCYST-DERIVED STEM CELLS (hBS CELLS) FROM A FEEDER-SUPPORTED TO A FEEDER-FREE CULTURE SYSTEM
GB2417960B (en) * 2003-05-08 2008-03-26 Cellartis Ab A method for efficient transfer of human blastocyst-derived stem cells (HBS cells) from a feeder-supported to a feeder-free culture system
US20090203141A1 (en) * 2003-05-15 2009-08-13 Shi-Lung Lin Generation of tumor-free embryonic stem-like pluripotent cells using inducible recombinant RNA agents
US9567591B2 (en) 2003-05-15 2017-02-14 Mello Biotechnology, Inc. Generation of human embryonic stem-like cells using intronic RNA
US20050058628A1 (en) * 2003-06-11 2005-03-17 Jan Remmereit Nuclear reprogramming of cells for therapeutic use
US20050032209A1 (en) * 2003-06-27 2005-02-10 Messina Darin J. Regeneration and repair of neural tissue using postpartum-derived cells
US9504719B2 (en) 2003-06-27 2016-11-29 DePuy Synthes Products, Inc. Soft tissue repair and regeneration using postpartum-derived cells and cell products
US8491883B2 (en) 2003-06-27 2013-07-23 Advanced Technologies And Regenerative Medicine, Llc Treatment of amyotrophic lateral sclerosis using umbilical derived cells
US9592258B2 (en) 2003-06-27 2017-03-14 DePuy Synthes Products, Inc. Treatment of neurological injury by administration of human umbilical cord tissue-derived cells
US9572840B2 (en) 2003-06-27 2017-02-21 DePuy Synthes Products, Inc. Regeneration and repair of neural tissue using postpartum-derived cells
US7510873B2 (en) 2003-06-27 2009-03-31 Ethicon, Incorporated Postpartum cells isolated from umbilical cord tissue, and methods of making and using the same
US20100210013A1 (en) * 2003-06-27 2010-08-19 Ethicon, Incorporated Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US9234172B2 (en) 2003-06-27 2016-01-12 DePuy Synthes Products, Inc. Repair and regeneration of ocular tissue using postpartum-derived cells
US20100272803A1 (en) * 2003-06-27 2010-10-28 Sanjay Mistry Repair and regeneration of ocular tissue using postpartum-derived cells
US7413734B2 (en) 2003-06-27 2008-08-19 Ethicon, Incorporated Treatment of retinitis pigmentosa with human umbilical cord cells
US8518390B2 (en) 2003-06-27 2013-08-27 Advanced Technologies And Regenerative Medicine, Llc Treatment of stroke and other acute neural degenerative disorders via intranasal administration of umbilical cord-derived cells
US7524489B2 (en) 2003-06-27 2009-04-28 Ethicon Incorporated Regeneration and repair of neural tissue using postpartum-derived cells
US9717763B2 (en) 2003-06-27 2017-08-01 DePuy Synthes Products, Inc. Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US10500234B2 (en) 2003-06-27 2019-12-10 DePuy Synthes Products, Inc. Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US8658152B2 (en) 2003-06-27 2014-02-25 DePuy Synthes Products, LLC Regeneration and repair of neural tissue using postpartum-derived cells
US8703121B2 (en) 2003-06-27 2014-04-22 DePuy Synthes Products, LLC Postpartum-derived cells for use in treatment of disease of the heart and circulatory system
US8361459B2 (en) 2003-06-27 2013-01-29 Advanced Technologies And Regenerative Medicine, Llc Treatment of stroke and other acute neural degenerative disorders using postpartum-derived cells
US9498501B2 (en) 2003-06-27 2016-11-22 DePuy Synthes Products, Inc. Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US7560276B2 (en) 2003-06-27 2009-07-14 Ethicon, Incorporated Soft tissue repair and regeneration using postpartum-derived cells
US20070036767A1 (en) * 2003-06-27 2007-02-15 Ethicon, Incorporated Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US20070014771A1 (en) * 2003-06-27 2007-01-18 Ethicon, Incorporated Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US8318483B2 (en) 2003-06-27 2012-11-27 Advanced Technologies And Regenerative Medicine, Llc Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US20070009494A1 (en) * 2003-06-27 2007-01-11 Ethicon, Incorporated Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US11179422B2 (en) 2003-06-27 2021-11-23 DePuy Synthes Products, Inc. Method of differentiating umbilical cord tissue into a chondrogenic phenotype
US8790637B2 (en) 2003-06-27 2014-07-29 DePuy Synthes Products, LLC Repair and regeneration of ocular tissue using postpartum-derived cells
US7875272B2 (en) 2003-06-27 2011-01-25 Ethicon, Incorporated Treatment of stroke and other acute neuraldegenerative disorders using postpartum derived cells
US8815587B2 (en) 2003-06-27 2014-08-26 DePuy Synthes Products, LLC Postpartum cells derived from umbilical tissue and methods of making and using the same
US10383898B2 (en) 2003-06-27 2019-08-20 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US20110223205A1 (en) * 2003-06-27 2011-09-15 Advanced Technologies And Regenerative Medicine, Llc Treatment of amyotrophic lateral sclerosis using umbilical derived cells
US20060234376A1 (en) * 2003-06-27 2006-10-19 Ethicon Incorporated Repair and regeneration of ocular tissue using postpartum-derived cells
US20050019865A1 (en) * 2003-06-27 2005-01-27 Kihm Anthony J. Cartilage and bone repair and regeneration using postpartum-derived cells
US20060188983A1 (en) * 2003-06-27 2006-08-24 Ethicon Incorporated Postpartum-derived cells for use in treatment of disease of the heart and circulatory system
US20100215714A1 (en) * 2003-06-27 2010-08-26 Ethicon, Incorporated Treatment of stroke and other acute neural degenerative disorders using postpartum-derived cells
US20050037491A1 (en) * 2003-06-27 2005-02-17 Sanjay Mistry Repair and regeneration of ocular tissue using postpartum-derived cells
US11191789B2 (en) 2003-06-27 2021-12-07 DePuy Synthes Products, Inc. Cartilage and bone repair and regeneration using postpartum-derived cells
US20100159025A1 (en) * 2003-06-27 2010-06-24 Ethicon, Incorporated Systemically and locally administered cells for neuropathic pain
US20060154367A1 (en) * 2003-06-27 2006-07-13 Ethicon, Incorporated Cartilage and bone repair and regeneration using postpartum-derived cells
US20060153817A1 (en) * 2003-06-27 2006-07-13 Ethicon, Incorporated Cartilage and bone repair and regeneration using postpartum-derived cells
US20060153816A1 (en) * 2003-06-27 2006-07-13 Laura Brown Soft tissue repair and regeneration using postpartum-derived cells and cell products
US20060154366A1 (en) * 2003-06-27 2006-07-13 Laura Brown Treatment of osteochondral diseases using postpartum-derived cells and products thereof
US8277796B2 (en) 2003-06-27 2012-10-02 Advanced Technologies And Regenerative Medicine, Llc Regeneration and repair of neural tissue using postpartum-derived cells
US20060153818A1 (en) * 2003-06-27 2006-07-13 Ethicon, Incorporated Cartilage and bone repair and regeneration using postpartum-derived cells
US10220059B2 (en) 2003-06-27 2019-03-05 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US10195233B2 (en) 2003-06-27 2019-02-05 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US10039793B2 (en) 2003-06-27 2018-08-07 DePuy Synthes Products, Inc. Soft tissue repair and regeneration using postpartum-derived cells and cell products
US20050054098A1 (en) * 2003-06-27 2005-03-10 Sanjay Mistry Postpartum cells derived from umbilical cord tissue, and methods of making and using the same
US10744164B2 (en) 2003-06-27 2020-08-18 DePuy Synthes Products, Inc. Repair and regeneration of ocular tissue using postpartum-derived cells
US9579351B2 (en) 2003-06-27 2017-02-28 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US10758576B2 (en) 2003-06-27 2020-09-01 DePuy Synthes Products, Inc. Soft tissue repair and regeneration using postpartum-derived cells and cell products
US20050058630A1 (en) * 2003-06-27 2005-03-17 Harris Ian Ross Postpartum-derived cells for use in treatment of disease of the heart and circulatory system
US20050058629A1 (en) * 2003-06-27 2005-03-17 Harmon Alexander M. Soft tissue repair and regeneration using postpartum-derived cells
US11000554B2 (en) 2003-06-27 2021-05-11 DePuy Synthes Products, Inc. Postpartum cells derived from placental tissue, and methods of making and using the same
US20050019907A1 (en) * 2003-07-22 2005-01-27 Santiago Munne Obtaining normal disomic stem cells from chromosomally abnormal embryos
EP3473102A1 (en) 2003-08-01 2019-04-24 Stratatech Corporation Methods for providing human skin equivalents
EP3100611A1 (en) 2003-08-01 2016-12-07 Stratatech Corporation Human skin equivalents expressing exogenous polypeptides
EP2481287A1 (en) 2003-08-01 2012-08-01 Stratatech Corporation Human skin equivalents expressing exogenous polypeptides
US20050054093A1 (en) * 2003-08-14 2005-03-10 Martin Haas Multipotent amniotic fetal stem cells
US20050042595A1 (en) * 2003-08-14 2005-02-24 Martin Haas Banking of multipotent amniotic fetal stem cells
US7569385B2 (en) 2003-08-14 2009-08-04 The Regents Of The University Of California Multipotent amniotic fetal stem cells
US20050095702A1 (en) * 2003-09-03 2005-05-05 Reliance Life Sciences Pvt. Ltd. In vitro generation of GABAergic neurons from embryonic stem cells and their use in the treatment of neurological disorders
US7820439B2 (en) 2003-09-03 2010-10-26 Reliance Life Sciences Pvt Ltd. In vitro generation of GABAergic neurons from pluripotent stem cells
US20050054100A1 (en) * 2003-09-08 2005-03-10 Rennard Stephen I. Methods for fibroblast differentiation
US20060222636A1 (en) * 2003-09-19 2006-10-05 The Rockefeller University Compositions, methods and kits relating to reprogramming adult differentiated cells and production of embryonic stem cell-like cells
US20050100924A1 (en) * 2003-11-06 2005-05-12 National University Of Singapore C/EBPalpha gene targeting constructs and uses thereof
US20050106725A1 (en) * 2003-11-19 2005-05-19 Palecek Sean P. Method of reducing cell differentiation
US8940536B2 (en) 2003-11-26 2015-01-27 Whitehead Institute For Biomedical Research Methods for making somatic cells more susceptible to reprogramming
US11987815B2 (en) 2003-11-26 2024-05-21 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US11655459B2 (en) 2003-11-26 2023-05-23 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US9670464B2 (en) 2003-11-26 2017-06-06 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US10457917B2 (en) 2003-11-26 2019-10-29 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US10017744B2 (en) 2003-11-26 2018-07-10 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US8951797B2 (en) 2003-11-26 2015-02-10 Whitehead Institute For Biomedical Research Compositions for identifying reprogramming factors
US20100144031A1 (en) * 2003-11-26 2010-06-10 Rudolf Jaenisch Methods for reprogramming somatic cells
US8932856B2 (en) 2003-11-26 2015-01-13 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US8927279B2 (en) 2003-11-26 2015-01-06 Whitehead Institute For Biomedical Research Methods for reprogramming somatic cells
US9834751B2 (en) 2003-12-02 2017-12-05 Celavie Biosciences, Llc Pluripotent cells
US7632681B2 (en) 2003-12-02 2009-12-15 Celavie Biosciences, Llc Compositions and methods for propagation of neural progenitor cells
US8367406B2 (en) 2003-12-02 2013-02-05 Celavie Biosciences, Llc Pluripotent cells
US20050118561A1 (en) * 2003-12-02 2005-06-02 Catholic Healthcare West Compositions and methods for propagation of neural progenitor cells
US20090280097A1 (en) * 2003-12-02 2009-11-12 Celavie Biosciences, Llc Pluripotent cells
US9439932B2 (en) 2003-12-02 2016-09-13 Celavie Biosciences, Llc Pluripotent cells
US20070269412A1 (en) * 2003-12-02 2007-11-22 Celavie Biosciences, Llc Pluripotent cells
US20060030042A1 (en) * 2003-12-19 2006-02-09 Ali Brivanlou Maintenance of embryonic stem cells by the GSK-3 inhibitor 6-bromoindirubin-3'-oxime
US10179902B2 (en) 2003-12-23 2019-01-15 Viacyte, Inc. Methods of making human primitive ectoderm cells
US8216836B2 (en) 2003-12-23 2012-07-10 Viacyte, Inc. Methods for identifying factors for differentiating definitive endoderm
US20100151568A1 (en) * 2003-12-23 2010-06-17 D Amour Kevin Allen Definitive endoderm
US20060148081A1 (en) * 2003-12-23 2006-07-06 Olivia Kelly Expansion of definitive endoderm cells
US20100041150A1 (en) * 2003-12-23 2010-02-18 Olivia Kelly Expansion of definitive endoderm cells
US7625753B2 (en) 2003-12-23 2009-12-01 Cythera, Inc. Expansion of definitive endoderm cells
US8586357B2 (en) 2003-12-23 2013-11-19 Viacyte, Inc. Markers of definitive endoderm
US20090220959A1 (en) * 2003-12-23 2009-09-03 D Amour Kevin Allen Markers of definitive endoderm
US9732318B2 (en) 2003-12-23 2017-08-15 Viacyte, Inc. Preprimitive streak and mesendoderm cells
US8623645B2 (en) 2003-12-23 2014-01-07 Viacyte, Inc. Definitive endoderm
US7541185B2 (en) 2003-12-23 2009-06-02 Cythera, Inc. Methods for identifying factors for differentiating definitive endoderm
US20090311703A1 (en) * 2003-12-23 2009-12-17 D Amour Kevin Allen Methods for identifying factors for differentiating definitive endoderm
US7510876B2 (en) 2003-12-23 2009-03-31 Cythera, Inc. Definitive endoderm
US8658151B2 (en) 2003-12-23 2014-02-25 Viacyte, Inc. Expansion of definitive endoderm cells
US10421942B2 (en) 2003-12-23 2019-09-24 Viacyte, Inc. Definitive endoderm
US7704738B2 (en) 2003-12-23 2010-04-27 Cythera, Inc. Definitive endoderm
US20060003313A1 (en) * 2003-12-23 2006-01-05 D Amour Kevin A Methods for identifying factors for differentiating definitive endoderm
EP2722387A2 (en) 2003-12-23 2014-04-23 Viacyte, Inc. Definitive endoderm
US10550367B2 (en) 2003-12-23 2020-02-04 Viacyte, Inc. Methods of making human primitive ectoderm cells
US11667889B2 (en) 2003-12-23 2023-06-06 Viacyte, Inc. Methods of making human primitive ectoderm cells
US9605243B2 (en) 2003-12-23 2017-03-28 Viacyte, Inc. Markers of definitive endoderm
US8597944B2 (en) 2004-01-02 2013-12-03 Advanced Cell Technology, Inc. Culture systems for ex vivo development
US10638734B2 (en) 2004-01-05 2020-05-05 Abt Holding Company Multipotent adult stem cells, sources thereof, methods of obtaining and maintaining same, methods of differentiation thereof, methods of use thereof and cells derived thereof
US8449866B2 (en) 2004-01-16 2013-05-28 Carnegie Mellon University Cellular labeling for nuclear magnetic resonance techniques
EP2319544A1 (en) 2004-01-16 2011-05-11 Carnegie Mellon University Cellular labeling for nuclear magnetic resonance techniques
US8147806B2 (en) 2004-01-16 2012-04-03 Carnegie Mellon University Cellular labeling for nuclear magnetic resonance techniques
US20080241107A1 (en) * 2004-01-23 2008-10-02 Copland Iii John A Methods and Compositions For Preparing Pancreatic Insulin Secreting Cells
US20050186672A1 (en) * 2004-01-27 2005-08-25 Reliance Life Sciences Pvt. Ltd. Tissue system with undifferentiated stem cells derived from corneal limbus
US20060216821A1 (en) * 2004-02-26 2006-09-28 Reliance Life Sciences Pvt. Ltd. Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
US20090263878A1 (en) * 2004-02-26 2009-10-22 Satish Mahadeorao Totey Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
US8067233B2 (en) 2004-02-26 2011-11-29 Reliance Life Science Pvt. Ltd. Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
US8187875B2 (en) 2004-02-26 2012-05-29 Reliance Life Sciences Pvt. Ltd. Dopaminergic neurons derived from corneal limbus, methods of isolation and uses thereof
WO2005084119A3 (en) * 2004-02-26 2010-06-17 Reliance Life Sciences Pvt. Ltd. Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
AU2005220066B2 (en) * 2004-02-26 2010-01-21 Reliance Life Sciences Pvt. Ltd. Pluripotent embryonic-like stem cells derived from corneal limbus, methods of isolation and uses thereof
US20100028851A1 (en) * 2004-04-23 2010-02-04 Bioe, Inc. Multi-Lineage Progenitor Cells
US7622108B2 (en) 2004-04-23 2009-11-24 Bioe, Inc. Multi-lineage progenitor cells
US8163275B2 (en) 2004-04-23 2012-04-24 Bioe Llc Multi-lineage progenitor cells
US20050255592A1 (en) * 2004-04-23 2005-11-17 Bioe, Inc., A Minnesota Corporation Multi-lineage progenitor cells
US20060040392A1 (en) * 2004-04-23 2006-02-23 Collins Daniel P Multi-lineage progenitor cells
US7670596B2 (en) 2004-04-23 2010-03-02 Bioe, Inc. Multi-lineage progenitor cells
EP2377922A2 (en) 2004-04-27 2011-10-19 Viacyte, Inc. PDX1 expressing endoderm
US20050266554A1 (en) * 2004-04-27 2005-12-01 D Amour Kevin A PDX1 expressing endoderm
US9222069B2 (en) 2004-04-27 2015-12-29 Viacyte, Inc. Methods for making anterior foregut endoderm
US8633024B2 (en) 2004-04-27 2014-01-21 Viacyte, Inc. PDX1 expressing endoderm
US20090011502A1 (en) * 2004-04-27 2009-01-08 Novocell, Inc. Pdx1 Expressing Endoderm
US20090042287A1 (en) * 2004-04-27 2009-02-12 D Amour Kevin Allen Pdx1 expressing endoderm
US8647873B2 (en) 2004-04-27 2014-02-11 Viacyte, Inc. PDX1 expressing endoderm
US10465162B2 (en) 2004-04-27 2019-11-05 Viacyte, Inc. Anterior endoderm cells and methods of production
US11746323B2 (en) 2004-04-27 2023-09-05 Viacyte, Inc. PDX1 positive foregut endoderm cells and methods of production
US20060014281A1 (en) * 2004-06-09 2006-01-19 Luciano Conti Neural stem cells
US9309495B2 (en) 2004-06-09 2016-04-12 The University Court Of The University Of Edinburgh Neural stem cells
US8785187B2 (en) 2004-06-09 2014-07-22 The University Court Of The University Of Edinburgh Neural stem cells
US20060008451A1 (en) * 2004-07-06 2006-01-12 Michigan State University In vivo methods for effecting tissue specific differentiation of embryonic stem cells
EP3505622A1 (en) 2004-07-09 2019-07-03 Viacyte, Inc. Preprimitive streak and mesendoderm cells
US20070004038A1 (en) * 2004-07-09 2007-01-04 D Amour Kevin A Preprimitive streak and mesendoderm cells
US7985585B2 (en) 2004-07-09 2011-07-26 Viacyte, Inc. Preprimitive streak and mesendoderm cells
WO2006017134A2 (en) 2004-07-09 2006-02-16 Cythera, Inc. Preprimitive streak and mesendoderm cells
EP2341147A2 (en) 2004-07-09 2011-07-06 Viacyte, Inc. Preprimitive streak and mesendoderm cells
WO2006016999A1 (en) 2004-07-09 2006-02-16 Cythera, Inc. Methods for identifying factors for differentiating definitive endoderm
WO2006017370A2 (en) 2004-07-13 2006-02-16 Geron Corporation Medium for growing human embryonic stem cells
EP2267116A1 (en) 2004-07-13 2010-12-29 Geron Corporation Growth medium for primate embryonic stem cells
US20070281355A1 (en) * 2004-08-13 2007-12-06 Stephen Dalton Compositions And Methods For Self-Renewal And Differentiation In Human Embryonic Stem Cells
US8187878B2 (en) 2004-08-13 2012-05-29 University Of Georgia Research Foundation, Inc. Methods for increasing definitive endoderm differentiation of pluripotent human embryonic stem cells with PI-3 kinase inhibitors
US7416888B2 (en) 2004-09-30 2008-08-26 Reneuron Limited Cell lines
US7666672B2 (en) 2004-09-30 2010-02-23 Reneuron Limited Cell lines
US20080118479A1 (en) * 2004-09-30 2008-05-22 John Sinden Cell Lines
US20060104959A1 (en) * 2004-09-30 2006-05-18 John Sinden Cell lines
US7419827B2 (en) 2004-09-30 2008-09-02 Reneuron Limited Cell lines
US20140356952A1 (en) * 2004-11-04 2014-12-04 Advanced Cell Technology, Inc. Derivation of embryonic stem cells and embryo-derived cells
US9550974B2 (en) 2004-11-04 2017-01-24 Astellas Institute For Regenerative Medicine Derivation of embryonic stem cells
US10072243B2 (en) 2004-11-04 2018-09-11 Astellas Institute For Regenerative Medicine Derivation of embryonic stem cells and embryo-derived cells
US9617512B2 (en) * 2004-11-04 2017-04-11 Astellas Institute For Regenerative Medicine Derivation of embryonic stem cells and embryo-derived cells
US8778673B2 (en) 2004-12-17 2014-07-15 Lifescan, Inc. Seeding cells on porous supports
US20060171930A1 (en) * 2004-12-21 2006-08-03 Agnieszka Seyda Postpartum cells derived from umbilical cord tissue, and methods of making, culturing, and using the same
US20060166361A1 (en) * 2004-12-21 2006-07-27 Agnieszka Seyda Postpartum cells derived from placental tissue, and methods of making, culturing, and using the same
US20060153815A1 (en) * 2004-12-21 2006-07-13 Agnieszka Seyda Tissue engineering devices for the repair and regeneration of tissue
EP1674563A1 (en) * 2004-12-23 2006-06-28 Wolfgang Würfel Isolation of pluripotent embryonic stem cells without destroying the embryo, stem cells obtained by this method and their use
US7875273B2 (en) 2004-12-23 2011-01-25 Ethicon, Incorporated Treatment of Parkinson's disease and related disorders using postpartum derived cells
WO2006071911A2 (en) 2004-12-23 2006-07-06 Cythera, Inc. Expansion of definitive endoderm cells
US20060263879A1 (en) * 2004-12-30 2006-11-23 Stemlifeline, Inc. Methods and systems relating to embryonic stem cell lines
US20060275899A1 (en) * 2004-12-30 2006-12-07 Stemlifeline, Inc. Methods and compositions relating to embryonic stem cell lines
US7883847B2 (en) 2005-04-01 2011-02-08 Wake Forest University Health Sciences Transcriptional profiling of stem cells and their multilineage differentiation
US9062346B2 (en) 2005-04-01 2015-06-23 Wake Forest University Health Sciences Transcriptional profiling of stem cells and their multilineage differentiation
US20060246488A1 (en) * 2005-04-01 2006-11-02 Jason Hipp Transcriptional profiling of stem cells and their multilineage differentiation
US20060286544A1 (en) * 2005-05-17 2006-12-21 Arundhati Mandal Establishment of a human embryonic stem cell line using mammalian cells
US7811817B2 (en) 2005-05-17 2010-10-12 Reliance Life Sciences Pvt. Ltd. Establishment of a human embryonic stem cell line using mammalian cells
US20070122903A1 (en) * 2005-05-27 2007-05-31 Alireza Rezania Amniotic fluid derived cells
US20060280729A1 (en) * 2005-06-08 2006-12-14 Sanjay Mistry Cellular therapy for ocular degeneration
US9074189B2 (en) 2005-06-08 2015-07-07 Janssen Biotech, Inc. Cellular therapy for ocular degeneration
EP3599277A1 (en) 2005-06-22 2020-01-29 Asterias Biotherapeutics, Inc. Suspension culture of human embryonic stem cells
US20060292694A1 (en) * 2005-06-22 2006-12-28 Roslin Institute Reporter hepatocytes and other cells for drug screening and toxicity testing
US20060292695A1 (en) * 2005-06-22 2006-12-28 Roslin Institute Methods and kits for drug screening and toxicity testing using promoter-reporter cells derived from embryonic stem cells
WO2007002136A2 (en) 2005-06-22 2007-01-04 Geron Corporation Differentiation of primate pluripotent stem cells to cardiomyocyte-lineage cells
WO2007002086A2 (en) 2005-06-22 2007-01-04 Geron Corporation Suspension culture of human embryonic stem cells
US10676714B2 (en) 2005-06-22 2020-06-09 Asterias Biotherapeutics, Inc. Suspension culture of human embryonic stem cells
US9074181B2 (en) 2005-06-22 2015-07-07 Asterias Biotherapeutics, Inc. Suspension culture of human embryonic stem cells
US20080152632A1 (en) * 2005-06-22 2008-06-26 Roslin Institute Promoter-reporter cells for determining drug metabolism, drug interactions, and the effects of allotype variation
US20100144033A1 (en) * 2005-06-22 2010-06-10 Ramkumar Mandalam Suspension Culture of Human Embryonic Stem Cells
EP2796544A1 (en) 2005-09-09 2014-10-29 Duke University Tissue engineering methods and compositions
WO2007030811A2 (en) 2005-09-09 2007-03-15 Duke University Tissue engineering methods and compositions
US20070122905A1 (en) * 2005-10-27 2007-05-31 D Amour Kevin A PDX1-expressing dorsal and ventral foregut endoderm
US11427805B2 (en) 2005-10-27 2022-08-30 Viacyte, Inc. Methods of producing human foregut endoderm cells expressing PDX1 from human definitive endoderm
US9499795B2 (en) 2005-10-27 2016-11-22 Viacyte, Inc. PDX1-expressing dorsal and ventral foregut endoderm
EP2674485A1 (en) 2005-10-27 2013-12-18 Viacyte, Inc. PDX1-expressing dorsal and ventral foregut endoderm
EP3584311A1 (en) 2005-10-27 2019-12-25 Viacyte, Inc. Pdx-1 expressing dorsal and ventral foregut endoderm
US20070098696A1 (en) * 2005-10-31 2007-05-03 President And Fellows Of Harvard College Immortalized fibroblasts
US7413900B2 (en) 2005-10-31 2008-08-19 President And Fellows Of Harvard College Immortalized fibroblasts
US20100184160A1 (en) * 2005-11-21 2010-07-22 The Board Of Trustees Of The University Of Arkansas Staphylococus aureus strain cyl1892
US8097446B2 (en) 2005-11-21 2012-01-17 Board Of Trustees Of The University Of Arkansas Staphylococus aureus strain CYL1892
US9175261B2 (en) 2005-12-16 2015-11-03 DePuy Synthes Products, Inc. Human umbilical cord tissue cells for inhibiting adverse immune response in histocompatibility-mismatched transplantation
US20070264269A1 (en) * 2005-12-16 2007-11-15 Ethicon, Incorporated Compositions and methods for inhibiting adverse immune response in histocompatibility-mismatched transplantation
US8741638B2 (en) 2005-12-19 2014-06-03 DePuy Synthes Products, LLC In vitro expansion of postpartum-derived cells in roller bottles
US20070141700A1 (en) * 2005-12-19 2007-06-21 Ethicon, Incorporated In vitro expansion of postpartum-derived cells in roller bottles
US9125906B2 (en) 2005-12-28 2015-09-08 DePuy Synthes Products, Inc. Treatment of peripheral vascular disease using umbilical cord tissue-derived cells
US9585918B2 (en) 2005-12-28 2017-03-07 DePuy Synthes Products, Inc. Treatment of peripheral vascular disease using umbilical cord tissue-derived cells
US20070160588A1 (en) * 2005-12-28 2007-07-12 Ethicon, Incorporated Treatment Of Peripheral Vascular Disease Using Postpartum-Derived Cells
EP2420565A1 (en) 2006-02-23 2012-02-22 ViaCyte, Inc. Compositions and methods useful for culturing differentiable cells
US8658352B2 (en) 2006-02-23 2014-02-25 Viacyte, Inc. Compositions and methods useful for culturing differentiable cells
US8415158B2 (en) 2006-02-23 2013-04-09 Viacyte, Inc. Compositions and methods useful for culturing differentiable cells
US7695965B2 (en) 2006-03-02 2010-04-13 Cythera, Inc. Methods of producing pancreatic hormones
US20090004152A1 (en) * 2006-03-02 2009-01-01 Cythera, Inc. Methods of producing pancreatic hormones
US11896622B2 (en) 2006-03-02 2024-02-13 Viacyte, Inc. Methods of producing pancreatic hormones
US10517901B2 (en) 2006-03-02 2019-12-31 Viacyte, Inc. Methods of lowering blood glucose levels in a mammal
EP4112718A1 (en) 2006-03-02 2023-01-04 ViaCyte, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
US8129182B2 (en) 2006-03-02 2012-03-06 Viacyte, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
US12173323B2 (en) 2006-03-02 2024-12-24 Viacyte, Inc. Methods of using PDX1-positive pancreatic endoderm cells and endocrine precursor cells
US10370645B2 (en) 2006-03-02 2019-08-06 Emory University Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
WO2007103282A2 (en) 2006-03-02 2007-09-13 Cythera, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
US9585917B2 (en) 2006-03-02 2017-03-07 Viacyte, Inc. Methods of producing pancreatic hormones
US11254916B2 (en) 2006-03-02 2022-02-22 Viacyte, Inc. Methods of making and using PDX1-positive pancreatic endoderm cells
US20070259421A1 (en) * 2006-03-02 2007-11-08 D Amour Kevin A Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
EP2650359A1 (en) 2006-03-02 2013-10-16 Viacyte, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
US9980986B2 (en) 2006-03-02 2018-05-29 Viacyte, Inc. Methods of producing pancreatic hormones
US8603811B2 (en) 2006-03-02 2013-12-10 Viacyte, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
US7993920B2 (en) 2006-03-02 2011-08-09 Viacyte, Inc. Methods of producing pancreatic hormones
EP2650360A2 (en) 2006-03-02 2013-10-16 Viacyte, Inc. Endocrine precursor cells, pancreatic hormone-expressing cells and methods of production
EP2422801A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US9383349B2 (en) 2006-03-07 2016-07-05 Geeta Shroff Method of partially differentiating hES cells
US9134299B2 (en) 2006-03-07 2015-09-15 Geeta Shroff Method of isolating human embryonic stem cells in minimal essential medium
EP2422796A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
EP2422797A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US8900861B2 (en) 2006-03-07 2014-12-02 Geeta Shroff Method for storing a preparation of human embryonic stem cells
EP2422799A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
EP2422803A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
EP2422795A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US8592208B2 (en) 2006-03-07 2013-11-26 Geeta Shroff Methods of expanding human embryonic stem cells
EP2422800A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
EP2422798A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
EP2422794A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US9482660B2 (en) 2006-03-07 2016-11-01 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US9804151B2 (en) 2006-03-07 2017-10-31 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US10545135B2 (en) 2006-03-07 2020-01-28 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US9488643B2 (en) 2006-03-07 2016-11-08 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
EP2422802A2 (en) 2006-03-07 2012-02-29 Geeta Shroff Compositions comprising human embryonic stem cells and their derivatives, methods of use, and methods of preparation
US20070269411A1 (en) * 2006-03-10 2007-11-22 Wei Sun Porous silicon materials and devices
US20070248947A1 (en) * 2006-04-10 2007-10-25 Wisconsin Alumni Research Foundation Reagents and Methods for Using Human Embryonic Stem Cells to Evaluate Toxicity of Pharmaceutical Compounds and Other Chemicals
US8703483B2 (en) 2006-04-10 2014-04-22 Wisconsin Alumni Research Foundation Reagents and methods for using human embryonic stem cells to evaluate toxicity of pharmaceutical compounds and other chemicals
US20100297087A1 (en) * 2006-04-11 2010-11-25 Nanodiagnostics Israel., Ltd Pluripotent stem cells characterized by expression of germline specific genes
US8263043B2 (en) 2006-04-14 2012-09-11 Carnegie Mellon University Cellular labeling and quantification for nuclear magnetic resonance techniques
US20070258886A1 (en) * 2006-04-14 2007-11-08 Celsense Inc. Methods for assessing cell labeling
US20070253910A1 (en) * 2006-04-14 2007-11-01 Carnegie Mellon University Cellular labeling and quantification for nuclear magnetic resonance techniques
US7727763B2 (en) 2006-04-17 2010-06-01 Bioe, Llc Differentiation of multi-lineage progenitor cells to respiratory epithelial cells
US20070249047A1 (en) * 2006-04-17 2007-10-25 Bioe, Inc. Differentiation of Multi-Lineage Progenitor Cells to Respiratory Epithelial Cells
US20090298170A1 (en) * 2006-04-28 2009-12-03 D Amour Kevin Hepatocyte lineage cells
US9725699B2 (en) 2006-04-28 2017-08-08 Lifescan, Inc. Differentiation of human embryonic stem cells
EP4438720A2 (en) 2006-04-28 2024-10-02 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
EP3527658A1 (en) 2006-04-28 2019-08-21 Lifescan, Inc. Differentiation of human embryonic stem cells
US20070254359A1 (en) * 2006-04-28 2007-11-01 Lifescan, Inc. Differentiation of human embryonic stem cells
US8741643B2 (en) 2006-04-28 2014-06-03 Lifescan, Inc. Differentiation of pluripotent stem cells to definitive endoderm lineage
US7989204B2 (en) 2006-04-28 2011-08-02 Viacyte, Inc. Hepatocyte lineage cells
US8574905B2 (en) 2006-04-28 2013-11-05 Viacyte, Inc. Hepatocyte lineage cells
US8557295B2 (en) 2006-05-11 2013-10-15 Regenics As Use of cellular extracts for skin rejuvenation
US10092504B2 (en) 2006-05-11 2018-10-09 Regenics As Use of cellular extracts for skin rejuvenation
US9486401B2 (en) 2006-05-11 2016-11-08 Regenics As Use of cellular extracts for skin rejuvenation
US8920848B2 (en) 2006-05-11 2014-12-30 Regenics As Use of cellular extracts for skin rejuvenation
EP2656832A2 (en) 2006-05-11 2013-10-30 Regenics AS Administration of cells and cellular extracts for rejuvenation
US9066883B2 (en) 2006-05-11 2015-06-30 Regenics As Administration of cells and cellular extracts for rejuvenation
US20090274770A1 (en) * 2006-05-11 2009-11-05 Regenics As Cellular extracts
US8075920B2 (en) 2006-05-11 2011-12-13 Regenics A/S Administration of cells and cellular extracts for rejuvenation
US9314488B2 (en) 2006-05-11 2016-04-19 Regenics As Cellular extracts
US10478461B2 (en) 2006-05-11 2019-11-19 Regenics As Cellular extracts
US20090175927A1 (en) * 2006-05-11 2009-07-09 Regenics A/S Administration of cells and cellular extracts for rejuvenation
US9999639B2 (en) 2006-05-11 2018-06-19 Regenics As Cellular extracts
US8460713B2 (en) 2006-05-11 2013-06-11 Regenics As Administration of cells and cellular extracts for rejuvenation
US8877253B2 (en) 2006-05-11 2014-11-04 Regenics As Cellular extracts
US11033587B2 (en) 2006-05-11 2021-06-15 Regenics As Administration of cells and cellular extracts for rejuvenation
US20090298169A1 (en) * 2006-06-02 2009-12-03 The University Of Georgia Research Foundation Pancreatic and Liver Endoderm Cells and Tissue by Differentiation of Definitive Endoderm Cells Obtained from Human Embryonic Stems
US8415153B2 (en) 2006-06-19 2013-04-09 Geron Corporation Differentiation and enrichment of islet-like cells from human pluripotent stem cells
US20080124276A1 (en) * 2006-07-24 2008-05-29 Lifeline Cell Technology Synthetic cornea from retinal stem cells
WO2008013557A1 (en) 2006-07-24 2008-01-31 International Stem Cell Corporation Synthetic cornea from retinal stem cells
US20100068187A1 (en) * 2006-08-31 2010-03-18 Roisen Fred J Transcription factors for differentiation of adult human olfactory progenitor cells
US20100323442A1 (en) * 2006-10-17 2010-12-23 Emmanuel Edward Baetge Modulation of the phosphatidylinositol-3-kinase pathway in the differentiation of human embryonic stem cells
US9458471B2 (en) 2006-11-03 2016-10-04 The Trustees Of Princeton University Engineered cellular pathways for programmed autoregulation of differentiation
US20100285584A1 (en) * 2006-11-03 2010-11-11 Ron Weiss Engineered cellular pathways for programmed autoregulation of differentiation
US8685720B2 (en) 2006-11-03 2014-04-01 The Trustees Of Princeton University Engineered cellular pathways for programmed autoregulation of differentiation
US9005964B2 (en) 2006-11-24 2015-04-14 Regents Of The University Of Minnesota Endodermal progenitor cells
US20100150876A1 (en) * 2006-11-24 2010-06-17 Regents Of The Univeristy Of Minnesota Endodermal progenitor cells
WO2008087257A1 (en) 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel methods and reagents directed to production of cells
WO2008087258A1 (en) 2007-01-18 2008-07-24 Suomen Punainen Risti, Veripalvelu Novel carbohydrate from human cells and methods for analysis and modification thereof
US9873862B2 (en) 2007-01-22 2018-01-23 The Board Of Trustees Of The University Of Arkansas Maintenance and propagation of mesenchymal stem cells
US8084023B2 (en) 2007-01-22 2011-12-27 The Board Of Trustees Of The University Of Arkansas Maintenance and propagation of mesenchymal stem cells
US8961955B2 (en) 2007-01-22 2015-02-24 The Board Of Trustees Of The University Of Arkansas Maintenance and propagation of mesenchymal stem cells
US10676718B2 (en) 2007-01-22 2020-06-09 The Board Of Trustees Of The University Of Arkansas Maintenance and propagation of mesenchymal stem cells
US8388947B2 (en) 2007-01-22 2013-03-05 The Board Of Trustees Of The University Of Arkansas Maintenance and propagation of mesenchymal stem cells
US20080175816A1 (en) * 2007-01-22 2008-07-24 Board Of Trustees Of The University Of Arkansas Maintenance and Propagation of Mesenchymal Stem Cells
US20080200369A1 (en) * 2007-02-08 2008-08-21 Michiko Fukuda Trophinin-Binding Peptides and Uses Thereof
US8097588B2 (en) 2007-02-08 2012-01-17 Sanford-Burnham Medical Research Institute Trophinin-binding peptides and uses thereof
US10584313B2 (en) 2007-02-23 2020-03-10 Astellas Institute For Regenerative Medicine Method of producing a differentiated mammalian cell comprising culturing a single mammalian blastomere
US20100105043A1 (en) * 2007-03-26 2010-04-29 Ko Minoru S H Methods for modulating embryonic stem cell differentiation
US8617813B2 (en) 2007-03-26 2013-12-31 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for modulating embryonic stem cell differentiation
US20080267874A1 (en) * 2007-03-28 2008-10-30 The Buck Institute For Age Research Targeted Neuronal And Glial Human Embryonic Stem Cell Line
US20110076678A1 (en) * 2007-04-07 2011-03-31 Rudolf Jaenisch Reprogramming of somatic cells
US10093904B2 (en) 2007-04-07 2018-10-09 Whitehead Institute For Biomedical Research Reprogramming of somatic cells
US9382515B2 (en) 2007-04-07 2016-07-05 Whitehead Institute For Biomedical Research Reprogramming of somatic cells
US9714414B2 (en) 2007-04-07 2017-07-25 Whitehead Institute For Biomedical Research Reprogramming of somatic cells
US8815585B2 (en) 2007-06-29 2014-08-26 Cellular Dynamics International, Inc. Automated method and apparatus for embryonic stem cell culture
EP3293256A1 (en) 2007-06-29 2018-03-14 Cellular Dynamics International, Inc. Automated method and apparatus for embryonic stem cell culture
US20090029462A1 (en) * 2007-06-29 2009-01-29 Cellular Dynamics International, Inc. Automated method and apparatus for embryonic stem cell culture
US20090325294A1 (en) * 2007-07-01 2009-12-31 Shelley Nelson Single pluripotent stem cell culture
US9080145B2 (en) 2007-07-01 2015-07-14 Lifescan Corporation Single pluripotent stem cell culture
US10316293B2 (en) 2007-07-01 2019-06-11 Janssen Biotech, Inc. Methods for producing single pluripotent stem cells and differentiation thereof
US20090074673A1 (en) * 2007-07-10 2009-03-19 Carnegie Mellon University Compositions and methods for producing cellular labels for nuclear magnetic resonance techniques
US8227610B2 (en) 2007-07-10 2012-07-24 Carnegie Mellon University Compositions and methods for producing cellular labels for nuclear magnetic resonance techniques
EP3957716A1 (en) 2007-07-18 2022-02-23 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
EP2562248A1 (en) 2007-07-18 2013-02-27 Lifescan, Inc. Differentiation of human embryonic stem cells
US20090029463A1 (en) * 2007-07-25 2009-01-29 Bioe, Inc. Differentiation of Multi-Lineage Progenitor Cells to Chondrocytes
US20100015100A1 (en) * 2007-07-31 2010-01-21 Jean Xu Differentiation of human embryonic stem cells
EP2584034A1 (en) 2007-07-31 2013-04-24 Lifescan, Inc. Pluripotent stem cell differentiation by using human feeder cells
EP2610336A1 (en) 2007-07-31 2013-07-03 Lifescan, Inc. Differentiation of human embryonic stem cells
US9096832B2 (en) 2007-07-31 2015-08-04 Lifescan, Inc. Differentiation of human embryonic stem cells
US9744195B2 (en) 2007-07-31 2017-08-29 Lifescan, Inc. Differentiation of human embryonic stem cells
US10456424B2 (en) 2007-07-31 2019-10-29 Janssen Biotech, Inc. Pancreatic endocrine cells and methods thereof
WO2009026106A1 (en) 2007-08-16 2009-02-26 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Methods for promoting stem cell proliferation and survival
EP3078738A1 (en) 2007-08-31 2016-10-12 Whitehead Institute for Biomedical Research Wnt pathway stimulation in reprogramming somatic cells
WO2009032194A1 (en) 2007-08-31 2009-03-12 Whitehead Institute For Biomedical Research Wnt pathway stimulation in reprogramming somatic cells
US7993916B2 (en) 2007-09-24 2011-08-09 Viacyte, Inc. Methods for increasing definitive endoderm production
US7695963B2 (en) 2007-09-24 2010-04-13 Cythera, Inc. Methods for increasing definitive endoderm production
US20090092653A1 (en) * 2007-10-05 2009-04-09 Ethicon, Incorporated Repair and regeneration of renal tissue using human umbilical cord tissue-derived cells
US8034329B2 (en) 2007-10-05 2011-10-11 Advanced Technologies And Regenerative Medicine, Llc Repair and regeneration of renal tissue using human umbilical cord tissue-derived cells
EP3375867A1 (en) 2007-10-19 2018-09-19 ViaCyte, Inc. Feeder-free culture system
WO2009052505A1 (en) 2007-10-19 2009-04-23 Bresagen, Inc. Feeder-free pluripotent stem cell media containing human serum
EP4368701A2 (en) 2007-10-19 2024-05-15 ViaCyte, Inc. Feeder-free culture system
US20090104696A1 (en) * 2007-10-19 2009-04-23 Robins Allan J Methods and Compositions for Feeder-Free Pluripotent Stem Cell Media Containing Human Serum
US8623650B2 (en) 2007-10-19 2014-01-07 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US8334138B2 (en) 2007-10-19 2012-12-18 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US10808223B2 (en) 2007-10-19 2020-10-20 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US9267110B2 (en) 2007-10-19 2016-02-23 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US11920154B2 (en) 2007-10-19 2024-03-05 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US10246680B2 (en) 2007-10-19 2019-04-02 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US20100311164A1 (en) * 2007-10-19 2010-12-09 Viacyte, Inc. Methods and compositions for feeder-free pluripotent stem cell media containing human serum
US9062290B2 (en) 2007-11-27 2015-06-23 Lifescan, Inc. Differentiation of human embryonic stem cells
US20090170198A1 (en) * 2007-11-27 2009-07-02 Alireza Rezania Differentiation of human embryonic stem cells
US9969982B2 (en) 2007-11-27 2018-05-15 Lifescan, Inc. Differentiation of human embryonic stem cells
US8609413B2 (en) 2007-12-11 2013-12-17 Research Development Foundation Neurons, astrocytes and oligodendrocytes differentiated from a mammalian pluripotent or neural stem cells exposed to a pyridine deriviative
US20110046092A1 (en) * 2007-12-11 2011-02-24 Research Development Foundation Small molecules for neuronal differentiation of embryonic stem cells
US20090166178A1 (en) * 2007-12-20 2009-07-02 Ethicon, Incorporated Methods for sterilizing materials containing biologically active agents
US8574897B2 (en) 2007-12-20 2013-11-05 DePuy Synthes Products, LLC Methods for sterilizing materials containing biologically active agents
US8236538B2 (en) 2007-12-20 2012-08-07 Advanced Technologies And Regenerative Medicine, Llc Methods for sterilizing materials containing biologically active agents
WO2009092092A1 (en) 2008-01-18 2009-07-23 Regents Of The University Of Minnesota Stem cell aggregates and methods for making and using
US8513009B2 (en) 2008-01-30 2013-08-20 Geron Corporation Synthetic surfaces for culturing stem cell derived oligodendrocyte progenitor cells
US10221390B2 (en) 2008-01-30 2019-03-05 Asterias Biotherapeutics, Inc. Synthetic surfaces for culturing stem cell derived oligodendrocyte progenitor cells
US20090191626A1 (en) * 2008-01-30 2009-07-30 Christopher Bankole Shogbon Synthetic Surfaces for Culturing Stem Cell Derived Oligodendrocyte Progenitor Cells
US10066203B2 (en) 2008-02-21 2018-09-04 Janssen Biotech Inc. Methods, surface modified plates and compositions for cell attachment, cultivation and detachment
US11001802B2 (en) 2008-02-21 2021-05-11 Nunc A/S Surface of a vessel with polystyrene, nitrogen, oxygen and a static sessile contact angle for attachment and cultivation of cells
EP2100954A1 (en) 2008-03-10 2009-09-16 Assistance Publique - Hopitaux de Paris Method for generating primate cardiac progenitor cells for clinical use from primate embryonic stem cells, and their applications
US9068170B2 (en) 2008-03-17 2015-06-30 The Scripps Research Institute Generation of pluripotent stem cells using recombinant proteins
US9534205B2 (en) 2008-03-17 2017-01-03 The Scripps Research Institute Combined chemical and genetic approaches for generation of induced pluripotent stem cells
US20100233804A1 (en) * 2008-03-17 2010-09-16 The Scripps Research Institute Generation of pluripotent stem cells using recombinant proteins
US9926533B2 (en) 2008-03-17 2018-03-27 The Scripps Research Institute Combined chemical and genetic approaches for generation of induced pluripotent stem cells
US20110110899A1 (en) * 2008-03-17 2011-05-12 Scripps Research Institute Combined Chemical and Genetic Approaches for Generation of Induced Pluripotent Stem Cells
US9771563B2 (en) 2008-03-17 2017-09-26 The Scripps Research Institute Chemical approaches for generation of induced pluripotent stem cells
US9394524B2 (en) 2008-03-17 2016-07-19 The Scripps Research Institute Chemical approaches for generation of induced pluripotent stem cells
US9540615B2 (en) 2008-03-17 2017-01-10 The Scripps Research Institute Combined chemical and genetic approaches for generation of induced pluripotent stem cells
US20100267141A1 (en) * 2008-03-17 2010-10-21 The Scripps Research Institute Chemical approaches for generation of induced pluripotent stem cells
WO2009120891A2 (en) 2008-03-27 2009-10-01 Geron Corporation Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
US20090246869A1 (en) * 2008-03-27 2009-10-01 Geron Corporation Differentiation of Primate Pluripotent Stem Cells to Hematopoietic Lineage Cells
EP3293255A1 (en) 2008-03-27 2018-03-14 Asterias Biotherapeutics, Inc. Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
US10344262B2 (en) 2008-03-27 2019-07-09 Asterias Biotherapeutics, Inc. Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
US8093049B2 (en) 2008-03-27 2012-01-10 Geron Corporation Differentiation of primate pluripotent stem cells to hematopoietic lineage cells
US20090263896A1 (en) * 2008-04-21 2009-10-22 Olivia Kelly Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
US9045736B2 (en) 2008-04-21 2015-06-02 Viacyte, Inc. Methods for enriching for pancreatic endocrine cells
US8338170B2 (en) 2008-04-21 2012-12-25 Viacyte, Inc. Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
US10266808B2 (en) 2008-04-21 2019-04-23 Viacyte, Inc. Method of enriching for pancreatic endocrine cells that express chromogranin A
US9506034B2 (en) 2008-04-21 2016-11-29 Viacyte, Inc. Method of enriching for pancreatic endoderm cells
WO2009131568A1 (en) 2008-04-21 2009-10-29 Cythera, Inc. Methods for purifying endoderm and pancreatic endoderm cells derived from human embryonic stem cells
EP2727998A2 (en) 2008-04-21 2014-05-07 Viacyte, Inc. Methods for purifying pancreatic endoderm cells derived from human embryonic stem cells
EP2669366A2 (en) 2008-04-24 2013-12-04 Janssen Biotech, Inc. Pluripotent cells
US7939322B2 (en) 2008-04-24 2011-05-10 Centocor Ortho Biotech Inc. Cells expressing pluripotency markers and expressing markers characteristic of the definitive endoderm
US8623648B2 (en) 2008-04-24 2014-01-07 Janssen Biotech, Inc. Treatment of pluripotent cells
US9845460B2 (en) 2008-04-24 2017-12-19 Janssen Biotech, Inc. Treatment of pluripotent cells
USRE43876E1 (en) 2008-04-24 2012-12-25 Centocor Ortho Biotech Inc. Cells expressing pluripotency markers and expressing markers characteristic of the definitive endoderm
US20090269845A1 (en) * 2008-04-24 2009-10-29 Alireza Rezania Pluripotent cells
US20090325293A1 (en) * 2008-04-24 2009-12-31 Janet Davis Treatment of pluripotent cells
EP3327114A1 (en) 2008-04-24 2018-05-30 Janssen Biotech, Inc. Pluripotent cells
EP3851520A1 (en) 2008-04-30 2021-07-21 SanBio, Inc. Neural regenerating cells with alterations in dna methylation
US20110136114A1 (en) * 2008-04-30 2011-06-09 Sanbio Inc. Neural regenerating cells with alterations in dna methylation
EP3118308A1 (en) 2008-04-30 2017-01-18 SanBio, Inc. Neural regenerating cells with alterations in dna methylation
US10316288B2 (en) 2008-04-30 2019-06-11 Sanbio, Inc. Neural regenerating cells with alterations in DNA methylation
US20110110863A1 (en) * 2008-05-02 2011-05-12 Celsense, Inc. Compositions and methods for producing emulsions for nuclear magnetic resonance techniques and other applications
US20090280096A1 (en) * 2008-05-09 2009-11-12 Atsushi Kubo Pancreatic endocrine progenitor cells derived from pluripotent stem cells
US20090291494A1 (en) * 2008-05-21 2009-11-26 Bioe, Inc. Differentiation of Multi-Lineage Progenitor Cells to Pancreatic Cells
EP2993226A1 (en) 2008-06-03 2016-03-09 Viacyte, Inc. Growth factors for production of definitive endoderm
US20090298178A1 (en) * 2008-06-03 2009-12-03 D Amour Kevin Allen Growth factors for production of definitive endoderm
US9644184B2 (en) 2008-06-04 2017-05-09 Cellular Dynamics International, Inc. Methods for the production of IPS cells using Epstein-Barr (EBV)-based reprogramming vectors
US9497943B2 (en) 2008-06-13 2016-11-22 Whitehead Institute For Biomedical Research Nucleic acid constructs encoding reprogramming factors linked by self-cleaving peptides
US11851670B2 (en) 2008-06-13 2023-12-26 Whitehead Institute For Biomedical Research Nucleic acid constructs encoding reprogramming factors linked by self-cleaving peptides
US10233421B2 (en) 2008-06-30 2019-03-19 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
EP2942392A1 (en) 2008-06-30 2015-11-11 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
US9593305B2 (en) 2008-06-30 2017-03-14 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
US10351820B2 (en) 2008-06-30 2019-07-16 Janssen Biotech, Inc. Methods for making definitive endoderm using at least GDF-8
US20100015711A1 (en) * 2008-06-30 2010-01-21 Janet Davis Differentiation of Pluripotent Stem Cells
US9593306B2 (en) 2008-06-30 2017-03-14 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
US20100028307A1 (en) * 2008-07-31 2010-02-04 O'neil John J Pluripotent stem cell differentiation
EP3517605A1 (en) 2008-10-31 2019-07-31 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US20100112693A1 (en) * 2008-10-31 2010-05-06 Alireza Rezania Differentiation of Human Embryonic Stem Cells
US9012218B2 (en) 2008-10-31 2015-04-21 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US20100112692A1 (en) * 2008-10-31 2010-05-06 Alireza Rezania Differentiation of Human Embryonic Stem Cells
US9234178B2 (en) 2008-10-31 2016-01-12 Janssen Biotech, Inc. Differentiation of human pluripotent stem cells
US9388387B2 (en) 2008-10-31 2016-07-12 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9752126B2 (en) 2008-10-31 2017-09-05 Janssen Biotech, Inc. Differentiation of human pluripotent stem cells
WO2010053472A1 (en) 2008-11-04 2010-05-14 Novocell, Inc. Stem cell aggregate suspension compositions and methods for differentiation thereof
EP3550012A1 (en) 2008-11-04 2019-10-09 ViaCyte, Inc. Stem cell aggregate suspension compositions and methods for differentiation thereof
US20100124564A1 (en) * 2008-11-14 2010-05-20 Laura Martinson Encapsulation of pancreatic cells derived from human pluripotent stem cells
US8425928B2 (en) 2008-11-14 2013-04-23 Viacyte, Inc. Encapsulation of pancreatic cells derived from human pluripotent stem cells
US9913930B2 (en) 2008-11-14 2018-03-13 Viacyte, Inc. Encapsulation of pancreatic cells derived from human pluripotent stem cells
US9132226B2 (en) 2008-11-14 2015-09-15 Viacyte, Inc. Encapsulation of pancreatic cells derived from human pluripotent stem cells
US8278106B2 (en) 2008-11-14 2012-10-02 Viacyte, Inc. Encapsulation of pancreatic cells derived from human pluripotent stem cells
US10272179B2 (en) 2008-11-14 2019-04-30 Viacyte, Inc. Encapsulation of pancreatic cells derived from human pluripotent stem cells
US11660377B2 (en) 2008-11-14 2023-05-30 Viacyte, Inc. Cryopreserved in vitro cell culture of human pancreatic progenitor cells
US9764062B2 (en) 2008-11-14 2017-09-19 Viacyte, Inc. Encapsulation of pancreatic cells derived from human pluripotent stem cells
US9969972B2 (en) 2008-11-20 2018-05-15 Janssen Biotech, Inc. Pluripotent stem cell culture on micro-carriers
US20100124783A1 (en) * 2008-11-20 2010-05-20 Ya Xiong Chen Methods and Compositions for Cell Attachment and Cultivation on Planar Substrates
US9969973B2 (en) 2008-11-20 2018-05-15 Janssen Biotech, Inc. Methods and compositions for cell attachment and cultivation on planar substrates
US9695395B2 (en) 2008-12-17 2017-07-04 The Scripps Research Institute Generation and maintenance of stem cells
WO2010077955A1 (en) 2008-12-17 2010-07-08 The Scripps Research Institute Generation and maintenance of stem cells
US12054741B2 (en) 2008-12-17 2024-08-06 The Scripps Research Institute Generation and maintenance of stem cells
EP3312269A1 (en) 2008-12-17 2018-04-25 The Scripps Research Institute Generation and maintenance of stem cells
US8906677B2 (en) 2008-12-17 2014-12-09 The Scripps Research Institute Generation and maintenance of stem cells
US10179900B2 (en) 2008-12-19 2019-01-15 DePuy Synthes Products, Inc. Conditioned media and methods of making a conditioned media
US10557116B2 (en) 2008-12-19 2020-02-11 DePuy Synthes Products, Inc. Treatment of lung and pulmonary diseases and disorders
US20100158880A1 (en) * 2008-12-19 2010-06-24 Ethicon, Incorporated Regeneration and repair of neural tissue following injury
US20100159588A1 (en) * 2008-12-19 2010-06-24 Ethicon, Incorporated Conditioned media and methods of making a conditioned media
US10400214B2 (en) 2008-12-23 2019-09-03 Boco Silicon Valley, Inc. Target populations of oligodendrocyte precursor cells and methods of making and using same
US20100209399A1 (en) * 2009-02-13 2010-08-19 Celavie Biosciences, Llc Brain-derived stem cells for repair of musculoskeletal system in vertebrate subjects
EP2233566A1 (en) 2009-03-17 2010-09-29 Vrije Universiteit Brussel Generation of pancreatic progenitor cells
US9943552B2 (en) 2009-03-26 2018-04-17 DePuy Synthes Products, Inc. hUTC as therapy for Alzheimer's disease
US20100247499A1 (en) * 2009-03-26 2010-09-30 Ethicon, Inc. hUTC AS THERAPY FOR ALZHEIMER'S DISEASE
US8722034B2 (en) 2009-03-26 2014-05-13 Depuy Synthes Products Llc hUTC as therapy for Alzheimer's disease
WO2010116148A1 (en) 2009-04-09 2010-10-14 Antoxis Limited Use of compounds for differentiation of cells
US20100272695A1 (en) * 2009-04-22 2010-10-28 Alan Agulnick Cell compositions derived from dedifferentiated reprogrammed cells
US9988604B2 (en) 2009-04-22 2018-06-05 Viacyte, Inc. Cell compositions derived from dedifferentiated reprogrammed cells
US9982235B2 (en) 2009-04-22 2018-05-29 Viacyte, Inc. Cell compositions derived from dedifferentiated reprogrammed cells
US11905530B2 (en) 2009-04-22 2024-02-20 Viacyte, Inc. Cell encapsulation device comprising a pancreatic progenitor cell population
EP3904505A1 (en) 2009-04-22 2021-11-03 Viacyte, Inc. Cell compositions derived from dedifferentiated reprogrammed cells
US9109245B2 (en) 2009-04-22 2015-08-18 Viacyte, Inc. Cell compositions derived from dedifferentiated reprogrammed cells
WO2010144696A1 (en) 2009-06-11 2010-12-16 Burnham Institute For Medical Research Directed differentiation of stem cells
US8193235B2 (en) 2009-06-12 2012-06-05 University Of Kansas Compositions and methods for establishing and maintaining stem cells in an undifferentiated state
US20100317100A1 (en) * 2009-06-12 2010-12-16 Soumen Paul Compositions and methods for establishing and maintaining stem cells in an undifferentiated state
WO2010149346A1 (en) 2009-06-26 2010-12-29 Ge Healthcare Uk Limited Methods for predicting the toxicity of a chemical
WO2011005326A1 (en) 2009-07-09 2011-01-13 Massachusetts Institute Of Technology Methods and compositions for increased safety of stem cell-derived populations
US20110014702A1 (en) * 2009-07-20 2011-01-20 Jean Xu Differentiation of Human Embryonic Stem Cells
US8785185B2 (en) 2009-07-20 2014-07-22 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US10076544B2 (en) 2009-07-20 2018-09-18 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US20110014703A1 (en) * 2009-07-20 2011-01-20 Jean Xu Differentiation of Human Embryonic Stem Cells
WO2011011302A2 (en) 2009-07-20 2011-01-27 Centocor Ortho Biotech Inc. Differentiation of human embryonic stem cells
WO2011011300A2 (en) 2009-07-20 2011-01-27 Centocor Ortho Biotech Inc. Differentiation of human embryonic stem cells
US10471104B2 (en) 2009-07-20 2019-11-12 Janssen Biotech, Inc. Lowering blood glucose
WO2011011349A2 (en) 2009-07-20 2011-01-27 Centocor Ortho Biotech Inc. Differentiation of human embryonic stem cells
US8785184B2 (en) 2009-07-20 2014-07-22 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
EP3831930A1 (en) 2009-07-21 2021-06-09 ABT Holding Company Use of stem cells to reduce leukocyte extravasation
WO2011011477A1 (en) 2009-07-21 2011-01-27 Abt Holding Company Use of stem cells to reduce leukocyte extravasation
WO2011011500A1 (en) 2009-07-21 2011-01-27 Abt Holding Company Use of stem cells to reduce leukocyte extravasation
US9074224B2 (en) 2009-08-03 2015-07-07 Recombinetics, Inc. Methods and compositions for targeted gene modification
WO2011017315A2 (en) 2009-08-03 2011-02-10 Recombinetics, Inc. Methods and compositions for targeted gene modification
US20110059160A1 (en) * 2009-08-03 2011-03-10 Essner Jeffrey J Methods and compositions for targeted gene modification
WO2011025736A1 (en) 2009-08-22 2011-03-03 The Board Of Trustees Of The Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP3805762A1 (en) 2009-08-22 2021-04-14 The Board of Trustees of the Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP2615460A1 (en) 2009-08-22 2013-07-17 The Board Of Trustees Of The University Of the Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP2827150A1 (en) 2009-08-22 2015-01-21 The Board Of Trustees Of The University Of the Leland Stanford Junior University Imaging and evaluating embryos, oocytes, and stem cells
EP3222723A1 (en) 2009-08-26 2017-09-27 Shi-Lung Lin Development of universal cancer drugs and vaccines
WO2011025566A1 (en) 2009-08-26 2011-03-03 Shi-Lung Lin Development of universal cancer drugs and vaccines
US8741649B2 (en) 2009-09-04 2014-06-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for enhancing genome stability and telomere elongation in embryonic stem cells
WO2011028880A2 (en) 2009-09-04 2011-03-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for enhancing genome stability and telomere elongation in embryonic stem cells
US9012223B2 (en) 2009-09-04 2015-04-21 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for enhancing genome stability and telomere elongation in embryonic stem cells
US9005968B2 (en) 2009-10-16 2015-04-14 The Scripps Research Institute Induction of pluripotent cells
US11046933B2 (en) 2009-10-16 2021-06-29 The Scripps Research Institute Induction of pluripotent cells
US12195762B2 (en) 2009-10-16 2025-01-14 The Scripps Research Institute Induction of pluripotent cells
US9909105B2 (en) 2009-10-16 2018-03-06 The Scripps Research Institute Induction of pluripotent cells
EP4364797A2 (en) 2009-10-19 2024-05-08 FUJIFILM Cellular Dynamics, Inc. Cardiomyocyte production
EP3255142A1 (en) 2009-10-19 2017-12-13 Cellular Dynamics International, Inc. Cardiomyocyte production
US20110104805A1 (en) * 2009-10-29 2011-05-05 Centocor Ortho Biotech Inc. Pluripotent Stem Cells
US9808489B2 (en) 2009-11-09 2017-11-07 Aal Scientifics, Inc. Treatment of heart disease
US10568912B2 (en) 2009-11-09 2020-02-25 Aal Scientifics, Inc. Treatment of heart disease
US20110136681A1 (en) * 2009-12-02 2011-06-09 Olivier Preynat-Seauve Selection of stem cell clones with defined differentiation capabilities
US10947499B2 (en) 2009-12-02 2021-03-16 Research Development Foundation Selection of stem cell clones with defined differentiation capabilities
US20110151561A1 (en) * 2009-12-23 2011-06-23 Janet Davis Differentiation of human embryonic stem cells
US9133439B2 (en) 2009-12-23 2015-09-15 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US10704025B2 (en) 2009-12-23 2020-07-07 Janssen Biotech, Inc. Use of noggin, an ALK5 inhibitor and a protein kinase c activator to produce endocrine cells
US9593310B2 (en) 2009-12-23 2017-03-14 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US20110151560A1 (en) * 2009-12-23 2011-06-23 Jean Xu Differentiation of human embryonic stem cells
EP4410991A2 (en) 2009-12-23 2024-08-07 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9150833B2 (en) 2009-12-23 2015-10-06 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
WO2011091945A1 (en) 2010-01-26 2011-08-04 Université Libre de Bruxelles Tools for isolating and following cardiovascular progenitor cells
WO2011091944A1 (en) 2010-01-26 2011-08-04 Université Libre de Bruxelles Tools for isolating and following cardiovascular progenitor cells
WO2011106521A1 (en) 2010-02-25 2011-09-01 Abt Holding Company Modulation of macrophage activation
WO2011106365A1 (en) 2010-02-25 2011-09-01 Abt Holding Company Modulation of angiogenesis
EP3940060A1 (en) 2010-02-25 2022-01-19 ABT Holding Company Modulation of macrophage activation
US9969981B2 (en) 2010-03-01 2018-05-15 Janssen Biotech, Inc. Methods for purifying cells derived from pluripotent stem cells
US20110212067A1 (en) * 2010-03-01 2011-09-01 Centocor Ortho Biotech Inc. Methods for Purifying Cells Derived from Pluripotent Stem Cells
US10329534B2 (en) 2010-03-01 2019-06-25 Janssen Biotech, Inc. Methods for purifying cells derived from pluripotent stem cells
US8703424B2 (en) 2010-03-22 2014-04-22 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomics
WO2011119637A1 (en) 2010-03-22 2011-09-29 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomics
US10473641B2 (en) 2010-03-22 2019-11-12 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomics
WO2011119507A2 (en) 2010-03-25 2011-09-29 International Stem Cell Corporation Method of altering the differentiative state of a cell and compositions thereof
US9657274B2 (en) 2010-03-31 2017-05-23 The Scripps Research Institute Reprogramming cells
US9315779B2 (en) 2010-03-31 2016-04-19 The Scripps Research Institute Reprogramming cells
US10214729B2 (en) 2010-03-31 2019-02-26 The Scripps Research Institute Reprogramming cells
US10738281B2 (en) 2010-03-31 2020-08-11 The Scripps Research Institute Reprogramming cells
WO2011124894A1 (en) 2010-04-08 2011-10-13 The University Court Of The University Of Edinburgh Chondrogenic progenitor cells, protocol for derivation of cells and uses thereof
US8815592B2 (en) 2010-04-21 2014-08-26 Research Development Foundation Methods and compositions related to dopaminergic neuronal cells
WO2011133284A1 (en) 2010-04-22 2011-10-27 Oregon Health & Science University Fumarylacetoacetate hydrolase (fah)-deficient pigs and uses thereof
EP3502254A1 (en) 2010-04-23 2019-06-26 Cold Spring Harbor Laboratory Novel structurally designed shrnas
WO2011133889A2 (en) 2010-04-23 2011-10-27 Cold Spring Harbor Laboratory NOVEL STRUCTURALLY DESIGNED shRNAs
US9752125B2 (en) 2010-05-12 2017-09-05 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
WO2011143415A1 (en) 2010-05-12 2011-11-17 Abt Holding Company Modulation of splenocytes in cell therapy
EP3498825A1 (en) 2010-05-12 2019-06-19 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9556417B2 (en) 2010-06-14 2017-01-31 The Scripps Research Institute Reprogramming of cells to a new fate
US10308912B2 (en) 2010-06-14 2019-06-04 The Scripps Research Institute Reprogramming of cells to a new fate
US10934528B2 (en) 2010-06-14 2021-03-02 The Scripps Research Institute Reprogramming of cells to a new fate
US9376664B2 (en) 2010-06-14 2016-06-28 The Scripps Research Institute Reprogramming of cells to a new fate
WO2011158125A2 (en) 2010-06-17 2011-12-22 Katholieke Universiteit Leuven Methods for differentiating cells into hepatic stellate cells and hepatic sinusoidal endothelial cells, cells produced by the methods, and methods for using the cells
WO2011160128A2 (en) 2010-06-18 2011-12-22 Cellular Dynamics International, Inc. Cardiomyocyte medium with dialyzed serum
US9365826B2 (en) 2010-06-18 2016-06-14 Cellular Dynamics International, Inc. Cardiomyocyte medium with dialyzed serum
US8841123B2 (en) 2010-07-01 2014-09-23 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions
US9994826B2 (en) 2010-07-01 2018-06-12 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions
US8481308B2 (en) 2010-07-01 2013-07-09 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions
EP4202040A1 (en) 2010-07-01 2023-06-28 Regenerative Research Foundation Methods for culturing undifferentiated cells using sustained release compositions
US11154639B2 (en) 2010-07-12 2021-10-26 University Of Southern California Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same
US10188769B2 (en) 2010-07-12 2019-01-29 University Of Southern California Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same
US8808687B2 (en) 2010-07-12 2014-08-19 Mark Humayun Biocompatible substrate for facilitating interconnections between stem cells and target tissues and methods for implanting same
WO2012021698A2 (en) 2010-08-12 2012-02-16 Janssen Biotech, Inc. Treatment of diabetes with pancreatic endocrine precursor cells
EP3981415A1 (en) 2010-08-12 2022-04-13 Janssen Biotech, Inc. Treatment of diabetes with pancreatic endocrine precursor cells
WO2012027358A1 (en) 2010-08-23 2012-03-01 President And Fellows Of Harvard College Optogenetic probes for measuring membrane potential
WO2012027474A1 (en) 2010-08-24 2012-03-01 Regents Of The University Of Minnesota Non-static suspension culture of cell aggregates
US9528090B2 (en) 2010-08-31 2016-12-27 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9181528B2 (en) 2010-08-31 2015-11-10 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
US9458430B2 (en) 2010-08-31 2016-10-04 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
EP3211070A1 (en) 2010-08-31 2017-08-30 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
EP3372672A1 (en) 2010-08-31 2018-09-12 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9951314B2 (en) 2010-08-31 2018-04-24 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
US9506036B2 (en) 2010-08-31 2016-11-29 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
EP2853589A1 (en) 2010-08-31 2015-04-01 Janssen Biotech, Inc. Differentiation of human embryonic stem cells
WO2012030540A2 (en) 2010-08-31 2012-03-08 Janssen Biotech, Inc. Differentiation of pluripotent stem cells
WO2012030919A2 (en) 2010-09-01 2012-03-08 Thomas Jefferson University Composition and method for muscle repair and regeneration
EP3721880A1 (en) 2010-09-01 2020-10-14 Thomas Jefferson University Composition and method for muscle repair and regeneration
EP4066826A1 (en) 2010-09-01 2022-10-05 Thomas Jefferson University Retinoic acid receptor gamma agonists for muscle repair and regeneration
US9617511B2 (en) 2010-09-07 2017-04-11 The Board Of Regents Of The University Of Texas System Tissue-specific differentiation matrices and uses thereof
WO2012037456A1 (en) 2010-09-17 2012-03-22 President And Fellows Of Harvard College Functional genomics assay for characterizing pluripotent stem cell utility and safety
WO2012044979A2 (en) 2010-10-01 2012-04-05 The Goverment Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Manipulation of stem cell function by p53 isoforms
US10870827B2 (en) 2010-10-08 2020-12-22 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11773363B2 (en) 2010-10-08 2023-10-03 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11746319B2 (en) 2010-10-08 2023-09-05 Terumo Bct, Inc. Customizable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US11613727B2 (en) 2010-10-08 2023-03-28 Terumo Bct, Inc. Configurable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US10669519B2 (en) 2010-10-08 2020-06-02 Terumo Bct, Inc. Customizable methods and systems of growing and harvesting cells in a hollow fiber bioreactor system
US10844356B2 (en) 2010-12-22 2020-11-24 Fate Therapeutics, Inc. Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs
US12415989B2 (en) 2010-12-22 2025-09-16 Fate Therapeutics, Inc. Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs
US9732319B2 (en) 2010-12-22 2017-08-15 Fate Therapeutics, Inc. Cell culture platform for single cell sorting and enhanced reprogramming of iPSCs
WO2012101181A1 (en) 2011-01-25 2012-08-02 Université Catholique de Louvain Compositions and methods for cell transplantation
WO2012116185A1 (en) 2011-02-23 2012-08-30 The Board Of Trustees Of The Leland Stanford Junior University Methods of detecting aneuploidy in human embryos
EP3498818A1 (en) 2011-02-28 2019-06-19 President and Fellows of Harvard College Cell culture system
WO2012135253A1 (en) 2011-03-29 2012-10-04 Geron Corporation Enriched populations of cardiomyocyte lineage cells from pluripotent stem cells
WO2012135621A2 (en) 2011-03-30 2012-10-04 Cellular Dynamics International. Inc Priming of pluripotent stem cells for neural differentiation
US8785190B2 (en) 2011-04-06 2014-07-22 Sanbio, Inc. Methods and compositions for modulating peripheral immune function
USRE46382E1 (en) 2011-04-06 2017-05-02 Sanbio, Inc. Methods and compositions for modulating peripheral immune function
US9655927B2 (en) 2011-04-06 2017-05-23 Sanbio, Inc. Methods and compositions for modulating peripheral immune function
US10543234B2 (en) 2011-04-06 2020-01-28 Sanbio, Inc. Methods and compositions for modulating peripheral immune function
US11903972B2 (en) 2011-04-06 2024-02-20 Sanbio, Inc. Methods and compositions for modulating peripheral immune function
US10478206B2 (en) 2011-04-29 2019-11-19 University Of Southern California Instruments and methods for the implantation of cell-seeded substrates
EP3572497A1 (en) 2011-06-06 2019-11-27 Regenesys bvba Expansion of stem cells in hollow fiber bioreactors
WO2012168295A1 (en) 2011-06-06 2012-12-13 ReGenesys BVBA Expansion of stem cells in hollow fiber bioreactors
WO2012172354A1 (en) 2011-06-16 2012-12-20 Isis Innovation Limited Method of cryopreserving pluripotent stem cells
WO2013010965A1 (en) 2011-07-15 2013-01-24 Universite Libre De Bruxelles Generation of mesodermal cells from pluripotent stem cells
WO2013019661A1 (en) 2011-07-29 2013-02-07 Cellular Dynamics International, Inc. Metabolic maturation in stem cell-derived tissue cells
EP3578042A1 (en) 2011-08-26 2019-12-11 Yecuris Corporation Fumarylacetoacetate hydrolase (fah)-deficient and immunodeficient rats and uses thereof
WO2013032918A1 (en) 2011-08-26 2013-03-07 Yecuris Corporation Fumarylacetoacetate hydrolase (fah)-deficient and immunodeficient rats and uses thereof
WO2013068557A1 (en) 2011-11-09 2013-05-16 Katholieke Universiteit Leuven Virus infectable stem cells
EP2594635A1 (en) 2011-11-18 2013-05-22 Univercell Biosolutions Method for generating primate cardiovascular progenitor cells for clinical and drug cells testing use from primate embryonic stem cells or embryonic-like state cells, and their applications
WO2013072527A1 (en) 2011-11-18 2013-05-23 Univercell Biosolutions Method for generating primate cardiovascular progenitor cells for clinical and drug cells testing use from primate embryonic stem cells or embryonic-like state cells, and their applications
WO2013082268A1 (en) 2011-11-30 2013-06-06 The Wistar Institute Of Anatomy And Biology Methods and compositions for regulation of cell aging, carcinogenesis, and reprogramming
EP3653698A1 (en) 2011-12-01 2020-05-20 New York Stem Cell Foundation, Inc. Automated system for producing induced pluripotent stem cells or differentiated cells
WO2013082509A1 (en) 2011-12-01 2013-06-06 The New York Stem Cell Foundation Automated system for producing induced pluripotent stem cells or differentiated cells
WO2013082106A1 (en) 2011-12-02 2013-06-06 The General Hospital Corporation Differentiation into brown adipocytes
US11318225B2 (en) 2011-12-05 2022-05-03 California Institute Of Technology Ultrathin parylene-C semipermeable membranes for biomedical applications
US9248013B2 (en) 2011-12-05 2016-02-02 California Institute Of Technology 3-Dimensional parylene scaffold cage
US8877489B2 (en) 2011-12-05 2014-11-04 California Institute Of Technology Ultrathin parylene-C semipermeable membranes for biomedical applications
US9642940B2 (en) 2011-12-05 2017-05-09 California Institute Of Technology 3-dimensional parylene scaffold cage
US12215354B2 (en) 2011-12-22 2025-02-04 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into single hormonal insulin positive cells
US10358628B2 (en) 2011-12-22 2019-07-23 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into single hormonal insulin positive cells
US11377640B2 (en) 2011-12-22 2022-07-05 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into single hormonal insulin positive cells
US9611513B2 (en) 2011-12-23 2017-04-04 DePuy Synthes Products, Inc. Detection of human umbilical cord tissue derived cells
US10724105B2 (en) 2011-12-23 2020-07-28 DePuy Synthes Products, Inc. Detection of human umbilical cord tissue-derived cells
EP3822340A1 (en) 2012-01-13 2021-05-19 The General Hospital Corporation Isolated human lung progenitor cells and uses thereof
WO2013110354A1 (en) 2012-01-25 2013-08-01 Université Catholique de Louvain Compositions and methods for cell transplantation
US9593307B2 (en) 2012-03-07 2017-03-14 Janssen Biotech, Inc. Defined media for expansion and maintenance of pluripotent stem cells
US9434920B2 (en) 2012-03-07 2016-09-06 Janssen Biotech, Inc. Defined media for expansion and maintenance of pluripotent stem cells
WO2013163228A1 (en) 2012-04-24 2013-10-31 International Stem Cell Corporation Derivation of neural stem cells and dopaminergic neurons from human pluripotent stem cells
EP3483261A1 (en) 2012-04-24 2019-05-15 VCell Therapeutics, Inc. Generating pluripotent cells de novo
EP3594323A1 (en) 2012-04-30 2020-01-15 University Health Network Methods and compositions for generating pancreatic progenitors and functional beta cells from hpscs
WO2013163739A1 (en) 2012-04-30 2013-11-07 University Health Network METHODS AND COMPOSITIONS FOR GENERATING PANCREATIC PROGENITORS AND FUNCTIONAL BETA CELLS FROM hPSCs
WO2013168403A1 (en) 2012-05-08 2013-11-14 株式会社大塚製薬工場 Trehalose-containing mammalian cell suspension for prevention of pulmonary embolism formation
EP3597749A1 (en) 2012-05-25 2020-01-22 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
EP4570908A2 (en) 2012-05-25 2025-06-18 The Regents of the University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
DE202013012240U1 (en) 2012-05-25 2016-02-02 Emmanuelle Charpentier Compositions for RNA-directed modification of a target DNA and for RNA-driven modulation of transcription
EP3241902A1 (en) 2012-05-25 2017-11-08 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
DE202013012242U1 (en) 2012-05-25 2016-02-02 Emmanuelle Charpentier Compositions for RNA-directed modification of a target DNA and for RNA-driven modulation of transcription
DE202013012241U1 (en) 2012-05-25 2016-01-18 Emmanuelle Charpentier Compositions for RNA-directed modification of a target DNA and for RNA-driven modulation of transcription
EP4289948A2 (en) 2012-05-25 2023-12-13 The Regents of the University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
EP3401400A1 (en) 2012-05-25 2018-11-14 The Regents of The University of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
WO2013181549A2 (en) 2012-05-31 2013-12-05 Auxogyn, Inc. In vitro embryo blastocyst prediction methods
US10066210B2 (en) 2012-06-08 2018-09-04 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into pancreatic endocrine cells
US10208288B2 (en) 2012-06-08 2019-02-19 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into pancreatic endocrine cells
US9714280B2 (en) 2012-07-31 2017-07-25 Escape Therapeutics, Inc. HLA G-modified cells and methods
EP3805261A1 (en) 2012-07-31 2021-04-14 AgeX Therapeutics, Inc. Hla-g transfected cells and their use in treating diabetes
US10502738B2 (en) 2012-07-31 2019-12-10 Agex Therapeutics, Inc. HLA G-modified cells and methods
EP4015530A1 (en) 2012-07-31 2022-06-22 AgeX Therapeutics, Inc. Hla-g transfected cells and their use in treating diabetes
US11977073B2 (en) 2012-07-31 2024-05-07 Agex Therapeutics, Inc. HLA G-modified cells and methods
EP4534650A2 (en) 2012-09-25 2025-04-09 Yale University Differentiation of human ips cells to human alveolar type ii via definitive endoderm
US11859210B2 (en) 2012-09-28 2024-01-02 Scripps Health Methods of differentiating stem cells into chondrocytes
US10724005B2 (en) 2012-09-28 2020-07-28 Scripps Health Methods of differentiating stem cells into chondrocytes
US9914911B2 (en) 2012-10-29 2018-03-13 Scripps Health Methods of reprogramming chondrocytes
US10385318B2 (en) 2012-10-29 2019-08-20 Scripps Health Method of making a population of chondrocytes from reprogrammed chondrocytes
US9974885B2 (en) 2012-10-29 2018-05-22 Scripps Health Methods of transplanting chondrocytes
US10179193B2 (en) 2012-10-29 2019-01-15 Scripps Health Methods of transplanting chondrocytes
WO2014071137A1 (en) 2012-11-02 2014-05-08 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomic ratios
US10209240B2 (en) 2012-11-02 2019-02-19 Stemina Biomarker Discovery, Inc. Predicting human developmental toxicity of pharmaceuticals using human stem-like cells and metabolomic ratios
EP2730649A1 (en) 2012-11-08 2014-05-14 Viacyte, Inc. Scalable primate pluripotent stem cell aggregate suspension culture and differentiation thereof
EP4053264A1 (en) 2012-11-08 2022-09-07 ViaCyte, Inc. Scalable primate pluripotent stem cell aggregate suspension culture and differentiation thereof
US11007385B2 (en) 2012-12-10 2021-05-18 Regenics As Use of cellular extracts for skin rejuvenation
US10377989B2 (en) 2012-12-31 2019-08-13 Janssen Biotech, Inc. Methods for suspension cultures of human pluripotent stem cells
US10344264B2 (en) 2012-12-31 2019-07-09 Janssen Biotech, Inc. Culturing of human embryonic stem cells at the air-liquid interface for differentiation into pancreatic endocrine cells
US10370644B2 (en) 2012-12-31 2019-08-06 Janssen Biotech, Inc. Method for making human pluripotent suspension cultures and cells derived therefrom
US10138465B2 (en) 2012-12-31 2018-11-27 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into pancreatic endocrine cells using HB9 regulators
US10947511B2 (en) 2012-12-31 2021-03-16 Janssen Biotech, Inc. Differentiation of human embryonic stem cells into pancreatic endocrine cells using thyroid hormone and/or alk5, an inhibitor of tgf-beta type 1 receptor
US10241108B2 (en) 2013-02-01 2019-03-26 Ares Trading S.A. Abnormal syngamy phenotypes observed with time lapse imaging for early identification of embryos with lower development potential
US11007232B2 (en) 2013-02-15 2021-05-18 International Stem Cell Corporation Use of neural cells derived from human pluripotent stem cells for the treatment of neurodegenerative diseases
WO2014127289A1 (en) 2013-02-15 2014-08-21 International Stem Cell Corporation Use of neural cells derived from human pluripotent stem cells for the treatment of neurodegenerative diseases
WO2014143383A1 (en) 2013-03-13 2014-09-18 Agilent Technologies, Inc. Transposome tethered to a gene delivery vehicle
WO2014153230A1 (en) 2013-03-14 2014-09-25 The Regents Of The University Of California In vitro production of medial ganglionic eminence precursor cells
US8859286B2 (en) 2013-03-14 2014-10-14 Viacyte, Inc. In vitro differentiation of pluripotent stem cells to pancreatic endoderm cells (PEC) and endocrine cells
US11446335B2 (en) 2013-03-14 2022-09-20 Viacyte, Inc. Cryopreserved endocrine cells that express chromogranin A
US9650610B2 (en) 2013-03-14 2017-05-16 Viacyte, Inc. In vitro differentiation of pluripotent stem cells to pancreatic endoderm cells (PEC) and endocrine cells
WO2014160413A1 (en) 2013-03-14 2014-10-02 Viacyte, Inc. In vitro differentiation of pluripotent stem cells to pancreatic endoderm cells (pec) and endocrine cells
EP3656849A1 (en) 2013-03-14 2020-05-27 The Regents of The University of California In vitro production of medial ganglionic eminence precursor cells
US10376545B2 (en) 2013-03-14 2019-08-13 Viacyte, Inc. Methods for producing hormone secreting cells in a subject
EP3521418A1 (en) 2013-03-14 2019-08-07 ViaCyte, Inc Cell culture
EP4520817A2 (en) 2013-03-14 2025-03-12 The Regents of the University of California In vitro production of medial ganglionic eminence precursor cells
US11047848B2 (en) 2013-03-15 2021-06-29 Whitehead Institute For Biomedical Research Cellular discovery platform for neurodegenerative diseases
EP3736343A1 (en) 2013-03-15 2020-11-11 Whitehead Institute For Biomedical Research Cellular discovery platform for neurodegenerative diseases
WO2014161075A1 (en) 2013-04-05 2014-10-09 University Health Network Methods and compositions for generating chondrocyte lineage cells and/or cartilage like tissue
EP3896153A1 (en) 2013-04-05 2021-10-20 University Health Network Methods and compositions for generating chondrocyte lineage cells and/or cartilage like tissue
WO2014169277A1 (en) 2013-04-12 2014-10-16 Lafrancesca Saverio Improving organs for transplantation
EP3795159A1 (en) 2013-04-12 2021-03-24 Houston Methodist Hospital Improving organs for transplantation
WO2014184666A2 (en) 2013-04-30 2014-11-20 Katholieke Universiteit Leuven Cell therapy for myelodysplastic syndromes
US9758763B2 (en) 2013-05-29 2017-09-12 The Regents Of The University Of California Methods and compositions for somatic cell proliferation and viability
US10214725B2 (en) 2013-05-29 2019-02-26 The Regents Of The University Of California Methods and compositions for somatic cell proliferation and viability
US12421513B2 (en) 2013-06-05 2025-09-23 Reverse Bioengineering, Inc. Compositions and methods for induced tissue regeneration in mammalian species
US10961531B2 (en) 2013-06-05 2021-03-30 Agex Therapeutics, Inc. Compositions and methods for induced tissue regeneration in mammalian species
WO2014200905A2 (en) 2013-06-10 2014-12-18 President And Fellows Of Harvard College Early developmental genomic assay for characterizing pluripotent stem cell utility and safety
WO2014200340A1 (en) 2013-06-10 2014-12-18 Academisch Ziekenhuis Leiden Differentiation and expansion of endothelial cells from pluripotent stem cells and the in vitro formation of vasculature like structures
US10119122B2 (en) 2013-06-10 2018-11-06 Academisch Ziekenhuis Leiden Differentiation and expansion of endothelial cells from pluripotent stem cells and the in vitro formation of vasculature like structures
EP4461806A2 (en) 2013-06-11 2024-11-13 President and Fellows of Harvard College Sc-b cells and compositions and methods for generating the same
DE202014011287U1 (en) 2013-06-11 2019-02-06 The President And Fellows Of Harvard College SC-β cells and compositions for producing the cells
EP3569694A1 (en) 2013-06-11 2019-11-20 President and Fellows of Harvard College Sc-beta cells and compositions and methods for generating the same
US9624471B2 (en) 2013-06-12 2017-04-18 University Of Washington Through Its Center For Commercialization Methods for maturing cardiomyocytes and uses thereof
WO2014208053A1 (en) 2013-06-28 2014-12-31 株式会社大塚製薬工場 Trehalose and dextran-containing solution for transplanting mammalian cells
US11028367B2 (en) 2013-08-16 2021-06-08 Yale University Epithelial cell differentiation of human mesenchymal stromal cells
US12404495B2 (en) 2013-08-16 2025-09-02 Yale University Epithelial cell differentiation of human mesenchymal stromal cells
WO2015023720A1 (en) 2013-08-16 2015-02-19 Yale University Epithelial cell differentiation of human mesenchymal stromal cells
US10711246B2 (en) 2013-09-13 2020-07-14 University Health Network Methods and compositions for generating epicardium cells
US11767507B2 (en) 2013-11-08 2023-09-26 The Mclean Hospital Corporation Methods for efficient generation of GABAergic interneurons from pluripotent stem cells
US12241084B2 (en) 2013-11-08 2025-03-04 The Mclean Hospital Corporation Methods for efficient generation of GABAergic interneurons from pluripotent stem cells
US9932607B2 (en) 2013-11-15 2018-04-03 The Board Of Trustees Of The Leland Stanford Junior University Site-specific integration of transgenes into human cells
US11667876B2 (en) 2013-11-16 2023-06-06 Terumo Bct, Inc. Expanding cells in a bioreactor
US11708554B2 (en) 2013-11-16 2023-07-25 Terumo Bct, Inc. Expanding cells in a bioreactor
US10633625B2 (en) 2013-11-16 2020-04-28 Terumo Bct, Inc. Expanding cells in a bioreactor
EP3760719A1 (en) 2013-11-18 2021-01-06 CRISPR Therapeutics AG Crispr-cas system materials and methods
EP3375877A1 (en) 2013-11-18 2018-09-19 Crispr Therapeutics AG Crispr-cas system materials and methods
EP3835419A1 (en) 2013-12-12 2021-06-16 The Regents of The University of California Methods and compositions for modifying a single stranded target nucleic acid
WO2015112839A1 (en) 2014-01-23 2015-07-30 President And Fellows Of Harvard College Engineered polymeric valves, tubular structures, and sheets and uses thereof
US11352606B2 (en) 2014-02-10 2022-06-07 The Johns Hopkins University Low oxygen tension enhances endothelial fate of human pluripotent stem cells
US11078462B2 (en) 2014-02-18 2021-08-03 ReCyte Therapeutics, Inc. Perivascular stromal cells from primate pluripotent stem cells
US11268069B2 (en) 2014-03-04 2022-03-08 Fate Therapeutics, Inc. Reprogramming methods and cell culture platforms
WO2015143125A1 (en) 2014-03-19 2015-09-24 The Brigham And Women's Hospital, Inc. Methods relating to pluripotent cells
WO2015143350A1 (en) 2014-03-20 2015-09-24 Auxogyn, Inc. Quantitative measurement of human blastocyst and morula morphology developmental kinetics
WO2015143342A1 (en) 2014-03-21 2015-09-24 Cellular Dynamics International, Inc. Production of midbrain dopaminergic neurons and methods for the use thereof
US10006006B2 (en) 2014-05-16 2018-06-26 Janssen Biotech, Inc. Use of small molecules to enhance MAFA expression in pancreatic endocrine cells
US10870832B2 (en) 2014-05-16 2020-12-22 Janssen Biotech, Inc. Use of small molecules to enhance MAFA expression in pancreatic endocrine cells
US11274281B2 (en) 2014-07-03 2022-03-15 ReCyte Therapeutics, Inc. Exosomes from clonal progenitor cells
WO2016025510A1 (en) 2014-08-12 2016-02-18 Rappolee Daniel A Systems and methods to detect stem cell stress and uses thereof
US10596200B2 (en) 2014-08-22 2020-03-24 Procella Therapeutics Ab Use of LIFR or FGFR3 as a cell surface marker for isolating human cardiac ventricular progenitor cells
US10597637B2 (en) 2014-08-22 2020-03-24 Procella Therapeutics Ab Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells
EP3524673A1 (en) 2014-08-22 2019-08-14 Procella Therapeutics AB Use of jagged 1/frizzled 4 as a cell surface marker for isolating human cardiac ventricular progenitor cells
WO2016036754A1 (en) 2014-09-02 2016-03-10 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification
WO2016040794A1 (en) 2014-09-12 2016-03-17 Whitehead Institute For Biomedical Research Cells expressing apolipoprotein e and uses thereof
EP3842514A1 (en) 2014-09-12 2021-06-30 Whitehead Institute for Biomedical Research Cells expressing apolipoprotein e and uses thereof
US11390885B2 (en) 2014-09-15 2022-07-19 Children's Medical Center Corporation Methods and compositions to increase somatic cell nuclear transfer (SCNT) efficiency by removing histone H3-lysine trimethylation
WO2016044271A2 (en) 2014-09-15 2016-03-24 Children's Medical Center Corporation Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation
EP3868873A1 (en) 2014-10-24 2021-08-25 Sumitomo Dainippon Pharma Co., Ltd. Production method for retinal tissue
US11730770B2 (en) 2015-02-17 2023-08-22 University Health Network Methods for making and using sinoatrial node-like pacemaker cardiomyocytes and ventricular-like cardiomyocytes
US10561687B2 (en) 2015-02-17 2020-02-18 University Health Network Methods for making and using sinoatrial node-like pacemaker cardiomyocytes and ventricular-like cardiomyocytes
WO2016131137A1 (en) 2015-02-17 2016-08-25 University Health Network Methods for making and using sinoatrial node-like pacemaker cardiomyocytes and ventricular-like cardiomyocytes
EP4092109A1 (en) 2015-09-08 2022-11-23 Sumitomo Pharma Co., Ltd. Method for producing retinal pigment epithelial cells
WO2017044488A1 (en) 2015-09-08 2017-03-16 Cellular Dynamics International, Inc. Macs-based purification of stem cell-derived retinal pigment epithelium
EP4001402A1 (en) 2015-09-08 2022-05-25 FUJIFILM Cellular Dynamics, Inc. Macs-based purification of stem cell-derived retinal pigment epithelium
EP4345160A2 (en) 2015-09-08 2024-04-03 The United States of America, as represented by The Secretary, Department of Health and Human Services Method for reproducible differentiation of clinical-grade retinal pigment epithelium cells
WO2017044483A1 (en) 2015-09-08 2017-03-16 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for reproducible differentiation of clinical-grade retinal pigment epithelium cells
WO2017064546A1 (en) 2015-09-24 2017-04-20 Crispr Therapeutics Ag Novel family of rna-programmable endonucleases and their uses in genome editing and other applications
US12351831B2 (en) 2015-10-16 2025-07-08 Fate Therapeutics, Inc. Platform for the induction and maintenance of ground state pluripotency
US11441126B2 (en) 2015-10-16 2022-09-13 Fate Therapeutics, Inc. Platform for the induction and maintenance of ground state pluripotency
WO2017070145A1 (en) 2015-10-19 2017-04-27 Cellular Dynamics International, Inc. Production of virus-receptive pluripotent stem cell (psc)-derived hepatocytes
US12129486B2 (en) 2015-10-20 2024-10-29 FUJIFILM Cellular Dynamics, Inc. Methods for directed differentiation of pluripotent stem cells to immune cells
WO2017070333A1 (en) 2015-10-20 2017-04-27 Cellular Dynamics International, Inc. Multi-lineage hematopoietic precursor cell production by genetic programming
US10947502B2 (en) 2015-10-20 2021-03-16 FUJIFILM Cellular Dynamics, Inc. Methods for directed differentiation of pluripotent stem cells to immune cells
WO2017075389A1 (en) 2015-10-30 2017-05-04 The Regents Of The Universtiy Of California Methods of generating t-cells from stem cells and immunotherapeutic methods using the t-cells
US12404493B2 (en) 2015-12-07 2025-09-02 Agex Therapeutics, Inc. Methods for the re-derivation of diverse pluripotent stem cell-derived brown fat cells
WO2017100313A1 (en) 2015-12-07 2017-06-15 Biotime, Inc. Methods for the re-derivation of diverse pluripotent stem cell-derive brown fat cells
WO2017117333A1 (en) 2015-12-30 2017-07-06 Cellular Dynamics International, Inc. Microtissue formation using stem cell-derived human hepatocytes
US10612094B2 (en) 2016-02-19 2020-04-07 Procella Therapeutics Ab Genetic markers for engraftment of human cardiac ventricular progenitor cells
EP4269566A2 (en) 2016-02-19 2023-11-01 Procella Therapeutics AB Genetic markers for engraftment of human cardiac ventricular progenitor cells
WO2017172086A1 (en) 2016-02-19 2017-10-05 Leung Chuen Yan Genetic markers for engraftment of human cardiac ventricular progenitor cells
US11725244B2 (en) 2016-02-19 2023-08-15 Procella Therapeutics Ab Genetic markers for engraftment of human cardiac ventricular progenitor cells
WO2017147536A1 (en) 2016-02-24 2017-08-31 The Rockefeller University Embryonic cell-based therapeutic candidate screening systems, models for huntington's disease and uses thereof
US11534466B2 (en) 2016-03-09 2022-12-27 Aal Scientifics, Inc. Pancreatic stem cells and uses thereof
WO2017176810A1 (en) 2016-04-04 2017-10-12 Biotime, Inc. Pluripotent stem cell-derived 3d retinal tissue and uses thereof
US10420803B2 (en) 2016-04-14 2019-09-24 Janssen Biotech, Inc. Differentiation of pluripotent stem cells to intestinal midgut endoderm cells
WO2017202814A1 (en) 2016-05-24 2017-11-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of neuropathological disorders characterized by a loss of cortical neurons
WO2017202949A1 (en) 2016-05-25 2017-11-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers
WO2017210537A1 (en) 2016-06-02 2017-12-07 The Cleveland Clinic Foundation Complement inhibition for improving cell viability
WO2017216771A2 (en) 2016-06-17 2017-12-21 Genesis Technologies Limited Crispr-cas system, materials and methods
WO2018005975A1 (en) 2016-07-01 2018-01-04 Research Development Foundation Elimination of proliferating cells from stem cell-derived grafts
WO2018035214A1 (en) 2016-08-16 2018-02-22 Cellular Dynamics International., Inc. Methods for differentiating pluripotent cells
EP4001403A1 (en) 2016-08-16 2022-05-25 FUJIFILM Cellular Dynamics, Inc. Methods for differentiating pluripotent cells
EP4328301A2 (en) 2016-08-16 2024-02-28 FUJIFILM Cellular Dynamics, Inc. Methods for differentiating pluripotent cells
US10961505B2 (en) 2016-10-05 2021-03-30 FUJIFILM Cellular Dynamics, Inc. Generating mature lineages from induced pluripotent stem cells with MECP2 disruption
WO2018067826A1 (en) 2016-10-05 2018-04-12 Cellular Dynamics International, Inc. Generating mature lineages from induced pluripotent stem cells with mecp2 disruption
US12098202B2 (en) 2016-10-10 2024-09-24 The National Institute for Biotechnology in the Negev Ltd. Non-cytotoxic modified cells and use thereof
WO2018085516A2 (en) 2016-11-02 2018-05-11 Aal Scientifics, Inc. Non-mesenchymal human lung stem cells and methods of their use for treating respiratory diseases
WO2018084228A1 (en) 2016-11-04 2018-05-11 国立大学法人東京大学 Solution for cryopreservation of animal cells or animal tissues, cryopreserved product, and cryopreservation method
WO2018097253A1 (en) 2016-11-25 2018-05-31 国立研究開発法人理化学研究所 Cell population for transplantation and method for producing same
US10508263B2 (en) 2016-11-29 2019-12-17 Procella Therapeutics Ab Methods for isolating human cardiac ventricular progenitor cells
US11401508B2 (en) 2016-11-29 2022-08-02 Procella Therapeutics Ab Methods for isolating human cardiac ventricular progenitor cells
WO2018100433A1 (en) 2016-11-29 2018-06-07 Procella Therapeutics Ab Methods for isolating human cardiac ventricular progenitor cells
WO2018110159A1 (en) 2016-12-14 2018-06-21 株式会社大塚製薬工場 Mammalian cell cryopreservation liquid
US10828330B2 (en) 2017-02-22 2020-11-10 IO Bioscience, Inc. Nucleic acid constructs comprising gene editing multi-sites and uses thereof
WO2018164240A1 (en) 2017-03-08 2018-09-13 大日本住友製薬株式会社 Method for producing retinal pigment epithelial cells
WO2018195175A1 (en) 2017-04-18 2018-10-25 FUJIFILM Cellular Dynamics, Inc. Antigen-specific immune effector cells
US12163155B2 (en) 2017-04-18 2024-12-10 FUJIFILM Cellular Dynamics, Inc. Antigen-specific immune effector cells
EP4083063A2 (en) 2017-04-18 2022-11-02 FUJIFILM Cellular Dynamics, Inc. Antigen-specific immune effector cells
WO2018195418A1 (en) 2017-04-20 2018-10-25 Oregon Health & Science University Human gene correction
WO2019017492A1 (en) 2017-07-20 2019-01-24 国立研究開発法人理化学研究所 Method for maturation of retinal tissue containing continuous epithelium
WO2019017491A1 (en) 2017-07-20 2019-01-24 国立研究開発法人理化学研究所 Method for preserving neural tissue
WO2019028088A1 (en) 2017-07-31 2019-02-07 Biotime, Inc. Compositions and methods for restoring or preventing loss of vision caused by disease or traumatic injury
US12404488B2 (en) 2017-08-23 2025-09-02 Procella Therapeutics Ab Use of neuropilin-1 (NRP1) as a cell surface marker for isolating human cardiac ventricular progenitor cells
US11186820B2 (en) 2017-08-23 2021-11-30 Procella Therapeutics Ab Use of Neuropilin-1 (NRP1) as a cell surface marker for isolating human cardiac ventricular progenitor cells
EP3663393A1 (en) 2017-08-23 2020-06-10 Procella Therapeutics AB Use of neuropilin-1 (nrp1) as a cell surface marker for isolating human cardiac ventricular progenitor cells
WO2019038587A1 (en) 2017-08-23 2019-02-28 Procella Therapeutics Ab Use of neuropilin-1 (nrp1) as a cell surface marker for isolating human cardiac ventricular progenitor cells
WO2019050015A1 (en) 2017-09-08 2019-03-14 国立研究開発法人理化学研究所 Cell aggregate including retinal tissue and production method therefor
WO2019054515A1 (en) 2017-09-14 2019-03-21 国立研究開発法人理化学研究所 Method for amplifying cone photoreceptors or rod photoreceptors using dorsalization signal transmitter or ventralization signal transmitter
WO2019054514A1 (en) 2017-09-14 2019-03-21 国立研究開発法人理化学研究所 Method for producing retinal tissues
WO2019092507A2 (en) 2017-11-09 2019-05-16 Crispr Therapeutics Ag Crispr/cas systems for treatment of dmd
WO2019092505A1 (en) 2017-11-09 2019-05-16 Casebia Therapeutics Llp Self-inactivating (sin) crispr/cas or crispr/cpf1 systems and uses thereof
WO2019096787A1 (en) 2017-11-14 2019-05-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Regulatory t cells genetically modified for the lymphotoxin alpha gene and uses thereof
US11945795B2 (en) 2017-11-15 2024-04-02 Vertex Pharmaceuticals Incorporated Islet cell manufacturing compositions and methods of use
US12304900B2 (en) 2017-11-15 2025-05-20 Vertex Pharmaceuticals Incorporated Islet cell manufacturing compositions and methods of use
WO2019099725A1 (en) 2017-11-15 2019-05-23 Semma Therapeutics, Inc. Islet cell manufacturing compositions and methods of use
WO2019101956A1 (en) 2017-11-24 2019-05-31 Institut National De La Santé Et De La Recherche Médicale (Inserm) Methods and compositions for treating cancers
WO2019103125A1 (en) 2017-11-24 2019-05-31 住友化学株式会社 Production method for cell mass including neural cells/tissue and non-neural epithelial tissue, and cell mass from same
WO2019103129A1 (en) 2017-11-24 2019-05-31 住友化学株式会社 Method for producing cell mass including pituitary tissue, and cell mass thereof
WO2019118935A1 (en) 2017-12-14 2019-06-20 Casebia Therapeutics Limited Liability Partnership Novel rna-programmable endonuclease systems and their use in genome editing and other applications
WO2019160148A1 (en) 2018-02-19 2019-08-22 大日本住友製薬株式会社 Cell aggregate, mixture of cell aggregates, and method for preparing same
US12203110B2 (en) 2018-03-19 2025-01-21 Crispr Therapeutics Ag RNA-programmable endonuclease systems and uses thereof
WO2019183150A1 (en) 2018-03-19 2019-09-26 Casebia Therapeutics Limited Liability Partnership Novel rna-programmable endonuclease systems and uses thereof
WO2019204817A1 (en) 2018-04-20 2019-10-24 FUJIFILM Cellular Dynamics, Inc. Method for differentiation of ocular cells and use thereof
WO2019213276A1 (en) 2018-05-02 2019-11-07 Novartis Ag Regulators of human pluripotent stem cells and uses thereof
EP3572512A1 (en) 2018-05-24 2019-11-27 B.R.A.I.N. Ag A method for engineering a protein
WO2019224105A1 (en) 2018-05-24 2019-11-28 B.R.A.I.N. Ag A method for engineering a protein
US10821155B2 (en) 2018-06-27 2020-11-03 Juvena Therapeutics, Inc. Heparin-associated polypeptides and uses thereof
WO2020030634A1 (en) 2018-08-06 2020-02-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers
US11999971B2 (en) 2018-08-10 2024-06-04 Vertex Pharmaceuticals Incorporated Stem cell derived islet differentiation
EP3833365A1 (en) 2018-08-10 2021-06-16 Vertex Pharmaceuticals Incorporated Stem cell derived islet differentiation
US12215355B2 (en) 2018-08-10 2025-02-04 Vertex Pharmaceuticals Incorporated Stem cell derived islet differentiation
US11466256B2 (en) 2018-08-10 2022-10-11 Vertex Pharmaceuticals Incorporated Stem cell derived islet differentiation
US11525120B2 (en) 2018-08-10 2022-12-13 Vertex Pharmaceuticals Incorporated Stem cell derived islet differentiation
WO2020039732A1 (en) 2018-08-24 2020-02-27 住友化学株式会社 Cell aggregation including olfactory neuron or precursor cell thereof, and method for producing same
WO2020051429A1 (en) 2018-09-07 2020-03-12 Hebecell Corporation Methods and compositions for retinal neuron generation in carrier-free 3d sphere suspension culture
WO2020066991A1 (en) 2018-09-28 2020-04-02 株式会社大塚製薬工場 Mammal cell preserving solution containing acarbose or stachyose
WO2020100481A1 (en) 2018-11-15 2020-05-22 Jsr株式会社 Method for producing brain organoids
WO2020106622A1 (en) 2018-11-19 2020-05-28 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Biodegradable tissue replacement implant and its use
US12263227B2 (en) 2018-11-28 2025-04-01 Crispr Therapeutics Ag Optimized mRNA encoding CAS9 for use in LNPs
WO2020130068A1 (en) 2018-12-20 2020-06-25 住友化学株式会社 Embryonic erythroblast-containing cell population and method for producing same, cell culture composition, and compound test method
WO2020138430A1 (en) 2018-12-28 2020-07-02 国立研究開発法人理化学研究所 Therapeutic drug for disease accompanied by disorders in retinal system cells or retinal tissue
DE212020000516U1 (en) 2019-03-07 2022-01-17 The Regents of the University of California CRISPR-CAS effector polypeptides
EP4219700A1 (en) 2019-03-07 2023-08-02 The Regents of the University of California Crispr-cas effector polypeptides and methods of use thereof
WO2020209959A1 (en) 2019-03-08 2020-10-15 Crispr Therapeutics Ag Nucleobase-editing fusion protein systems, compositions, and uses thereof
WO2020186059A2 (en) 2019-03-12 2020-09-17 Crispr Therapeutics Ag Novel high fidelity rna-programmable endonuclease systems and uses thereof
EP4613867A2 (en) 2019-03-12 2025-09-10 CRISPR Therapeutics AG Novel high fidelity rna-programmable endonuclease systems and uses thereof
WO2020184720A1 (en) 2019-03-13 2020-09-17 大日本住友製薬株式会社 Method for evaluating quality of transplant neural retina, and transplant neural retina sheet
WO2020218480A1 (en) 2019-04-26 2020-10-29 国立研究開発法人理化学研究所 Composite including neural retina, retinal pigment epithelial cells, and hydrogel, and method for producing same
WO2020218461A1 (en) 2019-04-26 2020-10-29 株式会社大塚製薬工場 Trehalose-containing liquid for mammalian cell preservation
WO2020225606A1 (en) 2019-05-08 2020-11-12 Crispr Therapeutics Ag Crispr/cas all-in-two vector systems for treatment of dmd
WO2020229546A1 (en) 2019-05-14 2020-11-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Regulatory t cells targeted by lymphotoxin alpha blocking agent and uses thereof
EP4386081A2 (en) 2019-05-21 2024-06-19 President and Fellows of Harvard College Endocrine differentiation-inducing molecule
WO2020264072A1 (en) 2019-06-25 2020-12-30 Semma Therapeutics, Inc. Enhanced differentiation of beta cells
WO2020262613A1 (en) 2019-06-27 2020-12-30 国立大学法人東京大学 Method for separating pancreatic progenitor cells
WO2021030424A1 (en) 2019-08-13 2021-02-18 Semma Therapeutics, Inc. Pancreatic differentiation
WO2021045217A1 (en) 2019-09-06 2021-03-11 学校法人慶應義塾 Method for producing cell aggregate including glial progenitor cells
WO2021069593A1 (en) 2019-10-09 2021-04-15 INSERM (Institut National de la Santé et de la Recherche Médicale) T cells modified to express mutated cxcr4 or partially deleted and uses thereof
WO2021100829A1 (en) 2019-11-20 2021-05-27 大日本住友製薬株式会社 Method for freezing neural cells
WO2021100830A1 (en) 2019-11-20 2021-05-27 大日本住友製薬株式会社 Method for freezing cell aggregates
US12358963B2 (en) 2019-12-24 2025-07-15 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof
WO2021243256A1 (en) 2020-05-29 2021-12-02 FUJIFILM Cellular Dynamics, Inc. Retinal pigmented epithelium and photoreceptor dual cell aggregates and methods of use thereof
WO2021243203A1 (en) 2020-05-29 2021-12-02 FUJIFILM Cellular Dynamics, Inc. Bilayer of retinal pigmented epithelium and photoreceptors and use thereof
WO2021250058A2 (en) 2020-06-12 2021-12-16 Bayer Aktiengesellschaft CRISPR-Cas12a DIRECTED RANDOM MUTAGENESIS AGENTS AND METHODS
WO2022054925A1 (en) 2020-09-11 2022-03-17 国立研究開発法人理化学研究所 Complex containing neural retina-containing cell aggregates and matrix, and method for manufacturing same
WO2022054924A1 (en) 2020-09-11 2022-03-17 大日本住友製薬株式会社 Medium for tissue for transplantation
WO2022063224A1 (en) 2020-09-24 2022-03-31 中国科学院动物研究所 Activated pluripotent stem cell, and preparation method therefor and use thereof
WO2022087260A1 (en) 2020-10-22 2022-04-28 The Regents Of The University Of California Devices and methods for evaluating the viability of embryos
WO2022110494A1 (en) 2020-11-26 2022-06-02 北京赛尔湃腾科技咨询合伙企业(有限合伙) Method for reprogramming cell
WO2022191216A1 (en) 2021-03-09 2022-09-15 国立研究開発法人理化学研究所 Method for producing hypoimmunogenic retinal pigment epithelial cells
WO2022207889A1 (en) 2021-04-01 2022-10-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Liver organoid manufacturing methods, liver organoids obtained with the same, and uses thereof
WO2022216911A1 (en) 2021-04-07 2022-10-13 FUJIFILM Cellular Dynamics, Inc. Dopaminergic precursor cells and methods of use
WO2022221051A1 (en) 2021-04-11 2022-10-20 President And Fellows Of Harvard College Cardiomyocytes and compositions and methods for producing the same
WO2022251499A1 (en) 2021-05-28 2022-12-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods to generate macular, central and peripheral retinal pigment epithelial cells
WO2022251477A1 (en) 2021-05-28 2022-12-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Biodegradable tissue scaffold with secondary matrix to host weakly adherent cells
EP4101928A1 (en) 2021-06-11 2022-12-14 Bayer AG Type v rna programmable endonuclease systems
WO2022258753A1 (en) 2021-06-11 2022-12-15 Bayer Aktiengesellschaft Type v rna programmable endonuclease systems
WO2022265086A1 (en) 2021-06-17 2022-12-22 国立大学法人京都大学 Method for producing cerebral cortical cell preparation derived from human pluripotent stem cells
US12329801B2 (en) 2021-06-21 2025-06-17 Juvena Therapeutics, Inc. Regenerative polypeptides and uses thereof
WO2023036669A1 (en) 2021-09-07 2023-03-16 Bayer Aktiengesellschaft Novel small rna programmable endonuclease systems with impoved pam specificity and uses thereof
EP4144841A1 (en) 2021-09-07 2023-03-08 Bayer AG Novel small rna programmable endonuclease systems with impoved pam specificity and uses thereof
WO2023039588A1 (en) 2021-09-13 2023-03-16 FUJIFILM Cellular Dynamics, Inc. Methods for the production of committed cardiac progenitor cells
WO2023049826A1 (en) 2021-09-23 2023-03-30 President And Fellows Of Harvard College Genetically encoded voltage indicators and uses thereof
WO2023054395A1 (en) 2021-09-30 2023-04-06 住友ファーマ株式会社 Cell aggregate including pituitary hormone-producing cells and method for producing same
WO2023054396A1 (en) 2021-09-30 2023-04-06 住友化学株式会社 Method for producing cell mass including pituitary tissue and cell mass
WO2023070019A1 (en) 2021-10-21 2023-04-27 Vertex Pharmaceuticals Incorporated Hypoimmune cells
WO2023077140A2 (en) 2021-11-01 2023-05-04 Vertex Pharmaceuticals Incorporated Stem cell derived pancreatic islet differentiation
WO2023090427A1 (en) 2021-11-19 2023-05-25 国立研究開発法人理化学研究所 Production method for sheet-like retinal tissue
WO2023118068A1 (en) 2021-12-23 2023-06-29 Bayer Aktiengesellschaft Novel small type v rna programmable endonuclease systems
WO2023127824A1 (en) 2021-12-27 2023-07-06 住友ファーマ株式会社 Neural crest cell culturing method and production method
WO2023167986A1 (en) 2022-03-02 2023-09-07 Lineage Cell Therapeutics, Inc. Methods and compositions for treating hearing loss
WO2023178239A1 (en) 2022-03-16 2023-09-21 The Children's Medical Center Corporation Hpsc-derived articular chondrocyte compositions, systems and methods of use thereof
WO2023176906A1 (en) 2022-03-16 2023-09-21 住友ファーマ株式会社 Transplantation medium
WO2023199641A1 (en) 2022-04-12 2023-10-19 株式会社大塚製薬工場 Mammalian cell cryopreservation liquid
WO2023199113A1 (en) 2022-04-15 2023-10-19 Smartcella Solutions Ab COMPOSITIONS AND METHODS FOR EXOSOME-MEDIATED DELIVERY OF mRNA AGENTS
WO2023230391A1 (en) 2022-05-26 2023-11-30 Tender Food, Inc. Plant-based shredded meat products, and methods of producing the same
WO2023237587A1 (en) 2022-06-10 2023-12-14 Bayer Aktiengesellschaft Novel small type v rna programmable endonuclease systems
WO2024059358A1 (en) 2022-09-16 2024-03-21 Tender Food, Inc. Plant and animal cell blended meat products and methods of producing the same
WO2024073776A1 (en) 2022-09-30 2024-04-04 FUJIFILM Cellular Dynamics, Inc. Methods for the production of cardiac fibroblasts
WO2024129234A1 (en) 2022-12-16 2024-06-20 Tender Food, Inc. Plant-based poultry products, and methods of producing the same
WO2025126208A1 (en) 2023-12-12 2025-06-19 Accellta Ltd. Media for maintaining, differentiating, or both, pluripotent stem cells

Also Published As

Publication number Publication date
US5843780A (en) 1998-12-01
US20050164381A1 (en) 2005-07-28
US20030008392A1 (en) 2003-01-09
EP0770125A4 (en) 1998-01-14
US7029913B2 (en) 2006-04-18
EP1640448A3 (en) 2006-04-26
AU4758496A (en) 1996-08-07
US20010024825A1 (en) 2001-09-27
CA2190528C (en) 2010-04-27
CA2190528A1 (en) 1996-07-25
US20120328582A1 (en) 2012-12-27
US20110256623A1 (en) 2011-10-20
WO1996022362A1 (en) 1996-07-25
EP1640448A2 (en) 2006-03-29
US20090011503A1 (en) 2009-01-08
US20050158854A1 (en) 2005-07-21
US20150056698A1 (en) 2015-02-26
US7582479B2 (en) 2009-09-01
US20060040383A1 (en) 2006-02-23
US7781216B2 (en) 2010-08-24
EP0770125A1 (en) 1997-05-02
US8273569B2 (en) 2012-09-25

Similar Documents

Publication Publication Date Title
US6200806B1 (en) Primate embryonic stem cells
Thomson et al. Isolation of a primate embryonic stem cell line.
Martin Teratocarcinomas as a model system for the study of embryogenesis and neoplasia
CA2456981C (en) Alternative compositions and methods for the culture of stem cells
US9255247B2 (en) Methods of deriving mammalian pluripotent stem cell lines
Strelchenko Bovine pluripotent stem cells
Vaags et al. Derivation and characterization of canine embryonic stem cell lines with in vitro and in vivo differentiation potential
US20020160509A1 (en) Embryonic stem cells
Suemori et al. Establishment of the Embryo‐derived Stem (ES) Cell Lines from Mouse Blastocysts: Effects of the Feeder Cell Layer.
Andrews et al. Embryonal carcinoma cells as embryonic stem cells
US20030073234A1 (en) Clonal human embryonic stem cell lines and methods of generating same
Fan et al. A modified culture medium increases blastocyst formation and the efficiency of human embryonic stem cell derivation from poor-quality embryos
Pall et al. Establishment of an embryonic stem cell line from blastocyst stage mouse embryos
Vrana et al. Colloquium Nonhuman primate parthenogenetic stem cells
Davies et al. Embryonic stem cells and the capture of pluripotency
JPH08116966A (en) Bovine embryonic stem cell and its preparation
IL192399A (en) Human foreskin cells suitable for culturing stem cells

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

RR Request for reexamination filed

Effective date: 20060717

B1 Reexamination certificate first reexamination

Free format text: CLAIMS 1, 3, 9 AND 11 ARE DETERMINED TO BE PATENTABLE AS AMENDED. CLAIMS 2, 4-8, AND 10, DEPENDENT ON AN AMENDED CLAIM, ARE DETERMINED TO BE PATENTABLE. NEW CLAIMS 12, 13 AND 14 ARE ADDED AND DETERMINED TO BE PATENTABLE.

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

AS Assignment

Owner name: WISCONSIN ALUMNI RESEARCH FOUNDATION, WISCONSIN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:THOMSON, JAMES;REEL/FRAME:031347/0603

Effective date: 19960702